Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
FAM131C	348487	broad.mit.edu	37	1	16361925	16361925	+	Silent	SNP	G	A	A	rs146790110		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16361925G>A	uc010obz.1	-	7	781	c.591C>T	c.(589-591)AGC>AGT	p.S197S	CLCNKB_uc001axw.3_Intron	NM_182623	NP_872429	Q96AQ9	F131C_HUMAN	hypothetical protein LOC348487	197											0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		CGCTGGGAAGGCTGTCCTGAA	0.647													6	36	---	---	---	---	PASS
CNKSR1	10256	broad.mit.edu	37	1	26513674	26513674	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26513674G>A	uc001bln.3	+	15	1403	c.1345G>A	c.(1345-1347)GGC>AGC	p.G449S	CNKSR1_uc001blm.3_Missense_Mutation_p.G442S|CNKSR1_uc009vsd.2_Missense_Mutation_p.G184S|CNKSR1_uc009vse.2_Missense_Mutation_p.G184S|CNKSR1_uc001blo.2_Missense_Mutation_p.G184S	NM_006314	NP_006305	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras	449	PH.				Rho protein signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cell cortex|cell-cell junction	protein binding, bridging			lung(1)|kidney(1)	2		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGGCTGAGGGCCTCATCAA	0.532													81	201	---	---	---	---	PASS
INPP5B	3633	broad.mit.edu	37	1	38327856	38327856	+	3'UTR	SNP	A	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38327856A>T	uc001ccg.1	-	24					INPP5B_uc009vvk.1_3'UTR|MTF1_uc001cce.1_5'Flank|MTF1_uc009vvj.1_5'Flank|INPP5B_uc001ccf.1_3'UTR	NM_005540	NP_005531	P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TAATTGGGGTACTAGGCTCAG	0.453													14	38	---	---	---	---	PASS
SLC44A5	204962	broad.mit.edu	37	1	75681492	75681492	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75681492A>G	uc001dgu.2	-	19	1819	c.1675T>C	c.(1675-1677)TTC>CTC	p.F559L	SLC44A5_uc001dgt.2_Missense_Mutation_p.F559L|SLC44A5_uc001dgs.2_Missense_Mutation_p.F517L|SLC44A5_uc001dgr.2_Missense_Mutation_p.F517L|SLC44A5_uc010oqz.1_Missense_Mutation_p.F598L|SLC44A5_uc010ora.1_Missense_Mutation_p.F553L|SLC44A5_uc010orb.1_Missense_Mutation_p.F429L	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	559	Cytoplasmic (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						AAACACCAGAAGCAGCATCTC	0.338													4	42	---	---	---	---	PASS
DENND2D	79961	broad.mit.edu	37	1	111741341	111741341	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111741341C>A	uc001eak.1	-	3	467	c.267G>T	c.(265-267)CAG>CAT	p.Q89H	DENND2D_uc001eal.1_Missense_Mutation_p.Q86H	NM_024901	NP_079177	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	89	UDENN.									ovary(1)	1		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		CCTCCTCCTGCTGACCCCGAA	0.552													21	50	---	---	---	---	PASS
WDR77	79084	broad.mit.edu	37	1	111989749	111989749	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111989749A>C	uc001ebb.2	-	4	500	c.461T>G	c.(460-462)CTT>CGT	p.L154R	WDR77_uc010owd.1_RNA|WDR77_uc010owe.1_Intron|ATP5F1_uc009wgf.1_5'Flank|ATP5F1_uc001ebc.2_5'Flank|ATP5F1_uc001ebd.3_5'Flank	NM_024102	NP_077007	Q9BQA1	MEP50_HUMAN	WD repeat domain 77	154	WD 2.				ncRNA metabolic process|spliceosomal snRNP assembly	cytosol|nucleus	ligand-dependent nuclear receptor transcription coactivator activity|protein binding				0		all_cancers(81;0.000902)|all_epithelial(167;0.00056)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTGCTGAGCAAGGTCCCAAAC	0.383													50	130	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144813815	144813815	+	Silent	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144813815A>G	uc009wig.1	+	10	1138	c.1062A>G	c.(1060-1062)GCA>GCG	p.A354A	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Silent_p.A354A|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Silent_p.A285A|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Silent_p.A285A|NBPF9_uc010oyg.1_Silent_p.A319A|NBPF9_uc009wii.1_Silent_p.A83A|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Silent_p.A14A	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	354	Potential.					cytoplasm					0						AGAAGCTTGCAGAGCAGCTGA	0.532													13	107	---	---	---	---	PASS
SETDB1	9869	broad.mit.edu	37	1	150902502	150902502	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150902502A>G	uc001evu.2	+	3	510	c.320A>G	c.(319-321)TAC>TGC	p.Y107C	SETDB1_uc009wmf.2_Missense_Mutation_p.Y107C|SETDB1_uc001evv.2_Missense_Mutation_p.Y107C|SETDB1_uc001evw.3_Missense_Mutation_p.Y107C|SETDB1_uc009wmg.1_Missense_Mutation_p.Y107C	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1	107					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGACTACAATACCGGGACAGT	0.443													5	242	---	---	---	---	PASS
TCHHL1	126637	broad.mit.edu	37	1	152057648	152057648	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152057648A>G	uc001ezo.1	-	3	2575	c.2510T>C	c.(2509-2511)GTA>GCA	p.V837A		NM_001008536	NP_001008536	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	837							calcium ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			GGTGAGGGATACACTGCAAAG	0.468													7	400	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152286698	152286698	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152286698T>C	uc001ezu.1	-	3	700	c.664A>G	c.(664-666)AGA>GGA	p.R222G	uc001ezv.2_Intron	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	222					keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGTCATTCTTCCTGTATTT	0.348									Ichthyosis				6	234	---	---	---	---	PASS
IL19	29949	broad.mit.edu	37	1	207014376	207014376	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207014376C>T	uc001hep.2	+	6	1330	c.391C>T	c.(391-393)CAG>TAG	p.Q131*	IL19_uc001heo.2_Nonsense_Mutation_p.Q169*	NM_013371	NP_037503	Q9UHD0	IL19_HUMAN	interleukin 19 isoform 2 precursor	131					apoptosis|immune response|signal transduction	extracellular space	cytokine activity			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(75;0.211)			TCACTGCAGGCAGGAAGCCAC	0.522													41	78	---	---	---	---	PASS
CAPN9	10753	broad.mit.edu	37	1	230910375	230910375	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230910375C>A	uc001htz.1	+	8	1064	c.951C>A	c.(949-951)TTC>TTA	p.F317L	CAPN9_uc009xfg.1_Missense_Mutation_p.F254L|CAPN9_uc001hua.1_Intron	NM_006615	NP_006606	O14815	CAN9_HUMAN	calpain 9 isoform 1	317	Calpain catalytic.				digestion|proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)	1	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				ATGGGGAATTCTGGTACCGTG	0.512													114	287	---	---	---	---	PASS
RAD51AP2	729475	broad.mit.edu	37	2	17698891	17698891	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17698891C>T	uc002rcl.1	-	1	816	c.792G>A	c.(790-792)ATG>ATA	p.M264I	RAD51AP2_uc010exn.1_Missense_Mutation_p.M255I	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	264										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TATTTAAGTCCATTGGAAACT	0.348													8	372	---	---	---	---	PASS
DTNB	1838	broad.mit.edu	37	2	25754451	25754451	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25754451T>A	uc002rgh.2	-	9	1142	c.892A>T	c.(892-894)AAG>TAG	p.K298*	DTNB_uc010yko.1_Nonsense_Mutation_p.K241*|DTNB_uc010ykp.1_Nonsense_Mutation_p.K94*|DTNB_uc002rgo.2_Nonsense_Mutation_p.K119*|DTNB_uc002rgi.2_Nonsense_Mutation_p.K298*|DTNB_uc002rgj.2_Nonsense_Mutation_p.K298*|DTNB_uc002rgk.2_Nonsense_Mutation_p.K298*|DTNB_uc002rgl.2_Nonsense_Mutation_p.K298*|DTNB_uc002rgq.2_Nonsense_Mutation_p.K298*|DTNB_uc002rgm.2_Nonsense_Mutation_p.K298*|DTNB_uc002rgn.2_Nonsense_Mutation_p.K94*|DTNB_uc002rgr.1_Nonsense_Mutation_p.K287*|DTNB_uc010ykq.1_Nonsense_Mutation_p.K151*	NM_021907	NP_068707	O60941	DTNB_HUMAN	dystrobrevin, beta isoform 1	298						cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGCTCAGCTTCTTTGCAGGA	0.408													56	196	---	---	---	---	PASS
GTF3C2	2976	broad.mit.edu	37	2	27549570	27549570	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27549570G>A	uc002rjv.1	-	20	3071	c.2708C>T	c.(2707-2709)ACC>ATC	p.T903I	MPV17_uc002rjt.2_5'Flank|GTF3C2_uc010eyy.1_Missense_Mutation_p.T358I|GTF3C2_uc002rju.1_Missense_Mutation_p.T914I|GTF3C2_uc002rjw.1_Missense_Mutation_p.T903I	NM_001521	NP_001512	Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide	903						transcription factor TFIIIC complex				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCGATGGCTGGTTGGAGAGAA	0.582													6	131	---	---	---	---	PASS
INPP4A	3631	broad.mit.edu	37	2	99162460	99162460	+	Silent	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99162460A>G	uc002syy.2	+	12	1371	c.978A>G	c.(976-978)AAA>AAG	p.K326K	INPP4A_uc010yvj.1_Silent_p.K326K|INPP4A_uc010yvk.1_Silent_p.K326K|INPP4A_uc002syx.2_Silent_p.K326K|INPP4A_uc010fik.2_Intron	NM_001134224	NP_001127696	Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type 1	326					signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			kidney(1)	1						GCAGTTTGAAAGCAGATAAAA	0.403													7	404	---	---	---	---	PASS
PLA2R1	22925	broad.mit.edu	37	2	160832610	160832610	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160832610T>C	uc002ube.1	-	17	2771	c.2564A>G	c.(2563-2565)GAG>GGG	p.E855G	PLA2R1_uc010zcp.1_Missense_Mutation_p.E855G|PLA2R1_uc002ubf.2_Missense_Mutation_p.E855G	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor	855	Extracellular (Potential).|C-type lectin 5.				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						GAATTCTTGCTCATGTGCAGA	0.423													6	240	---	---	---	---	PASS
CIR1	9541	broad.mit.edu	37	2	175213496	175213496	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175213496G>A	uc002uim.2	-	10	1175	c.1082C>T	c.(1081-1083)ACC>ATC	p.T361I	CIR1_uc002uin.2_Missense_Mutation_p.T235I|CIR1_uc002uio.2_Missense_Mutation_p.T188I|CIR1_uc002uip.2_Missense_Mutation_p.T250I	NM_004882	NP_004873	Q86X95	CIR1_HUMAN	CBF1 interacting corepressor	361	Lys/Ser-rich.				mRNA processing|negative regulation of transcription, DNA-dependent|RNA splicing	nuclear speck	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			large_intestine(1)	1						ATGTTTATGGGTTCTGGACTT	0.512													45	551	---	---	---	---	PASS
ITGAV	3685	broad.mit.edu	37	2	187514592	187514592	+	Silent	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187514592A>G	uc002upq.2	+	14	1653	c.1377A>G	c.(1375-1377)GTA>GTG	p.V459V	ITGAV_uc010frs.2_Silent_p.V423V|ITGAV_uc010zfv.1_Silent_p.V413V	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor	459	FG-GAP 7.|Extracellular (Potential).				angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		CTTTTGGTGTAGATCGAGCTA	0.289													7	517	---	---	---	---	PASS
WDFY1	57590	broad.mit.edu	37	2	224746768	224746768	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224746768G>T	uc002vnq.2	-	10	1006	c.955C>A	c.(955-957)CAG>AAG	p.Q319K		NM_020830	NP_065881	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1	319	FYVE-type.					cytosol|early endosome|nucleus	1-phosphatidylinositol binding|zinc ion binding			lung(1)	1		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		CAGACAGCCTGCCCGCATTTC	0.453													8	133	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227871978	227871978	+	3'UTR	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227871978T>C	uc010zlt.1	-	47						NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor						axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CTTAGCACAGTCTAGGAAGTC	0.478													36	88	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230667172	230667172	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230667172A>G	uc002vpw.1	-	20	2886	c.2777T>C	c.(2776-2778)GTA>GCA	p.V926A	TRIP12_uc002vpx.1_Missense_Mutation_p.V974A|TRIP12_uc002vpy.1_Missense_Mutation_p.V656A|TRIP12_uc010zlz.1_Intron	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	926					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TTGATGCATTACACCTTTATA	0.398													5	214	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191513	10191513	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191513T>C	uc003bvc.2	+	3	719	c.506T>C	c.(505-507)CTA>CCA	p.L169P	VHL_uc003bvd.2_Missense_Mutation_p.L128P	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	169					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L169P(5)|p.L169L(2)|p.S168fs*3(1)|p.L169_V170del(1)|p.L169*(1)|p.L169fs*33(1)|p.V170fs*31(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTCCGGAGCCTAGTCAAGCCT	0.517		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				59	83	---	---	---	---	PASS
ZCWPW2	152098	broad.mit.edu	37	3	28562594	28562594	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28562594A>G	uc003ceh.2	+	9	1064	c.896A>G	c.(895-897)AAT>AGT	p.N299S	ZCWPW2_uc003cei.2_Missense_Mutation_p.N299S|ZCWPW2_uc010hfo.2_Missense_Mutation_p.N104S	NM_001040432	NP_001035522	Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	299							zinc ion binding			ovary(2)	2						GAGGAAATAAATATGGGAGAA	0.358													5	167	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52443568	52443568	+	Splice_Site	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52443568A>G	uc003ddx.2	-	3	237	c.122_splice	c.e3+1	p.G41_splice	PHF7_uc003ddy.2_5'Flank|PHF7_uc003ddz.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1						monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	p.?(1)		pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		ACAGCCACTCACCCCTGACAT	0.577			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								43	80	---	---	---	---	PASS
PPP4R2	151987	broad.mit.edu	37	3	73108251	73108251	+	Silent	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73108251A>G	uc003dph.1	+	4	421	c.351A>G	c.(349-351)GGA>GGG	p.G117G	PPP4R2_uc003dpi.1_Silent_p.G60G|FLJ10213_uc003dpj.2_5'Flank	NM_174907	NP_777567	Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	117					mRNA processing|protein modification process|regulation of double-strand break repair via homologous recombination|RNA splicing	centrosome|nucleus|protein phosphatase 4 complex	protein binding, bridging|protein phosphatase type 4 regulator activity			lung(1)	1		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		ACTATACAGGAACAGACAAAT	0.299													7	384	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124149504	124149504	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124149504T>C	uc003ehg.2	+	16	2832	c.2705T>C	c.(2704-2706)GTT>GCT	p.V902A	KALRN_uc010hrv.1_Missense_Mutation_p.V902A|KALRN_uc003ehf.1_Missense_Mutation_p.V902A|KALRN_uc011bjy.1_Missense_Mutation_p.V902A|KALRN_uc003ehh.1_Missense_Mutation_p.V248A	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	902	Spectrin 4.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						ATTCCCTAGGTTCTGGGATGG	0.572													7	163	---	---	---	---	PASS
PIK3R4	30849	broad.mit.edu	37	3	130463702	130463702	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130463702T>C	uc003enj.2	-	2	942	c.361A>G	c.(361-363)AAT>GAT	p.N121D		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	121	Protein kinase.				fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						TCAATGTTATTCAAGAATGGA	0.458													5	124	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142189019	142189019	+	Silent	SNP	T	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142189019T>A	uc003eux.3	-	37	6350	c.6228A>T	c.(6226-6228)CTA>CTT	p.L2076L	ATR_uc003euy.1_5'Flank	NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	2076	FAT.				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						TTCCATATTGTAGAGATCTGC	0.308								Other_conserved_DNA_damage_response_genes					6	218	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186953403	186953403	+	Intron	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186953403T>C	uc003frh.1	-						MASP1_uc003fri.2_3'UTR|MASP1_uc003frj.2_3'UTR	NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform						complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		ATAAGTAATGTGGAGTGTGCT	0.567													4	16	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195511238	195511238	+	Missense_Mutation	SNP	C	T	T	rs3103956		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195511238C>T	uc011bto.1	-	2	7673	c.7213G>A	c.(7213-7215)GAC>AAC	p.D2405N	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.592													8	208	---	---	---	---	PASS
ZNF518B	85460	broad.mit.edu	37	4	10446630	10446630	+	Silent	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10446630A>G	uc003gmn.2	-	3	1810	c.1323T>C	c.(1321-1323)ATT>ATC	p.I441I		NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	441					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4						AATTTGGCATAATAAAATCAT	0.328													4	124	---	---	---	---	PASS
RBPJ	3516	broad.mit.edu	37	4	26432685	26432685	+	3'UTR	SNP	A	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26432685A>C	uc003grx.1	+	12					RBPJ_uc003gry.1_3'UTR|RBPJ_uc003grz.1_3'UTR|RBPJ_uc003gsa.1_3'UTR|RBPJ_uc003gsb.1_3'UTR|RBPJ_uc003gsc.1_3'UTR|uc003gsd.2_5'Flank	NM_005349	NP_005340	Q06330	SUH_HUMAN	recombining binding protein suppressor of						DNA recombination|negative regulation of transcription, DNA-dependent|positive regulation of transcription of Notch receptor target	cytoplasm|nucleolus|nucleoplasm	DNA binding|protein binding|recombinase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)	3		Breast(46;0.0503)				AAGTTAACAAAAAAGGAGAAA	0.393													8	16	---	---	---	---	PASS
ARAP2	116984	broad.mit.edu	37	4	36093614	36093614	+	Silent	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36093614T>C	uc003gsq.1	-	28	4652	c.4314A>G	c.(4312-4314)GAA>GAG	p.E1438E		NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	1438	PH 5.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TCAAGATTCCTTCTTTGATGC	0.338													8	589	---	---	---	---	PASS
CWH43	80157	broad.mit.edu	37	4	49019269	49019269	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49019269T>C	uc003gyv.2	+	9	1372	c.1190T>C	c.(1189-1191)CTG>CCG	p.L397P	CWH43_uc011bzl.1_Missense_Mutation_p.L370P	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	397	Helical; (Potential).				GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						TGTTTAGTTCTGTGGCTGCTT	0.363													148	577	---	---	---	---	PASS
NPFFR2	10886	broad.mit.edu	37	4	73013282	73013282	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73013282A>T	uc003hgg.2	+	4	1420	c.1322A>T	c.(1321-1323)AAT>ATT	p.N441I	NPFFR2_uc010iig.1_Missense_Mutation_p.N223I|NPFFR2_uc003hgi.2_Missense_Mutation_p.N342I|NPFFR2_uc003hgh.2_Missense_Mutation_p.N339I|NPFFR2_uc003hgj.2_RNA	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2 isoform 1	441	Cytoplasmic (Potential).				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			TTCAACGAGAATTTCCGCCGT	0.463													20	39	---	---	---	---	PASS
SDAD1	55153	broad.mit.edu	37	4	76878704	76878704	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76878704T>A	uc003hje.3	-	19	1855	c.1736A>T	c.(1735-1737)AAA>ATA	p.K579I	SDAD1_uc003hjf.3_Missense_Mutation_p.K482I|SDAD1_uc011cbr.1_Missense_Mutation_p.K542I	NM_018115	NP_060585	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	579					protein transport|ribosomal large subunit biogenesis	nucleolus	protein binding			ovary(1)	1			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTCAATGTATTTCCTCTTCTG	0.443													10	426	---	---	---	---	PASS
MAML3	55534	broad.mit.edu	37	4	140640547	140640547	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140640547T>C	uc003ihz.1	-	7	4084	c.3332A>G	c.(3331-3333)GAC>GGC	p.D1111G	MGST2_uc010ioi.1_Intron|MAML3_uc011chd.1_Missense_Mutation_p.D579G	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3	1112					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					GATGATGGAGTCCACAAGGTC	0.572													26	50	---	---	---	---	PASS
SDHAP3	728609	broad.mit.edu	37	5	1572243	1572243	+	Intron	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1572243C>T	uc011cmd.1	-						SDHAP3_uc011cme.1_RNA					Homo sapiens cDNA FLJ58919 complete cds, moderately similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC1.3.5.1).												0						AGTGCAGAAGCGTATGAAGAC	0.502													4	41	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13916511	13916511	+	Silent	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13916511A>G	uc003jfd.2	-	9	1185	c.1143T>C	c.(1141-1143)TAT>TAC	p.Y381Y	DNAH5_uc003jfe.1_RNA	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	381	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GAGAGATACTATAGATCATTT	0.323									Kartagener_syndrome				4	136	---	---	---	---	PASS
ADAMTS6	11174	broad.mit.edu	37	5	64510620	64510620	+	Splice_Site	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64510620C>T	uc003jtp.2	-	20	3389	c.2575_splice	c.e20+1	p.G859_splice	ADAMTS6_uc003jto.2_Splice_Site|ADAMTS6_uc003jtq.2_Splice_Site|ADAMTS6_uc003jtr.1_Missense_Mutation_p.G480D	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		GGGCATCTTACCTCCAGCACA	0.443													24	70	---	---	---	---	PASS
MAST4	375449	broad.mit.edu	37	5	66462005	66462005	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66462005A>T	uc003jut.1	+	28	6499	c.6431A>T	c.(6430-6432)CAC>CTC	p.H2144L	MAST4_uc003juw.2_Missense_Mutation_p.H2072L|MAST4_uc003jux.2_Intron	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	2336						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TCTCCAAAGCACCCCAAACCA	0.507											OREG0016638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	78	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70808132	70808132	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70808132A>G	uc003kbp.1	+	18	4387	c.4124A>G	c.(4123-4125)AAA>AGA	p.K1375R	BDP1_uc003kbo.2_Missense_Mutation_p.K1375R	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	1375					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AATTCTGAAAAAGAAGTATCA	0.363													43	208	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150924987	150924987	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150924987A>G	uc003lue.3	-	9	5714	c.5701T>C	c.(5701-5703)TCA>CCA	p.S1901P	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	1901	Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTGACTTCTGAGTCTTCATCG	0.488													6	209	---	---	---	---	PASS
ODZ2	57451	broad.mit.edu	37	5	167379664	167379664	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167379664C>T	uc010jjd.2	+	4	784	c.784C>T	c.(784-786)CAT>TAT	p.H262Y	ODZ2_uc003lzq.2_Missense_Mutation_p.H141Y|ODZ2_uc003lzr.3_Missense_Mutation_p.H71Y	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		CACGCTGTCCCATCACCACTC	0.607													6	293	---	---	---	---	PASS
GRM6	2916	broad.mit.edu	37	5	178416292	178416292	+	Nonsense_Mutation	SNP	G	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178416292G>C	uc003mjr.2	-	5	1306	c.1127C>G	c.(1126-1128)TCA>TGA	p.S376*	GRM6_uc010jla.1_5'UTR|GRM6_uc003mjs.1_5'UTR	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	376	Extracellular (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		GGAATCGTCTGACTGGGTACC	0.403													95	130	---	---	---	---	PASS
GCM2	9247	broad.mit.edu	37	6	10874533	10874533	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10874533G>A	uc003mzn.3	-	5	1288	c.1216C>T	c.(1216-1218)CGA>TGA	p.R406*	SYCP2L_uc011dim.1_Intron	NM_004752	NP_004743	O75603	GCM2_HUMAN	glial cells missing homolog 2	406					cellular calcium ion homeostasis|cellular phosphate ion homeostasis|parathyroid gland development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				TTCACCTCTCGCACACTGTCA	0.557													14	238	---	---	---	---	PASS
ITPR3	3710	broad.mit.edu	37	6	33657132	33657132	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33657132G>A	uc011drk.1	+	50	7031	c.6812G>A	c.(6811-6813)CGC>CAC	p.R2271H	ITPR3_uc003oey.2_Missense_Mutation_p.R358H	NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	2271	Helical; (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						CTCATCCTGCGCTCCATCTAC	0.582													35	64	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38830146	38830146	+	Silent	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38830146A>G	uc003ooe.1	+	42	6171	c.5571A>G	c.(5569-5571)AAA>AAG	p.K1857K		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						AAACCACAAAAGACATGGGAA	0.468													7	478	---	---	---	---	PASS
COL21A1	81578	broad.mit.edu	37	6	56035909	56035909	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56035909G>A	uc003pcs.2	-	4	890	c.658C>T	c.(658-660)CGA>TGA	p.R220*	COL21A1_uc003pct.1_RNA|COL21A1_uc011dxi.1_Nonsense_Mutation_p.R220*|COL21A1_uc003pcu.1_Nonsense_Mutation_p.R220*	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor	220					cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			ACTGGAATTCGTGTTGGACAG	0.318													26	75	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117679050	117679050	+	Silent	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117679050T>C	uc003pxp.1	-	24	3970	c.3771A>G	c.(3769-3771)GAA>GAG	p.E1257E	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1257	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TCACCTTGTGTTCAAGATCAA	0.328			T	GOPC|ROS1	glioblastoma|NSCLC								8	348	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129371200	129371200	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129371200C>T	uc003qbn.2	+	2	355	c.250C>T	c.(250-252)CGA>TGA	p.R84*	LAMA2_uc003qbo.2_Nonsense_Mutation_p.R84*	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	84	Laminin N-terminal.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CCCGCAGTGTCGAATCTGCAA	0.458													18	309	---	---	---	---	PASS
PNLDC1	154197	broad.mit.edu	37	6	160240368	160240368	+	Missense_Mutation	SNP	G	A	A	rs138386704		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160240368G>A	uc003qsx.1	+	18	1654	c.1483G>A	c.(1483-1485)GTC>ATC	p.V495I	PNLDC1_uc003qsy.1_Missense_Mutation_p.V506I	NM_173516	NP_775787	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain	495	Helical; Anchor for type IV membrane protein; (Potential).					integral to membrane|nucleus	nucleic acid binding				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CTCCCCAAACGTCAACTGCCT	0.617													4	46	---	---	---	---	PASS
HGC6.3	100128124	broad.mit.edu	37	6	168377220	168377220	+	Missense_Mutation	SNP	T	G	G	rs79173693	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168377220T>G	uc010kks.1	-	1	400	c.113A>C	c.(112-114)CAA>CCA	p.Q38P		NM_001129895	NP_001123367	Q9UM08	Q9UM08_HUMAN	hypothetical protein LOC100128124	38											0						TGCAGTGTGTTGGGAGGAGAA	0.622													5	45	---	---	---	---	PASS
PAPOLB	56903	broad.mit.edu	37	7	4899654	4899654	+	Silent	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4899654G>A	uc003snk.2	-	1	1972	c.1788C>T	c.(1786-1788)CAC>CAT	p.H596H	RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snj.1_Intron	NM_020144	NP_064529	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	595					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		GAGAGACAGCGTGAGGAATAC	0.458													39	154	---	---	---	---	PASS
FBXL13	222235	broad.mit.edu	37	7	102665656	102665656	+	Silent	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102665656A>G	uc003vaq.2	-	6	776	c.349T>C	c.(349-351)TTG>CTG	p.L117L	FBXL13_uc010liq.1_5'UTR|FBXL13_uc010lir.1_Silent_p.L117L|FBXL13_uc003var.2_RNA|FBXL13_uc003vas.2_Silent_p.L117L|FBXL13_uc003vav.2_RNA	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13 isoform	117											0						CATTTTTTCAATTGAAGTTCA	0.338													26	208	---	---	---	---	PASS
SSBP1	6742	broad.mit.edu	37	7	141438971	141438971	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141438971T>C	uc003vwo.1	+	2	83	c.5T>C	c.(4-6)TTT>TCT	p.F2S	FLJ40852_uc011krh.1_5'Flank|FLJ40852_uc010lnm.2_5'Flank|FLJ40852_uc010lnn.2_5'Flank|FLJ40852_uc003vwm.3_5'Flank|FLJ40852_uc010lno.2_5'Flank|SSBP1_uc011kri.1_Missense_Mutation_p.F2S|SSBP1_uc010lnp.1_Missense_Mutation_p.F2S	NM_003143	NP_003134	Q04837	SSBP_HUMAN	single-stranded DNA binding protein 1 precursor	2					DNA replication|positive regulation of helicase activity	mitochondrial nucleoid	single-stranded DNA binding			ovary(1)	1	Melanoma(164;0.0171)					GAAGCCATGTTTCGAAGACCT	0.328													7	432	---	---	---	---	PASS
DNAJB6	10049	broad.mit.edu	37	7	157178323	157178323	+	Intron	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157178323C>T	uc003wnk.2	+						DNAJB6_uc003wnj.2_Missense_Mutation_p.R237C|DNAJB6_uc003wnl.2_Intron|DNAJB6_uc011kvy.1_Intron|DNAJB6_uc011kvz.1_Intron|DNAJB6_uc010lqt.2_Missense_Mutation_p.R237C	NM_058246	NP_490647	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6						intermediate filament organization|negative regulation of caspase activity|protein folding|response to unfolded protein	nucleus|perinuclear region of cytoplasm	ATPase activator activity|chaperone binding|heat shock protein binding|unfolded protein binding			ovary(2)	2	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		GCAGCTGCTGCGCTTGGATAA	0.368													20	315	---	---	---	---	PASS
ARHGEF10	9639	broad.mit.edu	37	8	1806206	1806206	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1806206C>T	uc003wpr.2	+	3	296	c.118C>T	c.(118-120)CCA>TCA	p.P40S	ARHGEF10_uc003wpq.1_Missense_Mutation_p.P64S|ARHGEF10_uc003wps.2_Missense_Mutation_p.P40S|ARHGEF10_uc003wpt.2_5'Flank|ARHGEF10_uc010lrd.1_5'Flank|ARHGEF10_uc003wpu.2_5'Flank	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	64					centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		AGATGAAATCCCAGAAGCGGA	0.398													5	212	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106815071	106815071	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106815071A>C	uc003ymd.2	+	8	2784	c.2761A>C	c.(2761-2763)AAT>CAT	p.N921H	ZFPM2_uc011lhs.1_Missense_Mutation_p.N652H	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	921					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GAAAAATGGGAATTTGAAGCA	0.458													21	81	---	---	---	---	PASS
ST3GAL1	6482	broad.mit.edu	37	8	134478309	134478309	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134478309T>C	uc003yuk.2	-	6	1160	c.331A>G	c.(331-333)AAT>GAT	p.N111D	ST3GAL1_uc003yum.2_Missense_Mutation_p.N111D	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	111	Lumenal (Potential).				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			TTCAAGTTATTGGGCTTCTTC	0.612													12	55	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144942850	144942850	+	Silent	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144942850G>A	uc003zaa.1	-	1	4585	c.4572C>T	c.(4570-4572)CTC>CTT	p.L1524L		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	1524						cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTGCTTCCGGAGCCCTCTGA	0.672													3	9	---	---	---	---	PASS
ACER2	340485	broad.mit.edu	37	9	19450666	19450666	+	3'UTR	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19450666C>T	uc003zny.1	+	6					ACER2_uc003znx.1_RNA|ACER2_uc003znz.1_3'UTR	NM_001010887	NP_001010887	Q5QJU3	ACER2_HUMAN	alkaline ceramidase 2						ceramide metabolic process|negative regulation of cell adhesion mediated by integrin|negative regulation of cell-matrix adhesion|negative regulation of protein glycosylation in Golgi|positive regulation of cell proliferation|response to retinoic acid|sphingosine biosynthetic process	integral to Golgi membrane	ceramidase activity			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						CTCTGCTTATCGCCCCTCATG	0.507													5	105	---	---	---	---	PASS
OGN	4969	broad.mit.edu	37	9	95165563	95165563	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95165563A>C	uc004asa.2	-	2	362	c.127T>G	c.(127-129)TTT>GTT	p.F43V	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|OGN_uc004asb.2_Missense_Mutation_p.F43V|OGN_uc011ltx.1_Missense_Mutation_p.F61V	NM_014057	NP_054776	P20774	MIME_HUMAN	osteoglycin preproprotein	43						extracellular space|proteinaceous extracellular matrix	growth factor activity				0						TCTTGGCTAAATATGGATTCT	0.353													45	114	---	---	---	---	PASS
C9orf156	51531	broad.mit.edu	37	9	100675684	100675684	+	Silent	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100675684T>C	uc004axv.1	-	3	485	c.408A>G	c.(406-408)GAA>GAG	p.E136E	C9orf156_uc004axw.1_5'UTR|C9orf156_uc004axx.1_5'UTR|C9orf156_uc010msq.1_5'UTR	NM_016481	NP_057565	Q9BU70	NAP1_HUMAN	Nef associated protein 1	136					interspecies interaction between organisms		hydrolase activity				0		Acute lymphoblastic leukemia(62;0.158)				ATGGGTTACCTTCTACCTTTT	0.438													5	125	---	---	---	---	PASS
TSC1	7248	broad.mit.edu	37	9	135780999	135780999	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135780999C>A	uc004cca.2	-	15	2200	c.1966G>T	c.(1966-1968)GGA>TGA	p.G656*	TSC1_uc004ccb.3_Nonsense_Mutation_p.G655*|TSC1_uc011mcq.1_Nonsense_Mutation_p.G605*|TSC1_uc011mcr.1_Intron	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1	656					activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.?(1)		lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		GCGTCTGCTCCCTGCTGTATC	0.478			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				8	337	---	---	---	---	PASS
GRIN1	2902	broad.mit.edu	37	9	140043519	140043519	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140043519A>G	uc004clk.2	+	4	959	c.629A>G	c.(628-630)GAG>GGG	p.E210G	GRIN1_uc004cli.1_5'UTR|GRIN1_uc004clj.1_Missense_Mutation_p.E207G|GRIN1_uc004cll.2_Missense_Mutation_p.E210G|GRIN1_uc004clm.2_Missense_Mutation_p.E210G|GRIN1_uc004cln.2_Missense_Mutation_p.E228G|GRIN1_uc004clo.2_Missense_Mutation_p.E228G	NM_007327	NP_015566	Q05586	NMDZ1_HUMAN	NMDA receptor 1 isoform NR1-3 precursor	210	Extracellular (Potential).				ionotropic glutamate receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|regulation of excitatory postsynaptic membrane potential|response to ethanol|visual learning	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane|synaptic vesicle|synaptosome	calcium ion binding|calmodulin binding|extracellular-glutamate-gated ion channel activity|glutamate binding|glycine binding			skin(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	CTGCTGATGGAGGCGAAAGAG	0.622													5	120	---	---	---	---	PASS
MBL2	4153	broad.mit.edu	37	10	54527937	54527937	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54527937C>T	uc001jjt.2	-	4	772	c.707G>A	c.(706-708)TGC>TAC	p.C236Y		NM_000242	NP_000233	P11226	MBL2_HUMAN	soluble mannose-binding lectin precursor	236	C-type lectin.				acute-phase response|complement activation, classical pathway|complement activation, lectin pathway|defense response to Gram-positive bacterium|negative regulation of growth of symbiont in host|opsonization|response to oxidative stress	collagen|extracellular space	bacterial cell surface binding|calcium-dependent protein binding|eukaryotic cell surface binding|mannose binding|receptor binding			ovary(1)	1						GGAGGTGGAGCAGGGGACGTC	0.507													21	103	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55581871	55581871	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55581871T>C	uc001jju.1	-	33	6010	c.5615A>G	c.(5614-5616)AAA>AGA	p.K1872R	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Missense_Mutation_p.K726R|PCDH15_uc010qhv.1_Missense_Mutation_p.K1869R|PCDH15_uc010qhw.1_Missense_Mutation_p.K1832R|PCDH15_uc010qhx.1_Missense_Mutation_p.K1803R|PCDH15_uc010qhy.1_Missense_Mutation_p.K1879R|PCDH15_uc010qhz.1_Missense_Mutation_p.K1874R|PCDH15_uc010qia.1_Missense_Mutation_p.K1852R|PCDH15_uc010qib.1_Missense_Mutation_p.K1849R	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1872	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				AGGGTCTGTTTTACACACTGT	0.398										HNSCC(58;0.16)			8	108	---	---	---	---	PASS
OR52N1	79473	broad.mit.edu	37	11	5809804	5809804	+	Silent	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5809804G>A	uc010qzo.1	-	1	243	c.243C>T	c.(241-243)CCC>CCT	p.P81P	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001913	NP_001001913	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N,	81	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		AGAGAGTGTTGGGAAGGGTGC	0.468													6	254	---	---	---	---	PASS
SCGB1A1	7356	broad.mit.edu	37	11	62190622	62190622	+	3'UTR	SNP	C	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62190622C>A	uc001ntj.2	+	3						NM_003357	NP_003348	P11684	UTER_HUMAN	secretoglobin, family 1A, member 1						embryo implantation|signal transduction	extracellular region	binding|phospholipase A2 inhibitor activity				0						TGCTTTGAGTCCACGCCCACC	0.507													21	58	---	---	---	---	PASS
SDHD	6392	broad.mit.edu	37	11	111965721	111965721	+	3'UTR	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111965721T>C	uc001pmz.2	+	4						NM_003002	NP_002993	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D						respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II	electron carrier activity|heme binding|succinate dehydrogenase activity|ubiquinone binding				0		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Succinic acid(DB00139)	CTTTGAAGAATTGATGTATGC	0.418			Mis|N|F|S			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome				5	21	---	---	---	---	PASS
SDHD	6392	broad.mit.edu	37	11	111965729	111965729	+	3'UTR	SNP	T	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111965729T>A	uc001pmz.2	+	4						NM_003002	NP_002993	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D						respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II	electron carrier activity|heme binding|succinate dehydrogenase activity|ubiquinone binding				0		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Succinic acid(DB00139)	AATTGATGTATGCCTCTTTGC	0.408			Mis|N|F|S			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome				5	20	---	---	---	---	PASS
ARHGEF12	23365	broad.mit.edu	37	11	120348256	120348256	+	Intron	SNP	C	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120348256C>A	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron|ARHGEF12_uc010rzn.1_3'UTR|ARHGEF12_uc009zau.1_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		CTGAAGAGTTCAATGGAGAAT	0.264			T	MLL	AML								7	421	---	---	---	---	PASS
OR8D4	338662	broad.mit.edu	37	11	123777914	123777914	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123777914A>T	uc010saa.1	+	1	776	c.776A>T	c.(775-777)TAT>TTT	p.Y259F		NM_001005197	NP_001005197	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D,	259	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		ATGTCCATGTATCTCAAACCT	0.443													25	286	---	---	---	---	PASS
VSIG2	23584	broad.mit.edu	37	11	124618331	124618331	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124618331T>C	uc001qas.2	-	6	882	c.806A>G	c.(805-807)GAG>GGG	p.E269G	VSIG2_uc001qat.2_Missense_Mutation_p.E269G	NM_014312	NP_055127	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	269	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		CTTCCCCCTCTCTTTCTGGAA	0.607													8	152	---	---	---	---	PASS
PRB1	5542	broad.mit.edu	37	12	11506582	11506582	+	Splice_Site	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11506582C>T	uc001qzw.1	-	3	490	c.453_splice	c.e3+1	p.P151_splice	PRB1_uc001qzu.1_Intron|PRB1_uc001qzv.1_Intron	NM_005039	NP_005030	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1 isoform 1							extracellular region					0			OV - Ovarian serous cystadenocarcinoma(49;0.185)			TGGAGGAGATCAGGGACTTCG	0.607													6	175	---	---	---	---	PASS
C12orf39	80763	broad.mit.edu	37	12	21679901	21679901	+	Splice_Site	SNP	G	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21679901G>T	uc001rfa.1	+	2	238	c.87_splice	c.e2+1	p.Q29_splice	C12orf39_uc009ziv.1_5'Flank|C12orf39_uc009ziw.1_5'Flank	NM_030572	NP_085049	Q9BT56	SPXN_HUMAN	spexin precursor							extracellular region|nucleus|transport vesicle					0						CGCTCCGCAGGTAATCAAATG	0.413													174	225	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	22069967	22069967	+	Silent	SNP	G	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22069967G>T	uc001rfi.1	-	4	497	c.477C>A	c.(475-477)GGC>GGA	p.G159G	ABCC9_uc001rfh.2_Silent_p.G159G|ABCC9_uc001rfj.1_Silent_p.G159G	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	159	Extracellular (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	ATATGTCCAAGCCAGACTGAC	0.408													10	172	---	---	---	---	PASS
PDE1B	5153	broad.mit.edu	37	12	54971106	54971106	+	Silent	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54971106G>A	uc001sgd.1	+	15	1771	c.1605G>A	c.(1603-1605)CTG>CTA	p.L535L	PDE1B_uc010soz.1_Silent_p.L398L|PDE1B_uc010spa.1_Silent_p.L494L|PDE1B_uc001sgf.2_Silent_p.L398L|PDE1B_uc001sge.2_Silent_p.L515L|PDE1B_uc009znq.2_Silent_p.L331L	NM_000924	NP_000915	Q01064	PDE1B_HUMAN	phosphodiesterase 1B isoform 1	535					activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						ATGGGAATCTGGATTAGCCCT	0.577													53	90	---	---	---	---	PASS
GRIP1	23426	broad.mit.edu	37	12	66788042	66788042	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66788042T>C	uc001stk.2	-	16	2160	c.1919A>G	c.(1918-1920)GAG>GGG	p.E640G	GRIP1_uc010sta.1_Missense_Mutation_p.E584G|GRIP1_uc001stj.2_Missense_Mutation_p.E422G|GRIP1_uc001stl.1_Missense_Mutation_p.E532G|GRIP1_uc001stm.2_Missense_Mutation_p.E640G	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	692	PDZ 6.				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		ATCAAACGGCTCTTCAGTTCC	0.428													7	330	---	---	---	---	PASS
LRRC10	376132	broad.mit.edu	37	12	70003903	70003903	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70003903C>T	uc001svc.2	-	1	1040	c.716G>A	c.(715-717)AGA>AAA	p.R239K		NM_201550	NP_963844	Q5BKY1	LRC10_HUMAN	leucine rich repeat containing 10	239						nucleus					0	all_cancers(2;2.83e-105)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;1.98e-18)|GBM - Glioblastoma multiforme(2;7.43e-12)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			CTCTGCCCATCTCCCCACACG	0.597													26	110	---	---	---	---	PASS
USP44	84101	broad.mit.edu	37	12	95926780	95926780	+	Missense_Mutation	SNP	C	G	G	rs138559988		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95926780C>G	uc001teg.2	-	2	1397	c.1253G>C	c.(1252-1254)GGT>GCT	p.G418A	USP44_uc001teh.2_Missense_Mutation_p.G418A|USP44_uc009zte.2_Missense_Mutation_p.G415A	NM_001042403	NP_001035862	Q9H0E7	UBP44_HUMAN	ubiquitin thiolesterase 44	418					anaphase|cell division|mitosis|negative regulation of mitotic anaphase-promoting complex activity|protein deubiquitination|regulation of spindle checkpoint|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)|breast(1)|central_nervous_system(1)	3						TTGGGCGTAACCACGAAAGGC	0.443													15	304	---	---	---	---	PASS
IGF1	3479	broad.mit.edu	37	12	102872293	102872293	+	Intron	SNP	A	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102872293A>C	uc001tjp.3	-						IGF1_uc001tjn.2_5'UTR|IGF1_uc001tjm.2_Intron|IGF1_uc001tjo.2_Intron	NM_001111285	NP_001104755	P05019	IGF1_HUMAN	insulin-like growth factor 1 isoform 3						anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2						TGTTTGTTCCAGGTCTTTTAC	0.408													11	267	---	---	---	---	PASS
GLT8D2	83468	broad.mit.edu	37	12	104393229	104393229	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104393229C>T	uc001tkh.1	-	6	754	c.348G>A	c.(346-348)ATG>ATA	p.M116I	GLT8D2_uc001tki.1_Missense_Mutation_p.M116I	NM_031302	NP_112592	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	116	Lumenal (Potential).					integral to membrane	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2						CTTTGAGGACCATCGGGTTGA	0.443													8	702	---	---	---	---	PASS
CCDC62	84660	broad.mit.edu	37	12	123307924	123307924	+	Silent	SNP	C	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123307924C>A	uc001udc.2	+	12	2158	c.2013C>A	c.(2011-2013)GTC>GTA	p.V671V	CCDC62_uc010tah.1_Intron|CCDC62_uc001udf.2_Intron|CCDC62_uc001ude.2_Silent_p.V432V	NM_201435	NP_958843	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62 isoform b	671						cytoplasm|nucleus				ovary(2)|large_intestine(1)|pancreas(1)|skin(1)	5	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		AGTCAGAGGTCCCAGAAGAGT	0.353													80	472	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20635215	20635215	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20635215C>T	uc001umr.2	+	18	3060	c.2762C>T	c.(2761-2763)CCT>CTT	p.P921L	ZMYM2_uc001ums.2_Missense_Mutation_p.P921L|ZMYM2_uc001umt.2_Missense_Mutation_p.P921L|ZMYM2_uc010tco.1_RNA|ZMYM2_uc001umv.2_Missense_Mutation_p.P301L|ZMYM2_uc001umw.2_Missense_Mutation_p.P374L	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	921					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		GTTTTTCTGCCTGCTCCATTG	0.373													13	374	---	---	---	---	PASS
HMGB1	3146	broad.mit.edu	37	13	31035234	31035234	+	3'UTR	SNP	C	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31035234C>G	uc001usw.2	-	5					HMGB1_uc001usz.2_3'UTR|HMGB1_uc001usv.2_3'UTR|HMGB1_uc001usx.2_3'UTR|HMGB1_uc001usy.2_3'UTR|HMGB1_uc001uta.1_3'UTR	NM_002128	NP_002119	P09429	HMGB1_HUMAN	high-mobility group box 1						base-excision repair, DNA ligation|dendritic cell chemotaxis|DNA fragmentation involved in apoptotic nuclear change|DNA topological change|inflammatory response to antigenic stimulus|innate immune response|myeloid dendritic cell activation|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|neuron projection development|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|V(D)J recombination	cell surface|condensed chromosome|extracellular space|nucleolus|nucleoplasm	chemoattractant activity|cytokine activity|damaged DNA binding|DNA bending activity|double-stranded DNA binding|RAGE receptor binding|repressing transcription factor binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(1)	1		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		CAACAAGAACCTGCTTTAAAT	0.393													4	1	---	---	---	---	PASS
HNRNPC	3183	broad.mit.edu	37	14	21699200	21699200	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21699200G>T	uc001vzy.2	-	4	517	c.273C>A	c.(271-273)AAC>AAA	p.N91K	HNRNPC_uc001vzw.2_Missense_Mutation_p.N91K|HNRNPC_uc001wad.2_Intron|HNRNPC_uc001vzx.2_Intron|HNRNPC_uc001vzz.2_Missense_Mutation_p.N91K|HNRNPC_uc001waa.2_Missense_Mutation_p.N91K|HNRNPC_uc010ail.2_Missense_Mutation_p.N91K|HNRNPC_uc010tlq.1_RNA|HNRNPC_uc001wab.2_Missense_Mutation_p.N91K|HNRNPC_uc001wac.2_Missense_Mutation_p.N91K|HNRNPC_uc010tlr.1_5'Flank|HNRNPC_uc001waf.2_Missense_Mutation_p.N91K|HNRNPC_uc001wae.2_Missense_Mutation_p.N91K	NM_031314	NP_112604	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C	91						catalytic step 2 spliceosome|nucleoplasm	identical protein binding|nucleotide binding|RNA binding				0	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		CTTTTCCTCGGTTCACTTTTG	0.413													63	202	---	---	---	---	PASS
METTL3	56339	broad.mit.edu	37	14	21966492	21966492	+	Silent	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21966492C>T	uc001wbc.2	-	11	1745	c.1653G>A	c.(1651-1653)CTG>CTA	p.L551L	TOX4_uc001waz.2_3'UTR|TOX4_uc001wba.2_RNA|TOX4_uc010tlu.1_3'UTR|TOX4_uc010tlv.1_3'UTR|METTL3_uc001wbb.2_Silent_p.L396L	NM_019852	NP_062826	Q86U44	MTA70_HUMAN	methyltransferase like 3	551					gene expression	nuclear speck	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity|RNA binding			pancreas(1)|skin(1)	2	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		GGATCCCATCCAGTTGGTTTC	0.418													31	189	---	---	---	---	PASS
METTL3	56339	broad.mit.edu	37	14	21967449	21967449	+	Splice_Site	SNP	C	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21967449C>G	uc001wbc.2	-	9	1610	c.1518_splice	c.e9+1	p.E506_splice	METTL3_uc001wbb.2_Splice_Site_p.E351_splice	NM_019852	NP_062826	Q86U44	MTA70_HUMAN	methyltransferase like 3						gene expression	nuclear speck	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity|RNA binding			pancreas(1)|skin(1)	2	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		GAAGCACATACCTCAGCTACG	0.423													41	223	---	---	---	---	PASS
METTL3	56339	broad.mit.edu	37	14	21967512	21967512	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21967512C>T	uc001wbc.2	-	9	1548	c.1456G>A	c.(1456-1458)GGT>AGT	p.G486S	METTL3_uc001wbb.2_Missense_Mutation_p.G331S	NM_019852	NP_062826	Q86U44	MTA70_HUMAN	methyltransferase like 3	486					gene expression	nuclear speck	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity|RNA binding			pancreas(1)|skin(1)	2	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		CCTTTGACACCAACCTGCTCA	0.433													39	247	---	---	---	---	PASS
METTL3	56339	broad.mit.edu	37	14	21967647	21967647	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21967647C>T	uc001wbc.2	-	8	1533	c.1441G>A	c.(1441-1443)GAA>AAA	p.E481K	METTL3_uc001wbb.2_Missense_Mutation_p.E326K	NM_019852	NP_062826	Q86U44	MTA70_HUMAN	methyltransferase like 3	481					gene expression	nuclear speck	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity|RNA binding			pancreas(1)|skin(1)	2	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		AAGCAGTGTTCCTTCCCATGG	0.448													34	218	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105419895	105419895	+	Silent	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105419895T>C	uc010axc.1	-	7	2013	c.1893A>G	c.(1891-1893)GAA>GAG	p.E631E	AHNAK2_uc001ypx.2_Silent_p.E531E	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	631						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTTTTAATCCTTCCTCTGTGC	0.418													8	549	---	---	---	---	PASS
RTF1	23168	broad.mit.edu	37	15	41769654	41769654	+	Splice_Site	SNP	A	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41769654A>T	uc001zny.2	+	14	1695	c.1683_splice	c.e14-2	p.S561_splice		NM_015138	NP_055953	Q92541	RTF1_HUMAN	Paf1/RNA polymerase II complex component						histone modification|regulation of transcription, DNA-dependent|transcription initiation, DNA-dependent	nucleoplasm	protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		CTTACCCCACAGTTACATCAA	0.473													16	178	---	---	---	---	PASS
SECISBP2L	9728	broad.mit.edu	37	15	49301547	49301547	+	Silent	SNP	A	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49301547A>C	uc001zxe.1	-	14	2027	c.1893T>G	c.(1891-1893)ACT>ACG	p.T631T	SECISBP2L_uc001zxd.1_Silent_p.T586T|SECISBP2L_uc010bep.1_Silent_p.T393T	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	631										breast(1)|skin(1)	2						GAGAGAGTGAAGTATCACTGG	0.438													14	474	---	---	---	---	PASS
PML	5371	broad.mit.edu	37	15	74325822	74325822	+	Intron	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74325822G>A	uc002awv.2	+						PML_uc002awm.2_Intron|PML_uc002awl.2_Intron|PML_uc002awj.1_Missense_Mutation_p.C527Y|PML_uc002awk.2_Intron|PML_uc002awn.2_Intron|PML_uc002awo.2_Intron|PML_uc002awp.2_Intron|PML_uc002awq.2_Intron|PML_uc002awr.2_Intron|PML_uc002aws.2_Intron|PML_uc002awt.2_Intron|PML_uc002awu.2_Intron|PML_uc010ule.1_Intron|PML_uc002awx.2_Intron|PML_uc002awy.2_Intron	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1						cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5						CCCCTCTTCTGTATTTTGGCC	0.612			T	RARA|PAX5	APL|ALL								3	9	---	---	---	---	PASS
SLC28A1	9154	broad.mit.edu	37	15	85488459	85488459	+	3'UTR	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85488459T>C	uc002blg.2	+	19					SLC28A1_uc010bnb.2_3'UTR|SLC28A1_uc010upe.1_3'UTR|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCTTCTGCGCTTCTGAGGGCT	0.567													6	200	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102516424	102516424	+	Silent	SNP	G	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102516424G>T	uc002cdi.2	+	11	2170	c.750G>T	c.(748-750)CCG>CCT	p.P250P	WASH3P_uc002cdl.2_Silent_p.P250P|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Silent_p.P250P|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						TGCCGCCACCGCAGCAGCCAC	0.647													4	28	---	---	---	---	PASS
AXIN1	8312	broad.mit.edu	37	16	338170	338170	+	Silent	SNP	C	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:338170C>A	uc002cgp.1	-	11	2718	c.2541G>T	c.(2539-2541)CTG>CTT	p.L847L	AXIN1_uc002cgq.1_Silent_p.L811L	NM_003502	NP_003493	O15169	AXIN1_HUMAN	axin 1 isoform a	847	DIX.				activation of JUN kinase activity|activation of protein kinase activity|apoptosis|axial mesoderm formation|canonical Wnt receptor signaling pathway involved in neural plate anterior/posterior pattern formation|cellular protein complex assembly|cellular response to organic cyclic compound|cytoplasmic microtubule organization|determination of left/right symmetry|dorsal/ventral axis specification|embryonic eye morphogenesis|embryonic skeletal joint morphogenesis|forebrain anterior/posterior pattern formation|muscle cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|olfactory placode formation|optic placode formation|positive regulation of JNK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity|regulation of catenin import into nucleus|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway involved in somitogenesis	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|cell cortex|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|cytosol|lateral plasma membrane|nucleus|perinuclear region of cytoplasm|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|I-SMAD binding|p53 binding|protein complex scaffold|protein homodimerization activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			breast(1)|liver(1)	2		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CAAAGACGGGCAGGACGGCCT	0.602													7	209	---	---	---	---	PASS
CCNF	899	broad.mit.edu	37	16	2503516	2503516	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2503516C>T	uc002cqd.1	+	15	1781	c.1693C>T	c.(1693-1695)CCC>TCC	p.P565S	CCNF_uc002cqe.1_Missense_Mutation_p.P257S	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	565					cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				CCTCAGCTCTCCCTCGGGGCG	0.607													28	72	---	---	---	---	PASS
ADCY9	115	broad.mit.edu	37	16	4043480	4043480	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4043480G>T	uc002cvx.2	-	4	2455	c.1916C>A	c.(1915-1917)CCC>CAC	p.P639H		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	639	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						TTCAGATTTGGGAGCAAATGT	0.542													79	83	---	---	---	---	PASS
ADCY9	115	broad.mit.edu	37	16	4043482	4043482	+	Silent	SNP	A	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4043482A>T	uc002cvx.2	-	4	2453	c.1914T>A	c.(1912-1914)GCT>GCA	p.A638A		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	638	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						CAGATTTGGGAGCAAATGTGA	0.547													78	80	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30724950	30724950	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30724950A>T	uc002dze.1	+	16	2796	c.2411A>T	c.(2410-2412)AAG>ATG	p.K804M	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.K661M|SRCAP_uc010bzz.1_Missense_Mutation_p.K374M	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	804					interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			CGCGAGTTCAAGGAGTGGTTC	0.512													17	401	---	---	---	---	PASS
CA7	766	broad.mit.edu	37	16	66887326	66887326	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66887326G>T	uc002eqi.2	+	7	829	c.720G>T	c.(718-720)AGG>AGT	p.R240S	uc002eqh.2_RNA|CA7_uc002eqj.2_Missense_Mutation_p.R184S	NM_005182	NP_005173	P43166	CAH7_HUMAN	carbonic anhydrase VII isoform 1	240					one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		ACGATGAGAGGATCCACATGG	0.602													26	114	---	---	---	---	PASS
AP1G1	164	broad.mit.edu	37	16	71789925	71789925	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71789925T>C	uc010cgg.2	-	12	1540	c.1226A>G	c.(1225-1227)GAA>GGA	p.E409G	AP1G1_uc002fba.2_Missense_Mutation_p.E412G|AP1G1_uc002fbb.2_Missense_Mutation_p.E432G	NM_001128	NP_001119	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1	409					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|recycling endosome	kinesin binding|protein transporter activity			ovary(2)	2		Ovarian(137;0.125)				ATCTTACTTTTCTGCAGCAAG	0.318													73	265	---	---	---	---	PASS
POLR2A	5430	broad.mit.edu	37	17	7404425	7404425	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7404425A>G	uc002ghf.3	+	12	2282	c.2048A>G	c.(2047-2049)GAG>GGG	p.E683G		NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	683					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				CTCCTCATCGAGGGTGAGCAT	0.507													6	215	---	---	---	---	PASS
WDR16	146845	broad.mit.edu	37	17	9538843	9538843	+	Missense_Mutation	SNP	C	A	A	rs142289033		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9538843C>A	uc002gly.2	+	11	1511	c.1442C>A	c.(1441-1443)ACC>AAC	p.T481N	WDR16_uc002glz.2_Missense_Mutation_p.T413N|WDR16_uc010coc.2_Missense_Mutation_p.T491N	NM_145054	NP_659491	Q8N1V2	WDR16_HUMAN	WD40-repeat protein upregulated in HCC isoform	481	WD 8.					cytoplasm|intracellular membrane-bounded organelle	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4						ACCGCCAGCACCGATGGGACT	0.502													10	163	---	---	---	---	PASS
SLC13A2	9058	broad.mit.edu	37	17	26820678	26820678	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26820678G>T	uc002hbh.2	+	7	1035	c.968G>T	c.(967-969)GGC>GTC	p.G323V	SLC13A2_uc010wal.1_Missense_Mutation_p.G280V|SLC13A2_uc010wam.1_Missense_Mutation_p.G279V|SLC13A2_uc010wan.1_Missense_Mutation_p.G372V|SLC13A2_uc010wao.1_Missense_Mutation_p.G280V|SLC13A2_uc002hbi.2_Missense_Mutation_p.G252V	NM_003984	NP_003975	Q13183	S13A2_HUMAN	solute carrier family 13, member 2 isoform b	323						integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity				0	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	AGGCTGCTGGGCCCCATGACC	0.572													29	55	---	---	---	---	PASS
TLK2	11011	broad.mit.edu	37	17	60598172	60598172	+	Silent	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60598172C>T	uc010ddp.2	+	3	388	c.120C>T	c.(118-120)TGC>TGT	p.C40C	TLK2_uc002izx.3_5'UTR|TLK2_uc002izz.3_Silent_p.C40C|TLK2_uc002jaa.3_Silent_p.C40C|TLK2_uc010wpd.1_Silent_p.C40C	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A	40					cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						AGAGCTTGTGCAGCGTCGGAT	0.323													8	317	---	---	---	---	PASS
C17orf80	55028	broad.mit.edu	37	17	71241410	71241410	+	Intron	SNP	T	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71241410T>A	uc002jjm.3	+						C17orf80_uc010wqu.1_3'UTR|C17orf80_uc010dfj.2_Intron|C17orf80_uc002jjk.1_3'UTR|C17orf80_uc002jjl.3_Intron	NM_017941	NP_060411	Q9BSJ5	CQ080_HUMAN	lung cancer-related protein 8 isoform a							integral to membrane				skin(1)	1			LUSC - Lung squamous cell carcinoma(166;0.197)			CTTAACAGTTTAAAAATGTAT	0.368													11	166	---	---	---	---	PASS
TMC8	147138	broad.mit.edu	37	17	76134202	76134202	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76134202T>A	uc002jup.2	+	12	1848	c.1466T>A	c.(1465-1467)CTC>CAC	p.L489H	TMC8_uc002juq.2_Missense_Mutation_p.L266H|TMC8_uc010wtr.1_Silent_p.P194P|TMC8_uc002jur.1_5'UTR	NM_152468	NP_689681	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	489	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			TGGATGGGCCTCTTCTACTGC	0.612									Epidermodysplasia_Verruciformis_Familial_Clustering_of				25	62	---	---	---	---	PASS
RPTOR	57521	broad.mit.edu	37	17	78935234	78935234	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78935234A>C	uc002jyt.1	+	31	4451	c.3646A>C	c.(3646-3648)AAG>CAG	p.K1216Q	RPTOR_uc010wug.1_Missense_Mutation_p.K1058Q|RPTOR_uc002jyu.1_Missense_Mutation_p.K109Q	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1	1216	WD 5.				cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						CTGGGTGGTGAAGGCCTCCCT	0.617													13	45	---	---	---	---	PASS
SYT4	6860	broad.mit.edu	37	18	40853880	40853880	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40853880C>T	uc002law.2	-	2	883	c.514G>A	c.(514-516)GTC>ATC	p.V172I	SYT4_uc010dng.2_Intron|SYT4_uc010xcm.1_Missense_Mutation_p.V154I|SYT4_uc010dnh.2_Intron	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	172	Phospholipid binding (Probable).|C2 1.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			skin(5)	5						TTGATATTGACCACAAATGCT	0.443													4	45	---	---	---	---	PASS
MYO5B	4645	broad.mit.edu	37	18	47352733	47352733	+	3'UTR	SNP	G	T	T	rs112174362		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47352733G>T	uc002leb.2	-	40					MYO5B_uc002ldz.2_3'UTR|MYO5B_uc002lea.2_3'UTR	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		GTCAATCTCTGATTTGATCTA	0.343													4	16	---	---	---	---	PASS
NEDD4L	23327	broad.mit.edu	37	18	55992365	55992365	+	Silent	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55992365G>A	uc002lgy.2	+	9	925	c.651G>A	c.(649-651)CGG>CGA	p.R217R	NEDD4L_uc002lgz.2_Silent_p.R217R|NEDD4L_uc002lgx.2_Silent_p.R217R|NEDD4L_uc010xee.1_Silent_p.R96R|NEDD4L_uc002lhc.2_Silent_p.R209R|NEDD4L_uc002lhd.2_Silent_p.R96R|NEDD4L_uc002lhb.2_Silent_p.R96R|NEDD4L_uc002lhe.2_Silent_p.R209R|NEDD4L_uc002lhf.2_Silent_p.R96R|NEDD4L_uc002lhg.2_Silent_p.R96R|NEDD4L_uc002lhh.2_Silent_p.R96R|NEDD4L_uc010dpm.1_Silent_p.R68R	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally	217	WW 1.				cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						ACAACAACCGGACCACTCAGT	0.542													16	180	---	---	---	---	PASS
NAPA	8775	broad.mit.edu	37	19	47996401	47996401	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47996401A>G	uc002pha.1	-	6	751	c.451T>C	c.(451-453)TAC>CAC	p.Y151H	uc002pgz.1_Intron|NAPA_uc002phb.1_Missense_Mutation_p.Y112H|NAPA_uc002phc.1_Missense_Mutation_p.Y38H|NAPA_uc002phd.1_Missense_Mutation_p.Y151H|NAPA_uc010elf.1_Silent_p.T20T	NM_003827	NP_003818	P54920	SNAA_HUMAN	N-ethylmaleimide-sensitive factor attachment	151					cellular membrane fusion|intra-Golgi vesicle-mediated transport|post-Golgi vesicle-mediated transport	cytosol					0		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000466)|all cancers(93;0.000739)|Epithelial(262;0.0168)|GBM - Glioblastoma multiforme(486;0.049)		CCTTTGTAGTAGTCTGCAGAC	0.647													4	128	---	---	---	---	PASS
KLK13	26085	broad.mit.edu	37	19	51561893	51561893	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51561893G>C	uc002pvn.2	-	4	590	c.547C>G	c.(547-549)CTT>GTT	p.L183V	KLK13_uc002pvl.2_RNA|KLK13_uc002pvm.2_RNA|KLK13_uc002pvo.2_RNA|KLK13_uc002pvp.2_RNA|KLK13_uc010eon.2_Missense_Mutation_p.L110V|KLK13_uc002pvq.2_RNA|KLK13_uc010eoo.2_Missense_Mutation_p.L31V	NM_015596	NP_056411	Q9UKR3	KLK13_HUMAN	kallikrein 13 precursor	183	Peptidase S1.				proteolysis		protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00432)		TCTGAGCGAAGTTGGATGTTG	0.483													13	329	---	---	---	---	PASS
CPXM1	56265	broad.mit.edu	37	20	2779480	2779480	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2779480T>C	uc002wgu.2	-	2	296	c.232A>G	c.(232-234)AAG>GAG	p.K78E	CPXM1_uc010gas.2_Missense_Mutation_p.K78E	NM_019609	NP_062555	Q96SM3	CPXM1_HUMAN	carboxypeptidase X, member 1 precursor	78					cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding			ovary(2)|skin(2)	4						TTCTTCCGCTTCTTCATAATG	0.567													6	234	---	---	---	---	PASS
MKKS	8195	broad.mit.edu	37	20	10393658	10393658	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10393658T>C	uc002wnt.1	-	3	1392	c.505A>G	c.(505-507)AAG>GAG	p.K169E	MKKS_uc002wnu.1_Missense_Mutation_p.K169E|MKKS_uc010zrd.1_Intron	NM_018848	NP_061336	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome protein	169					brain morphogenesis|cerebral cortex development|convergent extension involved in gastrulation|detection of mechanical stimulus involved in sensory perception of sound|fat cell differentiation|flagellum assembly|gonad development|heart looping|hippocampus development|intracellular transport|melanosome transport|photoreceptor cell maintenance|pigment granule aggregation in cell center|protein folding|regulation of cilium beat frequency involved in ciliary motility|sensory perception of smell|social behavior|spermatid development|striatum development	cytosol|microtubule organizing center|motile cilium	ATP binding|unfolded protein binding				0						TCTGTTTCCTTTCTGGTGAGC	0.413									Bardet-Biedl_syndrome				27	66	---	---	---	---	PASS
FAM182A	284800	broad.mit.edu	37	20	26061818	26061818	+	RNA	SNP	G	C	C	rs112101451	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26061818G>C	uc010gdq.2	+	4		c.879G>C				NR_026713				Homo sapiens cDNA FLJ38374 fis, clone FEBRA2002552.												0						GATTTCTCCTGCTTAGAAATG	0.408													6	123	---	---	---	---	PASS
DSN1	79980	broad.mit.edu	37	20	35399610	35399610	+	Intron	SNP	T	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35399610T>C	uc010gfr.2	-						DSN1_uc002xfz.2_Intron|DSN1_uc002xfy.3_Intron|DSN1_uc002xga.2_Intron|DSN1_uc010zvs.1_Intron|DSN1_uc002xgc.2_Intron|DSN1_uc002xgb.2_5'UTR	NM_001145316	NP_001138788	Q9H410	DSN1_HUMAN	DSN1, MIND kinetochore complex component,						cell division|chromosome segregation|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding			ovary(2)	2		Myeloproliferative disorder(115;0.00874)				GTATTTGTTATAAAAAAGTCA	0.368													15	49	---	---	---	---	PASS
MCM3AP	8888	broad.mit.edu	37	21	47655178	47655178	+	3'UTR	SNP	C	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47655178C>A	uc002zir.1	-	28					MCM3APAS_uc002zim.2_Intron|MCM3APAS_uc002zin.2_Intron|MCM3AP_uc002zio.1_3'UTR|MCM3AP_uc002zip.1_3'UTR|MCM3AP_uc002ziq.1_3'UTR|MCM3APAS_uc002zis.1_5'Flank	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3						DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					ACAGGTCAGGCTGCTCAAATG	0.473													8	140	---	---	---	---	PASS
LARGE	9215	broad.mit.edu	37	22	33700268	33700268	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33700268C>A	uc003and.3	-	13	2256	c.1677G>T	c.(1675-1677)ATG>ATT	p.M559I	LARGE_uc011amd.1_Missense_Mutation_p.M358I|LARGE_uc003ane.3_Missense_Mutation_p.M559I|LARGE_uc010gwp.2_Missense_Mutation_p.M507I|LARGE_uc011ame.1_Missense_Mutation_p.M491I|LARGE_uc011amf.1_Missense_Mutation_p.M559I	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase	559	Lumenal (Potential).				glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				CAGACAGGAACATGTAGGGAG	0.552													5	91	---	---	---	---	PASS
MIR421	693122	broad.mit.edu	37	X	73438284	73438284	+	RNA	SNP	G	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73438284G>T	hsa-mir-421|MI0003685	-			c.13G>T			NCRNA00182_uc010nlq.1_Intron|uc004ebq.1_Intron																	0						atttaatgaggcctacaatgt	0.189													6	102	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117782912	117782912	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117782912C>T	uc004eqp.2	+	41	4466	c.4403C>T	c.(4402-4404)CCT>CTT	p.P1468L	DOCK11_uc004eqq.2_Missense_Mutation_p.P1247L	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1468					blood coagulation	cytosol	GTP binding			ovary(3)	3						CTTTAGTTTCCTTCAGCATTT	0.348													5	167	---	---	---	---	PASS
KIAA1210	57481	broad.mit.edu	37	X	118219357	118219357	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118219357G>T	uc004era.3	-	12	4837	c.4837C>A	c.(4837-4839)CCT>ACT	p.P1613T		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	1613										ovary(4)|skin(1)	5						TCATATTTAGGCTCCTTAGTC	0.448													113	103	---	---	---	---	PASS
GDI1	2664	broad.mit.edu	37	X	153669611	153669611	+	Intron	SNP	G	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153669611G>A	uc004fli.3	+						GDI1_uc011mzo.1_3'UTR|GDI1_uc004flj.2_5'Flank|FAM50A_uc004fll.3_5'Flank	NM_001493	NP_001484	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1						protein transport|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|midbody	GTPase activator activity|protein binding				0	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCTCTGTGCTGTCGAGTCTCC	0.592													9	10	---	---	---	---	PASS
CD24	100133941	broad.mit.edu	37	Y	21154603	21154603	+	5'UTR	SNP	A	C	C	rs79788321		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:21154603A>C	uc004ftz.1	-	1					TTTY14_uc004fty.2_Intron	NM_013230	NP_037362	P25063	CD24_HUMAN	CD24 antigen precursor						axon guidance|B cell receptor transport into membrane raft|cell activation|cell migration|cell-cell adhesion|chemokine receptor transport out of membrane raft|cholesterol homeostasis|elevation of cytosolic calcium ion concentration|induction of apoptosis by intracellular signals|negative regulation of transforming growth factor-beta3 production|positive regulation of activated T cell proliferation|positive regulation of MAP kinase activity|regulation of cytokine-mediated signaling pathway|regulation of epithelial cell differentiation|regulation of MAPKKK cascade|respiratory burst|response to estrogen stimulus|response to hypoxia|response to molecule of bacterial origin|T cell costimulation|Wnt receptor signaling pathway	anchored to membrane|cell surface|membrane raft|plasma membrane	protein kinase binding|protein tyrosine kinase activator activity|signal transducer activity				0						CATGTCCCCTACGTCGGTGCG	0.662													4	4	---	---	---	---	PASS
KIAA1751	85452	broad.mit.edu	37	1	1893558	1893559	+	Intron	INS	-	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1893558_1893559insC	uc001aim.1	-						KIAA1751_uc009vkz.1_Intron	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452											pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CTACAAACCTGTCCACAAAGAG	0.297													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	5431611	5431611	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5431611delG								AJAP1 (587761 upstream) : NPHP4 (491259 downstream)																							AGAGTTCCCTGGCCATTCCTG	0.448													4	2	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	7073103	7073104	+	Intron	DEL	CT	-	-	rs140856151		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7073103_7073104delCT	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		cctgagtcccctctctcgtctc	0.000													3	6	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	7734403	7734405	+	Intron	DEL	AGC	-	-	rs142775751		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7734403_7734405delAGC	uc001aoi.2	+						CAMTA1_uc010nzv.1_Intron	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GAGGGCAGTGAGCAGCAGTGAGT	0.586													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	13123163	13123163	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13123163delA								PRAMEF5 (5412 upstream) : LOC440563 (59798 downstream)																							agactccatcaaaaaaaaaaa	0.234													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	13219737	13219739	+	IGR	DEL	TTT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13219737_13219739delTTT								LOC440563 (35770 upstream) : PRAMEF3 (109094 downstream)																							CACTTTCACAttttttttttttt	0.271													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	14494950	14494951	+	IGR	DEL	TC	-	-	rs72474551		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14494950_14494951delTC								PRDM2 (343378 upstream) : KAZ (430262 downstream)																							AATTGACACTTCTCTGCTCTTC	0.490													3	3	---	---	---	---	
NBL1	4681	broad.mit.edu	37	1	19948263	19948263	+	Intron	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19948263delG	uc009vpl.1	+						C1orf151_uc001bch.1_Intron|C1orf151_uc001bci.1_Intron	NM_005380	NP_005371	P41271	NBL1_HUMAN	neuroblastoma, suppression of tumorigenicity 1 2							extracellular region				ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00043)|Ovarian(437;0.00373)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.9e-05)|Kidney(64;0.000173)|GBM - Glioblastoma multiforme(114;0.0012)|KIRC - Kidney renal clear cell carcinoma(64;0.0026)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TCTTTGAGGTGGGTAGGAGAG	0.562													4	2	---	---	---	---	
RPL11	6135	broad.mit.edu	37	1	24019391	24019391	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24019391delT	uc001bhk.2	+						RPL11_uc001bhl.2_Intron|RPL11_uc001bhm.2_Intron|RPL11_uc001bhn.1_Intron	NM_000975	NP_000966	P62913	RL11_HUMAN	ribosomal protein L11						endocrine pancreas development|protein localization to nucleus|protein targeting|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|rRNA binding|structural constituent of ribosome			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.13e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		AAGAGGTGTCTTTTTTTTTTT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	31869273	31869274	+	IGR	INS	-	TC	TC			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31869273_31869274insTC								FABP3 (23350 upstream) : SERINC2 (13774 downstream)																							TGGGGCTGACATCTCTCTCTCT	0.520													4	2	---	---	---	---	
PEF1	553115	broad.mit.edu	37	1	32104602	32104603	+	Intron	DEL	AG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32104602_32104603delAG	uc001bth.1	-						PEF1_uc010ogm.1_Intron	NM_012392	NP_036524	Q9UBV8	PEF1_HUMAN	penta-EF-hand domain containing 1						response to calcium ion	cytoplasm|membrane	calcium ion binding|protein heterodimerization activity				0		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)|all_neural(195;0.186)		STAD - Stomach adenocarcinoma(196;0.0546)		aaggaagcttagatggaggaat	0.000													4	2	---	---	---	---	
PSMB2	5690	broad.mit.edu	37	1	36076590	36076590	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36076590delT	uc001bzf.1	-						PSMB2_uc001bzd.1_Intron|PSMB2_uc010ohz.1_Intron|PSMB2_uc001bzg.1_Intron	NM_002794	NP_002785	P49721	PSB2_HUMAN	proteasome beta 2 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)			Bortezomib(DB00188)	AAATGGATGATTTTTTTTTTC	0.388													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	40789741	40789741	+	IGR	DEL	T	-	-	rs35226348		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40789741delT								COL9A2 (6681 upstream) : SMAP2 (49987 downstream)																							ttccctcccctgacccagcat	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	47309278	47309278	+	IGR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47309278delT								CYP4B1 (24258 upstream) : CYP4Z2P (14628 downstream)																							ACAAGATCCATTTTTTTTTCT	0.189													6	3	---	---	---	---	
AGBL4	84871	broad.mit.edu	37	1	49225225	49225227	+	Intron	DEL	CAC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49225225_49225227delCAC	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron|BEND5_uc001crx.3_Intron|BEND5_uc001crw.3_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		ttttccttttcaccactctgcct	0.266													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	67211929	67211929	+	IGR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67211929delT								SGIP1 (1162 upstream) : TCTEX1D1 (6211 downstream)																							gtttctcatctttagaatggg	0.065													4	2	---	---	---	---	
ANKRD13C	81573	broad.mit.edu	37	1	70778351	70778351	+	Intron	DEL	A	-	-	rs71645362		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70778351delA	uc001dex.3	-						ANKRD13C_uc009wbk.2_Intron	NM_030816	NP_110443	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C						protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding				0						ctctgtctccaaaaaaaaaaa	0.184													3	3	---	---	---	---	
ZRANB2	9406	broad.mit.edu	37	1	71532880	71532880	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71532880delT	uc001dft.2	-						ZRANB2_uc001dfs.2_Intron	NM_203350	NP_976225	O95218	ZRAB2_HUMAN	zinc finger protein 265 isoform 1						mRNA processing|RNA splicing	nucleus	protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						GAATTTAAACTTTTTTTAAGG	0.259													4	2	---	---	---	---	
ST6GALNAC3	256435	broad.mit.edu	37	1	76624745	76624746	+	Intron	INS	-	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76624745_76624746insT	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						TCCCTTTCCCATTTTAGGGACA	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	86875431	86875432	+	IGR	INS	-	C	C	rs34815252		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86875431_86875432insC								ODF2L (13428 upstream) : CLCA2 (14337 downstream)																							acaacaacaatacagacagcaa	0.005													4	2	---	---	---	---	
LMO4	8543	broad.mit.edu	37	1	87806074	87806074	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87806074delA	uc001dmi.2	+						LMO4_uc001dmj.2_Intron	NM_006769	NP_006760	P61968	LMO4_HUMAN	LIM domain only 4						neural tube closure|transcription from RNA polymerase II promoter	transcription factor complex	sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding				0		Lung NSC(277;0.179)		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)		CTTTCTAGTTAAAAAAAAAAT	0.303													7	4	---	---	---	---	
AKNAD1	254268	broad.mit.edu	37	1	109363506	109363506	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109363506delA	uc001dwa.2	-						AKNAD1_uc001dwb.2_Intron	NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN	hypothetical protein LOC254268											ovary(3)	3						ctgtctctacaaaaaaaaaat	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	111265153	111265153	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111265153delG								KCNA3 (47498 upstream) : CD53 (148668 downstream)																							ctgtacatgtgggcagtgtgt	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	115885947	115885947	+	IGR	DEL	T	-	-	rs112833394		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115885947delT								NGF (5090 upstream) : VANGL1 (298627 downstream)																							TTCAGGCTGGTCTGACTCCAG	0.567													5	4	---	---	---	---	
CD58	965	broad.mit.edu	37	1	117114766	117114766	+	5'Flank	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117114766delC	uc001egm.2	-						CD58_uc001egn.2_5'Flank|CD58_uc010owy.1_5'Flank|CD58_uc001egp.3_5'Flank	NM_001779	NP_001770	P19256	LFA3_HUMAN	CD58 molecule isoform 1						blood coagulation|cell-cell adhesion|leukocyte migration	anchored to membrane|integral to plasma membrane	protein binding				0	Lung SC(450;0.225)	all_cancers(81;0.000363)|all_lung(203;0.000118)|all_epithelial(167;0.000149)|Lung NSC(69;0.000577)		Lung(183;0.0086)|LUSC - Lung squamous cell carcinoma(189;0.0528)|Colorectal(144;0.0775)|all cancers(265;0.109)|Epithelial(280;0.118)|COAD - Colon adenocarcinoma(174;0.121)		CCTCCATTATCCCCAGGTGGG	0.433													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145129695	145129695	+	Intron	DEL	T	-	-	rs66650863		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145129695delT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						CTGGAACGTATTTTTTTTCAT	0.303													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145280127	145280127	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145280127delT	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TGTGAGGATATTTTTTTCTCT	0.378													4	2	---	---	---	---	
CLK2	1196	broad.mit.edu	37	1	155240974	155240974	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155240974delA	uc001fjy.2	-						RAG1AP1_uc010pey.1_Intron|CLK2_uc001fjw.2_Intron|CLK2_uc001fjx.2_Intron|CLK2_uc009wqm.2_Intron	NM_003993	NP_003984	P49760	CLK2_HUMAN	CDC-like kinase 2							nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GAAACTCTAGAAAGCCCCCAA	0.348								Other_conserved_DNA_damage_response_genes					4	2	---	---	---	---	
PEAR1	375033	broad.mit.edu	37	1	156866978	156866978	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156866978delA	uc001fqj.1	+							NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1							integral to membrane				ovary(2)|central_nervous_system(1)	3	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					tcctggggttaaagtggtgag	0.035													4	2	---	---	---	---	
PEA15	8682	broad.mit.edu	37	1	160178920	160178923	+	Intron	DEL	ACAT	-	-	rs141637727		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160178920_160178923delACAT	uc001fvk.2	+						uc001fvj.1_5'Flank|PEA15_uc001fvl.2_Intron|PEA15_uc001fvm.2_Intron	NM_003768	NP_003759	Q15121	PEA15_HUMAN	phosphoprotein enriched in astrocytes 15						anti-apoptosis|apoptosis|carbohydrate transport|negative regulation of glucose import	cytoplasm|microtubule associated complex	protein binding				0	all_cancers(52;3.11e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGGTTTAGACACATACAAACACAC	0.495													4	3	---	---	---	---	
UHMK1	127933	broad.mit.edu	37	1	162485361	162485364	+	Intron	DEL	GAAA	-	-	rs67132157		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162485361_162485364delGAAA	uc001gcc.1	+						UHMK1_uc001gcb.1_Intron|UHMK1_uc009wuu.1_Intron	NM_175866	NP_787062	Q8TAS1	UHMK1_HUMAN	kinase interacting stathmin						cell cycle arrest|neuron projection development|peptidyl-serine phosphorylation|positive regulation of translational initiation|protein autophosphorylation|regulation of protein export from nucleus	axon|dendrite cytoplasm|neuronal RNA granule|nucleus	protein binding|protein serine/threonine kinase activity|ribonucleoprotein binding|RNA binding				0	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TTGTCTGTCTGAAAGAAAGTCTTG	0.382													4	2	---	---	---	---	
PIGC	5279	broad.mit.edu	37	1	172412760	172412760	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172412760delA	uc001gil.2	-						PIGC_uc001gii.1_Intron|PIGC_uc001gij.1_Intron|C1orf105_uc001gik.2_Intron|PIGC_uc001gin.2_Intron|PIGC_uc001gio.2_Intron	NM_153747	NP_714969	Q92535	PIGC_HUMAN	phosphatidylinositol glycan, class C						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity			lung(1)	1						CAAATTTGAGAAAAAAAAAAT	0.403													4	2	---	---	---	---	
TNNI1	7135	broad.mit.edu	37	1	201378807	201378807	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201378807delC	uc010ppq.1	-						TNNI1_uc001gwo.1_Intron	NM_003281	NP_003272	P19237	TNNI1_HUMAN	troponin I, skeletal, slow						muscle filament sliding|regulation of striated muscle contraction	cytosol|troponin complex	actin binding|tropomyosin binding				0						TGCACATTCTCTCAGCACTTC	0.527											OREG0014079	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
TRAF5	7188	broad.mit.edu	37	1	211508624	211508624	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211508624delA	uc001hih.2	+						TRAF5_uc001hii.2_Intron|TRAF5_uc010psx.1_Intron|TRAF5_uc010psy.1_Intron	NM_004619	NP_004610	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5						apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis	CD40 receptor complex|centrosome|internal side of plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(2)|ovary(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		cccgatctgtaaaatatgaag	0.000													4	2	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	215807491	215807492	+	Intron	DEL	AC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215807491_215807492delAC	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		atccctagttacacattaaaat	0.168										HNSCC(13;0.011)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	221964868	221964868	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221964868delC								DUSP10 (49407 upstream) : HHIPL2 (730734 downstream)																							CCTTGAAAGTCCCAGGACTTG	0.517													4	2	---	---	---	---	
DNAH14	127602	broad.mit.edu	37	1	225140832	225140833	+	Intron	DEL	TT	-	-	rs72130753		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225140832_225140833delTT	uc001how.2	+						DNAH14_uc001hou.3_Intron|DNAH14_uc001hot.3_Intron|DNAH14_uc001hov.3_Intron	NM_001373	NP_001364	Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1						ATAGAAATACtttttttttttg	0.149													1	5	---	---	---	---	
ZNF678	339500	broad.mit.edu	37	1	227760956	227760956	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227760956delT	uc001hqw.1	+						ZNF678_uc009xet.1_Intron|ZNF678_uc009xeu.1_Intron	NM_178549	NP_848644	F5GXA7	F5GXA7_HUMAN	zinc finger protein 678						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			pancreas(1)	1		Prostate(94;0.0885)				CTTTTAATAATTTTTTTTGTA	0.358													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	228983721	228983721	+	IGR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228983721delT								RHOU (101312 upstream) : RAB4A (423158 downstream)																							CGTTCTTAACttttttttttt	0.095													11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230710568	230710569	+	IGR	DEL	TG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230710568_230710569delTG								PGBD5 (197201 upstream) : COG2 (67633 downstream)																							atgtgtgtgttgtgtgttgttt	0.178													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	234918490	234918490	+	IGR	DEL	T	-	-	rs77588844		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234918490delT								IRF2BP2 (173219 upstream) : TOMM20 (354170 downstream)																							TTTTTAATGGTTTTTTTCTCC	0.418													4	2	---	---	---	---	
NID1	4811	broad.mit.edu	37	1	236171234	236171235	+	Intron	INS	-	T	T	rs144954187	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236171234_236171235insT	uc001hxo.2	-						NID1_uc009xgd.2_Intron|NID1_uc009xgc.2_Intron	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor						cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)	ggctttctaacttctaaccatg	0.064													3	3	---	---	---	---	
TRIM58	25893	broad.mit.edu	37	1	248030914	248030915	+	Intron	INS	-	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248030914_248030915insA	uc001ido.2	+						OR2W3_uc001idp.1_5'Flank	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58							intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ggctgaggcagggaggtggagg	0.010													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	5229351	5229351	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5229351delC								None (None upstream) : SOX11 (603448 downstream)																							TGGAAAAGGGCCCAGGGCCTG	0.423													4	2	---	---	---	---	
NOL10	79954	broad.mit.edu	37	2	10794906	10794906	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10794906delA	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron|NOL10_uc002rar.2_Intron	NM_024894	NP_079170	Q9BSC4	NOL10_HUMAN	nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		tgacctgtccaaAAAAAAGAA	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12915388	12915388	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12915388delC								TRIB2 (32532 upstream) : None (None downstream)																							CAAGAGTATTCACAGTTACAG	0.313													4	2	---	---	---	---	
VSNL1	7447	broad.mit.edu	37	2	17765518	17765518	+	Intron	DEL	G	-	-	rs139924846		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17765518delG	uc002rcm.2	+							NM_003385	NP_003376	P62760	VISL1_HUMAN	visinin-like 1								calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CCCACAAAAAGGGATACAAGG	0.328													3	4	---	---	---	---	
CAD	790	broad.mit.edu	37	2	27441330	27441330	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27441330delT	uc002rji.2	+						CAD_uc010eyw.2_Intron	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate						'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CCATTGAAGGTTTTTTTTTAG	0.433													4	2	---	---	---	---	
RBKS	64080	broad.mit.edu	37	2	28081648	28081649	+	Intron	DEL	CT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28081648_28081649delCT	uc002rlo.1	-						RBKS_uc010ezi.1_Intron|RBKS_uc010ymg.1_Intron	NM_022128	NP_071411	Q9H477	RBSK_HUMAN	ribokinase						D-ribose metabolic process		ATP binding|ribokinase activity			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)					GACAGAATTCCTCTCTCTCTCC	0.381													4	2	---	---	---	---	
BIRC6	57448	broad.mit.edu	37	2	32734674	32734674	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32734674delT	uc010ezu.2	+							NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6						anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TGCAGCATTCTAAAAAAACAT	0.244													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34872020	34872020	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34872020delC								MYADML (918736 upstream) : None (None downstream)																							TAGTACACCTCCCCTTGCCTG	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42113328	42113329	+	Intron	DEL	TT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42113328_42113329delTT	uc002rse.2	+						uc010fao.1_Intron					Homo sapiens cDNA FLJ44450 fis, clone UTERU2022981.																		CATCACTGTCTTTTTTTTTTTT	0.193													3	3	---	---	---	---	
MTIF2	4528	broad.mit.edu	37	2	55479362	55479363	+	Intron	INS	-	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55479362_55479363insA	uc002ryn.2	-						MTIF2_uc010yox.1_Intron|MTIF2_uc002ryo.2_Intron	NM_001005369	NP_001005369	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2						regulation of translational initiation	mitochondrion	GTP binding|GTPase activity|ribosomal small subunit binding|translation initiation factor activity			ovary(1)	1						ATAAAAAGTTGAAAAAAAAAGG	0.158													4	2	---	---	---	---	
ARHGAP25	9938	broad.mit.edu	37	2	69014714	69014714	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69014714delA	uc002seu.2	+						ARHGAP25_uc010yqk.1_Intron|ARHGAP25_uc010fdg.2_Intron|ARHGAP25_uc010yql.1_Intron|ARHGAP25_uc002sev.2_Intron|ARHGAP25_uc002sew.2_Intron|ARHGAP25_uc002sex.2_Intron|ARHGAP25_uc010fdh.1_Intron	NM_001007231	NP_001007232	P42331	RHG25_HUMAN	Rho GTPase activating protein 25 isoform a						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|breast(2)	4						CTGTCCTCTTAAATGAAAGCA	0.423													4	2	---	---	---	---	
HK2	3099	broad.mit.edu	37	2	75094526	75094527	+	Intron	INS	-	A	A	rs151230031		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75094526_75094527insA	uc002snd.2	+							NM_000189	NP_000180	P52789	HXK2_HUMAN	hexokinase 2						apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity			ovary(1)|lung(1)	2						agtgagggattaaaaaAAAAAC	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92194836	92194837	+	IGR	INS	-	T	T	rs145003390		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92194836_92194837insT								FKSG73 (64342 upstream) : None (None downstream)																							AGAGCAGGCTCTTGCCCACATC	0.495													8	6	---	---	---	---	
ACOXL	55289	broad.mit.edu	37	2	111552804	111552804	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111552804delT	uc002tgr.3	+						ACOXL_uc010fkc.2_Intron|ACOXL_uc010yxk.1_Intron	NM_001105516	NP_001098986	Q9NUZ1	ACOXL_HUMAN	acyl-Coenzyme A oxidase-like 2						fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0						TGACCCAGGGTTGCTGGTTGG	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132355841	132355841	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132355841delG								CCDC74A (64604 upstream) : C2orf27A (124223 downstream)																							TTGGTCATGTGGGTGAGAAAT	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134418526	134418527	+	IGR	INS	-	A	A	rs112404079		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134418526_134418527insA								NCKAP5 (92495 upstream) : MGAT5 (593303 downstream)																							TACAGGCTTGCAAAAAAAAAAA	0.366													4	2	---	---	---	---	
RIF1	55183	broad.mit.edu	37	2	152266244	152266246	+	5'Flank	DEL	CAC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152266244_152266246delCAC	uc002txm.2	+						RIF1_uc002txl.2_5'Flank|RIF1_uc010fnv.1_5'Flank|RIF1_uc002txn.2_5'Flank|RIF1_uc002txo.2_5'Flank|RIF1_uc010zby.1_5'Flank	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1						cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		tTAGGCAAAACACCACCACCTGA	0.241													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	154019842	154019842	+	IGR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154019842delT								ARL6IP6 (402075 upstream) : RPRM (314010 downstream)																							GAATTCAGGGTTTTTTTTGGT	0.438													4	2	---	---	---	---	
RAPGEF4	11069	broad.mit.edu	37	2	173679337	173679337	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173679337delT	uc002uhv.3	+						RAPGEF4_uc002uhu.2_Intron|RAPGEF4_uc010fqn.2_3'UTR	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			CAAGACATCCTTTTTTTTGTT	0.308													4	2	---	---	---	---	
ZAK	51776	broad.mit.edu	37	2	174080801	174080801	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174080801delC	uc002uhz.2	+						ZAK_uc002uhy.2_Intron|ZAK_uc010zei.1_Intron|ZAK_uc002uia.1_Intron|uc002uib.2_Intron	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)			ACTTCCCTCTCCCCTCTCCCT	0.453													4	2	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495217	187495218	+	Intron	INS	-	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495217_187495218insT	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgggttgtgatataaattat	0.084													3	3	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495222	187495224	+	Intron	DEL	AAA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495222_187495224delAAA	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgtgatataaattataatctt	0.089													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	201610662	201610662	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201610662delG								AOX1 (74447 upstream) : AOX2P (24733 downstream)																							ttcgctggctggggctgctga	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	215466871	215466872	+	IGR	INS	-	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215466871_215466872insT								VWC2L (26218 upstream) : BARD1 (126403 downstream)																							GAAATCAGGCATTTTTTTTTCT	0.406													3	3	---	---	---	---	
RUFY4	285180	broad.mit.edu	37	2	218951567	218951567	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218951567delC	uc002vgw.2	+						RUFY4_uc002vgy.1_Intron|RUFY4_uc010fvl.1_Intron	NM_198483	NP_940885	Q6ZNE9	RUFY4_HUMAN	RUN and FYVE domain containing 4								metal ion binding			pancreas(1)	1		Renal(207;0.0915)		Epithelial(149;4.11e-06)|all cancers(144;0.000519)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		ggaccaaggacccaggaggaa	0.000													4	2	---	---	---	---	
CRYBA2	1412	broad.mit.edu	37	2	219857613	219857613	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219857613delA	uc002vjj.1	-						CRYBA2_uc002vjk.1_Intron	NM_057094	NP_476435	P53672	CRBA2_HUMAN	crystallin, beta A2								structural constituent of eye lens				0		Renal(207;0.0474)		Epithelial(149;9.77e-07)|all cancers(144;0.000167)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGGAGGCTATGGGGTTTCC	0.577													4	2	---	---	---	---	
COL4A4	1286	broad.mit.edu	37	2	227979043	227979043	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227979043delC	uc010zlt.1	-							NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor						axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		cacaagtcagccccacaccaa	0.080													4	2	---	---	---	---	
HDAC4	9759	broad.mit.edu	37	2	240097833	240097833	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240097833delC	uc002vyk.3	-						HDAC4_uc010fyz.1_Intron|HDAC4_uc010zoa.1_Intron|HDAC4_uc010fza.2_Intron|HDAC4_uc010fyy.2_Intron|HDAC4_uc010znz.1_Intron	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		CTCACTCCTTCTGCCCCTCAC	0.383													4	2	---	---	---	---	
HDAC4	9759	broad.mit.edu	37	2	240158117	240158117	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240158117delC	uc002vyk.3	-						HDAC4_uc010fyz.1_Intron|HDAC4_uc010zoa.1_Intron|HDAC4_uc010fza.2_Intron|HDAC4_uc002vyl.1_Intron	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		CATTTCATTTCCAAAAAGGAT	0.463													4	2	---	---	---	---	
NUP210	23225	broad.mit.edu	37	3	13358970	13358970	+	3'UTR	DEL	A	-	-	rs76827659		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13358970delA	uc003bxv.1	-	40						NM_024923	NP_079199	Q8TEM1	PO210_HUMAN	nucleoporin 210 precursor						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11	all_neural(104;0.187)					ACTTGAAAGGAAAAAAACACA	0.423													4	2	---	---	---	---	
KIF9	64147	broad.mit.edu	37	3	47289743	47289744	+	Intron	DEL	GT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47289743_47289744delGT	uc010hjp.2	-						KIF9_uc003cqx.2_Intron|KIF9_uc003cqy.2_Intron|KIF9_uc011bat.1_Intron|KIF9_uc011bau.1_Intron	NM_001134878	NP_001128350	Q9HAQ2	KIF9_HUMAN	kinesin family member 9 isoform 2						blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(1)	1		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CTCCCGACTGGTGACTCTTCCC	0.540													5	3	---	---	---	---	
RBM6	10180	broad.mit.edu	37	3	50095749	50095749	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50095749delA	uc003cyc.2	+						RBM6_uc010hlc.1_Intron|RBM6_uc003cyd.2_Intron|RBM6_uc003cye.2_Intron|RBM6_uc011bdi.1_Intron|RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron	NM_005777	NP_005768	P78332	RBM6_HUMAN	RNA binding motif protein 6						RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		CATCTATAGTAAAAAATGACA	0.343													25	41	---	---	---	---	
TEX264	51368	broad.mit.edu	37	3	51726571	51726571	+	Intron	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51726571delG	uc010hls.2	+						TEX264_uc003dbk.3_Intron|TEX264_uc010hlt.2_Intron|TEX264_uc003dbl.3_Intron|TEX264_uc003dbm.3_Intron	NM_001129884	NP_001123356	Q9Y6I9	TX264_HUMAN	testis expressed 264 precursor							extracellular region					0				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		CTTCCCCTCTGGCAATTCCTG	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	52228022	52228023	+	IGR	DEL	AG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52228022_52228023delAG								POC1A (39316 upstream) : ALAS1 (4093 downstream)																							aaagaaagaaagaaagaaagaa	0.099													4	2	---	---	---	---	
SLC25A26	115286	broad.mit.edu	37	3	66397138	66397139	+	Intron	DEL	GC	-	-	rs56162618		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66397138_66397139delGC	uc011bfq.1	+						SLC25A26_uc011bfs.1_Intron|SLC25A26_uc011bft.1_Intron|SLC25A26_uc011bfr.1_Intron|SLC25A26_uc003dmt.2_Intron	NM_173471	NP_775742	Q70HW3	SAMC_HUMAN	solute carrier family 25, member 26 isoform a							integral to membrane|mitochondrial inner membrane|nucleus	S-adenosylmethionine transmembrane transporter activity			pancreas(1)	1		Lung NSC(201;0.00774)		BRCA - Breast invasive adenocarcinoma(55;0.00046)|KIRC - Kidney renal clear cell carcinoma(15;0.0515)|Kidney(15;0.0648)		TTTGCtgtgtgcgtgtgtgtgt	0.262													4	2	---	---	---	---	
RABL3	285282	broad.mit.edu	37	3	120412831	120412832	+	Intron	DEL	CA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120412831_120412832delCA	uc003edx.2	-							NM_173825	NP_776186	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3						small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)		ATAAATACGTCAGCAGGCCTTG	0.356													4	2	---	---	---	---	
ROPN1B	152015	broad.mit.edu	37	3	125694832	125694834	+	Intron	DEL	CTC	-	-	rs10540487		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125694832_125694834delCTC	uc003eih.2	+						ROPN1B_uc010hsb.2_Intron|ROPN1B_uc010hsc.2_Intron|ROPN1B_uc011bkg.1_Intron	NM_001012337	NP_001012337	Q9BZX4	ROP1B_HUMAN	ropporin, rhophilin associated protein 1B						acrosome reaction|cell-cell adhesion|cytokinesis|fusion of sperm to egg plasma membrane|Rho protein signal transduction|sperm motility|spermatogenesis	cytoplasm|flagellum	cAMP-dependent protein kinase regulator activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling complex scaffold activity				0				GBM - Glioblastoma multiforme(114;0.151)		TCGACAGTGTCTCCTTACTGATC	0.453													5	5	---	---	---	---	
XRN1	54464	broad.mit.edu	37	3	142089771	142089771	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142089771delC	uc003eus.2	-						XRN1_uc010huu.2_Intron|XRN1_uc003eut.2_Intron|XRN1_uc003euu.2_Intron	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						cgcctgtaatcccagcacttt	0.075													4	2	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173597429	173597429	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173597429delT	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			tttctgtgtgttttttttttt	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186536033	186536033	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186536033delC								RFC4 (11549 upstream) : ADIPOQ (24430 downstream)																							AAAGATCAGGCCCCACCCAGA	0.582													4	2	---	---	---	---	
HTT	3064	broad.mit.edu	37	4	3182013	3182014	+	Intron	INS	-	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3182013_3182014insT	uc011bvq.1	+							NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin						establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GGAGCCCTAGGTTTTTTTTCTT	0.317													4	2	---	---	---	---	
EVC2	132884	broad.mit.edu	37	4	5652704	5652704	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5652704delT	uc003gij.2	-						EVC2_uc011bwb.1_Intron|EVC2_uc003gik.2_Intron	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin							integral to membrane				large_intestine(3)|ovary(2)	5						CTTGATATCATTTTTTACAGC	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13095881	13095881	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13095881delC								None (None upstream) : HSP90AB2P (239156 downstream)																							ttctggcctgcagacctgtga	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	42228517	42228517	+	IGR	DEL	T	-	-	rs112740181		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42228517delT								BEND4 (73622 upstream) : SHISA3 (171339 downstream)																							cttattctgcttttttttttt	0.000													8	4	---	---	---	---	
GUF1	60558	broad.mit.edu	37	4	44690231	44690232	+	Intron	DEL	TT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44690231_44690232delTT	uc003gww.3	+						GUF1_uc010ifz.1_Intron	NM_021927	NP_068746	Q8N442	GUF1_HUMAN	GUF1 GTPase homolog						translation	mitochondrial inner membrane	GTP binding|GTPase activity			upper_aerodigestive_tract(1)	1						GTCTCAGTGGTTAAGGAAAAAA	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	55784212	55784212	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55784212delG								KIT (177333 upstream) : KDR (160215 downstream)																							ccctggcagtggccagatgct	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	90061182	90061182	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90061182delC								TIGD2 (25132 upstream) : GPRIN3 (104247 downstream)																							ggaacttcttcattcatcttc	0.070													4	2	---	---	---	---	
MAML3	55534	broad.mit.edu	37	4	140748083	140748087	+	Intron	DEL	AAATA	-	-	rs10561252		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140748083_140748087delAAATA	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					ACTGCAAATGAAATAAAATAAGAAA	0.366													2	4	---	---	---	---	
INPP4B	8821	broad.mit.edu	37	4	143019821	143019821	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143019821delT	uc003iix.3	-						INPP4B_uc003iiw.3_Intron|INPP4B_uc011chm.1_Intron|INPP4B_uc011chn.1_Intron|INPP4B_uc011cho.1_Intron	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					agggtggctatttttttcccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	143804814	143804814	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143804814delG								INPP4B (37210 upstream) : USP38 (301256 downstream)																							GGAAGCTCATGGTGGGCATAA	0.403													4	2	---	---	---	---	
TRIM2	23321	broad.mit.edu	37	4	154087546	154087547	+	Intron	DEL	AC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154087546_154087547delAC	uc003ing.2	+							NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2							cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		ggtaattgggacaagacctttg	0.030													4	2	---	---	---	---	
MARCH1	55016	broad.mit.edu	37	4	164781397	164781397	+	Intron	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164781397delG	uc003iqs.1	-							NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				atatattattggagacacagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	180496094	180496094	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180496094delA								None (None upstream) : None (None downstream)																							ctgaaaggagaaaaaaaaaga	0.000													9	4	---	---	---	---	
SNX25	83891	broad.mit.edu	37	4	186215588	186215588	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186215588delA	uc003ixh.2	+						SNX25_uc010ish.2_5'Flank	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25						cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		agataatcataaagggttctC	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	12269988	12269988	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12269988delA								CTNND2 (365878 upstream) : None (None downstream)																							ATGGGCAAAGAAAGGCAATAA	0.383													4	2	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13902737	13902737	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13902737delC	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					ctcacttctaccactgcaatg	0.154									Kartagener_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	24364556	24364558	+	IGR	DEL	CCA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24364556_24364558delCCA								PRDM9 (835852 upstream) : CDH10 (122652 downstream)																							ccctctgcagccaccaccaccac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	38050443	38050444	+	IGR	DEL	CA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38050443_38050444delCA								GDNF (210661 upstream) : EGFLAM (208089 downstream)																							TATCAGGAGTCACCAGGTTTGA	0.327													4	2	---	---	---	---	
C7	730	broad.mit.edu	37	5	40962631	40962631	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40962631delT	uc003jmh.2	+						C7_uc011cpn.1_Intron	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor						complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				TGCCACTGACTTTTTTTTTTC	0.428													4	4	---	---	---	---	
PTCD2	79810	broad.mit.edu	37	5	71619866	71619866	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71619866delA	uc003kcb.2	+						PTCD2_uc011csf.1_Intron|PTCD2_uc003kcc.2_Intron|PTCD2_uc011csg.1_Intron|PTCD2_uc011csh.1_Intron|PTCD2_uc003kcd.2_Intron	NM_024754	NP_079030	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2												0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		TATAGGGGGCAAAAAAATAAA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90515956	90515956	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90515956delC								GPR98 (55924 upstream) : ARRDC3 (148585 downstream)																							GAGTAGAGTGCCCAGGAGGCA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	105893703	105893704	+	IGR	DEL	AC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105893703_105893704delAC								None (None upstream) : EFNA5 (818887 downstream)																							TCAACCCTTGacacacacacac	0.347													3	3	---	---	---	---	
TSLP	85480	broad.mit.edu	37	5	110407274	110407274	+	5'Flank	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110407274delT	uc003kpb.2	+						TSLP_uc003kpa.2_Intron|TSLP_uc010jbt.1_5'Flank	NM_033035	NP_149024	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin isoform 1							extracellular space	cytokine activity				0		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)		TAGCTACTCCTTTTTTTTTTT	0.368													5	4	---	---	---	---	
DCP2	167227	broad.mit.edu	37	5	112339399	112339399	+	Intron	DEL	A	-	-	rs35517643		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112339399delA	uc003kqh.2	+						DCP2_uc011cwa.1_Intron|DCP2_uc010jcc.2_Intron	NM_152624	NP_689837	Q8IU60	DCP2_HUMAN	DCP2 decapping enzyme						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus|RNA-induced silencing complex	exoribonuclease activity, producing 5'-phosphomonoesters|manganese ion binding|protein binding|protein binding|RNA binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)		GTCTAGGATGAAAAAAAATAG	0.164													2	5	---	---	---	---	
SNCAIP	9627	broad.mit.edu	37	5	121785922	121785923	+	Intron	DEL	AT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121785922_121785923delAT	uc003ksw.1	+						SNCAIP_uc011cwl.1_Intron|SNCAIP_uc003ksx.1_Intron|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|SNCAIP_uc011cwm.1_Intron|SNCAIP_uc003kta.1_Intron|SNCAIP_uc010jcv.1_Intron|SNCAIP_uc010jcw.1_Intron|SNCAIP_uc010jcx.1_Intron|uc003ktb.1_Intron|SNCAIP_uc003ktc.1_Intron	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein						cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		ggaataggagatatatatatat	0.015													4	2	---	---	---	---	
TRPC7	57113	broad.mit.edu	37	5	135610164	135610164	+	Intron	DEL	A	-	-	rs66630545		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135610164delA	uc003lbn.1	-						TRPC7_uc010jef.1_Intron|TRPC7_uc010jeg.1_Intron|TRPC7_uc010jeh.1_Intron|TRPC7_uc010jei.1_Intron|TRPC7_uc010jej.1_Intron	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,						axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCTCTCTTTGAAAAAAAAAAG	0.294													10	5	---	---	---	---	
HDAC3	8841	broad.mit.edu	37	5	141003203	141003203	+	Intron	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141003203delG	uc003llf.2	-						HDAC3_uc003lle.1_Intron	NM_003883	NP_003874	O15379	HDAC3_HUMAN	histone deacetylase 3						anti-apoptosis|cellular lipid metabolic process|negative regulation of cell cycle|negative regulation of JNK cascade|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|spindle assembly|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|spindle microtubule|transcriptional repressor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|transcription corepressor activity|transcription factor binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Vorinostat(DB02546)	AGAAGGGATCGGGGGATATCC	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	153817929	153817932	+	Intron	DEL	AAAG	-	-	rs71852531		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153817929_153817932delAAAG	uc003lvi.2	-											Homo sapiens cDNA FLJ38109 fis, clone D3OST2001788.																		aaTATgaaaaaaagaaagaaagaa	0.000													3	5	---	---	---	---	
DOCK2	1794	broad.mit.edu	37	5	169075926	169075926	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169075926delC	uc003maf.2	+						DOCK2_uc011der.1_Intron	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGACTAGCGCCCGCCCGGGT	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	169581147	169581147	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169581147delA								FOXI1 (44419 upstream) : C5orf58 (78803 downstream)																							agttccttttaaaaaaagatt	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	171274775	171274776	+	IGR	DEL	AA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171274775_171274776delAA								FGF18 (390613 upstream) : FBXW11 (13780 downstream)																							GCCATGCTGTAAAAGATTCCAG	0.262													4	2	---	---	---	---	
AACSL	729522	broad.mit.edu	37	5	178226662	178226664	+	Intron	DEL	AGA	-	-	rs56260612		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178226662_178226664delAGA	uc011dgl.1	-						AACSL_uc003mjk.2_Intron					Homo sapiens acetoacetyl-CoA synthetase-like, mRNA (cDNA clone IMAGE:3945810), partial cds.												0						agatccaaggagaaggacgcgtc	0.123													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	178510272	178510273	+	IGR	DEL	AT	-	-	rs147516432		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178510272_178510273delAT								ZNF354C (2583 upstream) : ADAMTS2 (30578 downstream)																							tgggtagtagataatgtggtat	0.000													5	8	---	---	---	---	
GFPT2	9945	broad.mit.edu	37	5	179774683	179774684	+	Intron	DEL	TC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179774683_179774684delTC	uc003mlw.1	-							NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	AGCTCAGGGTTCAACCCCCAAG	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	1176926	1176928	+	IGR	DEL	GCT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1176926_1176928delGCT								LOC285768 (75359 upstream) : FOXQ1 (135747 downstream)																							CCTCCCTTCAGCTGCTGCAGCCC	0.571													4	2	---	---	---	---	
FARS2	10667	broad.mit.edu	37	6	5500969	5500969	+	Intron	DEL	T	-	-	rs112735671		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5500969delT	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558	O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	CTACCTTACATTTTTTTTTTT	0.294													4	4	---	---	---	---	
FARS2	10667	broad.mit.edu	37	6	5563321	5563321	+	Intron	DEL	A	-	-	rs149319323		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5563321delA	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558	O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	agacagagggaggggggctcc	0.010													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14807126	14807126	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14807126delA								CD83 (669980 upstream) : JARID2 (438608 downstream)																							ATGGGCAAGTAAAAAAATGTC	0.433													6	4	---	---	---	---	
MYLIP	29116	broad.mit.edu	37	6	16134253	16134254	+	Intron	DEL	CT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16134253_16134254delCT	uc003nbq.2	+						MYLIP_uc003nbr.2_Intron	NM_013262	NP_037394	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting						cellular component movement|nervous system development	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|ubiquitin-protein ligase activity|zinc ion binding			pancreas(1)	1	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			cagccccatcctcagccctcag	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	19294392	19294392	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19294392delG								MIR548A1 (722281 upstream) : ID4 (543225 downstream)																							TAAGCATACTGGGTAGTCGAG	0.527													4	2	---	---	---	---	
PPARD	5467	broad.mit.edu	37	6	35356065	35356066	+	Intron	DEL	GC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35356065_35356066delGC	uc003okm.2	+						PPARD_uc003okl.2_Intron|PPARD_uc003okn.2_Intron|PPARD_uc011dtb.1_Intron|PPARD_uc011dtc.1_Intron|uc011dtd.1_5'Flank	NM_006238	NP_006229	Q03181	PPARD_HUMAN	peroxisome proliferative activated receptor,						apoptosis|axon ensheathment|cholesterol metabolic process|decidualization|embryo implantation|fatty acid beta-oxidation|fatty acid transport|generation of precursor metabolites and energy|glucose metabolic process|glucose transport|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fat cell differentiation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|linoleic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1					Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	CTGTAGATGTGCACACATATCC	0.550													4	2	---	---	---	---	
TAF8	129685	broad.mit.edu	37	6	42046086	42046087	+	3'UTR	DEL	TG	-	-	rs3839620		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42046086_42046087delTG	uc003ors.2	+	9					TAF8_uc003ort.2_3'UTR|TAF8_uc003oru.1_Intron|TAF8_uc003orv.1_Intron|TAF8_uc011dun.1_3'UTR	NM_138572	NP_612639	Q7Z7C8	TAF8_HUMAN	TBP-associated factor 8						cell differentiation|maintenance of protein location in nucleus|positive regulation of transcription, DNA-dependent|regulation of fat cell differentiation|transcription, DNA-dependent	perinuclear region of cytoplasm|transcription factor TFIID complex	DNA binding|protein binding			ovary(1)	1	Colorectal(47;0.196)		STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00179)			CAAGGAAGACTGTTTGTCCAGC	0.416													4	2	---	---	---	---	
LIN28B	389421	broad.mit.edu	37	6	105519964	105519965	+	Intron	DEL	TG	-	-	rs113521265		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105519964_105519965delTG	uc003pqv.1	+						LIN28B_uc010kda.1_Intron	NM_001004317	NP_001004317	Q6ZN17	LN28B_HUMAN	lin-28 homolog B						miRNA catabolic process|pre-miRNA processing|regulation of transcription, DNA-dependent|RNA 3'-end processing	cytoplasm|nucleus	DNA binding|protein binding|RNA binding|zinc ion binding				0		all_cancers(87;0.00346)|Acute lymphoblastic leukemia(125;2.26e-08)|all_hematologic(75;2.79e-06)|all_epithelial(87;0.204)				CTTTtgtgtctgtgtgtgtgtg	0.272													5	4	---	---	---	---	
C6orf186	728464	broad.mit.edu	37	6	110589872	110589872	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110589872delA	uc010kdu.1	-						C6orf186_uc003pub.2_Intron	NM_001123364	NP_001116836	Q5JXM2	CF186_HUMAN	chromosome 6 open reading frame 186 precursor							extracellular region					0						ACTTTTTTTTAGAGTAATGAC	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	125756420	125756420	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125756420delA								HDDC2 (133138 upstream) : HEY2 (312360 downstream)																							ATGAAAAAGGAAAAAAGGATG	0.408													4	2	---	---	---	---	
ECT2L	345930	broad.mit.edu	37	6	139210469	139210469	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139210469delT	uc003qif.1	+						ECT2L_uc011edq.1_Intron	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						tttctttttcttttttttttt	0.184													3	3	---	---	---	---	
SLC22A1	6580	broad.mit.edu	37	6	160554761	160554762	+	Intron	DEL	CG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160554761_160554762delCG	uc003qtc.2	+						SLC22A1_uc003qtd.2_Intron	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a							basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		TTGATGGGTCCGGGGCCCCAGA	0.644													3	7	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	162789553	162789562	+	Intron	DEL	GGCCCTCCTA	-	-	rs67278344		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162789553_162789562delGGCCCTCCTA	uc003qtx.3	-						PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		TTCTTTCTGTGGCCCTCCTAGGCTTGTCAC	0.471													3	3	---	---	---	---	
UNC93A	54346	broad.mit.edu	37	6	167707852	167707852	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167707852delA	uc003qvq.2	+						UNC93A_uc003qvr.2_Intron	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1							integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TTCTCCCACCAGCTTCAGAGG	0.622													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	170249490	170249490	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170249490delC								C6orf208 (46521 upstream) : LOC154449 (313932 downstream)																							TTTCATTCCTCCTTCTCTTCT	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	136986	136986	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136986delA								None (None upstream) : FAM20C (55983 downstream)																							ggtccactttaaaaaatatga	0.000													4	2	---	---	---	---	
PRKAR1B	5575	broad.mit.edu	37	7	625567	625567	+	Intron	DEL	C	-	-	rs71016881		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:625567delC	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron|PRKAR1B_uc003six.1_Intron	NM_002735	NP_002726	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		CAGAAAACCACAGTGAGCAGC	0.522													4	2	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	4256043	4256043	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4256043delC	uc003smx.2	+						SDK1_uc010kso.2_Intron|SDK1_uc003smy.2_Intron	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CTCCCCGAGGCCCCTAGGAGA	0.627													4	2	---	---	---	---	
C1GALT1	56913	broad.mit.edu	37	7	7227638	7227639	+	Intron	INS	-	TC	TC			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7227638_7227639insTC	uc010ktn.2	+						C1GALT1_uc010ktm.1_Intron	NM_020156	NP_064541	Q9NS00	C1GLT_HUMAN	core 1 synthase,						angiogenesis|cell differentiation|kidney development	integral to membrane	glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase activity|metal ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)		tcattctggtgacggggtatga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	17235458	17235458	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17235458delG								AGR3 (313845 upstream) : AHR (102818 downstream)																							AATACTTTATGGCAGGCTGCA	0.423													4	2	---	---	---	---	
AHR	196	broad.mit.edu	37	7	17379998	17379998	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17379998delT	uc011jxz.1	+						AHR_uc003stt.3_Intron	NM_001621	NP_001612	P35869	AHR_HUMAN	aryl hydrocarbon receptor precursor						apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			urinary_tract(1)|kidney(1)|pancreas(1)	3	Lung NSC(10;0.0392)|all_lung(11;0.0754)					TGTGACTACCTTTTTTTTTTT	0.313													6	4	---	---	---	---	
CREB5	9586	broad.mit.edu	37	7	28726098	28726098	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28726098delA	uc003szq.2	+						CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Intron|CREB5_uc003szs.2_Intron|CREB5_uc011jzr.1_Intron	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						AGGAAAaaagaaaaaaaaaaa	0.353													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	41904763	41904763	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41904763delA								LOC285954 (85789 upstream) : GLI3 (95787 downstream)																							ggtggcgcccaaaaaattcat	0.000													4	2	---	---	---	---	
TNS3	64759	broad.mit.edu	37	7	47536287	47536287	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47536287delC	uc003tnv.2	-						TNS3_uc003tnw.2_Intron|TNS3_uc010kyo.1_Intron	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3							focal adhesion	protein binding			ovary(4)	4						GTGAGAGAGGCGGAGGGCTGG	0.592													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56804206	56804207	+	IGR	INS	-	TCTTCCTC	TCTTCCTC			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56804206_56804207insTCTTCCTC								DKFZp434L192 (239229 upstream) : ZNF479 (383121 downstream)																							TGAAAGCCTTATCTTCCTCGTC	0.535													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64728451	64728451	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64728451delA								INTS4L1 (33852 upstream) : ZNF92 (110317 downstream)																							TGAAGAGGTTAAAAAAAAAAA	0.507													18	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65976420	65976420	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65976420delA								NCRNA00174 (111025 upstream) : LOC493754 (17026 downstream)																							catctcgaacaaaaaaaaaaa	0.244													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67035098	67035098	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67035098delC								STAG3L4 (248586 upstream) : None (None downstream)																							acagtttggacccccaaggac	0.040													4	2	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	69995693	69995693	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69995693delA	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		TACCACTAGCAAAAGGGATGT	0.527													4	2	---	---	---	---	
RFC2	5982	broad.mit.edu	37	7	73650153	73650153	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73650153delT	uc003uaj.2	-						RFC2_uc011kfa.1_Intron|RFC2_uc003uak.2_Intron|RFC2_uc010lbp.2_Intron|RFC2_uc003ual.2_Intron	NM_181471	NP_852136	P35250	RFC2_HUMAN	replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2						TGCTTAAATAtttttttttca	0.209													6	3	---	---	---	---	
TECPR1	25851	broad.mit.edu	37	7	97877845	97877846	+	Intron	INS	-	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97877845_97877846insA	uc003upg.2	-						TECPR1_uc003uph.1_Intron	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1							integral to membrane	protein binding			pancreas(1)	1						CTGCCACCGGCaaaaaaaaaaa	0.307													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98865458	98865458	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98865458delC								KPNA7 (60369 upstream) : MYH16 (5466 downstream)																							ACAAACTGCACCCCAACATGA	0.592													4	2	---	---	---	---	
LHFPL3	375612	broad.mit.edu	37	7	104415096	104415096	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104415096delC	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3							integral to membrane					0						CAGTGTTTTTCTAGAACTTGG	0.328													4	2	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105467837	105467838	+	Intron	DEL	TT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105467837_105467838delTT	uc003vde.2	-						ATXN7L1_uc003vdi.2_Intron	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						CTTTTATGTCTTTAGGAGaata	0.158													4	2	---	---	---	---	
DGKI	9162	broad.mit.edu	37	7	137530046	137530046	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137530046delC	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						CACACACCTGCCCCCATAAAT	0.483													4	2	---	---	---	---	
UBN2	254048	broad.mit.edu	37	7	138927628	138927628	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138927628delA	uc011kqr.1	+							NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2											ovary(1)|skin(1)	2						TAGGTTGAAGAAATGGGCACA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141654898	141654899	+	IGR	DEL	CA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141654898_141654899delCA								CLEC5A (8115 upstream) : TAS2R38 (17532 downstream)																							ctgacttggccacacaggagaa	0.050													4	2	---	---	---	---	
ZNF282	8427	broad.mit.edu	37	7	148904293	148904294	+	Intron	INS	-	AAGGTTCTTCATAAG	AAGGTTCTTCATAAG	rs147860582	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148904293_148904294insAAGGTTCTTCATAAG	uc003wfm.2	+						ZNF282_uc011kun.1_Intron|ZNF282_uc003wfn.2_Intron|ZNF282_uc003wfo.2_Intron	NM_003575	NP_003566	Q9UDV7	ZN282_HUMAN	zinc finger protein 282						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		GACTCGTTTTCAGATTACCCGC	0.545													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148964887	148964887	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148964887delA	uc003wfr.3	+											Homo sapiens cDNA FLJ36716 fis, clone UTERU2010651.																		gacttcatctaaaaaaaaaaa	0.244													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	149112764	149112765	+	IGR	INS	-	GT	GT	rs139899271	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149112764_149112765insGT								ZNF212 (160083 upstream) : ZNF777 (15696 downstream)																							GTGAAGAAAAGGTAGGCCATTT	0.460													6	3	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	154432177	154432178	+	Intron	INS	-	GT	GT	rs33983542		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154432177_154432178insGT	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CTGAACACAGCGCCCCTGAAGC	0.441													2	7	---	---	---	---	
ESYT2	57488	broad.mit.edu	37	7	158572383	158572389	+	Intron	DEL	TCCAATC	-	-	rs115287216	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158572383_158572389delTCCAATC	uc003wob.1	-						ESYT2_uc003woc.1_Intron|ESYT2_uc003wod.1_Intron	NM_020728	NP_065779	A0FGR8	ESYT2_HUMAN	family with sequence similarity 62 (C2 domain							integral to membrane|plasma membrane				central_nervous_system(2)|kidney(1)	3						CTCTAAACCGTCCAATCTGCTCCTGTC	0.498													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2478132	2478132	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2478132delA	uc003wqa.2	-											Homo sapiens cDNA clone IMAGE:4830065.																		cttctgagggagggggccttg	0.000													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	2982879	2982880	+	Intron	DEL	AG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2982879_2982880delAG	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ATCTGCTGTCAGAACCCTCATC	0.470													4	2	---	---	---	---	
MCPH1	79648	broad.mit.edu	37	8	6331986	6331986	+	Intron	DEL	A	-	-	rs35687711		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6331986delA	uc003wqi.2	+							NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		TGCTGTCTCCAAAAAAAAAat	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	7272108	7272108	+	IGR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7272108delT								LOC349196 (59234 upstream) : DEFB103B (14383 downstream)																							TTGGGCTTGCTTTTTTTAGGG	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	9764823	9764824	+	IGR	DEL	GA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9764823_9764824delGA								MIR124-1 (3841 upstream) : MSRA (147006 downstream)																							gggagagagggagagagagaga	0.450													4	2	---	---	---	---	
GSR	2936	broad.mit.edu	37	8	30536794	30536794	+	3'UTR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30536794delA	uc003xih.1	-	13						NM_000637	NP_000628	P00390	GSHR_HUMAN	glutathione reductase precursor						cell redox homeostasis|nucleobase, nucleoside and nucleotide interconversion	cytosol|mitochondrion	electron carrier activity|glutathione-disulfide reductase activity			ovary(2)|pancreas(2)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Glutathione(DB00143)|NADH(DB00157)	AGCTGTTAATAAAAAAAAAAC	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	47928562	47928564	+	IGR	DEL	CTT	-	-	rs75353303	byFrequency	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47928562_47928564delCTT								BEYLA (161155 upstream) : KIAA0146 (244978 downstream)																							TTATAGACTCCTTCTGCGGCTCA	0.320													6	8	---	---	---	---	
PRKDC	5591	broad.mit.edu	37	8	48709150	48709150	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48709150delT	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				TTTTTCTTCAttttttttttt	0.179								NHEJ					10	6	---	---	---	---	
PRKDC	5591	broad.mit.edu	37	8	48745007	48745007	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48745007delA	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				agcaacaaggaaagagcaact	0.000								NHEJ					4	2	---	---	---	---	
ST18	9705	broad.mit.edu	37	8	53062819	53062820	+	Intron	DEL	TG	-	-	rs111351277		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53062819_53062820delTG	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron|ST18_uc003xrb.2_Intron	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TTTATGAAAAtgtgtgtgtgtg	0.218													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58070947	58070948	+	IGR	DEL	TT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58070947_58070948delTT								IMPAD1 (164520 upstream) : C8orf71 (121154 downstream)																							gtgaggtagcttagtgggcagt	0.000													4	2	---	---	---	---	
TRPA1	8989	broad.mit.edu	37	8	72963342	72963342	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72963342delA	uc003xza.2	-						uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1							integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	TGGCTATTATAATCATTGTTC	0.373													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	74268842	74268844	+	5'Flank	DEL	CCT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74268842_74268844delCCT	uc003xzk.1	-											Homo sapiens cDNA FLJ46349 fis, clone TESTI4047746.																		CGCCCAGCCCCCTCCTCCTCCCT	0.621													4	2	---	---	---	---	
HNF4G	3174	broad.mit.edu	37	8	76468139	76468140	+	Intron	INS	-	T	T	rs2941468	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76468139_76468140insT	uc003yaq.2	+						HNF4G_uc003yar.2_Intron	NM_004133	NP_004124	Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma						endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			AAAGAACACTCTAAGTTAACAA	0.307													17	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	77114286	77114286	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77114286delG								HNF4G (635227 upstream) : LOC100192378 (408829 downstream)																							CAATGGCCGTGGTATCCTGAC	0.463													4	2	---	---	---	---	
MRPS28	28957	broad.mit.edu	37	8	80924362	80924363	+	Intron	INS	-	ATT	ATT	rs141030753	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80924362_80924363insATT	uc003ybp.2	-						MRPS28_uc003ybo.2_Intron|TPD52_uc010lzr.2_Intron	NM_014018	NP_054737	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S28							mitochondrial small ribosomal subunit					0	Lung NSC(7;1.86e-06)|all_lung(9;6.91e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00769)|Epithelial(68;0.0208)|all cancers(69;0.0805)			ATTTCTCCTCCATTTTTTGCCT	0.292													4	6	---	---	---	---	
CA2	760	broad.mit.edu	37	8	86392675	86392675	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86392675delT	uc003ydk.2	+							NM_000067	NP_000058	P00918	CAH2_HUMAN	carbonic anhydrase II						one-carbon metabolic process	apical part of cell	carbonate dehydratase activity|zinc ion binding			central_nervous_system(1)	1					Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)	tgtgtgtgtgttttttttttt	0.000													4	3	---	---	---	---	
SLC26A7	115111	broad.mit.edu	37	8	92330853	92330853	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92330853delA	uc003yex.2	+						SLC26A7_uc003yey.2_Intron|SLC26A7_uc003yez.2_Intron|SLC26A7_uc003yfa.2_Intron	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a							basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			GCATAATTAGAAAAAAAAAAC	0.348													5	3	---	---	---	---	
FAM92A1	137392	broad.mit.edu	37	8	94713911	94713912	+	Intron	INS	-	C	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94713911_94713912insC	uc010maq.2	+						FAM92A1_uc003yfu.1_RNA|FAM92A1_uc003yfv.3_Intron	NM_145269	NP_660312	A1XBS5	F92A1_HUMAN	hypothetical protein LOC137392												0	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			GTCTTGAATTTCCCCACTTTAT	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96751476	96751477	+	IGR	INS	-	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96751476_96751477insA								C8orf37 (470039 upstream) : GDF6 (403083 downstream)																							gtagcgtggagaaaaaaaaatg	0.000													4	2	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110375064	110375065	+	Intron	INS	-	AG	AG			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110375064_110375065insAG	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			gagacagacgcagagagagaga	0.416										HNSCC(38;0.096)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	125937593	125937593	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125937593delG								MTSS1 (196863 upstream) : LOC157381 (14291 downstream)																							caagtggcctgggttacactc	0.179													4	2	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131174564	131174564	+	Intron	DEL	T	-	-	rs11327491		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131174564delT	uc003yta.1	-						ASAP1_uc003ysz.1_Intron|ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						TTTGTTGTTGTTTTTTTAAGA	0.423													4	3	---	---	---	---	
PTPLAD2	401494	broad.mit.edu	37	9	21029067	21029067	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21029067delT	uc010miq.1	-						PTPLAD2_uc003zoj.1_Intron|PTPLAD2_uc010mir.1_Intron	NM_001010915	NP_001010915	Q5VWC8	HACD4_HUMAN	protein tyrosine phosphatase-like A domain						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	lyase activity			skin(1)	1				Lung(24;6.02e-14)|LUSC - Lung squamous cell carcinoma(38;1.29e-10)		CATCCATCTCTTTTTTGAGGC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	35010935	35010935	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35010935delA								DNAJB5 (12507 upstream) : C9orf131 (30167 downstream)																							GAAGAAGGAGAAAAAAAAAAG	0.363													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	36785805	36785805	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36785805delC								MELK (108127 upstream) : PAX5 (52726 downstream)																							CACTAACCATCCCAGGAGTCC	0.463													4	2	---	---	---	---	
ZNF658	26149	broad.mit.edu	37	9	40784385	40784385	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40784385delC	uc004abs.2	-						ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Intron	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TAATCCAAAGCCCTTTAATCT	0.358													35	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	71171968	71171968	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71171968delG								C9orf71 (16185 upstream) : PIP5K1B (148648 downstream)																							ctggaaccctgggagtcattc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	72553070	72553070	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72553070delC								C9orf135 (31923 upstream) : MAMDC2 (105427 downstream)																							tgcaacactgcccccaaacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	87235050	87235050	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87235050delG								SLC28A3 (251637 upstream) : NTRK2 (48416 downstream)																							GTTCCATCTCGTTAGGTAAAG	0.443													4	2	---	---	---	---	
SHC3	53358	broad.mit.edu	37	9	91693536	91693536	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91693536delC	uc004aqg.2	-							NM_016848	NP_058544	Q92529	SHC3_HUMAN	src homology 2 domain-containing transforming						central nervous system development|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	protein binding|signal transducer activity			lung(3)|skin(1)	4						GGCAGGAGGACCCCAGAGGGT	0.617													4	2	---	---	---	---	
CENPP	401541	broad.mit.edu	37	9	95111153	95111154	+	Intron	DEL	GG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95111153_95111154delGG	uc004arz.2	+						CENPP_uc010mqx.2_Intron|CENPP_uc004ary.1_Intron	NM_001012267	NP_001012267	Q6IPU0	CENPP_HUMAN	centromere protein P						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	chromosome, centromeric region|cytosol|nucleoplasm				ovary(2)	2						ttcataatctggattgcatagg	0.000													4	2	---	---	---	---	
COL15A1	1306	broad.mit.edu	37	9	101767869	101767870	+	Intron	DEL	TC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101767869_101767870delTC	uc004azb.1	+							NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor						angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				actcctcctttccactcctcct	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	111424618	111424618	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111424618delA								None (None upstream) : ACTL7B (192253 downstream)																							CAAAAACAGGAACTCCCAAGA	0.448													4	2	---	---	---	---	
RBM18	92400	broad.mit.edu	37	9	125021568	125021569	+	Intron	DEL	TT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125021568_125021569delTT	uc004bma.2	-						RBM18_uc004blz.2_Intron|RBM18_uc010mvy.2_Intron|RBM18_uc011lyp.1_Intron	NM_033117	NP_149108	Q96H35	RBM18_HUMAN	RNA binding motif protein 18								nucleotide binding|RNA binding				0						GTTTCCACACTTTAGATTTCCA	0.436													4	2	---	---	---	---	
NR6A1	2649	broad.mit.edu	37	9	127366053	127366053	+	Intron	DEL	A	-	-	rs79472957		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127366053delA	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						GGAAAGGGGGAAAAAAAACCT	0.338													4	2	---	---	---	---	
RALGPS1	9649	broad.mit.edu	37	9	129962219	129962220	+	Intron	DEL	AT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129962219_129962220delAT	uc004bqo.1	+						RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron	NM_014636	NP_055451	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1						atatacacacatgccctacaca	0.238													4	3	---	---	---	---	
RALGPS1	9649	broad.mit.edu	37	9	129962223	129962225	+	Intron	DEL	CCT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129962223_129962225delCCT	uc004bqo.1	+						RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron	NM_014636	NP_055451	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1						acacacatgccctacacacacat	0.222													4	3	---	---	---	---	
NCS1	23413	broad.mit.edu	37	9	132985664	132985664	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132985664delT	uc004bzi.2	+						NCS1_uc010myz.1_Intron	NM_014286	NP_055101	P62166	NCS1_HUMAN	frequenin homolog isoform 1						negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding				0						gtccttagccttttttttttg	0.214													3	3	---	---	---	---	
CACNA1B	774	broad.mit.edu	37	9	140863861	140863862	+	Intron	DEL	TG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140863861_140863862delTG	uc004cog.2	+						CACNA1B_uc011mfd.1_Intron	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,						membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	CACAGGAAGATGTGTGTGTGTG	0.530													6	3	---	---	---	---	
WDR37	22884	broad.mit.edu	37	10	1140966	1140966	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1140966delA	uc001igf.1	+						WDR37_uc001ige.2_Intron|WDR37_uc009xhm.1_Intron|WDR37_uc009xhn.1_Intron|WDR37_uc001igg.1_Intron	NM_014023	NP_054742	Q9Y2I8	WDR37_HUMAN	WD repeat domain 37												0		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		GGGAAACATGAGGTAATGGGT	0.493													4	2	---	---	---	---	
PFKP	5214	broad.mit.edu	37	10	3161275	3161276	+	Intron	INS	-	AACTT	AACTT			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3161275_3161276insAACTT	uc001igp.2	+						PFKP_uc001igq.2_Intron|PFKP_uc009xhr.2_Intron|PFKP_uc009xhs.1_Intron|PFKP_uc009xht.2_Intron|PFKP_uc009xhu.2_Intron	NM_002627	NP_002618	Q01813	K6PP_HUMAN	phosphofructokinase, platelet						glycolysis	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|metal ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		AACCGAGAAGCAAAAGCTTGAC	0.495													7	5	---	---	---	---	
TAF3	83860	broad.mit.edu	37	10	7940778	7940778	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7940778delT	uc010qbd.1	+							NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140						maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1						tttctttgagttttttttttc	0.030													4	2	---	---	---	---	
C10orf140	387640	broad.mit.edu	37	10	21805466	21805467	+	In_Frame_Ins	INS	-	CCTCCT	CCTCCT	rs138084841	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21805466_21805467insCCTCCT	uc009xkd.2	-	4	3538_3539	c.1285_1286insAGGAGG	c.(1285-1287)GGG>GAGGAGGGG	p.428_429insEE	uc001iqp.1_RNA	NM_207371	NP_997254	Q1XH10	DLN1_HUMAN	hypothetical protein LOC387640	347_348	Ser-rich.|Glu-rich.					nucleus	nucleotide binding			ovary(1)	1						CCCGCTGCccccctcctcctcc	0.441													6	3	---	---	---	---	
MLLT10	8028	broad.mit.edu	37	10	21834173	21834173	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21834173delT	uc001iqs.2	+						MLLT10_uc001iqt.2_Intron|MLLT10_uc001iqv.2_Intron|MLLT10_uc001iqy.2_Intron|MLLT10_uc001iqr.1_Intron|MLLT10_uc001iqq.1_Intron|MLLT10_uc001iqu.1_Intron|MLLT10_uc009xke.1_Intron|MLLT10_uc001iqw.1_Intron|MLLT10_uc001iqx.1_Intron|MLLT10_uc009xkf.1_Intron	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						ACCACATGCCTTTTTTTTTTT	0.333			T	MLL|PICALM|CDK6	AL								4	4	---	---	---	---	
DRGX	644168	broad.mit.edu	37	10	50582317	50582317	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50582317delC	uc010qgq.1	-							NM_001080520	NP_001073989	A6NNA5	DRGX_HUMAN	dorsal root ganglia homeobox						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						AGTGAAGACTCCAAGATGACT	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	50776210	50776212	+	IGR	DEL	CAC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50776210_50776212delCAC								PGBD3 (28626 upstream) : CHAT (40929 downstream)																							gcagttttctcaccctgtttcct	0.000													4	2	---	---	---	---	
PARG	8505	broad.mit.edu	37	10	51579522	51579541	+	Intron	DEL	TTAGATTACTAACTACTTAG	-	-	rs71987198		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51579522_51579541delTTAGATTACTAACTACTTAG	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|NCOA4_uc009xon.2_Intron|NCOA4_uc010qhd.1_Intron|NCOA4_uc001jis.3_Intron|NCOA4_uc010qhe.1_Intron|NCOA4_uc010qhf.1_Intron|NCOA4_uc001jit.2_Intron|NCOA4_uc009xoo.2_Intron	NM_003631	NP_003622	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)		TTCAGCTTACTTAGATTACTAACTACTTAGATTTTTGATT	0.409													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	54859693	54859694	+	IGR	DEL	GT	-	-	rs60398527	byFrequency	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54859693_54859694delGT								MBL2 (328233 upstream) : PCDH15 (702841 downstream)																							TGCCTCTGTGGTGAAGATTGCT	0.297													4	2	---	---	---	---	
JMJD1C	221037	broad.mit.edu	37	10	65182730	65182730	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65182730delT	uc001jmn.2	-						JMJD1C_uc001jmr.1_Intron	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a						blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					tttttttttcttttttttttt	0.000													5	3	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	78957649	78957650	+	Intron	DEL	CA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78957649_78957650delCA	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	GAAAAATGTTCAAACCACTCTA	0.515													4	2	---	---	---	---	
BTAF1	9044	broad.mit.edu	37	10	93713258	93713258	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93713258delA	uc001khr.2	+						BTAF1_uc009xua.1_Intron	NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription						negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				AATGTAGCATAAAAAAAGTTA	0.289													4	2	---	---	---	---	
MYOF	26509	broad.mit.edu	37	10	95147789	95147789	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95147789delA	uc001kin.2	-						MYOF_uc001kio.2_Intron	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						CTAACCTTCGAAATGAATCAG	0.458													40	18	---	---	---	---	
TM9SF3	56889	broad.mit.edu	37	10	98320595	98320595	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98320595delA	uc001kmm.3	-						TM9SF3_uc010qot.1_Intron	NM_020123	NP_064508	Q9HD45	TM9S3_HUMAN	transmembrane 9 superfamily member 3 precursor							integral to membrane	binding				0		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)		CAAAAACAGGAAAAAAAATTC	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	119433541	119433542	+	IGR	DEL	TG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119433541_119433542delTG								EMX2 (124485 upstream) : RAB11FIP2 (330887 downstream)																							tgtgtgcatatgtgtgtgtgtg	0.391													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	122835895	122835895	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122835895delG								WDR11 (166860 upstream) : FGFR2 (401950 downstream)																							CTGATCTTATGGGGCCTCAGA	0.522													4	2	---	---	---	---	
MMP21	118856	broad.mit.edu	37	10	127458552	127458552	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127458552delA	uc001liu.2	-							NM_147191	NP_671724	Q8N119	MMP21_HUMAN	matrix metalloproteinase 21 preproprotein						proteolysis	extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ccccatctctaaaaaaaaaaa	0.000													4	2	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128782290	128782291	+	Intron	DEL	TA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128782290_128782291delTA	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		ATCCTCTTCTTATTATGCTGAC	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130527774	130527775	+	IGR	DEL	CG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130527774_130527775delCG								MKI67 (603306 upstream) : MGMT (737679 downstream)																							AAAAGGGAGCCGTGAAAGACAG	0.500													4	2	---	---	---	---	
KNDC1	85442	broad.mit.edu	37	10	135039707	135039707	+	3'UTR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135039707delT	uc001llz.1	+	30						NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TGCAGTTCACTTTTTTTTAGG	0.453													6	3	---	---	---	---	
OSBPL5	114879	broad.mit.edu	37	11	3152576	3152587	+	Intron	DEL	CATCCATCCATC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3152576_3152587delCATCCATCCATC	uc001lxk.2	-						OSBPL5_uc009ydw.2_Intron|OSBPL5_uc001lxl.2_Intron|OSBPL5_uc009ydx.2_Intron|OSBPL5_uc001lxm.1_5'Flank	NM_020896	NP_065947	Q9H0X9	OSBL5_HUMAN	oxysterol-binding protein-like protein 5 isoform						cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		CCCTTCCAGGcatccatccatccatccatcca	0.231													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	4354327	4354327	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4354327delG								RRM1 (130568 upstream) : OR52B4 (34256 downstream)																							aattggagaagaagtgagagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	7877367	7877367	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7877367delA	uc001mfs.1	-											Homo sapiens cDNA FLJ34536 fis, clone HLUNG2008384.																		GTAGGAGGAGAGAAAAGGGGG	0.507													4	2	---	---	---	---	
ST5	6764	broad.mit.edu	37	11	8790787	8790787	+	Intron	DEL	T	-	-	rs72137614		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8790787delT	uc001mgt.2	-						ST5_uc009yfr.2_Intron|ST5_uc001mgu.2_Intron|ST5_uc001mgv.2_Intron|ST5_uc010rbq.1_5'Flank|ST5_uc001mgw.1_Intron	NM_213618	NP_998783	P78524	ST5_HUMAN	suppression of tumorigenicity 5 isoform 1						positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		AAGCAACttcttttttttttt	0.239													4	3	---	---	---	---	
NRIP3	56675	broad.mit.edu	37	11	9007034	9007035	+	Intron	INS	-	CCT	CCT	rs72555867		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9007034_9007035insCCT	uc001mhg.2	-						NRIP3_uc010rbu.1_Intron	NM_020645	NP_065696	Q9NQ35	NRIP3_HUMAN	nuclear receptor interacting protein 3						proteolysis		aspartic-type endopeptidase activity				0				Epithelial(150;4.77e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0241)		TTTTTATCTGACCACATTTGTT	0.213													5	4	---	---	---	---	
C11orf41	25758	broad.mit.edu	37	11	33619581	33619581	+	Intron	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33619581delG	uc001mup.3	+						C11orf41_uc001mun.1_Intron	NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758							integral to membrane				ovary(2)	2						GGGAGCTCTTGGGGGGCATGG	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	33806439	33806442	+	IGR	DEL	TTTT	-	-	rs71741225		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33806439_33806442delTTTT								FBXO3 (10368 upstream) : LMO2 (73683 downstream)																							TATCACTCAGTTTTTTTTTTTTTT	0.235													6	4	---	---	---	---	
PRR5L	79899	broad.mit.edu	37	11	36447369	36447369	+	Intron	DEL	A	-	-	rs2292648	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36447369delA	uc001mwo.3	+						PRR5L_uc001mwp.2_Intron|PRR5L_uc009ykk.2_Intron|PRR5L_uc010rfc.1_Intron	NM_001160167	NP_001153639	Q6MZQ0	PRR5L_HUMAN	protor-2 isoform a											ovary(1)	1						GTCATAGAGGAAAAAAAAAAA	0.418													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	44285841	44285841	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44285841delG								EXT2 (18862 upstream) : ALX4 (318 downstream)																							GTCACTGTTCGGGGGGAGGTG	0.632													4	2	---	---	---	---	
DDB2	1643	broad.mit.edu	37	11	47259955	47259955	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47259955delT	uc001neb.2	+						DDB2_uc001nec.2_Intron|DDB2_uc009yli.1_Intron|DDB2_uc001ned.2_Intron|DDB2_uc001nee.2_Intron|DDB2_uc001nef.2_Intron|DDB2_uc001neg.2_Intron|DDB2_uc001neh.2_Intron	NM_000107	NP_000098	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2						nucleotide-excision repair, DNA damage removal|protein autoubiquitination|protein polyubiquitination|response to UV	nucleoplasm|protein complex	damaged DNA binding|protein binding			kidney(2)|ovary(1)	3						CTAGTAtttcttttttttttt	0.249			Mis|N			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				4	3	---	---	---	---	
STIP1	10963	broad.mit.edu	37	11	63971881	63971881	+	3'UTR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63971881delT	uc001nyk.1	+	14					STIP1_uc010rnb.1_3'UTR|FERMT3_uc001nyl.2_5'Flank|FERMT3_uc001nym.2_5'Flank	NM_006819	NP_006810	P31948	STIP1_HUMAN	stress-induced-phosphoprotein 1						axon guidance|response to stress	Golgi apparatus|nucleus				ovary(2)|liver(1)	3						CCATAGTTGGTTTTTTTTTTA	0.562											OREG0021047	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
INTS4	92105	broad.mit.edu	37	11	77690367	77690367	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77690367delA	uc001oys.2	-						INTS4_uc001oyt.2_Intron|INTS4_uc001oyu.1_Intron|INTS4_uc001oyv.1_Intron	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			aataaatctgaaaaaatgagt	0.000													4	2	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	84351011	84351011	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84351011delA	uc001paj.2	-						DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc001pal.1_Intron	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TTTTTGCTTCACTCTTTGCCA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115017733	115017734	+	IGR	INS	-	GC	GC			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115017733_115017734insGC								FAM55B (440081 upstream) : CADM1 (22219 downstream)																							tgtgagtgtgtgtgtgatgtgt	0.223													4	2	---	---	---	---	
CEP164	22897	broad.mit.edu	37	11	117256846	117256846	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117256846delT	uc001prc.2	+						CEP164_uc001prb.2_Intron|CEP164_uc010rxk.1_Intron|CEP164_uc001prf.2_Intron|CEP164_uc009yzp.1_Intron|CEP164_uc001prg.1_5'UTR	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa						cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		TCCGCTTAGGTTGACTGAGCC	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	123381276	123381277	+	IGR	DEL	AG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123381276_123381277delAG								ASAM (315269 upstream) : GRAMD1B (15251 downstream)																							TATTTTCCCCAGCCTTCCAGAG	0.559													4	2	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126391555	126391556	+	Intron	INS	-	TA	TA			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126391555_126391556insTA	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TGTTGGTTCTCTCTCTCTCTCT	0.342													4	2	---	---	---	---	
FBXL14	144699	broad.mit.edu	37	12	1681962	1681970	+	Intron	DEL	GGTCAAAAT	-	-	rs141172646		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1681962_1681970delGGTCAAAAT	uc001qjh.2	-						WNT5B_uc009zdq.2_5'Flank	NM_152441	NP_689654	Q8N1E6	FXL14_HUMAN	F-box and leucine-rich repeat protein 14							cytoplasm				ovary(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00115)			ctgggacctgggtcaaaatggtcaaaatg	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5629426	5629427	+	IGR	INS	-	GATC	GATC	rs139841019	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5629426_5629427insGATC								NTF3 (24963 upstream) : ANO2 (42390 downstream)																							GACAGTGAGAGGATCAGATGAG	0.421													5	8	---	---	---	---	
CLEC7A	64581	broad.mit.edu	37	12	10280647	10280648	+	Intron	INS	-	A	A	rs35949285		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10280647_10280648insA	uc001qxg.2	-						CLEC7A_uc001qxe.3_Intron|CLEC7A_uc001qxf.2_Intron|CLEC7A_uc001qxh.2_Intron|CLEC7A_uc001qxi.2_Intron|CLEC7A_uc001qxj.2_Intron|CLEC7A_uc009zhg.1_Intron|CLEC7A_uc001qxk.1_Intron|CLEC7A_uc001qxl.1_Intron|CLEC7A_uc010sgy.1_Intron|CLEC7A_uc001qxm.1_Intron|CLEC7A_uc001qxn.2_Intron	NM_197947	NP_922938	Q9BXN2	CLC7A_HUMAN	dendritic cell-associated C-type lectin 1						carbohydrate mediated signaling|defense response to protozoan|inflammatory response|innate immune response|phagocytosis, recognition|T cell activation	cytoplasm|integral to membrane	metal ion binding|MHC protein binding|sugar binding			central_nervous_system(1)	1						ctgtccctaccaaaaaaaaaaa	0.000													5	3	---	---	---	---	
FAIM2	23017	broad.mit.edu	37	12	50294669	50294669	+	Intron	DEL	A	-	-	rs72326331		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50294669delA	uc001rvj.1	-						FAIM2_uc001rvi.1_Intron|FAIM2_uc001rvk.1_Intron	NM_012306	NP_036438	Q9BWQ8	FAIM2_HUMAN	Fas apoptotic inhibitory molecule 2						anti-apoptosis|apoptosis	cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|ovary(1)|skin(1)	3						TGGTGACTTGAAAAAAAAATG	0.438													6	3	---	---	---	---	
ATF1	466	broad.mit.edu	37	12	51203602	51203603	+	Intron	INS	-	TGTTT	TGTTT	rs71443204		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51203602_51203603insTGTTT	uc001rww.3	+						ATF1_uc010smu.1_Intron	NM_005171	NP_005162	P18846	ATF1_HUMAN	activating transcription factor 1						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway				EWSR1/ATF1(323)|FUS/ATF1(4)	soft_tissue(321)|ovary(2)|NS(2)|bone(2)|skin(2)	329						ACATTAGATACtgttttgtttt	0.025			T	EWSR1|FUS	malignant melanoma of soft parts |angiomatoid fibrous histiocytoma 								7	5	---	---	---	---	
SLC4A8	9498	broad.mit.edu	37	12	51842397	51842397	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51842397delA	uc001rys.1	+						SLC4A8_uc010sni.1_Intron|SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryo.2_Intron|SLC4A8_uc001ryp.1_Intron|SLC4A8_uc010snj.1_Intron|SLC4A8_uc001ryq.3_Intron|SLC4A8_uc001ryr.2_Intron|SLC4A8_uc010snk.1_Intron	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		AGAGTAGTGCAAGTGAACCAG	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	55391792	55391792	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55391792delC								KIAA0748 (13336 upstream) : NEUROD4 (21937 downstream)																							CCCATCTATTCCCTCCAGGGT	0.483													4	2	---	---	---	---	
CPM	1368	broad.mit.edu	37	12	69261788	69261789	+	Intron	DEL	CA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69261788_69261789delCA	uc001sup.2	-						CPM_uc001sur.2_Intron|CPM_uc001suq.2_Intron	NM_198320	NP_938079	P14384	CBPM_HUMAN	carboxypeptidase M precursor						anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding				0	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			CAGCTGGCTTCACCTGTTTTTT	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	70383058	70383059	+	IGR	DEL	GT	-	-	rs12425508	byFrequency	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70383058_70383059delGT								RAB3IP (166076 upstream) : CNOT2 (253718 downstream)																							CTGTCTCCTCgtgtgtgtgtgt	0.371													6	3	---	---	---	---	
ZFC3H1	196441	broad.mit.edu	37	12	72027431	72027431	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72027431delA	uc001swo.2	-							NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2						RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						CTGATCTTTTAAAAAAAAAAA	0.294													4	2	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78558320	78558322	+	Intron	DEL	AAA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78558320_78558322delAAA	uc001syp.2	+						NAV3_uc001syo.2_Intron|NAV3_uc010sub.1_Intron|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AAGTGTTTTTAAAAAATATATTG	0.281										HNSCC(70;0.22)			4	2	---	---	---	---	
SYT1	6857	broad.mit.edu	37	12	79702326	79702327	+	Intron	INS	-	AGAC	AGAC	rs140848209	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79702326_79702327insAGAC	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron|SYT1_uc001syv.2_Intron	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						gaaagaaagaaagaaaaaagaa	0.000													7	4	---	---	---	---	
POC1B	282809	broad.mit.edu	37	12	89818730	89818731	+	Intron	DEL	GT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89818730_89818731delGT	uc001tbc.2	-						POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc010sun.1_Intron|POC1B_uc009zsp.2_Intron|POC1B_uc009zsq.2_Intron	NM_172240	NP_758440	Q8TC44	POC1B_HUMAN	WD repeat domain 51B						cell projection organization	centriole|microtubule basal body				ovary(1)	1						AGCTGTGTGAGTGTGTGTGTGT	0.381													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	95801768	95801769	+	IGR	DEL	GA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95801768_95801769delGA								MIR331 (99479 upstream) : METAP2 (66053 downstream)																							ATTGGCATCTGAGGCTTCTTCT	0.515													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	102895079	102895082	+	IGR	DEL	TCAA	-	-	rs148077578		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102895079_102895082delTCAA								IGF1 (20701 upstream) : PAH (337022 downstream)																							ggattctgtctcaatcaatcaatc	0.142													1	6	---	---	---	---	
HCFC2	29915	broad.mit.edu	37	12	104496591	104496592	+	Intron	DEL	AA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104496591_104496592delAA	uc001tkj.3	+						HCFC2_uc009zul.2_Intron	NM_013320	NP_037452	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2						regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity			ovary(2)|central_nervous_system(1)	3						GGTAGGTTTTAAAAATCAACAA	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	105858326	105858326	+	IGR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105858326delT								C12orf75 (93031 upstream) : NUAK1 (598799 downstream)																							AGTCTGCATGTTTTTTTTATC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	107631710	107631711	+	IGR	INS	-	A	A	rs137865441	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107631710_107631711insA								CRY1 (144112 upstream) : BTBD11 (80486 downstream)																							CTCTAACTGTCAGCAATTATTA	0.450													4	3	---	---	---	---	
CUX2	23316	broad.mit.edu	37	12	111520796	111520796	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111520796delC	uc001tsa.1	+							NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						tttctcgactccacactgttg	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	113452840	113452840	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113452840delG								OAS2 (3313 upstream) : DTX1 (42822 downstream)																							ACCTCAGACAGGGGAAAGGTG	0.547													4	2	---	---	---	---	
HNF1A	6927	broad.mit.edu	37	12	121436394	121436395	+	Intron	DEL	GT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121436394_121436395delGT	uc001tzg.2	+						HNF1A_uc010szn.1_Intron	NM_000545	NP_000536	P20823	HNF1A_HUMAN	hepatic nuclear factor-1-alpha						glucose homeostasis|glucose import|insulin secretion|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|protein complex	DNA binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			liver(92)|large_intestine(15)|endometrium(6)|breast(2)|lung(1)	116	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					gagtgtatgcgtgtgtgtgtgt	0.178									Hepatic_Adenoma_Familial_Clustering_of				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127258616	127258621	+	5'Flank	DEL	CCTGAT	-	-	rs10551931		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127258616_127258621delCCTGAT	uc001uhk.3	-											Homo sapiens cDNA clone IMAGE:6160413.																		CCATCCCGGGCCTGATCTTTGCCATC	0.461													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	133415941	133415941	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133415941delC								GOLGA3 (10491 upstream) : CHFR (997 downstream)																							CTCGGCCTCACCCCCGCACTA	0.632													4	2	---	---	---	---	
DCLK1	9201	broad.mit.edu	37	13	36382930	36382930	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36382930delA	uc001uvf.2	-						DCLK1_uc001uve.3_Intron|DCLK1_uc010teh.1_Intron|DCLK1_uc010abk.2_Intron	NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		aaccagaaagaaaaaaaaaaa	0.134													5	3	---	---	---	---	
SPG20	23111	broad.mit.edu	37	13	36886063	36886063	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36886063delA	uc001uvn.2	-						SPG20_uc010ten.1_Intron|SPG20_uc001uvm.2_Intron|SPG20_uc001uvo.2_Intron|SPG20_uc001uvq.2_Intron	NM_001142296	NP_001135768	Q8N0X7	SPG20_HUMAN	spartin						cell death	cytoplasm	ubiquitin protein ligase binding				0		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		catttctactaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	37183541	37183541	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37183541delG								CCNA1 (166523 upstream) : C13orf36 (64508 downstream)																							GTGGAACCTTGCTCTGCAATC	0.448													4	2	---	---	---	---	
SMAD9	4093	broad.mit.edu	37	13	37495040	37495040	+	5'Flank	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37495040delG	uc001uvw.2	-						SMAD9_uc001uvx.2_5'Flank	NM_001127217	NP_001120689	O15198	SMAD9_HUMAN	SMAD family member 9 isoform a						BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		GGGGGTGAGTGGTGGTTAAAA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	40843788	40843788	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40843788delC								COG6 (477986 upstream) : LOC646982 (77485 downstream)																							CCCTCCCAGACCCTTCCTTAT	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	47116888	47116889	+	IGR	DEL	AG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47116888_47116889delAG								C13orf18 (104563 upstream) : LRCH1 (10407 downstream)																							TGAACCATCTAGATCCAAACAG	0.356													4	2	---	---	---	---	
SERPINE3	647174	broad.mit.edu	37	13	51935691	51935691	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51935691delC	uc001vfh.2	+						SERPINE3_uc010tgp.1_Intron	NM_001101320	NP_001094790	A8MV23	SERP3_HUMAN	nexin-related serine protease inhibitor						regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)	2						AGATATCCATCCCATAAAAAT	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20081407	20081408	+	IGR	DEL	AC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20081407_20081408delAC								P704P (61135 upstream) : OR4Q3 (134179 downstream)																							ATATATGTGGacacacacacac	0.257													9	4	---	---	---	---	
SYT16	83851	broad.mit.edu	37	14	62540934	62540934	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62540934delA	uc001xfu.1	+						SYT16_uc010tsd.1_Intron	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like											central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		TAGGAAGACGAAAGGGATGAA	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	71615613	71615613	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71615613delG								PCNX (33514 upstream) : SNORD56B (249441 downstream)																							TCTCAGAAAAGGGAGTCAGGG	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	76991394	76991394	+	IGR	DEL	A	-	-	rs67215598		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76991394delA								ESRRB (23216 upstream) : VASH1 (236841 downstream)																							tttgagtagcaaaagtagggt	0.060													15	8	---	---	---	---	
VIPAR	63894	broad.mit.edu	37	14	77917934	77917935	+	Intron	INS	-	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77917934_77917935insT	uc001xtt.1	-						VIPAR_uc001xtu.1_Intron|VIPAR_uc010tvj.1_Intron|VIPAR_uc001xtv.1_Intron	NM_022067	NP_071350	Q9H9C1	VIPAR_HUMAN	hypothetical protein LOC63894						endosome to lysosome transport|intracellular protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	early endosome|late endosome|recycling endosome	protein binding			central_nervous_system(1)	1						ctctttttttctttttttttag	0.005													4	3	---	---	---	---	
EML5	161436	broad.mit.edu	37	14	89134779	89134779	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89134779delA	uc001xxg.2	-						EML5_uc001xxf.2_5'Flank|EML5_uc001xxh.1_Intron	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like							cytoplasm|microtubule				ovary(3)	3						agtatttcagaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	94870524	94870526	+	IGR	DEL	CAC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94870524_94870526delCAC								SERPINA1 (13495 upstream) : SERPINA11 (38275 downstream)																							cgtgaccagtcacagtggatgtg	0.000													4	2	---	---	---	---	
CYFIP1	23191	broad.mit.edu	37	15	22955583	22955585	+	Intron	DEL	TGA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22955583_22955585delTGA	uc001yus.2	+						CYFIP1_uc001yut.2_Intron|CYFIP1_uc010aya.1_Intron|CYFIP1_uc001yuu.2_5'Flank	NM_014608	NP_055423	Q7L576	CYFP1_HUMAN	cytoplasmic FMR1 interacting protein 1 isoform						axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		CTGTGTTTCTTGATGGGTGTTTG	0.453													4	2	---	---	---	---	
GOLGA9P	283796	broad.mit.edu	37	15	23258265	23258268	+	Intron	DEL	TCTC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23258265_23258268delTCTC	uc001yvh.1	+						uc001yvi.2_5'Flank	NR_024074				RecName: Full=Putative golgin subfamily A member 6-like protein 11;												0						TAATGATTGTTCTCTCTACCTCTC	0.603													20	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23409435	23409436	+	Intron	INS	-	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23409435_23409436insT	uc010uab.1	-						uc002ceb.2_5'Flank	NM_001001413	NP_001001413			golgi autoantigen, golgin subfamily a, 6-like 1																		ttctttctttcttttttttttt	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	26299642	26299643	+	IGR	DEL	AG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26299642_26299643delAG								ATP10A (189325 upstream) : GABRB3 (489052 downstream)																							AACATTGGGCagagagagagag	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	39743084	39743084	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39743084delA								C15orf54 (196036 upstream) : THBS1 (130196 downstream)																							taaaagtaggaaaaaaaaatg	0.035													4	2	---	---	---	---	
INO80	54617	broad.mit.edu	37	15	41274054	41274055	+	Intron	DEL	CT	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41274054_41274055delCT	uc001zni.2	-						INO80_uc010ucu.1_Intron	NM_017553	NP_060023	Q9ULG1	INO80_HUMAN	INO80 complex homolog 1						cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4						CCTACTGCTCCTCTTCCATGGA	0.530													4	2	---	---	---	---	
STRC	161497	broad.mit.edu	37	15	43897810	43897810	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43897810delA	uc001zsf.2	-						STRC_uc010bdl.2_Intron|STRC_uc001zse.2_Intron	NM_153700	NP_714544	Q7RTU9	STRC_HUMAN	stereocilin precursor						sensory perception of sound	cell surface					0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		TAGTCTTCCTAAAAAAAAAAA	0.264													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	59047657	59047657	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59047657delA								ADAM10 (5480 upstream) : FAM63B (15736 downstream)																							tctccatctcaaaaaaaaaac	0.154													5	5	---	---	---	---	
RORA	6095	broad.mit.edu	37	15	60803073	60803073	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60803073delT	uc002agv.2	-						uc002ags.1_Intron|RORA_uc002agt.3_Intron|RORA_uc002agw.2_Intron|RORA_uc002agx.2_Intron	NM_134260	NP_599022	P35398	RORA_HUMAN	RAR-related orphan receptor A isoform b						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						tggactgccattttTTTTTTT	0.149													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	62908895	62908895	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62908895delG								C2CD4B (451413 upstream) : MGC15885 (20476 downstream)																							TAATTTCACTGGGAACCTCAT	0.388													4	2	---	---	---	---	
UACA	55075	broad.mit.edu	37	15	70961934	70961934	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70961934delA	uc002asr.2	-						UACA_uc010uke.1_Intron|UACA_uc002asq.2_Intron|UACA_uc010bin.1_Intron	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and							cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						AGTAAGATGGAAAAAAAATCA	0.333													4	3	---	---	---	---	
SEMA4B	10509	broad.mit.edu	37	15	90763301	90763302	+	Intron	DEL	GA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90763301_90763302delGA	uc002boy.2	+						SEMA4B_uc002boz.2_Intron|SEMA4B_uc010uqd.1_Intron|SEMA4B_uc002bpa.2_Intron|SEMA4B_uc010bnv.1_5'Flank	NM_020210	NP_064595			semaphorin 4B precursor											ovary(1)|breast(1)|kidney(1)	3	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			GCGCAGCCCTGACAGCCATGTC	0.624											OREG0023468	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	4	---	---	---	---	
SEMA4B	10509	broad.mit.edu	37	15	90763305	90763306	+	Intron	INS	-	CC	CC			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90763305_90763306insCC	uc002boy.2	+						SEMA4B_uc002boz.2_Intron|SEMA4B_uc010uqd.1_Intron|SEMA4B_uc002bpa.2_Intron|SEMA4B_uc010bnv.1_5'Flank	NM_020210	NP_064595			semaphorin 4B precursor											ovary(1)|breast(1)|kidney(1)	3	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			AGCCCTGACAGCCATGTCTCCC	0.629													8	4	---	---	---	---	
CRTC3	64784	broad.mit.edu	37	15	91145886	91145888	+	Intron	DEL	AAC	-	-	rs145710406		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91145886_91145888delAAC	uc002bpp.2	+						CRTC3_uc002bpo.2_Intron	NM_022769	NP_073606	Q6UUV7	CRTC3_HUMAN	transducer of regulated CREB protein 3 isoform						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			aaaCAaacaaaacaacaacaaca	0.015			T	MAML2	salivary gland mucoepidermoid								7	7	---	---	---	---	
FAM174B	400451	broad.mit.edu	37	15	93277457	93277458	+	5'Flank	DEL	CC	-	-	rs12442756	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93277457_93277458delCC	uc002bsl.3	-									Q3ZCQ3	F174B_HUMAN	Homo sapiens cDNA PSEC0264 fis, clone NT2RP3002337.							integral to membrane					0						tccgcctccgccccgccgcgcg	0.233													11	6	---	---	---	---	
SPATA8	145946	broad.mit.edu	37	15	97325872	97325872	+	5'Flank	DEL	T	-	-	rs79753202	byFrequency	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97325872delT	uc002bue.2	+						uc002buc.1_5'Flank|uc010uro.1_5'Flank|uc010urp.1_5'Flank	NM_173499	NP_775770	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8											ovary(1)|skin(1)	2	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			CCCAGGTCTCTACCATTCCAC	0.547													4	2	---	---	---	---	
LRRK1	79705	broad.mit.edu	37	15	101603083	101603083	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101603083delA	uc002bwr.2	+						LRRK1_uc010usb.1_Intron|LRRK1_uc010usc.1_Intron|LRRK1_uc002bws.2_Intron	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1						small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TCCGGTTTGCAAAAACCTAAG	0.522													4	2	---	---	---	---	
CASKIN1	57524	broad.mit.edu	37	16	2231706	2231707	+	Intron	INS	-	A	A	rs62038843		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2231706_2231707insA	uc010bsg.1	-							NM_020764	NP_065815	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1						signal transduction	cytoplasm				skin(2)	2						tggggctggggcggggctgggg	0.208													4	3	---	---	---	---	
CASKIN1	57524	broad.mit.edu	37	16	2231708	2231709	+	Intron	INS	-	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2231708_2231709insA	uc010bsg.1	-							NM_020764	NP_065815	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1						signal transduction	cytoplasm				skin(2)	2						gggctggggcggggctggggct	0.208													3	3	---	---	---	---	
CCNF	899	broad.mit.edu	37	16	2485656	2485667	+	Intron	DEL	GCACACACACAC	-	-	rs147350588	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2485656_2485667delGCACACACACAC	uc002cqd.1	+						CCNF_uc002cqe.1_Intron	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F						cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				atatatatatgcacacacacacatatatatat	0.142													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5555080	5555080	+	Intron	DEL	T	-	-	rs71404526		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5555080delT	uc002cyq.1	+											Homo sapiens cDNA clone IMAGE:5244947, **** WARNING: chimeric clone ****.																		caaacaccacttgagatgggc	0.070													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5780152	5780154	+	IGR	DEL	AGA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5780152_5780154delAGA								FAM86A (632363 upstream) : A2BP1 (288978 downstream)																							tcttggcagtagaagaagATTAT	0.182													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	6030846	6030847	+	IGR	INS	-	CGGGCAA	CGGGCAA	rs146550745	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6030846_6030847insCGGGCAA								FAM86A (883057 upstream) : A2BP1 (38285 downstream)																							agacactttgtcgggcaacgct	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9796772	9796773	+	IGR	DEL	TA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9796772_9796773delTA								C16orf72 (583227 upstream) : GRIN2A (50494 downstream)																							CTGAAACAGCTAAAAAAATTAA	0.401													4	2	---	---	---	---	
MKL2	57496	broad.mit.edu	37	16	14205629	14205629	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14205629delT	uc010uza.1	+						MKL2_uc002dcg.2_Intron	NM_014048	NP_054767	Q9ULH7	MKL2_HUMAN	megakaryoblastic leukemia 2 protein						cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5						tggttccccctttttctcggt	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	28604332	28604332	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28604332delA	uc010vct.1	-						SULT1A2_uc002dqg.1_Intron|SULT1A2_uc002dqh.1_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		actttgtctcaaaaaaaaaaG	0.294													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32416767	32416767	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32416767delG								HERC2P4 (252893 upstream) : TP53TG3B (268074 downstream)																							GTTCTCACTAGAAAAAATTAA	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33530995	33530995	+	IGR	DEL	T	-	-	rs78777890		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33530995delT								SLC6A10P (634532 upstream) : MIR1826 (434513 downstream)																							ATAACACTTATTTCTACTTGG	0.323													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46394392	46394392	+	IGR	DEL	T	-	-	rs112506160		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46394392delT								None (None upstream) : ANKRD26P1 (108857 downstream)																							catgattgcctttgattccat	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	48944287	48944288	+	IGR	DEL	CA	-	-	rs112743166	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48944287_48944288delCA								N4BP1 (300167 upstream) : CBLN1 (367923 downstream)																							cactgactctcacacacacaca	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	51905956	51905956	+	IGR	DEL	T	-	-	rs76727260		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51905956delT								SALL1 (720773 upstream) : TOX3 (565962 downstream)																							AGGAATGTTCTTTGTCCCTTT	0.348													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55162078	55162078	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55162078delC								IRX5 (193685 upstream) : IRX6 (196393 downstream)																							TGCCTATCAGCCCCAGCTCCT	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	58784312	58784313	+	IGR	INS	-	CTT	CTT	rs141724247	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58784312_58784313insCTT								GOT2 (16066 upstream) : None (None downstream)																							GAGTGACTGTGCTGTGtttttc	0.262													17	14	---	---	---	---	
SLC12A4	6560	broad.mit.edu	37	16	67991417	67991417	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67991417delT	uc002euz.2	-						SLC12A4_uc010ceu.2_Intron|SLC12A4_uc010vkh.1_Intron|SLC12A4_uc010vki.1_Intron|SLC12A4_uc010vkj.1_Intron|SLC12A4_uc002eva.2_Intron|SLC12A4_uc002evb.2_Intron|SLC12A4_uc010cew.1_Intron	NM_005072	NP_005063	Q9UP95	S12A4_HUMAN	solute carrier family 12, member 4 isoform a						cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	TACATTGCCCTTTTTTTTTCT	0.259													8	4	---	---	---	---	
DDX19A	55308	broad.mit.edu	37	16	70348600	70348601	+	Intron	DEL	TA	-	-	rs71667182		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70348600_70348601delTA	uc002eys.2	+						DDX19B_uc010vly.1_Intron|DDX19B_uc010vlv.1_Intron|DDX19B_uc010vlw.1_Intron|DDX19B_uc002eyo.2_Intron|DDX19B_uc002eyp.2_Intron|DDX19B_uc002eyq.2_Intron|DDX19B_uc002eyr.2_Intron|DDX19B_uc010vlx.1_Intron	NM_007242	NP_009173	Q9NUU7	DD19A_HUMAN	DEAD (Asp-Glu-Ala-As) box polypeptide 19 isoform						mRNA transport|protein transport|transmembrane transport	cytoplasm|nuclear membrane|nuclear pore	ATP binding|ATP-dependent helicase activity|RNA binding				0		Ovarian(137;0.221)				aaTATCTATCTATATATATATA	0.158													4	2	---	---	---	---	
HPR	3250	broad.mit.edu	37	16	72110005	72110006	+	Intron	INS	-	T	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72110005_72110006insT	uc002fby.2	+						TXNL4B_uc010cgl.2_Intron	NM_020995	NP_066275	P00739	HPTR_HUMAN	haptoglobin-related protein precursor						proteolysis	spherical high-density lipoprotein particle	hemoglobin binding|serine-type endopeptidase activity			central_nervous_system(1)	1		Ovarian(137;0.125)				AGAAATAGAGCTTTTTGTAATG	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	73419371	73419371	+	5'Flank	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73419371delG	uc002fcn.2	+						uc002fco.1_5'Flank					Homo sapiens cDNA clone IMAGE:5272469.																		TATAGGCCCTGGCAGCTCCAA	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	76152608	76152608	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76152608delC								TERF2IP (461280 upstream) : CNTNAP4 (158568 downstream)																							CATCTTTTTTCCCTTGGCTCA	0.453													4	2	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81249499	81249500	+	Intron	DEL	AG	-	-	rs67876166		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81249499_81249500delAG	uc002fgh.1	-						PKD1L2_uc002fgj.2_Intron	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GCATAGAGACAGGGAGAGAAAG	0.564													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	82260336	82260337	+	IGR	DEL	GC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82260336_82260337delGC								MPHOSPH6 (56507 upstream) : CDH13 (400241 downstream)																							TTTGTAGGTTGCAAGCCTGGAC	0.465													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	83197200	83197200	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83197200delT	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		ttctattgcctttgcagtcag	0.284													4	2	---	---	---	---	
ANKRD11	29123	broad.mit.edu	37	16	89369670	89369671	+	Intron	DEL	AA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89369670_89369671delAA	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fnd.2_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron|ANKRD11_uc002fnf.1_Intron	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GCAAAGAGCTAACAGCTACGTA	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	280610	280610	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:280610delA								C17orf97 (7094 upstream) : FAM101B (9164 downstream)																							actcagtctcaaaaaaaaaaa	0.134													5	3	---	---	---	---	
SMG6	23293	broad.mit.edu	37	17	1964631	1964631	+	3'UTR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1964631delC	uc002fub.1	-	19					SMG6_uc010vqv.1_3'UTR	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						AGGAGCAGGTCCCCCACAGCA	0.627													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	2424574	2424574	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2424574delA								METT10D (9374 upstream) : PAFAH1B1 (72349 downstream)																							tttctactataaacaatgctg	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	7043276	7043277	+	IGR	INS	-	TTGTT	TTGTT	rs140263099	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7043276_7043277insTTGTT								ASGR2 (24984 upstream) : ASGR1 (33475 downstream)																							gaggttttgccttgttttgttt	0.000													0	6	---	---	---	---	
CDRT4	284040	broad.mit.edu	37	17	15342591	15342591	+	Intron	DEL	A	-	-	rs10707095		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15342591delA	uc002gop.1	-						CDRT4_uc010vvw.1_Intron	NM_173622	NP_775893	Q8N9R6	CDRT4_HUMAN	CMT1A duplicated region transcript 4												0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0874)		GAATGCAGTTAAAAAAAAAAA	0.418													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	17304086	17304086	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17304086delC								NT5M (53111 upstream) : MED9 (76214 downstream)																							GAGTCCAGTGCCCACATAGCA	0.567													4	2	---	---	---	---	
LOC339240	339240	broad.mit.edu	37	17	18321849	18321850	+	5'Flank	DEL	AC	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18321849_18321850delAC	uc010vxy.1	+											Homo sapiens keratin pseudogene, mRNA (cDNA clone IMAGE:5270734).												0						ATTAAGTGCTACACACACACAC	0.475													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	19504275	19504275	+	IGR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19504275delT								SLC47A1 (21929 upstream) : ALDH3A2 (47789 downstream)																							CTCTTACttcttttttttttt	0.239													9	4	---	---	---	---	
FBXL20	84961	broad.mit.edu	37	17	37421934	37421934	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37421934delA	uc010wed.1	-						FBXL20_uc002hrt.2_Intron|FBXL20_uc010cvu.2_Intron	NM_032875	NP_116264	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20							cytoplasm				ovary(1)	1			LUAD - Lung adenocarcinoma(14;0.146)			tttttaaattaaaaaaatttt	0.000													4	2	---	---	---	---	
KCNH4	23415	broad.mit.edu	37	17	40318728	40318729	+	Intron	DEL	TG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40318728_40318729delTG	uc002hzb.2	-							NM_012285	NP_036417	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	two-component sensor activity|voltage-gated potassium channel activity			large_intestine(1)	1		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CAATTTTGCTTGCTGCATGTAC	0.495													4	2	---	---	---	---	
BRCA1	672	broad.mit.edu	37	17	41247621	41247621	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41247621delA	uc002icq.2	-						BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Intron|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Intron|BRCA1_uc002ict.2_Intron|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Intron|BRCA1_uc002ide.1_Intron|BRCA1_uc010cyy.1_Intron|BRCA1_uc010whs.1_Intron|BRCA1_uc010cyz.2_Intron|BRCA1_uc010cza.2_Intron|BRCA1_uc010wht.1_Intron	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1						androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		acaaacaaacaaaaaaaaAAA	0.164			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			5	4	---	---	---	---	
MEOX1	4222	broad.mit.edu	37	17	41729106	41729106	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41729106delT	uc002idz.2	-						MEOX1_uc002iea.2_Intron|MEOX1_uc002ieb.2_Intron	NM_004527	NP_004518	P50221	MEOX1_HUMAN	mesenchyme homeobox 1 isoform 1							nucleus	sequence-specific DNA binding				0		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)		TTATCCCCCCTCCCTGGGCCC	0.582													4	2	---	---	---	---	
ADAM11	4185	broad.mit.edu	37	17	42838552	42838553	+	Intron	DEL	TG	-	-	rs141028048		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42838552_42838553delTG	uc002ihh.2	+						ADAM11_uc010wjd.1_Intron	NM_002390	NP_002381	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11 preproprotein						integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			pancreas(1)	1		Prostate(33;0.0959)				GTGGTTACACTGTGGGGGAACT	0.594													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	47182798	47182799	+	IGR	DEL	AC	-	-	rs71873374		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47182798_47182799delAC								IGF2BP1 (49293 upstream) : B4GALNT2 (27023 downstream)																							agacttagcaacatgatgatca	0.193													5	3	---	---	---	---	
CA10	56934	broad.mit.edu	37	17	49725537	49725537	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49725537delT	uc002itw.3	-						CA10_uc002itu.3_Intron|CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			TACACATTCATTTTTTTTTCT	0.413													4	2	---	---	---	---	
FTSJ3	117246	broad.mit.edu	37	17	61898063	61898064	+	Intron	INS	-	GCTTGAACCTGGAAGACGG	GCTTGAACCTGGAAGACGG	rs142835534	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61898063_61898064insGCTTGAACCTGGAAGACGG	uc002jbz.2	-						FTSJ3_uc002jca.2_Intron	NM_017647	NP_060117	Q8IY81	RRMJ3_HUMAN	FtsJ homolog 3						RNA methylation|rRNA processing	nucleolus	methyltransferase activity|nucleic acid binding			ovary(1)	1						caaggagaatcaggctgcagtg	0.059													6	3	---	---	---	---	
RGS9	8787	broad.mit.edu	37	17	63198452	63198452	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63198452delA	uc002jfe.2	+						RGS9_uc010dem.2_Intron|RGS9_uc002jfd.2_Intron|RGS9_uc002jff.2_Intron|RGS9_uc002jfg.2_Intron	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1						intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						TCTAGGGGTTAAAAAAGCAAG	0.443													4	2	---	---	---	---	
PITPNC1	26207	broad.mit.edu	37	17	65633404	65633404	+	Intron	DEL	T	-	-	rs79219203		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65633404delT	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549	Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			TCAGAGTTCCTTTTTTTTTTT	0.398													7	4	---	---	---	---	
ACOX1	51	broad.mit.edu	37	17	73970228	73970228	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73970228delT	uc002jqf.2	-						ACOX1_uc010wsq.1_Intron|ACOX1_uc002jqe.2_Intron|ACOX1_uc010wsr.1_Intron	NM_007292	NP_009223	Q15067	ACOX1_HUMAN	acyl-Coenzyme A oxidase 1 isoform b						fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|prostaglandin metabolic process|very long-chain fatty acid metabolic process	peroxisomal matrix	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity|flavin adenine dinucleotide binding|protein N-terminus binding			ovary(1)	1						ATGTGTGTGGTTTTTTTTTTT	0.318													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	78950793	78950793	+	IGR	DEL	A	-	-	rs112496455		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78950793delA								RPTOR (10620 upstream) : CHMP6 (14848 downstream)																							tttgacaattaaaaaaaaaaa	0.129													4	2	---	---	---	---	
C18orf1	753	broad.mit.edu	37	18	13286239	13286240	+	Intron	DEL	CA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13286239_13286240delCA	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		cttcagggttcacacacattgg	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	28261921	28261921	+	IGR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28261921delT								MIR302F (382995 upstream) : DSC3 (308132 downstream)																							CTGTGCAGACTTTTTTCTAAC	0.478													4	2	---	---	---	---	
RPRD1A	55197	broad.mit.edu	37	18	33572841	33572841	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33572841delA	uc002kzf.1	-						RPRD1A_uc002kze.1_Intron|RPRD1A_uc002kzg.2_3'UTR|RPRD1A_uc010dmw.2_3'UTR	NM_018170	NP_060640	Q96P16	RPR1A_HUMAN	regulation of nuclear pre-mRNA domain containing											ovary(1)|breast(1)	2						GCCTTGGATCAAAAAAAAAAT	0.254													4	2	---	---	---	---	
ALPK2	115701	broad.mit.edu	37	18	56148699	56148700	+	3'UTR	DEL	TG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56148699_56148700delTG	uc002lhj.3	-	13						NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase								ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						GAATTTTGGCTGTGAACAGACT	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	71614629	71614630	+	IGR	DEL	TG	-	-	rs78139055	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71614629_71614630delTG								None (None upstream) : FBXO15 (125958 downstream)																							CCTTTTTTTTTGTTGTTTGCTT	0.396													4	3	---	---	---	---	
ZNF562	54811	broad.mit.edu	37	19	9769047	9769048	+	Intron	INS	-	A	A	rs146519922	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9769047_9769048insA	uc010xks.1	-						ZNF562_uc002mly.2_Intron|ZNF562_uc002mlx.2_Intron|ZNF562_uc010xkt.1_Intron|ZNF562_uc010xku.1_Intron|ZNF562_uc010xkv.1_Intron|ZNF562_uc010xkw.1_Intron	NM_001130032	NP_001123504	Q6V9R5	ZN562_HUMAN	zinc finger protein 562 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ttttttgtgacagagttttgct	0.153													4	4	---	---	---	---	
GCDH	2639	broad.mit.edu	37	19	13004060	13004060	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13004060delA	uc002mvq.2	+						GCDH_uc010xms.1_Intron|GCDH_uc002mvp.2_Intron|GCDH_uc010xmt.1_Intron|GCDH_uc010xmu.1_Intron	NM_000159	NP_000150	Q92947	GCDH_HUMAN	glutaryl-Coenzyme A dehydrogenase isoform a						lysine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|glutaryl-CoA dehydrogenase activity|protein binding				0						ttctcaagtgatcctcttgcc	0.020													8	8	---	---	---	---	
AKAP8L	26993	broad.mit.edu	37	19	15512984	15512984	+	Intron	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15512984delG	uc002naw.1	-						AKAP8L_uc002nax.1_Intron|AKAP8L_uc010xoh.1_Intron|AKAP8L_uc002nay.1_Intron|AKAP8L_uc002naz.2_5'Flank	NM_014371	NP_055186	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like							cytoplasm|nuclear matrix	DEAD/H-box RNA helicase binding|DNA binding|zinc ion binding			ovary(1)	1						AGCTTGCCCAGGGACAAGAAA	0.502													4	2	---	---	---	---	
CYP4F22	126410	broad.mit.edu	37	19	15661808	15661808	+	Intron	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15661808delT	uc002nbh.3	+							NM_173483	NP_775754	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F,							endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2						tcccattggctctatgatgcc	0.124													6	4	---	---	---	---	
PDE4C	5143	broad.mit.edu	37	19	18324506	18324506	+	Intron	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18324506delG	uc010xqc.1	-						PDE4C_uc002nik.3_Intron|PDE4C_uc002nil.3_Intron|PDE4C_uc002nif.3_Intron|PDE4C_uc002nig.3_Intron|PDE4C_uc002nih.3_Intron|PDE4C_uc010ebk.2_Intron|PDE4C_uc002nii.3_Intron|PDE4C_uc010ebl.2_Intron	NM_001098819	NP_001092289	Q08493	PDE4C_HUMAN	phosphodiesterase 4C isoform PDE4C-2						signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|skin(2)|central_nervous_system(1)	5					Dyphylline(DB00651)	GAGGTCATCTGGGTTGGCCAT	0.428													4	2	---	---	---	---	
ZNF383	163087	broad.mit.edu	37	19	37709967	37709967	+	Intron	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37709967delG	uc002oft.1	+						ZNF383_uc002ofs.1_Intron	NM_152604	NP_689817	Q8NA42	ZN383_HUMAN	zinc finger protein 383						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTTATTGTTTGGGTGAGGCGT	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	38375469	38375469	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38375469delA								ZNF573 (67529 upstream) : WDR87 (3 downstream)																							acaccgtctcaaaaaaaaaaa	0.214													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	43716867	43716867	+	IGR	DEL	T	-	-	rs35486161		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43716867delT								PSG4 (7077 upstream) : PSG9 (40569 downstream)																							tcttttaaaatttttctttgc	0.000													7	7	---	---	---	---	
CEACAM16	388551	broad.mit.edu	37	19	45207037	45207037	+	Intron	DEL	A	-	-	rs71364503		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45207037delA	uc010xxd.1	+						CEACAM16_uc002ozq.2_Intron	NM_001039213	NP_001034302	A7LI12	A7LI12_HUMAN	carcinoembryonic antigen-related cell adhesion											ovary(1)	1	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				TCttttttttaaaaaaaaaaa	0.468													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	45835887	45835887	+	IGR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45835887delT								CKM (9753 upstream) : KLC3 (8111 downstream)																							acccagctaatttttTTTTCT	0.159													5	3	---	---	---	---	
MEIS3	56917	broad.mit.edu	37	19	47916988	47916988	+	Intron	DEL	T	-	-	rs112493679		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47916988delT	uc002pgu.2	-						MEIS3_uc002pgo.2_5'Flank|MEIS3_uc002pgp.2_Intron|MEIS3_uc002pgq.2_Intron|MEIS3_uc002pgr.2_Intron|MEIS3_uc002pgt.2_Intron|MEIS3_uc002pgv.2_Intron|MEIS3_uc002pgs.2_Intron|MEIS3_uc010eld.2_Intron	NM_001009813	NP_001009813	Q99687	MEIS3_HUMAN	Meis1, myeloid ecotropic viral integration site							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		GGTTTGAttcttttttttttt	0.234													4	2	---	---	---	---	
PPP2R1A	5518	broad.mit.edu	37	19	52729587	52729587	+	3'UTR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52729587delT	uc002pyp.2	+	15					PPP2R1A_uc010ydk.1_3'UTR|PPP2R1A_uc002pyq.2_3'UTR	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein						ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CCATCATTGGTTTTTTTTTGT	0.468			Mis		clear cell ovarian carcinoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	53738059	53738059	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53738059delA								ZNF665 (41440 upstream) : ZNF677 (579 downstream)																							GCAAATCAGTAAAAAAAAATG	0.169													4	2	---	---	---	---	
ZSCAN18	65982	broad.mit.edu	37	19	58619075	58619075	+	Intron	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58619075delG	uc010yht.1	-						ZSCAN18_uc002qrm.2_RNA	NM_001145542	NP_001139014	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		ACAAAGAGGAGGCAAAGAAAA	0.343													4	2	---	---	---	---	
TRIB3	57761	broad.mit.edu	37	20	377225	377225	+	Frame_Shift_Del	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:377225delC	uc002wdm.2	+	4	1474	c.968delC	c.(967-969)GCCfs	p.A323fs	TRIB3_uc002wdn.2_Frame_Shift_Del_p.A350fs	NM_021158	NP_066981	Q96RU7	TRIB3_HUMAN	tribbles 3	323					apoptosis|cellular lipid metabolic process|insulin receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fatty acid biosynthetic process|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein binding|positive regulation of ubiquitin-protein ligase activity|regulation of glucose transport|regulation of MAP kinase activity|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	ATP binding|protein kinase activity|protein kinase binding|protein kinase inhibitor activity|transcription corepressor activity|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			central_nervous_system(2)	2		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		ATGCCCTTAGCCCCAACCCGA	0.642													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25742658	25742658	+	IGR	DEL	A	-	-	rs112655215		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25742658delA								ZNF337 (65189 upstream) : FAM182B (1444 downstream)																							aggtggtgatagatactgata	0.000													5	4	---	---	---	---	
FAM182B	728882	broad.mit.edu	37	20	25756137	25756137	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25756137delC	uc010zth.1	-						FAM182B_uc002wvd.1_Intron|FAM182B_uc002wve.2_Intron|FAM182B_uc010zti.1_Intron	NR_027061				Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0						TTTTTTTTAACCACTGGCAAT	0.308													11	6	---	---	---	---	
C20orf191	149934	broad.mit.edu	37	20	26084616	26084619	+	Intron	DEL	AAAG	-	-	rs149763253		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26084616_26084619delAAAG	uc002wvj.3	-							NR_003678				SubName: Full=Putative uncharacterized protein ENSP00000323172;												0						CAATCATGACAAAGGAAGATACCA	0.368													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36049424	36049424	+	IGR	DEL	T	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36049424delT								SRC (15605 upstream) : BLCAP (96396 downstream)																							CTTTATCTTCTTTCTTCTTCC	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37285292	37285292	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37285292delC								ADIG (68188 upstream) : SLC32A1 (67813 downstream)																							CATTCATTGGCCCCTGTGGGA	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48670785	48670785	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48670785delC								SNAI1 (65367 upstream) : TMEM189-UBE2V1 (26878 downstream)																							TCCTGCCACACCCACCAACCC	0.592													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	49808517	49808518	+	IGR	DEL	TG	-	-	rs59525139	by1000genomes	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49808517_49808518delTG								KCNG1 (168842 upstream) : NFATC2 (199248 downstream)																							tagagtccgctgtgataaggtg	0.040													4	2	---	---	---	---	
TFAP2C	7022	broad.mit.edu	37	20	55208253	55208253	+	Intron	DEL	T	-	-	rs72357061		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55208253delT	uc002xya.2	+						TFAP2C_uc010zzi.1_Intron	NM_003222	NP_003213	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma						cell-cell signaling|male gonad development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Colorectal(105;0.229)			actcttattattttttttttt	0.179													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57670630	57670630	+	IGR	DEL	T	-	-	rs139457495		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57670630delT								SLMO2 (52729 upstream) : ZNF831 (95445 downstream)																							gtcttcttcctttttttTTTT	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10427869	10427869	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10427869delC								None (None upstream) : TPTE (478874 downstream)																							aataagaaaacaaaaacaaaa	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11048049	11048049	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11048049delA	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ctgtgtcactaaacaacttag	0.055													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	15471821	15471822	+	Intron	INS	-	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15471821_15471822insA	uc002yjk.2	+						uc002yjl.2_Intron					Homo sapiens, clone IMAGE:4102980, mRNA.																		GACCCTGGGTGATTAATGTAAC	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	32422672	32422672	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32422672delC								KRTAP19-8 (11877 upstream) : TIAM1 (68064 downstream)																							CTCAAGGCCACCCATTGGCAA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16436529	16436529	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16436529delG								POTEH (148592 upstream) : OR11H1 (12297 downstream)																							CTGGAATCCTGGGGGAAAAAA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17237187	17237188	+	IGR	INS	-	T	T	rs143051422		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17237187_17237188insT								psiTPTE22 (57666 upstream) : XKR3 (27125 downstream)																							aaaatgctagctttttaaaaaa	0.050													12	7	---	---	---	---	
TOP3B	8940	broad.mit.edu	37	22	22326532	22326532	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22326532delA	uc002zvs.2	-						TOP3B_uc010gtl.2_Intron|TOP3B_uc002zvt.3_Intron	NM_003935	NP_003926	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta						DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		TTTTTGGACCAAAAAAAAAAG	0.289													4	2	---	---	---	---	
RGL4	266747	broad.mit.edu	37	22	24038567	24038568	+	Intron	INS	-	A	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24038567_24038568insA	uc002zxn.2	+						LOC91316_uc002zxk.3_Intron|LOC91316_uc010gua.2_Intron|LOC91316_uc002zxl.3_Intron|LOC91316_uc011aiz.1_Intron|LOC91316_uc002zxm.3_Intron|RGL4_uc002zxo.2_Intron|RGL4_uc002zxp.1_Intron|RGL4_uc002zxq.2_Intron	NM_153615	NP_705843	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation						small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle	guanyl-nucleotide exchange factor activity			ovary(1)	1						AGCCCTCAGAGGccctgtgagg	0.332													6	3	---	---	---	---	
TOMM22	56993	broad.mit.edu	37	22	39079148	39079148	+	Intron	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39079148delG	uc003awe.2	+						uc003awd.2_5'Flank	NM_020243	NP_064628	Q9NS69	TOM22_HUMAN	mitochondrial import receptor Tom22						protein import into mitochondrial outer membrane	integral to membrane|integral to membrane of membrane fraction|mitochondrial outer membrane translocase complex	protein binding|protein transmembrane transporter activity|receptor activity				0	Melanoma(58;0.04)					gccgggggtcggggggggggt	0.020													7	4	---	---	---	---	
WBP2NL	164684	broad.mit.edu	37	22	42198384	42198404	+	Intron	DEL	GGAGTCTCCAGTTGGAGACTG	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42198384_42198404delGGAGTCTCCAGTTGGAGACTG	uc011ape.1	+						LOC339674_uc003bba.1_Intron|CCDC134_uc003bbh.1_Intron|CCDC134_uc011apg.1_Intron	NM_152613	NP_689826	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like						egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding			ovary(2)	2						ttggagactaggagtctccagttggagactggtgactagga	0.000													5	3	---	---	---	---	
PARVB	29780	broad.mit.edu	37	22	44489416	44489416	+	Intron	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44489416delC	uc003ben.2	+						PARVB_uc003bem.2_Intron|PARVB_uc010gzn.2_Intron|PARVB_uc003beo.2_Intron	NM_013327	NP_037459	Q9HBI1	PARVB_HUMAN	parvin, beta isoform b						cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding				0		Ovarian(80;0.0246)|all_neural(38;0.0423)				CAGGACGCAGCCCCCCGGCAG	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49699945	49699945	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49699945delG								FAM19A5 (552203 upstream) : C22orf34 (108231 downstream)																							GGTGCACCCTGGGGTACACAG	0.642													4	2	---	---	---	---	
MLC1	23209	broad.mit.edu	37	22	50503313	50503313	+	Intron	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50503313delA	uc003bjg.1	-						MLC1_uc011arl.1_Intron|MLC1_uc003bjh.1_Intron|MLC1_uc011arm.1_Intron|MLC1_uc011arn.1_Intron|MLC1_uc011aro.1_Intron	NM_139202	NP_631941	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with							basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity			pancreas(1)	1		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		TCACTGCTACAAAAAGTAAGA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	174297	174298	+	IGR	DEL	AA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:174297_174298delAA								None (None upstream) : PLCXD1 (18694 downstream)																							actccatctcaaaaaaaaaaaa	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	3856195	3856196	+	IGR	DEL	GT	-	-	rs36108839		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3856195_3856196delGT								PRKX (224534 upstream) : None (None downstream)																							gaaagcctgagtgtgtgtgtgt	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	40374176	40374176	+	IGR	DEL	A	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40374176delA								BCOR (337594 upstream) : ATP6AP2 (66040 downstream)																							tttaaaaattaaaaaaaaaaa	0.104													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	45842789	45842789	+	IGR	DEL	C	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45842789delC								MIR222 (236259 upstream) : ZNF673 (463835 downstream)																							TCACTCTCCTCCCTGGCTAGC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	71034275	71034275	+	IGR	DEL	G	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71034275delG								BCYRN1 (85313 upstream) : NHSL2 (96663 downstream)																							GCATCTGCGTGGATCCCCAGC	0.617													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	128766958	128766959	+	IGR	DEL	AA	-	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128766958_128766959delAA								OCRL (40430 upstream) : APLN (12367 downstream)																							CGTCCCTGCTAAAGAGATGTTC	0.322													4	2	---	---	---	---	
