Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SPEN	23013	broad.mit.edu	37	1	16260312	16260312	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16260312A>C	uc001axk.1	+	11	7781	c.7577A>C	c.(7576-7578)GAT>GCT	p.D2526A	SPEN_uc010obp.1_Missense_Mutation_p.D2485A	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	2526	RID.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AAGGCCTCTGATGTTGACACC	0.552													131	261	---	---	---	---	PASS
CYP4A11	1579	broad.mit.edu	37	1	47399695	47399695	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47399695A>G	uc001cqp.3	-	9	1196	c.1145T>C	c.(1144-1146)CTC>CCC	p.L382P	CYP4A11_uc001cqq.2_Missense_Mutation_p.L382P|CYP4A11_uc010omm.1_RNA	NM_000778	NP_000769	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A,	382					long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding			ovary(2)|skin(2)	4					NADH(DB00157)	CGGTGGGTAGAGCCTCAGTGC	0.587													27	32	---	---	---	---	PASS
STIL	6491	broad.mit.edu	37	1	47761474	47761474	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47761474A>T	uc001crc.1	-	7	903	c.748T>A	c.(748-750)TCT>ACT	p.S250T	TAL1_uc001crb.1_Intron|STIL_uc010omn.1_Missense_Mutation_p.S203T|STIL_uc010omo.1_Missense_Mutation_p.S250T|STIL_uc001crd.1_Missense_Mutation_p.S250T|STIL_uc001cre.1_Missense_Mutation_p.S250T|STIL_uc001crg.1_Missense_Mutation_p.S203T	NM_003035	NP_003026	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus isoform 2	250					cell proliferation|multicellular organismal development	centrosome|cytosol				lung(2)|skin(1)	3		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				TTGGGATCAGATTCCAACAAA	0.303													7	129	---	---	---	---	PASS
JAK1	3716	broad.mit.edu	37	1	65344794	65344794	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65344794A>T	uc001dbu.1	-	4	492	c.243T>A	c.(241-243)TAT>TAA	p.Y81*	JAK1_uc009wam.1_Nonsense_Mutation_p.Y69*|JAK1_uc001dbv.2_5'Flank	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1	81	FERM.				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		TGTTCTCGTCATACAGGGCAA	0.463			Mis		ALL								9	85	---	---	---	---	PASS
ABCD3	5825	broad.mit.edu	37	1	94943864	94943864	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94943864G>A	uc001dqn.3	+	8	779	c.677G>A	c.(676-678)GGA>GAA	p.G226E	ABCD3_uc001dqm.3_Missense_Mutation_p.G226E|ABCD3_uc010oto.1_Missense_Mutation_p.G250E|ABCD3_uc010otp.1_Missense_Mutation_p.G153E|ABCD3_uc009wdr.2_Missense_Mutation_p.G226E	NM_002858	NP_002849	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D, member 3	226	ABC transmembrane type-1.|Helical; (Potential).				peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		AGTGCAATTGGAGCTCAGGTG	0.269													36	80	---	---	---	---	PASS
PRPF3	9129	broad.mit.edu	37	1	150301001	150301001	+	Intron	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150301001G>T	uc001eum.3	+						PRPF3_uc009wlo.2_3'UTR|PRPF3_uc009wlp.2_Intron|PRPF3_uc010pca.1_Intron|PRPF3_uc010pcb.1_Intron	NM_004698	NP_004689	O43395	PRPF3_HUMAN	PRP3 pre-mRNA processing factor 3 homolog						nuclear mRNA splicing, via spliceosome	Cajal body|cytoplasm|nuclear speck|spliceosomal complex	protein binding			ovary(1)	1	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		TGTATTTATTGTGGAAttttt	0.239													8	65	---	---	---	---	PASS
RPRD2	23248	broad.mit.edu	37	1	150444821	150444821	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150444821A>G	uc009wlr.2	+	11	3598	c.3397A>G	c.(3397-3399)ACA>GCA	p.T1133A	RPRD2_uc010pcc.1_3'UTR|RPRD2_uc001eup.3_Missense_Mutation_p.T1107A	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing	1133							protein binding			ovary(1)	1						TGATCTGAGCACATCAGGTAG	0.567													23	70	---	---	---	---	PASS
KPRP	448834	broad.mit.edu	37	1	152732829	152732829	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152732829C>A	uc001fal.1	+	2	823	c.765C>A	c.(763-765)TGC>TGA	p.C255*		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	255						cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGCAGATGCCTTCCTCCTC	0.617													70	56	---	---	---	---	PASS
MSTO2P	100129405	broad.mit.edu	37	1	155718444	155718444	+	RNA	SNP	T	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155718444T>C	uc010pgp.1	+	10		c.1068T>C				NR_024117				Homo sapiens SLTP005 (LST005) mRNA, complete cds.												0						TCCAGGCCAGTCCCTTCCTGA	0.537													96	91	---	---	---	---	PASS
MYOC	4653	broad.mit.edu	37	1	171605694	171605694	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171605694G>A	uc001ghu.2	-	3	908	c.886C>T	c.(886-888)CGC>TGC	p.R296C	MYOC_uc010pmk.1_Missense_Mutation_p.R238C	NM_000261	NP_000252	Q99972	MYOC_HUMAN	myocilin precursor	296	Olfactomedin-like.				anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity			lung(1)	1	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					AAAACCTGGCGGACATCCGTG	0.542													47	133	---	---	---	---	PASS
GLT25D2	23127	broad.mit.edu	37	1	183942768	183942768	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183942768C>G	uc001gqr.2	-	4	981	c.609G>C	c.(607-609)TGG>TGC	p.W203C	GLT25D2_uc010poj.1_Missense_Mutation_p.W203C|GLT25D2_uc001gqs.2_Missense_Mutation_p.W83C	NM_015101	NP_055916	Q8IYK4	GT252_HUMAN	glycosyltransferase 25 domain containing 2	203					lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity			ovary(1)|breast(1)	2						TGATTCCGCACCAGAAATTAG	0.443													20	446	---	---	---	---	PASS
PPP1R15B	84919	broad.mit.edu	37	1	204380282	204380282	+	Silent	SNP	T	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204380282T>C	uc001hav.3	-	1	663	c.258A>G	c.(256-258)CAA>CAG	p.Q86Q		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	86					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			CACCGAAAAGTTGGCTCCAAA	0.587													20	277	---	---	---	---	PASS
TARBP1	6894	broad.mit.edu	37	1	234536934	234536934	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234536934C>T	uc001hwd.2	-	25	4064	c.4064G>A	c.(4063-4065)TGT>TAT	p.C1355Y		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	1355					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			CACCTCTAGACAATAATCCTT	0.358													15	38	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21225676	21225676	+	Silent	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21225676C>T	uc002red.2	-	29	12746	c.12618G>A	c.(12616-12618)GGG>GGA	p.G4206G		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	4206					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TCCCAGGTTTCCCCGGAAACT	0.438													109	92	---	---	---	---	PASS
IFT172	26160	broad.mit.edu	37	2	27704017	27704017	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27704017G>T	uc002rku.2	-	8	732	c.681C>A	c.(679-681)CAC>CAA	p.H227Q	IFT172_uc002rkw.2_Missense_Mutation_p.H227Q|IFT172_uc010yls.1_Missense_Mutation_p.H206Q|IFT172_uc010ezc.2_Missense_Mutation_p.H227Q|IFT172_uc002rkv.2_Missense_Mutation_p.H227Q	NM_015662	NP_056477	Q9UG01	IF172_HUMAN	selective LIM binding factor homolog	227	WD 5.				cilium assembly	cilium	binding			large_intestine(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)					TTTGTAGCATGTGACCTTCTT	0.507													61	36	---	---	---	---	PASS
SLC3A1	6519	broad.mit.edu	37	2	44507853	44507853	+	Splice_Site	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44507853A>G	uc002ruc.3	+	2	509	c.431_splice	c.e2-2	p.G144_splice	SLC3A1_uc002rty.2_Splice_Site_p.G144_splice|SLC3A1_uc002rtz.2_Splice_Site_p.G144_splice|SLC3A1_uc002rua.2_Splice_Site_p.G144_splice|SLC3A1_uc002rub.2_Splice_Site_p.G144_splice	NM_000341	NP_000332	Q07837	SLC31_HUMAN	solute carrier family 3, member 1						carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	TTTTTTCTTCAGGTATTCAAG	0.284													20	71	---	---	---	---	PASS
ERLEC1	27248	broad.mit.edu	37	2	54045137	54045137	+	3'UTR	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54045137C>T	uc002rxl.2	+	14					ASB3_uc002rxi.3_Intron|ERLEC1_uc002rxm.2_3'UTR|ERLEC1_uc002rxn.2_3'UTR	NM_015701	NP_056516	Q96DZ1	ERLEC_HUMAN	erlectin isoform 1						ER-associated protein catabolic process	endoplasmic reticulum lumen	glycoprotein binding|protein binding			ovary(2)	2						AAGAAAAGATCATTGAAAGTC	0.368													31	82	---	---	---	---	PASS
SLC4A5	57835	broad.mit.edu	37	2	74477471	74477471	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74477471T>A	uc002sko.1	-	12	1654	c.1652A>T	c.(1651-1653)CAG>CTG	p.Q551L	SLC4A5_uc002skl.2_RNA|SLC4A5_uc002skn.2_Missense_Mutation_p.Q551L|SLC4A5_uc010ffc.1_Missense_Mutation_p.Q551L|SLC4A5_uc002skp.1_Missense_Mutation_p.Q487L|SLC4A5_uc002sks.1_Missense_Mutation_p.Q551L	NM_021196	NP_067019	Q9BY07	S4A5_HUMAN	sodium bicarbonate transporter 4 isoform a	551	Extracellular (Potential).					apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						CGCACACACCTGATAATTGTC	0.527											OREG0014716	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	43	33	---	---	---	---	PASS
ZAP70	7535	broad.mit.edu	37	2	98351754	98351754	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98351754C>T	uc002syd.1	+	10	1331	c.1124C>T	c.(1123-1125)ACG>ATG	p.T375M	ZAP70_uc010yvf.1_3'UTR|ZAP70_uc002sye.1_Missense_Mutation_p.T265M|ZAP70_uc002syf.1_Missense_Mutation_p.T68M	NM_001079	NP_001070	P43403	ZAP70_HUMAN	zeta-chain associated protein kinase 70kDa	375	Protein kinase.				immune response|intracellular protein kinase cascade|positive thymic T cell selection|T cell receptor signaling pathway	cytosol|T cell receptor complex	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						AAGCAGGGCACGGAGAAGGCA	0.672													15	215	---	---	---	---	PASS
BUB1	699	broad.mit.edu	37	2	111413453	111413453	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111413453G>C	uc002tgc.2	-	16	1851	c.1739C>G	c.(1738-1740)ACT>AGT	p.T580S	BUB1_uc010yxh.1_Missense_Mutation_p.T560S|BUB1_uc010fkb.2_Missense_Mutation_p.T580S	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1	580					apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		ACCCCATACAGTTGAGTCATC	0.458													18	619	---	---	---	---	PASS
CYP27C1	339761	broad.mit.edu	37	2	127961091	127961091	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127961091G>C	uc002tod.2	-	2	166	c.35C>G	c.(34-36)CCG>CGG	p.P12R		NM_001001665	NP_001001665	Q4G0S4	C27C1_HUMAN	cytochrome P450, family 27, subfamily C,	12						membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.071)		CACATCTTTCGGTTTCAGAAT	0.413													190	196	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179434729	179434729	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179434729A>C	uc010zfg.1	-	275	68650	c.68426T>G	c.(68425-68427)TTC>TGC	p.F22809C	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.F16504C|TTN_uc010zfi.1_Missense_Mutation_p.F16437C|TTN_uc010zfj.1_Missense_Mutation_p.F16312C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	23736							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAAACTCTGAACTCATAATC	0.453													6	163	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38647616	38647616	+	Silent	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38647616G>T	uc003cio.2	-	10	1358	c.1164C>A	c.(1162-1164)ATC>ATA	p.I388I	SCN5A_uc003cin.2_Silent_p.I388I|SCN5A_uc003cil.3_Silent_p.I388I|SCN5A_uc010hhi.2_Silent_p.I388I|SCN5A_uc010hhk.2_Silent_p.I388I|SCN5A_uc011ayr.1_Silent_p.I388I|SCN5A_uc010hhj.1_5'UTR	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	388					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	AGATCATGTAGATCTTCCCTG	0.557													32	23	---	---	---	---	PASS
LIMD1	8994	broad.mit.edu	37	3	45637344	45637344	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45637344G>C	uc003coq.2	+	1	1022	c.973G>C	c.(973-975)GTG>CTG	p.V325L		NM_014240	NP_055055	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	325					cytoplasmic mRNA processing body assembly|gene silencing by miRNA|multicellular organismal development|negative regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasmic mRNA processing body|nucleus|RNA-induced silencing complex	protein binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		GGTTTCAGGTGTGATGTCCAA	0.602													54	37	---	---	---	---	PASS
SPINK8	646424	broad.mit.edu	37	3	48362546	48362546	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48362546G>T	uc003csq.1	-	2	86	c.86C>A	c.(85-87)GCC>GAC	p.A29D		NM_001080525	NP_001073994	P0C7L1	ISK8_HUMAN	serine peptidase inhibitor, Kazal type 8	29						extracellular region	serine-type endopeptidase inhibitor activity				0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TCTTTCAGAGGCCATAGGAAG	0.483													3	16	---	---	---	---	PASS
FAM116A	201627	broad.mit.edu	37	3	57678668	57678668	+	Silent	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57678668G>A	uc003dja.2	-	1	149	c.78C>T	c.(76-78)GGC>GGT	p.G26G		NM_152678	NP_689891	Q8IWF6	F116A_HUMAN	hypothetical protein LOC201627	26										pancreas(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000621)|KIRC - Kidney renal clear cell carcinoma(284;0.0485)|Kidney(284;0.0607)		GCGCCTCGCGGCCCTCGGCCC	0.751													2	0	---	---	---	---	PASS
WDR5B	54554	broad.mit.edu	37	3	122133533	122133533	+	Silent	SNP	A	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122133533A>T	uc003efa.1	-	1	1350	c.843T>A	c.(841-843)ATT>ATA	p.I281I		NM_019069	NP_061942	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	281	WD 6.									ovary(3)	3				GBM - Glioblastoma multiforme(114;0.0704)		GAAGGTTCCAAATGTAAACCA	0.403													103	154	---	---	---	---	PASS
ZIC4	84107	broad.mit.edu	37	3	147114035	147114035	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147114035A>G	uc003ewd.1	-	3	565	c.292T>C	c.(292-294)TAC>CAC	p.Y98H	ZIC4_uc003ewc.1_Missense_Mutation_p.Y28H|ZIC4_uc011bno.1_Missense_Mutation_p.Y148H	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	98						nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						ATGCCCCCGTAGCCATGCAGG	0.687													13	13	---	---	---	---	PASS
TNIK	23043	broad.mit.edu	37	3	170945979	170945979	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170945979G>A	uc003fhh.2	-	3	500	c.155C>T	c.(154-156)GCC>GTC	p.A52V	TNIK_uc003fhi.2_Missense_Mutation_p.A52V|TNIK_uc003fhj.2_Missense_Mutation_p.A52V|TNIK_uc003fhk.2_Missense_Mutation_p.A52V|TNIK_uc003fhl.2_Missense_Mutation_p.A52V|TNIK_uc003fhm.2_Missense_Mutation_p.A52V|TNIK_uc003fhn.2_Missense_Mutation_p.A52V|TNIK_uc003fho.2_Missense_Mutation_p.A52V	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	52	Protein kinase.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			AACCTTGATGGCTGCAAGCTG	0.308													17	116	---	---	---	---	PASS
DNAJB11	51726	broad.mit.edu	37	3	186299285	186299285	+	Silent	SNP	C	T	T	rs138789127		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186299285C>T	uc003fqi.2	+	5	802	c.582C>T	c.(580-582)GAC>GAT	p.D194D		NM_016306	NP_057390	Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	194					protein folding	endoplasmic reticulum lumen	heat shock protein binding			ovary(1)|lung(1)	2	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		TGGTCTGCGACGAATGCCCTA	0.502													58	93	---	---	---	---	PASS
HSP90AB2P	391634	broad.mit.edu	37	4	13338959	13338959	+	RNA	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13338959G>A	uc003gms.2	+	1		c.3923G>A				NR_003132				Homo sapiens heat shock protein 90Bb (HSP90Bb) mRNA, complete cds.											kidney(1)	1						ACAAGACCAAGCCTATTTGGA	0.289													22	52	---	---	---	---	PASS
HSP90AB2P	391634	broad.mit.edu	37	4	13338960	13338960	+	RNA	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13338960C>T	uc003gms.2	+	1		c.3924C>T				NR_003132				Homo sapiens heat shock protein 90Bb (HSP90Bb) mRNA, complete cds.											kidney(1)	1						CAAGACCAAGCCTATTTGGAC	0.289													22	52	---	---	---	---	PASS
TMPRSS11A	339967	broad.mit.edu	37	4	68780433	68780433	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68780433T>C	uc003hdr.1	-	9	1098	c.977A>G	c.(976-978)GAT>GGT	p.D326G	LOC550112_uc003hdl.3_Intron|TMPRSS11A_uc003hds.1_Missense_Mutation_p.D323G	NM_182606	NP_872412	Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A isoform 1	326	Peptidase S1.|Extracellular (Potential).				cell cycle|proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			skin(1)	1						TTCTCGGAGATCATTTTGGGA	0.378													101	153	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187535488	187535488	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187535488G>A	uc003izf.2	-	12	9274	c.9086C>T	c.(9085-9087)TCA>TTA	p.S3029L		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	3029	Extracellular (Potential).|Cadherin 28.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						AATAGTGTCTGAATATAAAGT	0.373										HNSCC(5;0.00058)			56	85	---	---	---	---	PASS
WDR70	55100	broad.mit.edu	37	5	37379472	37379472	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37379472G>A	uc003jkv.2	+	1	61	c.3G>A	c.(1-3)ATG>ATA	p.M1I	WDR70_uc010iva.1_Missense_Mutation_p.M1I	NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	WD repeat domain 70	1										ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGCCAGCCATGGAGCGCTCTG	0.657													67	168	---	---	---	---	PASS
PCDHGB7	56099	broad.mit.edu	37	5	140798209	140798209	+	Silent	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140798209C>T	uc003lkn.1	+	1	928	c.783C>T	c.(781-783)ATC>ATT	p.I261I	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Silent_p.I261I|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	NM_018927	NP_061750	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7 isoform 1	261	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACCTCCATCCTGAGAGTGA	0.532													28	51	---	---	---	---	PASS
PCDHGC5	56097	broad.mit.edu	37	5	140890569	140890569	+	Silent	SNP	C	T	T	rs143630962		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140890569C>T	uc003lla.1	+	4	2664	c.2664C>T	c.(2662-2664)AGC>AGT	p.S888S	PCDHGA1_uc003lji.1_Silent_p.S875S|PCDHGA2_uc003ljk.1_Silent_p.S876S|PCDHGA3_uc003ljm.1_Silent_p.S876S|PCDHGA3_uc010jfx.1_Silent_p.S636S|PCDHGB1_uc003ljo.1_Silent_p.S871S|PCDHGA4_uc003ljq.1_Silent_p.S875S|PCDHGB2_uc003ljs.1_Silent_p.S875S|PCDHGA5_uc003lju.1_Silent_p.S875S|PCDHGB3_uc003ljw.1_Silent_p.S873S|PCDHGA6_uc003ljy.1_Silent_p.S876S|PCDHGA7_uc003lka.1_Silent_p.S876S|PCDHGB4_uc003lkc.1_Silent_p.S867S|PCDHGA8_uc003lkd.1_Silent_p.S876S|PCDHGB5_uc003lkf.1_Silent_p.S867S|PCDHGA9_uc003lkh.1_Silent_p.S876S|PCDHGB6_uc003lkj.1_Silent_p.S874S|PCDHGA10_uc003lkl.1_Silent_p.S880S|PCDHGB7_uc003lkn.1_Silent_p.S873S|PCDHGA11_uc003lkp.1_Silent_p.S694S|PCDHGA11_uc003lkq.1_Silent_p.S879S|PCDHGA12_uc003lkt.1_Silent_p.S876S|PCDHGC3_uc003lkv.1_Silent_p.S878S|PCDHGC3_uc003lkw.1_Silent_p.S78S|PCDHGC4_uc003lky.1_Silent_p.S882S	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5 isoform 1	888	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGATTGAGCGCCCGCTACG	0.617													91	183	---	---	---	---	PASS
G3BP1	10146	broad.mit.edu	37	5	151166245	151166245	+	Silent	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151166245C>T	uc003lun.2	+	2	235	c.64C>T	c.(64-66)CTG>TTG	p.L22L	G3BP1_uc010jhy.1_Silent_p.L22L|G3BP1_uc003lum.2_Silent_p.L22L|G3BP1_uc011dcu.1_5'UTR|G3BP1_uc010jhz.2_5'UTR|uc003luo.1_5'Flank|uc003lup.1_5'Flank	NM_005754	NP_005745	Q13283	G3BP1_HUMAN	Ras-GTPase-activating protein SH3-domain-binding	22	NTF2.				Ras protein signal transduction|transport	cytosol|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|endonuclease activity|protein binding|RNA binding			skin(3)|ovary(1)	4		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			GTATTACACACTGCTGAACCA	0.463													66	145	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169494626	169494626	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169494626T>A	uc003maf.2	+	45	4660	c.4580T>A	c.(4579-4581)CTC>CAC	p.L1527H	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.L1019H|DOCK2_uc003mah.2_Missense_Mutation_p.L83H	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1527	DHR-2.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATCAACCCACTCTCCATGCTC	0.522													19	216	---	---	---	---	PASS
TAP2	6891	broad.mit.edu	37	6	32800178	32800178	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32800178C>A	uc003occ.2	-	6	1235	c.1204G>T	c.(1204-1206)GGG>TGG	p.G402W	TAP2_uc011dqf.1_Missense_Mutation_p.G402W|TAP2_uc003ocb.1_Missense_Mutation_p.G402W|TAP2_uc003ocd.2_Missense_Mutation_p.G402W	NM_018833	NP_061313	Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family	402	Lumenal (Potential).|ABC transmembrane type-1.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding				0						GTGAGCTCCCCATCCTGCATC	0.567													3	39	---	---	---	---	PASS
B3GALT4	8705	broad.mit.edu	37	6	33246066	33246066	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33246066G>T	uc003odr.2	+	1	1150	c.870G>T	c.(868-870)GAG>GAT	p.E290D		NM_003782	NP_003773	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta	290	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	ganglioside galactosyltransferase activity|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)|breast(1)	2						TCCCATTAGAGGATGTCTTTG	0.617													46	117	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57185282	57185282	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57185282T>A	uc003pdx.2	+	3	269	c.182T>A	c.(181-183)GTG>GAG	p.V61E	PRIM2_uc003pdv.1_Missense_Mutation_p.V61E|PRIM2_uc003pdw.2_Missense_Mutation_p.V61E	NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	61					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AATCTTGGAGTGAGCTATGTG	0.323													12	26	---	---	---	---	PASS
IMPG1	3617	broad.mit.edu	37	6	76715159	76715159	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76715159G>A	uc003pik.1	-	10	1110	c.980C>T	c.(979-981)TCC>TTC	p.S327F		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	327	SEA 1.				visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				AATTTTGTTGGAATCAAAAGA	0.453													79	140	---	---	---	---	PASS
AIM1	202	broad.mit.edu	37	6	106987378	106987378	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106987378A>G	uc003prh.2	+	7	4082	c.3595A>G	c.(3595-3597)ATT>GTT	p.I1199V	AIM1_uc003pri.2_5'Flank	NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	1199	Beta/gamma crystallin 'Greek key' 4.						sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AGAAGCGTACATTGGATCCAT	0.443													8	113	---	---	---	---	PASS
C6orf186	728464	broad.mit.edu	37	6	110620348	110620348	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110620348C>A	uc010kdu.1	-	4	563	c.563G>T	c.(562-564)GGA>GTA	p.G188V	C6orf186_uc003pub.2_5'UTR	NM_001123364	NP_001116836	Q5JXM2	CF186_HUMAN	chromosome 6 open reading frame 186 precursor	188						extracellular region					0						ATCATCACTTCCTAGCCTATA	0.423													6	71	---	---	---	---	PASS
TMEM195	392636	broad.mit.edu	37	7	15433778	15433778	+	Silent	SNP	T	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15433778T>C	uc003stb.1	-	6	806	c.636A>G	c.(634-636)GAA>GAG	p.E212E		NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195	212					ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						TAAGAATCAGTTCCAAAGGAC	0.299													68	120	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20739468	20739468	+	Silent	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20739468A>G	uc003suw.3	+	9	1386	c.840A>G	c.(838-840)AAA>AAG	p.K280K	ABCB5_uc010kuh.2_Silent_p.K725K	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	280	Cytoplasmic (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						ATAATGATAAAACCACATTAA	0.294													25	64	---	---	---	---	PASS
POLM	27434	broad.mit.edu	37	7	44113448	44113448	+	Silent	SNP	T	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44113448T>C	uc003tjt.2	-	9	1340	c.1248A>G	c.(1246-1248)AGA>AGG	p.R416R	POLM_uc003tjw.1_Silent_p.R35R|POLM_uc003tju.2_Silent_p.R379R|POLM_uc003tjx.2_Silent_p.R336R|POLM_uc003tjv.2_RNA|POLM_uc011kbt.1_Silent_p.R66R	NM_013284	NP_037416	Q9NP87	DPOLM_HUMAN	DNA-directed DNA polymerase mu	416					DNA recombination|DNA repair	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3						CCAAGTCCACTCTCACGGCCT	0.627								DNA_polymerases_(catalytic_subunits)					41	71	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48682951	48682951	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48682951G>A	uc003toq.2	+	60	14930	c.14905G>A	c.(14905-14907)GAC>AAC	p.D4969N	ABCA13_uc010kys.1_Missense_Mutation_p.D2044N|ABCA13_uc010kyt.1_RNA|ABCA13_uc010kyu.1_Missense_Mutation_p.D699N	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	4969					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CACTGTTTCTGACCACTTGAA	0.308													34	306	---	---	---	---	PASS
RUNDC3B	154661	broad.mit.edu	37	7	87445570	87445570	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87445570G>A	uc003ujb.2	+	11	1680	c.1269G>A	c.(1267-1269)ATG>ATA	p.M423I	RUNDC3B_uc011khd.1_Missense_Mutation_p.M404I|RUNDC3B_uc011khe.1_Missense_Mutation_p.M406I|RUNDC3B_uc003ujc.2_Missense_Mutation_p.M357I|RUNDC3B_uc003ujd.2_Missense_Mutation_p.M279I	NM_138290	NP_612147	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B isoform a	423										skin(1)	1	Esophageal squamous(14;0.00164)					TAAATGTAATGAGTGAAGGTA	0.368													29	43	---	---	---	---	PASS
DNAJC2	27000	broad.mit.edu	37	7	102963110	102963110	+	Intron	SNP	A	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102963110A>C	uc003vbo.2	-						PMPCB_uc011kll.1_Intron|DNAJC2_uc003vbn.2_Translation_Start_Site|DNAJC2_uc010lix.2_Intron|DNAJC2_uc003vbp.2_Translation_Start_Site	NM_014377	NP_055192	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2						'de novo' cotranslational protein folding|chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane	chromatin binding|DNA binding|histone binding|Hsp70 protein binding|ubiquitin binding			kidney(1)	1						TCTCATTTTGAATTTCTAACA	0.259													29	61	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141770916	141770916	+	Intron	SNP	A	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141770916A>T	uc003vwy.2	+							NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase						polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ACACCCACTTAAGGTGAATGA	0.468													20	32	---	---	---	---	PASS
IARS	3376	broad.mit.edu	37	9	95027315	95027315	+	Silent	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95027315G>A	uc004art.1	-	16	1853	c.1596C>T	c.(1594-1596)AGC>AGT	p.S532S	IARS_uc004ars.1_Silent_p.S377S|IARS_uc004aru.3_Silent_p.S532S|IARS_uc010mqr.2_Silent_p.S422S|IARS_uc010mqt.2_Intron	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase	532					isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	CATAGGGCATGCTGCCACTCT	0.493													19	26	---	---	---	---	PASS
FAM120A	23196	broad.mit.edu	37	9	96320221	96320221	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96320221A>C	uc004atw.2	+	14	2622	c.2597A>C	c.(2596-2598)TAC>TCC	p.Y866S	FAM120A_uc004aty.2_Missense_Mutation_p.Y647S|FAM120A_uc004atz.2_Missense_Mutation_p.Y515S|FAM120A_uc010mrg.2_Missense_Mutation_p.Y179S	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN	oxidative stress-associated Src activator	866	RNA binding.					cytoplasm|plasma membrane	RNA binding				0						CTGCCCTTCTACCCTGCCTCT	0.647													4	20	---	---	---	---	PASS
RSU1	6251	broad.mit.edu	37	10	16794515	16794515	+	Intron	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16794515A>G	uc001iok.2	-						RSU1_uc001iol.2_Intron|RSU1_uc001iom.2_Intron|RSU1_uc001ion.2_3'UTR	NM_152724	NP_689937	Q15404	RSU1_HUMAN	ras suppressor protein 1 isoform 2						cell junction assembly|signal transduction	cytosol	protein binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(1;7.54e-08)		CCCAGAACTAAGTTCATTCAT	0.473													73	107	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37478443	37478443	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37478443A>G	uc001iza.1	+	25	2401	c.2302A>G	c.(2302-2304)ACG>GCG	p.T768A		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	824						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						ACCCAAGGCTACGCATCAAAA	0.289													3	28	---	---	---	---	PASS
MAPK8	5599	broad.mit.edu	37	10	49642940	49642940	+	Silent	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49642940C>T	uc009xnz.2	+	12	1376	c.1152C>T	c.(1150-1152)ATC>ATT	p.I384I	MAPK8_uc001jgl.2_3'UTR|MAPK8_uc001jgm.2_Silent_p.I384I|MAPK8_uc001jgo.2_3'UTR|MAPK8_uc009xoa.2_3'UTR|MAPK8_uc001jgn.2_Silent_p.I384I|MAPK8_uc010qgk.1_3'UTR|MAPK8_uc001jgp.2_Silent_p.I384I|MAPK8_uc001jgq.2_3'UTR	NM_139047	NP_620635	P45983	MK08_HUMAN	mitogen-activated protein kinase 8 isoform JNK1	384					activation of pro-apoptotic gene products|cellular response to mechanical stimulus|induction of apoptosis by intracellular signals|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of apoptosis|negative regulation of protein binding|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of deacetylase activity|regulation of protein localization|regulation of sequence-specific DNA binding transcription factor activity|response to UV|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|histone deacetylase binding|histone deacetylase regulator activity|JUN kinase activity|protein binding			central_nervous_system(3)|lung(2)|stomach(1)|ovary(1)|kidney(1)	8		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		CAGCAGTGATCAATGGCTCTC	0.473													13	210	---	---	---	---	PASS
NCOA4	8031	broad.mit.edu	37	10	51584968	51584968	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51584968A>C	uc001jis.3	+	8	1270	c.1067A>C	c.(1066-1068)AAA>ACA	p.K356T	PARG_uc001jih.2_Intron|uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|NCOA4_uc009xon.2_Missense_Mutation_p.K372T|NCOA4_uc010qhd.1_Missense_Mutation_p.K372T|NCOA4_uc010qhe.1_Missense_Mutation_p.K256T|NCOA4_uc010qhf.1_Missense_Mutation_p.K190T|NCOA4_uc001jit.2_Missense_Mutation_p.K356T|NCOA4_uc009xoo.2_Missense_Mutation_p.K356T	NM_001145263	NP_001138735	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4 isoform 3	356					androgen receptor signaling pathway|male gonad development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	androgen receptor binding|transcription coactivator activity			central_nervous_system(1)|kidney(1)	2						AACCAGCCCAAAGGTGTGGAG	0.473			T	RET	papillary thyroid 								23	53	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61900235	61900235	+	Intron	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61900235G>T	uc001jky.2	-						ANK3_uc001jkw.2_5'UTR|ANK3_uc009xpa.2_5'UTR|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron|ANK3_uc001jlc.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TCCCTGGTTTGTATCCACTCT	0.423													7	23	---	---	---	---	PASS
PLCE1	51196	broad.mit.edu	37	10	95791726	95791726	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95791726A>G	uc001kjk.2	+	2	1557	c.923A>G	c.(922-924)GAT>GGT	p.D308G	PLCE1_uc010qnx.1_Missense_Mutation_p.D308G	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	308					activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				GATAATTGTGATGATGTAGAA	0.373													108	181	---	---	---	---	PASS
SLC25A28	81894	broad.mit.edu	37	10	101373512	101373512	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101373512T>G	uc001kpx.2	-	2	590	c.461A>C	c.(460-462)AAG>ACG	p.K154T	SLC25A28_uc001kpy.2_5'UTR|SLC25A28_uc009xwk.1_Missense_Mutation_p.K154T	NM_031212	NP_112489	Q96A46	MFRN2_HUMAN	solute carrier family 25, member 28	154	Solcar 1.				ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Colorectal(252;0.234)		Epithelial(162;2.57e-10)|all cancers(201;2.01e-08)		CTTTTTTAACTTTTCGTAGCA	0.517													39	62	---	---	---	---	PASS
GAS2	2620	broad.mit.edu	37	11	22707336	22707336	+	Splice_Site	SNP	G	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22707336G>C	uc009yie.2	+	3	573	c.267_splice	c.e3+1	p.K89_splice	GAS2_uc001mqm.2_Splice_Site_p.K89_splice|GAS2_uc001mqn.2_Splice_Site|GAS2_uc001mqo.2_Splice_Site_p.K89_splice	NM_001143830	NP_001137302	O43903	GAS2_HUMAN	growth arrest-specific 2						cell cycle arrest|cellular component disassembly involved in apoptosis|regulation of cell shape	actin filament|cytosol|membrane				ovary(1)|skin(1)	2						GCCCACAAAGGTAAAAGATCC	0.358													53	72	---	---	---	---	PASS
KIF18A	81930	broad.mit.edu	37	11	28045366	28045366	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28045366C>T	uc001msc.2	-	16	2718	c.2536G>A	c.(2536-2538)GTA>ATA	p.V846I		NM_031217	NP_112494	Q8NI77	KI18A_HUMAN	kinesin family member 18A	846					blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2						CCAGAATTTACGTCTGCAGTT	0.318													47	71	---	---	---	---	PASS
TUT1	64852	broad.mit.edu	37	11	62348882	62348882	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62348882C>G	uc001nto.2	-	3	717	c.679G>C	c.(679-681)GAG>CAG	p.E227Q		NM_022830	NP_073741	Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6	189					mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2						GTGAAGACCTCCTGCATCAGG	0.587													7	61	---	---	---	---	PASS
NOX4	50507	broad.mit.edu	37	11	89223701	89223701	+	Silent	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89223701A>G	uc001pct.2	-	2	317	c.78T>C	c.(76-78)AAT>AAC	p.N26N	NOX4_uc009yvr.2_Intron|NOX4_uc001pcu.2_5'UTR|NOX4_uc001pcw.2_Silent_p.N26N|NOX4_uc001pcx.2_Silent_p.N26N|NOX4_uc001pcv.2_Silent_p.N26N|NOX4_uc009yvo.2_RNA|NOX4_uc010rtu.1_5'UTR|NOX4_uc009yvp.2_Silent_p.N26N|NOX4_uc010rtv.1_Silent_p.N2N|NOX4_uc009yvq.2_Silent_p.N2N|NOX4_uc009yvs.1_RNA|NOX4_uc001pcy.2_RNA	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	26	Helical; (Potential).				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AAAGCAGGACATTCATGGAGA	0.388													62	95	---	---	---	---	PASS
APLP2	334	broad.mit.edu	37	11	129999984	129999984	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129999984G>C	uc010sby.1	+	11	1664	c.1507G>C	c.(1507-1509)GAT>CAT	p.D503H	APLP2_uc001qfp.2_Missense_Mutation_p.D503H|APLP2_uc001qfq.2_Missense_Mutation_p.D447H|APLP2_uc010sbz.1_Missense_Mutation_p.D291H|APLP2_uc001qfr.2_Missense_Mutation_p.D269H|APLP2_uc001qfs.2_Missense_Mutation_p.D274H|APLP2_uc001qfv.2_Missense_Mutation_p.D394H	NM_001642	NP_001633	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	503	Extracellular (Potential).				G-protein coupled receptor protein signaling pathway	integral to membrane|nucleus|plasma membrane	DNA binding|identical protein binding|serine-type endopeptidase inhibitor activity			ovary(3)	3	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		TGAGAACAAAGATCGCTTACA	0.453													89	169	---	---	---	---	PASS
TPI1	7167	broad.mit.edu	37	12	6979622	6979622	+	3'UTR	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6979622C>T	uc001qrk.2	+	7					TPI1_uc010sfo.1_3'UTR	NM_000365	NP_000356	P60174	TPIS_HUMAN	triosephosphate isomerase 1 isoform 1						fatty acid biosynthetic process|gluconeogenesis|glycolysis|pentose-phosphate shunt	cytosol	triose-phosphate isomerase activity				0						CTGCCCTTTCCCTGCATATGC	0.498											OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	31	37	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57590881	57590881	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57590881T>A	uc001snd.2	+	56	9475	c.9009T>A	c.(9007-9009)TAT>TAA	p.Y3003*		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3003	Extracellular (Potential).|EGF-like 12; calcium-binding (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	ATGGCAGCTATAAGTGTCTGT	0.637													16	106	---	---	---	---	PASS
APPL2	55198	broad.mit.edu	37	12	105589090	105589090	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105589090G>A	uc001tlf.1	-	14	1408	c.1190C>T	c.(1189-1191)GCA>GTA	p.A397V	APPL2_uc010swt.1_Missense_Mutation_p.A354V|APPL2_uc001tlg.1_Missense_Mutation_p.A151V|APPL2_uc010swu.1_Missense_Mutation_p.A403V|APPL2_uc009zuq.2_Missense_Mutation_p.A354V	NM_018171	NP_060641	Q8NEU8	DP13B_HUMAN	adaptor protein, phosphotyrosine interaction, PH	397	Required for RAB5A binding (By similarity).				cell cycle|cell proliferation|signal transduction	early endosome membrane|nucleus	protein binding			upper_aerodigestive_tract(1)	1						GGGAGTCACTGCTTGCAGAGC	0.448													29	78	---	---	---	---	PASS
TRAFD1	10906	broad.mit.edu	37	12	112572550	112572550	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112572550A>G	uc001ttp.2	+	3	142	c.56A>G	c.(55-57)GAA>GGA	p.E19G	TRAFD1_uc001tto.2_Missense_Mutation_p.E19G|TRAFD1_uc009zwb.2_Missense_Mutation_p.E19G|TRAFD1_uc010syj.1_RNA	NM_006700	NP_006691	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	19					negative regulation of innate immune response	intracellular	protein binding|zinc ion binding				0						AGCAAAAAAGAAATTCCTGTG	0.408													66	140	---	---	---	---	PASS
HPD	3242	broad.mit.edu	37	12	122277538	122277538	+	3'UTR	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122277538C>T	uc001ubj.2	-	14					HPD_uc001ubk.2_3'UTR	NM_002150	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase						L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	4-hydroxyphenylpyruvate dioxygenase activity|metal ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	CGCTGGTGGGCGGGACCCAAG	0.711													4	12	---	---	---	---	PASS
CDK8	1024	broad.mit.edu	37	13	26978230	26978230	+	3'UTR	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26978230A>G	uc001uqr.1	+	13					CDK8_uc001uqs.1_3'UTR|CDK8_uc001uqt.1_3'UTR	NM_001260	NP_001251	P49336	CDK8_HUMAN	cyclin-dependent kinase 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|large_intestine(1)|ovary(1)|skin(1)	5	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		CTGCATCGGAATCTTGTCCAT	0.542													51	79	---	---	---	---	PASS
PAN3	255967	broad.mit.edu	37	13	28750663	28750663	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28750663C>G	uc001urz.2	+	2	156	c.148C>G	c.(148-150)CTA>GTA	p.L50V	PAN3_uc010tdo.1_Missense_Mutation_p.L196V|PAN3_uc001ury.2_5'UTR|PAN3_uc001urx.2_Missense_Mutation_p.L50V	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	196	Interaction with polyadenylate-binding protein.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		CCCAAGCCTTCTAAATGACAG	0.313													49	137	---	---	---	---	PASS
DNAJC15	29103	broad.mit.edu	37	13	43652822	43652822	+	Silent	SNP	A	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43652822A>T	uc001uyy.2	+	4	710	c.309A>T	c.(307-309)GTA>GTT	p.V103V		NM_013238	NP_037370	Q9Y5T4	DJC15_HUMAN	DNAJ domain-containing	103	J.					integral to membrane	heat shock protein binding				0		Lung NSC(96;4.3e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0737)		TTTTAGGTGTAAGGTAGGTGT	0.343													36	49	---	---	---	---	PASS
FAM155A	728215	broad.mit.edu	37	13	108518168	108518168	+	Silent	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108518168G>T	uc001vql.2	-	1	1293	c.777C>A	c.(775-777)ACC>ACA	p.T259T		NM_001080396	NP_001073865	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	259						integral to membrane	binding			skin(1)	1						GCCTGCAAGTGGTCATCTCGC	0.507													24	154	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64532268	64532268	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64532268C>T	uc001xgm.2	+	51	10561	c.10331C>T	c.(10330-10332)TCG>TTG	p.S3444L	SYNE2_uc001xgl.2_Missense_Mutation_p.S3444L|SYNE2_uc010apw.1_Missense_Mutation_p.S150L	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3444	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAGATTGTGTCGGCTCTGTGG	0.433													34	64	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64532269	64532269	+	Silent	SNP	G	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64532269G>C	uc001xgm.2	+	51	10562	c.10332G>C	c.(10330-10332)TCG>TCC	p.S3444S	SYNE2_uc001xgl.2_Silent_p.S3444S|SYNE2_uc010apw.1_Silent_p.S150S	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3444	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGATTGTGTCGGCTCTGTGGG	0.438													34	64	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71444679	71444679	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71444679T>A	uc001xmo.2	+	6	2071	c.1625T>A	c.(1624-1626)GTT>GAT	p.V542D	PCNX_uc001xmn.3_Missense_Mutation_p.V542D|PCNX_uc010are.1_Missense_Mutation_p.V542D	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	542						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GAAGGGGATGTTCGACCTAAA	0.453													64	154	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106368500	106368500	+	Splice_Site	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106368500C>T	uc010tyt.1	-	2842		c.47084_splice	c.e2842+1		KIAA0125_uc001ysq.2_Intron|KIAA0125_uc001ysr.2_Intron					Parts of antibodies, mostly variable regions.												0						TGGGCGGCACCACTGTGGTAA	0.602													6	30	---	---	---	---	PASS
ALDH1A2	8854	broad.mit.edu	37	15	58257978	58257978	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58257978T>A	uc002aex.2	-	8	904	c.846A>T	c.(844-846)AGA>AGT	p.R282S	ALDH1A2_uc002aey.2_Missense_Mutation_p.R244S|ALDH1A2_uc010ugv.1_Missense_Mutation_p.R261S|ALDH1A2_uc010ugw.1_Missense_Mutation_p.R253S|ALDH1A2_uc002aew.2_Missense_Mutation_p.R186S	NM_003888	NP_003879	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1A2 isoform 1	282					negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	CCAGAGTTACTCTCTTCAAAT	0.428													82	102	---	---	---	---	PASS
PIAS1	8554	broad.mit.edu	37	15	68457098	68457098	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68457098A>G	uc002aqz.2	+	8	1060	c.964A>G	c.(964-966)AGT>GGT	p.S322G		NM_016166	NP_057250	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	322	SP-RING-type.				androgen receptor signaling pathway|interferon-gamma-mediated signaling pathway|JAK-STAT cascade|positive regulation of protein sumoylation|positive regulation of transcription, DNA-dependent|regulation of interferon-gamma-mediated signaling pathway|transcription, DNA-dependent	nuclear speck	androgen receptor binding|DNA binding|enzyme binding|SUMO ligase activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)	2						GGATCCAGACAGTGAAATAGC	0.333													12	17	---	---	---	---	PASS
LMAN1L	79748	broad.mit.edu	37	15	75108801	75108801	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75108801G>A	uc002ayt.1	+	3	366	c.364G>A	c.(364-366)GGC>AGC	p.G122S	LMAN1L_uc010bkd.2_Missense_Mutation_p.G50S|LMAN1L_uc010ulo.1_Intron|LMAN1L_uc010bke.1_Missense_Mutation_p.G122S	NM_021819	NP_068591	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like precursor	122	Lumenal (Potential).|L-type lectin-like.					ER-Golgi intermediate compartment membrane|integral to membrane	sugar binding				0						GGGCCATGTAGGCTCTGTCCT	0.612													21	135	---	---	---	---	PASS
BNC1	646	broad.mit.edu	37	15	83932380	83932380	+	Silent	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83932380A>G	uc002bjt.1	-	4	1711	c.1623T>C	c.(1621-1623)AGT>AGC	p.S541S	BNC1_uc010uos.1_Silent_p.S529S	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	541				S->D: Strongly reduces phosphorylation and induces partial relocation into the cytoplasm.|S->A: Strongly reduces phosphorylation. Abolishes phosphorylation and induces nuclear restriction; when associated with A-537.	epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						TGATAGGCATACTGGACTTCC	0.458													15	248	---	---	---	---	PASS
EME2	197342	broad.mit.edu	37	16	1825398	1825398	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1825398G>T	uc002cmq.1	+	5	784	c.784G>T	c.(784-786)GAG>TAG	p.E262*	MRPS34_uc002cmn.2_5'Flank|MRPS34_uc002cmo.2_5'Flank|MRPS34_uc002cmp.1_5'Flank|EME2_uc010brw.1_Nonsense_Mutation_p.E218*	NM_001010865	NP_001010865	A4GXA9	EME2_HUMAN	essential meiotic endonuclease 1 homolog 2	218					DNA recombination|DNA repair	nucleus	DNA binding|endonuclease activity			lung(1)|central_nervous_system(1)|pancreas(1)	3						CAGCTGGCCGGAGGTGGAAGA	0.657								Direct_reversal_of_damage|Homologous_recombination					6	23	---	---	---	---	PASS
TSC2	7249	broad.mit.edu	37	16	2134519	2134519	+	Silent	SNP	C	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2134519C>G	uc002con.2	+	34	4402	c.4296C>G	c.(4294-4296)GCC>GCG	p.A1432A	TSC2_uc010bsd.2_Silent_p.A1409A|TSC2_uc002coo.2_Silent_p.A1365A|TSC2_uc010uvv.1_Silent_p.A1329A|TSC2_uc010uvw.1_Silent_p.A1317A|TSC2_uc002cop.2_Silent_p.A1188A|TSC2_uc002coq.2_Silent_p.A207A|TSC2_uc002cor.2_Silent_p.A133A	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1	1432					cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				CCTGGTCGGCCTCGGGCGAAG	0.706			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				10	18	---	---	---	---	PASS
KIAA0174	9798	broad.mit.edu	37	16	71961673	71961673	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71961673A>G	uc002fbj.1	+	12	1380	c.1097A>G	c.(1096-1098)GAT>GGT	p.D366G	KIAA0174_uc010cgh.1_Missense_Mutation_p.D366G|KIAA0174_uc002fbk.1_Missense_Mutation_p.M352V|KIAA0174_uc002fbm.1_Missense_Mutation_p.D353G|KIAA0174_uc002fbl.1_Missense_Mutation_p.D322G|KIAA0174_uc002fbn.1_Missense_Mutation_p.D205G|KIAA0174_uc010cgi.1_Missense_Mutation_p.D124G|KIAA0174_uc010cgj.1_Missense_Mutation_p.D270G|KIAA0174_uc010vml.1_RNA			P53990	IST1_HUMAN	SubName: Full=cDNA FLJ32696 fis, clone TESTI2000358; SubName: Full=cDNA FLJ77725;	351	Interaction with VPS4A, VTA1, MITD1 STAMBP and USP8.|MIT-interacting motif.|Interaction with VTA1.				cell cycle|cell division	cytoplasmic membrane-bounded vesicle|ER-Golgi intermediate compartment	protein binding			ovary(1)	1						ATTGACTTTGATGATCTTTCC	0.453													153	457	---	---	---	---	PASS
C17orf97	400566	broad.mit.edu	37	17	263996	263996	+	3'UTR	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:263996C>T	uc002frh.2	+	3					C17orf97_uc010vpz.1_RNA	NM_001013672	NP_001013694	Q6ZQX7	CQ097_HUMAN	hypothetical protein LOC400566											ovary(1)	1						AAATGAGACCCGTATCTGAAG	0.483													6	80	---	---	---	---	PASS
VTN	7448	broad.mit.edu	37	17	26696549	26696549	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26696549C>G	uc002hbc.2	-	3	657	c.508G>C	c.(508-510)GGT>CGT	p.G170R	SARM1_uc010wah.1_Intron|SEBOX_uc010crk.1_5'Flank|SARM1_uc010waj.1_Intron|SARM1_uc010crl.1_5'Flank	NM_000638	NP_000629	P04004	VTNC_HUMAN	vitronectin precursor	170	Hemopexin-like 1.				cell adhesion mediated by integrin|immune response|negative regulation of endopeptidase activity|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein binding|positive regulation of receptor-mediated endocytosis|positive regulation of smooth muscle cell migration|positive regulation of vascular endothelial growth factor receptor signaling pathway|smooth muscle cell-matrix adhesion	alphav-beta3 integrin-vitronectin complex|extracellular space	heparin binding|integrin binding|scavenger receptor activity			ovary(1)|kidney(1)	2	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Urokinase(DB00013)	AAGAGGGAACCGTTCTTGAGG	0.622													34	102	---	---	---	---	PASS
SEZ6	124925	broad.mit.edu	37	17	27287870	27287870	+	Silent	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27287870C>T	uc002hdp.2	-	6	1556	c.1362G>A	c.(1360-1362)CGG>CGA	p.R454R	SEZ6_uc002hdm.2_RNA|SEZ6_uc010cry.1_Silent_p.R454R|SEZ6_uc002hdq.1_Silent_p.R329R	NM_178860	NP_849191	Q53EL9	SEZ6_HUMAN	seizure related 6 homolog isoform 1	454	Extracellular (Potential).|CUB 1.					integral to membrane|plasma membrane				large_intestine(1)|central_nervous_system(1)	2	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			GCAGGTGTAGCCGCTGGCCCT	0.602													56	65	---	---	---	---	PASS
SUZ12	23512	broad.mit.edu	37	17	30310113	30310113	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30310113T>A	uc002hgs.2	+	9	1235	c.1013T>A	c.(1012-1014)CTT>CAT	p.L338H	SUZ12_uc002hgt.2_Missense_Mutation_p.L315H	NM_015355	NP_056170	Q15022	SUZ12_HUMAN	joined to JAZF1	338					negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				GAGACTATTCTTGATGGGAAG	0.403			T	JAZF1	endometrial stromal tumours								98	131	---	---	---	---	PASS
C17orf75	64149	broad.mit.edu	37	17	30660470	30660470	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30660470A>G	uc002hhg.2	-	9	972	c.941T>C	c.(940-942)CTT>CCT	p.L314P		NM_022344	NP_071739	Q9HAS0	NJMU_HUMAN	hypothetical protein LOC64149	314				L -> F (in Ref. 1; AAG23214).	spermatogenesis					ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			TTGTCGGAAAAGAAAAGGGTT	0.358													26	200	---	---	---	---	PASS
ORMDL3	94103	broad.mit.edu	37	17	38079479	38079479	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38079479G>T	uc002htj.1	-	3	352	c.212C>A	c.(211-213)CCC>CAC	p.P71H	ORMDL3_uc002hti.1_RNA|ORMDL3_uc002htk.1_Missense_Mutation_p.P71H	NM_139280	NP_644809	Q8N138	ORML3_HUMAN	ORM1-like 3	71	Lumenal (Potential).				ceramide metabolic process	integral to membrane|SPOTS complex	protein binding				0	Colorectal(19;0.000442)		Lung(15;0.0234)			GGTCTCAAAGGGTGTCCCCTT	0.567													96	208	---	---	---	---	PASS
NBR1	4077	broad.mit.edu	37	17	41341626	41341626	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41341626G>A	uc010czd.2	+	8	642	c.502G>A	c.(502-504)GAA>AAA	p.E168K	NBR1_uc010diz.2_Missense_Mutation_p.E168K|NBR1_uc010whu.1_Missense_Mutation_p.E168K|NBR1_uc010whv.1_Missense_Mutation_p.E168K|NBR1_uc010whw.1_Missense_Mutation_p.E147K|NBR1_uc010whx.1_5'Flank	NM_031862	NP_114068	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	168					macroautophagy|protein oligomerization	autophagic vacuole|cytoplasmic vesicle|cytosol|late endosome|lysosome|sarcomere	ubiquitin binding|zinc ion binding			skin(1)	1		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		AGTGGTTAACGAAACGGTTGA	0.393													55	85	---	---	---	---	PASS
MAPT	4137	broad.mit.edu	37	17	44061288	44061288	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44061288A>G	uc002ijr.3	+	6	1438	c.1118A>G	c.(1117-1119)CAA>CGA	p.Q373R	MAPT_uc010dau.2_Missense_Mutation_p.Q373R|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519	P10636	TAU_HUMAN	microtubule-associated protein tau isoform 1	373					cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)				CGGGTCCCTCAACTCAAAGGT	0.637													84	154	---	---	---	---	PASS
MED13	9969	broad.mit.edu	37	17	60129921	60129921	+	Silent	SNP	T	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60129921T>C	uc002izo.2	-	3	524	c.447A>G	c.(445-447)AAA>AAG	p.K149K		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	149					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						GTTTTTCATCTTTTTCATAAG	0.323													57	137	---	---	---	---	PASS
ENPP7	339221	broad.mit.edu	37	17	77707422	77707422	+	Missense_Mutation	SNP	G	A	A	rs145931726		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77707422G>A	uc002jxa.2	+	2	390	c.370G>A	c.(370-372)GTG>ATG	p.V124M		NM_178543	NP_848638	Q6UWV6	ENPP7_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	124					negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity			central_nervous_system(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CAACGGCAGCGTGCCCATCTG	0.622													25	31	---	---	---	---	PASS
ARHGAP28	79822	broad.mit.edu	37	18	6898615	6898615	+	Intron	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6898615G>T	uc010wzi.1	+						ARHGAP28_uc002knc.2_3'UTR|ARHGAP28_uc002knd.2_3'UTR|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_3'UTR			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				AGGGATTTGGGTATCCAGTAG	0.363													10	74	---	---	---	---	PASS
WBP11P1	441818	broad.mit.edu	37	18	30091829	30091829	+	RNA	SNP	A	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30091829A>T	uc010dmc.2	+	1		c.204A>T				NR_003558				Homo sapiens cDNA clone IMAGE:5265376, partial cds.												0						CAACATGGGAAGGAGATCTGC	0.388													23	139	---	---	---	---	PASS
ATP9B	374868	broad.mit.edu	37	18	76870367	76870367	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76870367G>A	uc002lmx.2	+	3	320	c.306G>A	c.(304-306)TGG>TGA	p.W102*	ATP9B_uc002lmv.1_RNA|ATP9B_uc002lmw.1_Nonsense_Mutation_p.W102*|ATP9B_uc002lmy.1_RNA|ATP9B_uc002lmz.1_5'Flank|ATP9B_uc002lmu.2_Nonsense_Mutation_p.W102*	NM_198531	NP_940933	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	102	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		GCTGTGGTTGGCTGATAAATA	0.323													11	112	---	---	---	---	PASS
ZNF556	80032	broad.mit.edu	37	19	2877284	2877284	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2877284G>A	uc002lwp.1	+	4	415	c.328G>A	c.(328-330)GTG>ATG	p.V110M	ZNF556_uc002lwq.2_Missense_Mutation_p.V109M	NM_024967	NP_079243	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	110					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAATCCAAGGGTGGAGAGACC	0.289													8	72	---	---	---	---	PASS
TMEM205	374882	broad.mit.edu	37	19	11456341	11456341	+	Intron	SNP	T	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11456341T>C	uc002mrb.2	-						TMEM205_uc002mra.2_Intron|TMEM205_uc002mqz.2_5'UTR|TMEM205_uc002mrc.2_5'UTR|CCDC159_uc010xlr.1_5'Flank|CCDC159_uc010xls.1_5'Flank|CCDC159_uc010xlt.1_5'Flank|CCDC159_uc010xlu.1_5'Flank|CCDC159_uc010xlv.1_5'Flank	NM_001145416	NP_001138888	Q6UW68	TM205_HUMAN	transmembrane protein 205							integral to membrane					0						GAACTTTACCTTTGCCTCATG	0.577													16	14	---	---	---	---	PASS
RFX1	5989	broad.mit.edu	37	19	14083791	14083791	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14083791C>G	uc002mxv.2	-	9	1350	c.1078G>C	c.(1078-1080)GTG>CTG	p.V360L	RFX1_uc010dzi.2_Missense_Mutation_p.V360L	NM_002918	NP_002909	P22670	RFX1_HUMAN	regulatory factor X1	360					immune response	nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			lung(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			CTGCCGGACACGTACATGGGC	0.552													10	17	---	---	---	---	PASS
PRODH2	58510	broad.mit.edu	37	19	36303397	36303397	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36303397G>T	uc002obx.1	-	3	482	c.464C>A	c.(463-465)TCC>TAC	p.S155Y		NM_021232	NP_067055	Q9UF12	PROD2_HUMAN	kidney and liver proline oxidase 1	155					glutamate biosynthetic process|proline catabolic process		proline dehydrogenase activity			ovary(2)	2	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCCATAGACGGATGCTCGGAG	0.662													18	26	---	---	---	---	PASS
ZNF606	80095	broad.mit.edu	37	19	58512737	58512737	+	5'UTR	SNP	A	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58512737A>C	uc002qqw.2	-	2					ZNF606_uc010yhp.1_5'UTR|ZNF606_uc002qqx.1_Missense_Mutation_p.L102V|uc002qqy.1_5'Flank|uc002qqz.1_5'Flank	NM_025027	NP_079303	Q8WXB4	ZN606_HUMAN	zinc finger protein 606						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		GCAAATCCCAACCTAGTGACA	0.493													22	39	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3673709	3673709	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3673709C>T	uc002wja.2	-	14	3578	c.3578G>A	c.(3577-3579)TGC>TAC	p.C1193Y	SIGLEC1_uc002wjb.1_5'UTR|SIGLEC1_uc002wiz.3_Missense_Mutation_p.C1193Y	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	1193	Ig-like C2-type 12.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						GTCCACAGTGCACAGTACCAG	0.697													14	10	---	---	---	---	PASS
MKKS	8195	broad.mit.edu	37	20	10393730	10393730	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10393730T>C	uc002wnt.1	-	3	1320	c.433A>G	c.(433-435)AGT>GGT	p.S145G	MKKS_uc002wnu.1_Missense_Mutation_p.S145G|MKKS_uc010zrd.1_Intron	NM_018848	NP_061336	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome protein	145					brain morphogenesis|cerebral cortex development|convergent extension involved in gastrulation|detection of mechanical stimulus involved in sensory perception of sound|fat cell differentiation|flagellum assembly|gonad development|heart looping|hippocampus development|intracellular transport|melanosome transport|photoreceptor cell maintenance|pigment granule aggregation in cell center|protein folding|regulation of cilium beat frequency involved in ciliary motility|sensory perception of smell|social behavior|spermatid development|striatum development	cytosol|microtubule organizing center|motile cilium	ATP binding|unfolded protein binding				0						TGAGTACTACTAAAGTCCACT	0.413									Bardet-Biedl_syndrome				64	96	---	---	---	---	PASS
SEL1L2	80343	broad.mit.edu	37	20	13830874	13830874	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13830874T>A	uc010gcf.2	-	19	1992	c.1910A>T	c.(1909-1911)GAA>GTA	p.E637V	SEL1L2_uc002woq.3_Missense_Mutation_p.E498V|SEL1L2_uc010zrl.1_Missense_Mutation_p.E524V|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	637	Extracellular (Potential).					integral to membrane	binding			ovary(2)	2						ATGCGTAGTTTCCAGTTTCAT	0.458													37	105	---	---	---	---	PASS
RALY	22913	broad.mit.edu	37	20	32663747	32663747	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32663747C>G	uc002xab.2	+	6	743	c.445C>G	c.(445-447)CGG>GGG	p.R149G	RALY_uc002xac.2_Missense_Mutation_p.R133G|RALY_uc002xad.2_RNA|RALY_uc002xae.1_Missense_Mutation_p.R149G	NM_016732	NP_057951	Q9UKM9	RALY_HUMAN	RNA binding protein (autoantigenic,	149						catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(1)	1						GAAGCGACCCCGGGTCACAGT	0.627													23	24	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33329729	33329729	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33329729A>G	uc002xav.2	-	12	6902	c.4331T>C	c.(4330-4332)GTC>GCC	p.V1444A	NCOA6_uc002xaw.2_Missense_Mutation_p.V1444A	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1444					brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						TTGGGCAGGGACTGCTTTTAG	0.453													36	82	---	---	---	---	PASS
CABLES2	81928	broad.mit.edu	37	20	60971621	60971621	+	Silent	SNP	G	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60971621G>A	uc002ycv.2	-	2	397	c.390C>T	c.(388-390)TCC>TCT	p.S130S		NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	130					cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GAAACTCCAGGGAGCAGCGCT	0.647													17	40	---	---	---	---	PASS
CHAF1B	8208	broad.mit.edu	37	21	37785583	37785583	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37785583C>G	uc002yvj.2	+	12	1601	c.1463C>G	c.(1462-1464)ACA>AGA	p.T488R		NM_005441	NP_005432	Q13112	CAF1B_HUMAN	chromatin assembly factor 1 subunit B	488					cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|cytoplasm	chromatin binding|histone binding|unfolded protein binding			ovary(1)|skin(1)	2						ACTCTGAACACACTGCAAGCC	0.532													13	44	---	---	---	---	PASS
AIFM3	150209	broad.mit.edu	37	22	21331018	21331018	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21331018G>T	uc002ztj.2	+	12	1327	c.1109G>T	c.(1108-1110)AGG>ATG	p.R370M	AIFM3_uc002ztk.2_Missense_Mutation_p.R370M|AIFM3_uc002ztl.2_Missense_Mutation_p.R376M|AIFM3_uc011ahx.1_Missense_Mutation_p.R358M|AIFM3_uc002ztm.1_Missense_Mutation_p.R182M|LZTR1_uc002ztn.2_5'Flank	NM_144704	NP_653305	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor,	370					activation of caspase activity by cytochrome c|cell redox homeostasis|electron transport chain|induction of apoptosis|mitochondrial depolarization|transport	endoplasmic reticulum|mitochondrial inner membrane	2 iron, 2 sulfur cluster binding|caspase activator activity|flavin adenine dinucleotide binding|metal ion binding|oxidoreductase activity|protein binding			ovary(2)|lung(2)	4	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CCCTTCAGGAGGTTCCTGGGG	0.697													15	17	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22661721	22661721	+	Intron	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22661721G>T	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						TTTTAGCTTTGTGCTTTTCCT	0.378													3	31	---	---	---	---	PASS
RAB36	9609	broad.mit.edu	37	22	23501360	23501360	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23501360C>G	uc002zwv.1	+	9	777	c.737C>G	c.(736-738)GCA>GGA	p.A246G	RAB36_uc010gtw.1_Missense_Mutation_p.A224G	NM_004914	NP_004905	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family	246					protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		TCAGGGGCCGCATGTGAGCAG	0.657													7	18	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41574358	41574358	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41574358C>A	uc003azl.3	+	31	7038	c.6643C>A	c.(6643-6645)CAA>AAA	p.Q2215K		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	2215	Interaction with NCOA2.				apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						CCAGCAACCCCAAGGAGTTGG	0.552			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				24	26	---	---	---	---	PASS
STS	412	broad.mit.edu	37	X	7171308	7171308	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7171308A>G	uc004cry.3	+	2	328	c.83A>G	c.(82-84)AAC>AGC	p.N28S	STS_uc004crw.2_RNA|STS_uc011mhp.1_RNA|STS_uc004crx.1_RNA|STS_uc010ndm.1_RNA	NM_000351	NP_000342	P08842	STS_HUMAN	steryl-sulfatase precursor	28	Lumenal.				female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)	TCAAGGCCGAACATCATCCTG	0.498									Ichthyosis				9	179	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65474914	65474914	+	Missense_Mutation	SNP	G	T	T	rs146719428		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65474914G>T	uc011moz.1	+	16	2670	c.2610G>T	c.(2608-2610)AGG>AGT	p.R870S	HEPH_uc004dwn.2_Missense_Mutation_p.R870S|HEPH_uc004dwo.2_Missense_Mutation_p.R600S|HEPH_uc010nkr.2_Missense_Mutation_p.R678S|HEPH_uc011mpa.1_Missense_Mutation_p.R870S|HEPH_uc010nks.2_Missense_Mutation_p.R159S	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	867	Extracellular (Potential).|Plastocyanin-like 5.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						TCCCAGAGAGGTCTGGCCCTG	0.502													8	220	---	---	---	---	PASS
BRWD3	254065	broad.mit.edu	37	X	79948521	79948521	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79948521C>T	uc004edt.2	-	28	3444	c.3181G>A	c.(3181-3183)GCC>ACC	p.A1061T	BRWD3_uc010nmi.1_RNA|BRWD3_uc004edo.2_Missense_Mutation_p.A657T|BRWD3_uc004edp.2_Missense_Mutation_p.A890T|BRWD3_uc004edq.2_Missense_Mutation_p.A657T|BRWD3_uc010nmj.1_Missense_Mutation_p.A657T|BRWD3_uc004edr.2_Missense_Mutation_p.A731T|BRWD3_uc004eds.2_Missense_Mutation_p.A657T|BRWD3_uc004edu.2_Missense_Mutation_p.A731T|BRWD3_uc004edv.2_Missense_Mutation_p.A657T|BRWD3_uc004edw.2_Missense_Mutation_p.A657T|BRWD3_uc004edx.2_Missense_Mutation_p.A657T|BRWD3_uc004edy.2_Missense_Mutation_p.A657T|BRWD3_uc004edz.2_Missense_Mutation_p.A731T|BRWD3_uc004eea.2_Missense_Mutation_p.A731T|BRWD3_uc004eeb.2_Missense_Mutation_p.A657T	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1061										ovary(4)	4						AACCACCAGGCGTCATCTATT	0.383													241	220	---	---	---	---	PASS
TEX13A	56157	broad.mit.edu	37	X	104464107	104464107	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104464107A>C	uc004ema.2	-	5	881	c.769T>G	c.(769-771)TAC>GAC	p.Y257D	IL1RAPL2_uc004elz.1_Intron|TEX13A_uc004emb.2_Missense_Mutation_p.S257R	NM_031274	NP_112564	Q9BXU3	TX13A_HUMAN	testis expressed sequence 13A	257						intracellular	zinc ion binding			ovary(2)	2						CAATAGGTGTACTTTTCCTGA	0.567													27	71	---	---	---	---	PASS
LRCH2	57631	broad.mit.edu	37	X	114384431	114384431	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114384431C>T	uc010nqe.2	-	14	1685	c.1654G>A	c.(1654-1656)GAA>AAA	p.E552K	LRCH2_uc004epz.2_Missense_Mutation_p.E552K	NM_020871	NP_065922	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH)	552										ovary(1)	1						CGCCTCCTTTCTTCACTCTGC	0.313													9	142	---	---	---	---	PASS
ANKRD58	347454	broad.mit.edu	37	X	118893385	118893385	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118893385G>T	uc010nql.2	+	1	810	c.755G>T	c.(754-756)GGG>GTG	p.G252V		NM_001105576	NP_001099046	A6NJG2	ANR58_HUMAN	ankyrin repeat domain 58	252											0						AGCGGCAGCGGGTGCACCAAC	0.692													3	9	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123184076	123184076	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123184076A>C	uc004etz.3	+	10	1273	c.934A>C	c.(934-936)ATT>CTT	p.I312L	STAG2_uc004eua.2_Missense_Mutation_p.I312L|STAG2_uc004eub.2_Missense_Mutation_p.I312L|STAG2_uc004euc.2_Missense_Mutation_p.I312L|STAG2_uc004eud.2_Missense_Mutation_p.I312L|STAG2_uc004eue.2_Missense_Mutation_p.I312L	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	312	SCD.				cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						CATTGAAGAGATTGGCATTTG	0.368													86	352	---	---	---	---	PASS
SH2D1A	4068	broad.mit.edu	37	X	123505313	123505313	+	3'UTR	SNP	A	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123505313A>G	uc004euf.3	+	4					SH2D1A_uc004euh.3_3'UTR|SH2D1A_uc004eug.3_RNA|SH2D1A_uc010nqw.2_RNA|SH2D1A_uc004eui.3_RNA|SH2D1A_uc010nqx.2_RNA	NM_002351	NP_002342	O60880	SH21A_HUMAN	SH2 domain protein 1A isoform 1						cell-cell signaling|cellular defense response	cytoplasm	SH3/SH2 adaptor activity				0						ATTGTAGATAATACAGTTCGG	0.338									X-linked_Lymphoproliferative_syndrome				37	21	---	---	---	---	PASS
CSAG1	158511	broad.mit.edu	37	X	151909172	151909172	+	Silent	SNP	C	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151909172C>A	uc004fge.2	+	5	529	c.201C>A	c.(199-201)CCC>CCA	p.P67P	CSAG1_uc004fgf.2_Silent_p.P67P|CSAG1_uc004fgd.2_RNA	NM_153478	NP_705611	Q6PB30	CSAG1_HUMAN	chondrosarcoma associated gene 1 precursor	67										ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					AAAAGGGACCCGTCAAGGAAG	0.532													67	198	---	---	---	---	PASS
PLXNA3	55558	broad.mit.edu	37	X	153697209	153697209	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153697209A>T	uc004flm.2	+	25	4504	c.4331A>T	c.(4330-4332)AAG>ATG	p.K1444M		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	1444	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGTGCCATCAAGCAGCAGATG	0.602													11	210	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	6430	6430	+	5'UTR	SNP	T	C	C			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:6430T>C	uc011mfh.1	+	1					uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		ACCCCCTGCCATAACCCAATA	0.468													3	0	---	---	---	---	PASS
CLIC4	25932	broad.mit.edu	37	1	25153754	25153754	+	Intron	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25153754delT	uc001bjo.2	+						CLIC4_uc001bjn.2_Intron|CLIC4_uc001bjp.1_Intron	NM_013943	NP_039234	Q9Y696	CLIC4_HUMAN	chloride intracellular channel 4						cellular response to calcium ion|establishment or maintenance of apical/basal cell polarity|keratinocyte differentiation|negative regulation of cell migration|regulation of cytoskeleton organization	actin cytoskeleton|apical part of cell|cell surface|cell-cell junction|centrosome|chloride channel complex|cytoplasmic vesicle membrane|cytosol|microvillus|midbody|mitochondrion|nuclear matrix|perinuclear region of cytoplasm|soluble fraction	voltage-gated chloride channel activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000778)|all_lung(284;0.00106)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0479)|OV - Ovarian serous cystadenocarcinoma(117;1.06e-24)|Colorectal(126;1.03e-07)|COAD - Colon adenocarcinoma(152;4.93e-06)|STAD - Stomach adenocarcinoma(196;0.000418)|GBM - Glioblastoma multiforme(114;0.000451)|BRCA - Breast invasive adenocarcinoma(304;0.00215)|KIRC - Kidney renal clear cell carcinoma(1967;0.00216)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.18)		TGGTCAGAAATTGGACAATAA	0.343													4	6	---	---	---	---	
ZMYND12	84217	broad.mit.edu	37	1	42905858	42905859	+	Intron	INS	-	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42905858_42905859insA	uc001chj.2	-						ZMYND12_uc010ojt.1_Intron	NM_032257	NP_115633	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12 isoform 1							intracellular	zinc ion binding			ovary(1)	1	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				tttggaagagtaaaaaaaaaaa	0.079													11	6	---	---	---	---	
FAM102B	284611	broad.mit.edu	37	1	109167054	109167055	+	Intron	INS	-	AA	AA	rs34112326		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109167054_109167055insAA	uc010ouy.1	+							NM_001010883	NP_001010883	Q5T8I3	F102B_HUMAN	hypothetical protein LOC284611											large_intestine(1)	1		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		CTTGTTATGTTAAAAAAAAAAA	0.356													4	2	---	---	---	---	
CLK2	1196	broad.mit.edu	37	1	155238498	155238498	+	Splice_Site	DEL	C	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155238498delC	uc001fjy.2	-	4	777	c.487_splice	c.e4+1	p.Y163_splice	RAG1AP1_uc010pey.1_Intron|CLK2_uc001fjw.2_Splice_Site_p.Y162_splice|CLK2_uc001fjx.2_Intron|CLK2_uc009wqm.2_Splice_Site_p.Y163_splice	NM_003993	NP_003984	P49760	CLK2_HUMAN	CDC-like kinase 2							nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TTGGCTTGTACATCGCTCTTG	0.562								Other_conserved_DNA_damage_response_genes					59	71	---	---	---	---	
C1orf9	51430	broad.mit.edu	37	1	172502728	172502728	+	Intron	DEL	A	-	-	rs55696309		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172502728delA	uc001giq.3	+						C1orf9_uc010pmm.1_Intron|C1orf9_uc009wwd.2_Intron|C1orf9_uc010pmn.1_Intron|C1orf9_uc010pmo.1_Intron	NM_014283	NP_055098	Q9UBS9	OSPT_HUMAN	chromosome 1 open reading frame 9 protein						multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane				ovary(2)	2		Breast(1374;0.212)		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)		TTTGGCTTTTAGGGTCCGGGT	0.572													3	6	---	---	---	---	
NEK7	140609	broad.mit.edu	37	1	198247384	198247385	+	Intron	INS	-	TCT	TCT	rs146890152	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198247384_198247385insTCT	uc001gun.3	+							NM_133494	NP_598001	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7							cytoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|lung(1)|ovary(1)	4						ATGTAAATTAATCTGCTTGACT	0.267													6	4	---	---	---	---	
CNTN2	6900	broad.mit.edu	37	1	205018039	205018048	+	Intron	DEL	GTGTGTGTGT	-	-	rs71933008		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205018039_205018048delGTGTGTGTGT	uc001hbr.2	+						CNTN2_uc001hbq.1_Intron	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor						axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CAGACTCtgcgtgtgtgtgtgtgtgtgtgt	0.343													4	2	---	---	---	---	
RBM34	23029	broad.mit.edu	37	1	235318310	235318311	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235318310_235318311delTG	uc001hwn.2	-	4	512_513	c.482_483delCA	c.(481-483)ACAfs	p.T161fs	RBM34_uc001hwo.2_RNA|ARID4B_uc001hwp.2_RNA|RBM34_uc010pxp.1_Frame_Shift_Del_p.T161fs	NM_015014	NP_055829	P42696	RBM34_HUMAN	RNA binding motif protein 34 isoform 1	161						nucleolus	nucleotide binding|RNA binding			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			CTGTGTCTTCTGTGTCATCAAG	0.351													115	64	---	---	---	---	
LYST	1130	broad.mit.edu	37	1	235929142	235929142	+	Intron	DEL	T	-	-	rs113006318		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235929142delT	uc001hxj.2	-						LYST_uc009xgb.1_Intron|LYST_uc010pxs.1_Intron	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			caaatacacattttttttttt	0.010									Chediak-Higashi_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	71004413	71004414	+	IGR	INS	-	A	A	rs55926232		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71004413_71004414insA								ADD2 (9084 upstream) : FIGLA (28 downstream)																							aactctatctcaaaaaaaaaaa	0.163													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92269633	92269637	+	IGR	DEL	ATTCC	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92269633_92269637delATTCC								FKSG73 (139139 upstream) : None (None downstream)																							tccatggattattccattccattcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	118165419	118165420	+	IGR	INS	-	CTTT	CTTT	rs138636071	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118165419_118165420insCTTT								None (None upstream) : DDX18 (406835 downstream)																							ttctttctttcctttcttcctt	0.064													4	4	---	---	---	---	
PTPN18	26469	broad.mit.edu	37	2	131129929	131129934	+	In_Frame_Del	DEL	GACGGG	-	-	rs112040677		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131129929_131129934delGACGGG	uc002trc.2	+	13	1214_1219	c.1113_1118delGACGGG	c.(1111-1119)CAGACGGGG>CAG	p.TG378del	PTPN18_uc002trd.2_In_Frame_Del_p.TG357del|PTPN18_uc002trb.2_In_Frame_Del_p.TG271del|PTPN18_uc002tre.2_In_Frame_Del_p.TG29del	NM_014369	NP_055184	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type	378_379				Missing (in Ref. 1; CAA56105).		cytoplasm|nucleus	non-membrane spanning protein tyrosine phosphatase activity			ovary(3)|kidney(1)	4	Colorectal(110;0.1)					gtgggacgcagacggggacggggacg	0.568													8	6	---	---	---	---	
NCKAP5	344148	broad.mit.edu	37	2	134256005	134256008	+	Intron	DEL	GGAA	-	-	rs56793576		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134256005_134256008delGGAA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1								protein binding				0						tgagaaaaacggaaggaaggaagg	0.118													4	2	---	---	---	---	
DCAF17	80067	broad.mit.edu	37	2	172305520	172305520	+	Intron	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172305520delT	uc002ugx.2	+						DCAF17_uc010zdq.1_Intron|DCAF17_uc010fqf.1_Intron|DCAF17_uc010zdr.1_Intron	NM_025000	NP_079276	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17 isoform 1							CUL4 RING ubiquitin ligase complex|integral to membrane|nucleolus					0						ATCAtttgtcttttttttttc	0.164													4	2	---	---	---	---	
COL4A4	1286	broad.mit.edu	37	2	227973882	227973882	+	Intron	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227973882delT	uc010zlt.1	-							NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor						axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		ATGTTGCTTCTTTATTTTCAT	0.453													320	154	---	---	---	---	
CAPN10	11132	broad.mit.edu	37	2	241529076	241529076	+	Intron	DEL	G	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241529076delG	uc002vzk.1	+						CAPN10_uc010zoh.1_Intron|CAPN10_uc002vzl.1_Intron|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_Intron|CAPN10_uc002vzo.1_Intron|CAPN10_uc010fzg.1_Intron|CAPN10_uc002vzp.1_Intron|CAPN10_uc002vzq.1_Intron	NM_023083	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10 isoform a						actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		CTCTGCTGCAGGGGGGGGTGC	0.632													4	2	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188305	10188306	+	Frame_Shift_Ins	INS	-	AT	AT			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188305_10188306insAT	uc003bvc.2	+	2	661_662	c.448_449insAT	c.(448-450)AATfs	p.N150fs	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	150	Involved in binding to CCT complex.				anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.N150fs*9(6)|p.F148fs*9(1)|p.?(1)|p.N150fs*7(1)|p.N150fs*23(1)|p.P146fs*23(1)|p.G144fs*19(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TATTTTTGCCAATATCACACTG	0.406		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				99	108	---	---	---	---	
NSUN3	63899	broad.mit.edu	37	3	93844904	93844904	+	Intron	DEL	A	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93844904delA	uc003drl.1	+							NM_022072	NP_071355	Q9H649	NSUN3_HUMAN	NOL1/NOP2/Sun domain family, member 3								methyltransferase activity			skin(1)	1						actctgtctcaaaaaaaaaaa	0.169													6	3	---	---	---	---	
DCUN1D1	54165	broad.mit.edu	37	3	182672832	182672832	+	Intron	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182672832delT	uc003fld.1	-						DCUN1D1_uc011bqn.1_Intron	NM_020640	NP_065691	Q96GG9	DCNL1_HUMAN	RP42 homolog							ubiquitin ligase complex	protein binding			ovary(1)	1	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TTAAATTGACttttttttttt	0.154													2	5	---	---	---	---	
KIAA0232	9778	broad.mit.edu	37	4	6810756	6810757	+	Intron	INS	-	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6810756_6810757insT	uc003gjr.3	+						KIAA0232_uc003gjq.3_Intron	NM_014743	NP_055558	Q92628	K0232_HUMAN	hypothetical protein LOC9778								ATP binding			ovary(2)	2						CTCTATAAGTGTTGGGAGGAAG	0.460													3	3	---	---	---	---	
GBA3	57733	broad.mit.edu	37	4	22749784	22749785	+	Intron	DEL	TA	-	-	rs33941035		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22749784_22749785delTA	uc003gqp.3	+						GBA3_uc010iep.2_Intron|GBA3_uc011bxo.1_Intron	NM_020973	NP_066024	Q9H227	GBA3_HUMAN	cytosolic beta-glucosidase isoform a						glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity				0						CAGGCatatgtatatatatata	0.337													4	2	---	---	---	---	
TBC1D1	23216	broad.mit.edu	37	4	38120014	38120015	+	Intron	INS	-	T	T	rs143317281	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38120014_38120015insT	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron|TBC1D1_uc003gtd.2_5'Flank	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1						CGGGGCTTCCCTAGATGCCTTC	0.490													3	3	---	---	---	---	
AASDH	132949	broad.mit.edu	37	4	57215942	57215942	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57215942delT	uc003hbn.2	-	11	2128	c.1975delA	c.(1975-1977)ACAfs	p.T659fs	AASDH_uc010ihb.2_Frame_Shift_Del_p.T174fs|AASDH_uc011caa.1_Frame_Shift_Del_p.T506fs|AASDH_uc003hbo.2_Frame_Shift_Del_p.T559fs|AASDH_uc011cab.1_Frame_Shift_Del_p.T174fs|AASDH_uc010ihc.2_Frame_Shift_Del_p.T659fs|AASDH_uc003hbp.2_Frame_Shift_Del_p.T659fs	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	659					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TGTAAAGATGTTCCACTGGCT	0.408													325	148	---	---	---	---	
HELQ	113510	broad.mit.edu	37	4	84339019	84339020	+	Intron	INS	-	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84339019_84339020insT	uc003hom.2	-						HELQ_uc010ikb.2_Intron|HELQ_uc003hol.3_Intron|HELQ_uc010ikc.2_Intron	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308								ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						TTCCTGTTATGTTTTTTTTTTC	0.401								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					9	4	---	---	---	---	
UNC5C	8633	broad.mit.edu	37	4	96128053	96128053	+	Intron	DEL	C	-	-	rs71583693		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96128053delC	uc003htp.1	-						UNC5C_uc010ilc.1_Intron	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor						apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TCCTGGAATTCTTTTTTTTTT	0.408													4	2	---	---	---	---	
NAA15	80155	broad.mit.edu	37	4	140255648	140255648	+	Intron	DEL	A	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140255648delA	uc003ihu.1	+							NM_057175	NP_476516	Q9BXJ9	NAA15_HUMAN	NMDA receptor regulated 1						angiogenesis|cell differentiation|N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	protein binding			ovary(1)|skin(1)	2						AGGAAAAGAGAAATAATAGGA	0.259													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	165981768	165981769	+	IGR	INS	-	T	T	rs138190650	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165981768_165981769insT								TRIM60 (18872 upstream) : TMEM192 (15462 downstream)																							TTGTTTTTTTGTTTTTTTTTAA	0.307													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20095674	20095675	+	IGR	INS	-	AGAAAGG	AGAAAGG	rs59909046		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20095674_20095675insAGAAAGG								CDH18 (107367 upstream) : None (None downstream)																							gaaagaaaggaaagaaaggaag	0.054													5	3	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	32077366	32077366	+	Intron	DEL	A	-	-	rs34030551		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32077366delA	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						tttagagttgaaaaaaatgga	0.000													4	5	---	---	---	---	
CCNG1	900	broad.mit.edu	37	5	162866030	162866031	+	Intron	INS	-	A	A	rs72299838		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162866030_162866031insA	uc003lzb.2	+						CCNG1_uc011dek.1_Intron|CCNG1_uc011del.1_Intron|CCNG1_uc003lzc.2_Intron	NM_199246	NP_954854	P51959	CCNG1_HUMAN	cyclin G1						cell division|mitosis|regulation of cyclin-dependent protein kinase activity	nucleus				lung(1)|kidney(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		gactccttctcaaaaaaaaaaa	0.168													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173545044	173545044	+	IGR	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173545044delT								HMP19 (8863 upstream) : MSX2 (606531 downstream)																							cttccttccctccttccttcc	0.000													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32552253	32552254	+	Intron	INS	-	G	G	rs149553038	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32552253_32552254insG	uc003obk.3	-						HLA-DRB1_uc011dqa.1_5'Flank|HLA-DRB6_uc003obo.1_5'Flank|HLA-DRB1_uc003obp.3_Intron|HLA-DRB1_uc011dqb.1_5'Flank|HLA-DRB1_uc011dqc.1_5'Flank	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						GTGCGGGCGCTGGAACCTTAAC	0.698													5	4	---	---	---	---	
C6orf142	90523	broad.mit.edu	37	6	54119533	54119534	+	Intron	INS	-	C	C	rs75266768		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54119533_54119534insC	uc003pcg.3	+						C6orf142_uc003pch.3_Intron|C6orf142_uc011dxa.1_Intron	NM_138569	NP_612636	Q5VWP3	MLIP_HUMAN	hypothetical protein LOC90523							nuclear envelope|PML body	protein binding				0	Lung NSC(77;0.0317)					TCTTTTTTtttctccctccctt	0.282													4	3	---	---	---	---	
CD109	135228	broad.mit.edu	37	6	74493299	74493299	+	Intron	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74493299delT	uc003php.2	+						CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Intron|CD109_uc010kba.2_Intron	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor							anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						TTTTAAATGGTTTTAAATTCA	0.249													9	5	---	---	---	---	
BCKDHB	594	broad.mit.edu	37	6	80878332	80878333	+	Intron	INS	-	G	G			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80878332_80878333insG	uc003pjd.2	+						BCKDHB_uc003pje.2_Intron	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		aaaggaaggaaggagggaggga	0.168													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	151958726	151958726	+	IGR	DEL	G	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151958726delG								C6orf97 (16399 upstream) : ESR1 (52905 downstream)																							CTGCAGCTCTGGTTGTAAAGG	0.239													4	2	---	---	---	---	
ZNF680	340252	broad.mit.edu	37	7	63983013	63983013	+	Intron	DEL	A	-	-	rs34852861		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63983013delA	uc003tta.2	-						ZNF680_uc010kzr.2_Intron	NM_178558	NP_848653	Q8NEM1	ZN680_HUMAN	zinc finger protein 680 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.118)|all_lung(88;0.243)				cctaaaagttaaaaaaaaaaa	0.080													3	3	---	---	---	---	
PTPRZ1	5803	broad.mit.edu	37	7	121678973	121678973	+	Intron	DEL	A	-	-	rs35195230		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121678973delA	uc003vjy.2	+						PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,						central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						TGTCACCCCCAAAAAAGTAAT	0.333													103	59	---	---	---	---	
GPR124	25960	broad.mit.edu	37	8	37692544	37692545	+	Intron	DEL	AA	-	-	rs66471448		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37692544_37692545delAA	uc003xkj.2	+						GPR124_uc010lvy.2_Intron	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124 precursor						central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(2)|ovary(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			ctgttcctctaaaaaaaaaaag	0.218													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	53354375	53354376	+	IGR	INS	-	GAAG	GAAG			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53354375_53354376insGAAG								ST18 (31936 upstream) : FAM150A (92222 downstream)																							aaggaaggaaggaaagaaagga	0.000													8	4	---	---	---	---	
LAPTM4B	55353	broad.mit.edu	37	8	98817905	98817906	+	Intron	INS	-	A	A	rs145779188	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98817905_98817906insA	uc003yia.2	+						LAPTM4B_uc010mbg.2_Intron	NM_018407	NP_060877	Q86VI4	LAP4B_HUMAN	lysosomal associated transmembrane protein 4						transport	endomembrane system|integral to membrane	protein binding			skin(1)	1	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			CTTACCCACTTAAAAATGATTG	0.381													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	127178216	127178231	+	IGR	DEL	TTCCTTCCTTCCTTCC	-	-	rs112421178		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127178216_127178231delTTCCTTCCTTCCTTCC								TRIB1 (727574 upstream) : FAM84B (386456 downstream)																							cttccttcctttccttccttccttccttccttcctt	0.005													5	4	---	---	---	---	
FAM135B	51059	broad.mit.edu	37	8	139207744	139207748	+	Intron	DEL	TGGAC	-	-	rs71956584		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139207744_139207748delTGGAC	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ATTGGAGCCATGGACTGGACTGAGC	0.444										HNSCC(54;0.14)			4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68430364	68430365	+	IGR	INS	-	A	A	rs140332329		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68430364_68430365insA								FAM27B (636175 upstream) : MIR1299 (571874 downstream)																							TTATGCAGAAGAAAAAATTAAC	0.322													11	6	---	---	---	---	
SMC5	23137	broad.mit.edu	37	9	72959324	72959325	+	Intron	DEL	AT	-	-	rs113697041		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72959324_72959325delAT	uc004ahr.2	+						SMC5_uc011lry.1_5'Flank	NM_015110	NP_055925	Q8IY18	SMC5_HUMAN	SMC5 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			ovary(2)|central_nervous_system(1)	3						TTTAAACTGaatatatatatat	0.282													4	2	---	---	---	---	
GOLM1	51280	broad.mit.edu	37	9	88642645	88642645	+	3'UTR	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88642645delT	uc004aol.2	-	10					GOLM1_uc004aom.2_3'UTR	NM_016548	NP_057632	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1							Golgi apparatus|integral to plasma membrane					0						ATTTAGTACATTTCACAGTTT	0.333													25	18	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7248006	7248011	+	Intron	DEL	AAAAAC	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7248006_7248011delAAAAAC	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						TTATACATTAaaaaacaaaaacaaaa	0.296													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	26958525	26958527	+	IGR	DEL	AAG	-	-	rs138608083		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26958525_26958527delAAG								LOC731789 (16143 upstream) : PDSS1 (28068 downstream)																							aagaaaagaaaagaagaaGAATC	0.133													4	5	---	---	---	---	
BMPR1A	657	broad.mit.edu	37	10	88676749	88676750	+	Intron	INS	-	A	A	rs112738256		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88676749_88676750insA	uc001kdy.2	+							NM_004329	NP_004320	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA						BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity			lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8						gactccatctcaaaaaaaaaaa	0.178			Mis|N|F			gastrointestinal polyps			Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis				4	3	---	---	---	---	
C10orf79	80217	broad.mit.edu	37	10	105924006	105924007	+	Frame_Shift_Ins	INS	-	A	A			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105924006_105924007insA	uc001kxw.2	-	24	3207_3208	c.3091_3092insT	c.(3091-3093)TATfs	p.Y1031fs	C10orf79_uc009xxq.2_Frame_Shift_Ins_p.Y339fs	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217	1031											0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		TTTTTGTTTATATGCAGCGTCA	0.317													37	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	128409976	128409977	+	IGR	INS	-	GAAG	GAAG	rs10901678	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128409976_128409977insGAAG								C10orf90 (50897 upstream) : DOCK1 (184046 downstream)																							aaagaaagaaagaaggaaggaa	0.074													5	3	---	---	---	---	
AMPD3	272	broad.mit.edu	37	11	10517464	10517464	+	Intron	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10517464delT	uc001mio.1	+						AMPD3_uc010rbz.1_Intron|AMPD3_uc001min.1_Intron|AMPD3_uc009yfw.1_Intron|AMPD3_uc009yfz.2_Intron|AMPD3_uc001mip.1_Intron|AMPD3_uc009yfy.2_Intron	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B						AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		ACTAGAGCTCttttttttttt	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	25761776	25761777	+	IGR	DEL	CA	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25761776_25761777delCA								LUZP2 (657594 upstream) : ANO3 (449052 downstream)																							AGCGTGcacgcacacacacaca	0.035													4	2	---	---	---	---	
SLC22A8	9376	broad.mit.edu	37	11	62763073	62763074	+	Intron	INS	-	T	T			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62763073_62763074insT	uc001nwo.2	-						SLC22A8_uc001nwn.1_3'UTR|SLC22A8_uc001nwp.2_Intron|SLC22A8_uc009yom.2_Intron|SLC22A8_uc010rmm.1_Intron|SLC22A8_uc009yon.2_Intron	NM_004254	NP_004245	Q8TCC7	S22A8_HUMAN	solute carrier family 22 member 8						response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3						GATTCTCTGACTTCTCTTTCAG	0.599													14	12	---	---	---	---	
FERMT3	83706	broad.mit.edu	37	11	63978951	63978951	+	Intron	DEL	C	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63978951delC	uc001nyl.2	+						FERMT3_uc001nym.2_Intron	NM_178443	NP_848537	Q86UX7	URP2_HUMAN	fermitin family homolog 3 long form						integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding			ovary(1)	1						TGTCAGGGCTCCCCCACCCAG	0.662													4	2	---	---	---	---	
CTTN	2017	broad.mit.edu	37	11	70281357	70281359	+	3'UTR	DEL	CTG	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70281357_70281359delCTG	uc001opv.3	+	18					CTTN_uc001opu.2_Intron|CTTN_uc001opw.3_3'UTR|CTTN_uc010rqm.1_Intron|CTTN_uc001opx.2_3'UTR	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a							cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		TGGGttttttctgtttttttttt	0.429													14	7	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134090261	134090261	+	Intron	DEL	A	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134090261delA	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GTCGTGTCTTAAAAAAAAAAA	0.209													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	53279489	53279492	+	IGR	DEL	CATT	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53279489_53279492delCATT								KRT78 (36711 upstream) : KRT8 (11479 downstream)																							aagagcacaccattcattgcactc	0.078													4	2	---	---	---	---	
AGAP2	116986	broad.mit.edu	37	12	58129302	58129303	+	Intron	INS	-	C	C	rs149789274	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58129302_58129303insC	uc001spq.2	-						AGAP2_uc001spp.2_Intron|AGAP2_uc001spr.2_Intron	NM_001122772	NP_001116244	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-L						axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						CAGCTTTCCAACCCCCCCCCAA	0.634													4	6	---	---	---	---	
CPM	1368	broad.mit.edu	37	12	69252512	69252512	+	Intron	DEL	G	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69252512delG	uc001sup.2	-						CPM_uc001sur.2_Intron|CPM_uc001suq.2_Intron	NM_198320	NP_938079	P14384	CBPM_HUMAN	carboxypeptidase M precursor						anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding				0	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			GAATTTTTGTGGTTTTTTTTT	0.323													7	4	---	---	---	---	
NTS	4922	broad.mit.edu	37	12	86270630	86270630	+	Intron	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86270630delT	uc001tag.2	+							NM_006183	NP_006174	P30990	NEUT_HUMAN	neurotensin/neuromedin N preproprotein						regulation of blood vessel size|signal transduction	extracellular region|soluble fraction|transport vesicle	neuropeptide hormone activity				0						TTTCTTTTAGTTAAAAGAAGT	0.284													4	2	---	---	---	---	
NTN4	59277	broad.mit.edu	37	12	96066096	96066097	+	Intron	DEL	CT	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96066096_96066097delCT	uc001tei.2	-						NTN4_uc009ztf.2_Intron|NTN4_uc009ztg.2_Intron	NM_021229	NP_067052	Q9HB63	NET4_HUMAN	netrin 4 precursor						axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2						CGCCTACAAACTGGTGCTGATC	0.515													18	15	---	---	---	---	
DEPDC4	120863	broad.mit.edu	37	12	100646135	100646135	+	3'UTR	DEL	A	-	-	rs66721214		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100646135delA	uc001thi.2	-	5					DEPDC4_uc001thh.1_Intron	NM_152317	NP_689530	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4						intracellular signal transduction						0						AAAAAATAGCAAAAAAAAATG	0.333													8	6	---	---	---	---	
ATXN2	6311	broad.mit.edu	37	12	111992031	111992032	+	Intron	INS	-	A	A	rs144235483		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111992031_111992032insA	uc001tsj.2	-						ATXN2_uc001tsh.2_Intron|ATXN2_uc001tsi.2_Intron|ATXN2_uc001tsk.2_Intron|ATXN2_uc001tsm.1_Intron	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2						cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						TCTGGAATATTAAAAAAAAAAA	0.168													9	7	---	---	---	---	
ZNF268	10795	broad.mit.edu	37	12	133764701	133764702	+	Intron	INS	-	T	T	rs112587939		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133764701_133764702insT	uc010tcf.1	+						ZNF268_uc010tbv.1_Intron|ZNF268_uc010tbw.1_Intron|ZNF268_uc010tbx.1_Intron|ZNF268_uc010tby.1_Intron|ZNF268_uc010tbz.1_Intron|ZNF268_uc010tca.1_Intron|ZNF268_uc010tcb.1_Intron|ZNF268_uc010tcc.1_Intron|ZNF268_uc010tcd.1_Intron|ZNF268_uc010tce.1_Intron|ZNF268_uc010tcg.1_Intron|ZNF268_uc010tch.1_Intron	NM_003415	NP_003406	Q14587	ZN268_HUMAN	zinc finger protein 268 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		TCTTTATTACCTTTTTTTTTTT	0.262													3	3	---	---	---	---	
ITM2B	9445	broad.mit.edu	37	13	48830433	48830438	+	In_Frame_Del	DEL	GAAGAA	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48830433_48830438delGAAGAA	uc001vbz.3	+	3	590_595	c.367_372delGAAGAA	c.(367-372)GAAGAAdel	p.EE125del		NM_021999	NP_068839	Q9Y287	ITM2B_HUMAN	integral membrane protein 2B	125_126	Lumenal (Potential).				nervous system development	Golgi membrane|integral to membrane|nucleus|plasma membrane	beta-amyloid binding				0		all_cancers(8;2.2e-31)|all_epithelial(8;6.77e-15)|all_lung(13;9.67e-07)|all_hematologic(8;9.72e-06)|Lung NSC(96;8.3e-05)|Breast(56;0.000141)|Acute lymphoblastic leukemia(8;0.00045)|Prostate(109;0.000669)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;1.97e-06)		TAAAATCTTTGAAGAAGAAGAAGTTG	0.398													98	44	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	58502420	58502421	+	IGR	INS	-	TA	TA	rs147854510	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58502420_58502421insTA								PCDH17 (199355 upstream) : None (None downstream)																							gtgtgtgtgtgtaGCATGTCTT	0.025													4	2	---	---	---	---	
ITGBL1	9358	broad.mit.edu	37	13	102250388	102250388	+	Intron	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102250388delT	uc001vpb.2	+						ITGBL1_uc010agb.2_Intron|ITGBL1_uc001vpc.3_Intron	NM_004791	NP_004782	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat						cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity			ovary(1)|skin(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TAATATGTTATATTATGTTCA	0.289													27	14	---	---	---	---	
C14orf21	161424	broad.mit.edu	37	14	24772593	24772593	+	Intron	DEL	T	-	-	rs112529240		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24772593delT	uc001wol.1	+						C14orf21_uc001wom.1_Intron	NM_174913	NP_777573	Q86U38	CN021_HUMAN	hypothetical protein LOC161424								RNA binding			breast(2)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(265;0.0185)		ACCCAGCTAAttttttttttt	0.313													7	4	---	---	---	---	
EXD2	55218	broad.mit.edu	37	14	69655247	69655247	+	5'Flank	DEL	T	-	-	rs34070983		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69655247delT	uc001xkt.2	+						EXD2_uc001xku.2_5'Flank|EXD2_uc001xkv.2_5'Flank|EXD2_uc001xkw.2_5'Flank	NM_018199	NP_060669	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						TCTCTCTCTCttttttttttt	0.060													4	4	---	---	---	---	
EML5	161436	broad.mit.edu	37	14	89087279	89087279	+	Intron	DEL	A	-	-	rs68091045		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89087279delA	uc001xxg.2	-						EML5_uc001xxf.2_Intron|EML5_uc001xxd.2_5'Flank|EML5_uc001xxe.2_Intron	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like							cytoplasm|microtubule				ovary(3)	3						TTCTGCatttaaaaaaaaaaa	0.363													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20476715	20476715	+	IGR	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20476715delT								None (None upstream) : GOLGA6L6 (260379 downstream)																							Atttttttgcttttttttttg	0.209													4	2	---	---	---	---	
UBR1	197131	broad.mit.edu	37	15	43378457	43378457	+	Intron	DEL	A	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43378457delA	uc001zqq.2	-						UBR1_uc010udk.1_Intron	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		AAAGAAGATGAAAATTAGACT	0.318													85	43	---	---	---	---	
NEO1	4756	broad.mit.edu	37	15	73552409	73552409	+	Intron	DEL	T	-	-	rs34823408		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73552409delT	uc002avm.3	+						NEO1_uc010ukx.1_Intron|NEO1_uc010uky.1_Intron|NEO1_uc010ukz.1_Intron|NEO1_uc002avn.3_Intron	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1 precursor						axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1						TGTTCAGGTCTTTTTTTTTTT	0.303													8	4	---	---	---	---	
MGRN1	23295	broad.mit.edu	37	16	4707458	4707458	+	Intron	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4707458delT	uc002cwz.2	+						MGRN1_uc002cxa.2_Intron|MGRN1_uc010btx.2_Intron|MGRN1_uc010btw.2_Intron|MGRN1_uc002cxb.2_Intron|MGRN1_uc010uxo.1_Intron|MGRN1_uc010uxp.1_Intron|MGRN1_uc010uxq.1_Intron	NM_001142290	NP_001135762	O60291	MGRN1_HUMAN	mahogunin, ring finger 1 isoform 3						endosome to lysosome transport|negative regulation of cAMP-mediated signaling|negative regulation of G-protein coupled receptor protein signaling pathway|protein monoubiquitination	cytosol|early endosome|nucleus|plasma membrane|plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2						TGTGTTTGGCTTCCTCCAGGG	0.637													23	36	---	---	---	---	
NUBP1	4682	broad.mit.edu	37	16	10850369	10850369	+	Intron	DEL	T	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10850369delT	uc002daa.1	+						NUBP1_uc010bum.1_Intron|NUBP1_uc002dab.1_Intron	NM_002484	NP_002475	P53384	NUBP1_HUMAN	nucleotide binding protein 1						cell growth|cellular iron ion homeostasis|iron-sulfur cluster assembly	cytosol	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding|nucleoside-triphosphatase activity|protein binding			ovary(1)|skin(1)	2						CATGGTACCCTTTTTTTTTTT	0.398													3	3	---	---	---	---	
SHISA9	729993	broad.mit.edu	37	16	13294266	13294267	+	Intron	INS	-	ACAC	ACAC	rs148088145	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13294266_13294267insACAC	uc010uyy.1	+							NM_001145204	NP_001138676	B4DS77	SHSA9_HUMAN	shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0						TATATCATGAAacacacacaca	0.183													6	3	---	---	---	---	
ABCC12	94160	broad.mit.edu	37	16	48167439	48167439	+	Intron	DEL	A	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48167439delA	uc002efc.1	-						ABCC12_uc002eey.1_Intron|ABCC12_uc002eez.1_Intron|ABCC12_uc002efa.1_Intron|ABCC12_uc002efb.1_Intron|ABCC12_uc002efd.1_Intron|ABCC12_uc002efe.1_Intron	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				cctgtctcagaaaaaaaaaaa	0.219													6	3	---	---	---	---	
CENPN	55839	broad.mit.edu	37	16	81058170	81058171	+	Intron	INS	-	CAACTCAGC	CAACTCAGC	rs150158893	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81058170_81058171insCAACTCAGC	uc002ffx.2	+						CENPN_uc010vnl.1_Intron|CENPN_uc010vnm.1_Intron|CENPN_uc002ffy.3_Intron	NM_001100624	NP_001094094	Q96H22	CENPN_HUMAN	centromere protein N isoform 2						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm					0						AGTGTCCTGCTCAACTCAGCCA	0.401													4	3	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81183625	81183627	+	Intron	DEL	TTT	-	-	rs35446881		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81183625_81183627delTTT	uc002fgh.1	-						PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						TTGTTCACACttttttttttttt	0.236													6	3	---	---	---	---	
ZZEF1	23140	broad.mit.edu	37	17	3945851	3945851	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3945851delA	uc002fxe.2	-	39	6242	c.6178delT	c.(6178-6180)TCAfs	p.S2060fs	ZZEF1_uc002fxh.2_Frame_Shift_Del_p.S374fs|ZZEF1_uc002fxi.2_Frame_Shift_Del_p.S295fs|ZZEF1_uc002fxj.1_Frame_Shift_Del_p.S673fs	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	2060							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GACACTTCTGAATCTTCAGCA	0.448													144	77	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	32560287	32560287	+	IGR	DEL	A	-	-	rs72218073		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32560287delA								ACCN1 (76462 upstream) : CCL2 (22009 downstream)																							agaaagaaagaaagaaagaaa	0.000													4	3	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544325	80544325	+	Intron	DEL	C	-	-	rs111739683		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544325delC	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			caaaggtgggccgggggggga	0.000													10	5	---	---	---	---	
KIAA1012	22878	broad.mit.edu	37	18	29508299	29508300	+	Intron	INS	-	AC	AC	rs137905224	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29508299_29508300insAC	uc002kxc.3	-						KIAA1012_uc002kxb.3_Intron|KIAA1012_uc002kxd.3_Intron|KIAA1012_uc002kxe.2_Intron	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878						ER to Golgi vesicle-mediated transport	cis-Golgi network					0						accttatctctacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68893231	68893233	+	IGR	DEL	GTT	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68893231_68893233delGTT								SOCS6 (895797 upstream) : None (None downstream)																							CTGCTGCTGAGTTGTTGTTATTA	0.463													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7105437	7105437	+	IGR	DEL	A	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7105437delA								ZNF557 (17461 upstream) : INSR (6829 downstream)																							ACAGATAGATAAAAAAAAAAA	0.294													4	2	---	---	---	---	
ETHE1	23474	broad.mit.edu	37	19	44011194	44011198	+	Intron	DEL	AGGAG	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44011194_44011198delAGGAG	uc002owp.2	-						PHLDB3_uc002own.3_5'Flank|PHLDB3_uc002owo.2_5'Flank	NM_014297	NP_055112	O95571	ETHE1_HUMAN	ETHE1 protein precursor							mitochondrial matrix|nucleus	hydrolase activity|metal ion binding				0		Prostate(69;0.0153)				cctcagacccaggagtccagtaccc	0.112													4	6	---	---	---	---	
TTYH1	57348	broad.mit.edu	37	19	54925317	54925319	+	5'Flank	DEL	CGC	-	-	rs62638023		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54925317_54925319delCGC	uc002qfq.2	+						TTYH1_uc010yey.1_5'Flank|TTYH1_uc002qfr.2_5'Flank|TTYH1_uc002qft.2_5'Flank	NM_020659	NP_065710	Q9H313	TTYH1_HUMAN	tweety 1 isoform 1						cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		ccaccaccatcgccaccaccatc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	56053834	56053837	+	IGR	DEL	CATC	-	-	rs113583456		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56053834_56053837delCATC								SBK2 (6173 upstream) : ZNF579 (35055 downstream)																							ccaaacctttcatccatccatcca	0.000													4	3	---	---	---	---	
C20orf117	140710	broad.mit.edu	37	20	35445688	35445688	+	Intron	DEL	G	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35445688delG	uc002xgd.1	-						C20orf117_uc002xge.1_5'Flank	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2												0		Myeloproliferative disorder(115;0.00874)				aaaaaaaaaagaaaagaaaaa	0.229													4	2	---	---	---	---	
RBL1	5933	broad.mit.edu	37	20	35684754	35684754	+	Intron	DEL	C	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35684754delC	uc002xgi.2	-						RBL1_uc010zvt.1_Intron|RBL1_uc002xgj.1_Intron|RBL1_uc010gfv.1_Intron	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a						cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)				CCttcttcttctttttttttt	0.159													11	6	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074688	62074690	+	Intron	DEL	CAC	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074688_62074690delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccatcaccatcaccaccatcacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	18511131	18511132	+	IGR	INS	-	GAAGGAAG	GAAGGAAG	rs140421958	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18511131_18511132insGAAGGAAG								C21orf34 (529037 upstream) : CXADR (374198 downstream)																							AGTTGTGTGCAgaaggaaggaa	0.099													4	2	---	---	---	---	
CACNG2	10369	broad.mit.edu	37	22	36962391	36962391	+	Intron	DEL	G	-	-	rs149483046	by1000genomes	TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36962391delG	uc003aps.1	-							NM_006078	NP_006069	Q9Y698	CCG2_HUMAN	voltage-dependent calcium channel gamma-2						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0						CTGGATCAGTGGCTGTTACCT	0.577													52	31	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49467094	49467096	+	IGR	DEL	TCC	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49467094_49467096delTCC								FAM19A5 (319352 upstream) : C22orf34 (341080 downstream)																							cttccttccttccttcttccttc	0.074													14	7	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467625	1467626	+	Intron	INS	-	TC	TC			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467625_1467626insTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	tcctttctttttctttctttct	0.000													2	4	---	---	---	---	
DHRSX	207063	broad.mit.edu	37	X	2232507	2232510	+	Intron	DEL	GGGA	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2232507_2232510delGGGA	uc004cqf.3	-							NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				aggaaggaaggggagaaggaagga	0.000													4	4	---	---	---	---	
CD99	4267	broad.mit.edu	37	X	2642016	2642017	+	Intron	INS	-	AAG	AAG			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2642016_2642017insAAG	uc004cqm.2	+						CD99_uc010nda.2_Intron|CD99_uc004cqn.2_Intron|CD99_uc004cqo.2_Intron	NM_002414	NP_002405	P14209	CD99_HUMAN	CD99 antigen isoform a precursor						cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1						ggagggaaggaaagaaggaagg	0.163													5	4	---	---	---	---	
WNK3	65267	broad.mit.edu	37	X	54285553	54285553	+	Intron	DEL	A	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54285553delA	uc004dtd.1	-						WNK3_uc004dtc.1_Intron	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2						intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						ATAAAAAAGCAAAAAAAAAAA	0.303													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	64844726	64844727	+	RNA	DEL	AG	-	-			TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64844726_64844727delAG	uc004dwe.2	+	4		c.743_744delAG								Homo sapiens cDNA clone IMAGE:30330955.																		agaaagaaaaagagaaagaaaa	0.015													6	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	89458542	89458545	+	IGR	DEL	CTTT	-	-	rs72206424		TCGA-CZ-4859-01A-02D-1429-08	TCGA-CZ-4859-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89458542_89458545delCTTT								TGIF2LX (280662 upstream) : None (None downstream)																							ttctttcttcctttccttccttcc	0.103													1	5	---	---	---	---	
