Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
Unknown	0	broad.mit.edu	37	1	2468428	2468429	+	IGR	DEL	GT	-	-	rs113262362		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2468428_2468429delGT								HES5 (6744 upstream) : LOC115110 (12930 downstream)																																			---	---	---	---
PRDM16	63976	broad.mit.edu	37	1	3242477	3242495	+	Intron	DEL	CTTGGCCCTCCTCGGCCCT	-	-	rs2500269		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3242477_3242495delCTTGGCCCTCCTCGGCCCT	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397			PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)				T	EVI1	MDS|AML								---	---	---	---
MEGF6	1953	broad.mit.edu	37	1	3421601	3421617	+	Intron	DEL	CAAGGCAACACCGGTAG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3421601_3421617delCAAGGCAACACCGGTAG	uc001akl.2	-						MEGF6_uc001akk.2_Intron	NM_001409	NP_001400			EGF-like-domain, multiple 3 precursor							extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	5677203	5677203	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5677203delG	uc001alp.1	-											Homo sapiens cDNA FLJ43088 fis, clone BRTHA3025826.																														---	---	---	---
KCNAB2	8514	broad.mit.edu	37	1	6077467	6077472	+	Intron	DEL	TGTGTG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6077467_6077472delTGTGTG	uc009vlv.1	+							NM_003636	NP_003627			potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane|juxtaparanode region of axon	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity				0	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	6997450	6997452	+	Intron	DEL	ACT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6997450_6997452delACT	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
SLC2A5	6518	broad.mit.edu	37	1	9110688	9110689	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9110688_9110689insA	uc001apo.2	-						SLC2A5_uc010nzy.1_5'Flank|SLC2A5_uc010nzz.1_Intron|SLC2A5_uc010oaa.1_Intron|SLC2A5_uc010oab.1_Intron|SLC2A5_uc010oac.1_Intron|SLC2A5_uc001app.3_Intron	NM_003039	NP_003030			solute carrier family 2 (facilitated						carbohydrate metabolic process	integral to membrane|plasma membrane	fructose transmembrane transporter activity|glucose transmembrane transporter activity			pancreas(2)|ovary(1)	3	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	9283779	9283781	+	IGR	DEL	TTC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9283779_9283781delTTC								MIR34A (71943 upstream) : H6PD (11082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	11620068	11620069	+	IGR	INS	-	CA	CA	rs77511805	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11620068_11620069insCA								PTCHD2 (22429 upstream) : FBXO2 (88381 downstream)																																			---	---	---	---
CLCN6	1185	broad.mit.edu	37	1	11868285	11868286	+	Intron	DEL	TG	-	-	rs71568357		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11868285_11868286delTG	uc001ate.3	+						MTHFR_uc001atc.1_5'Flank|MTHFR_uc001atd.1_5'Flank|MTHFR_uc009vnd.1_5'Flank|CLCN6_uc009vne.1_Intron|CLCN6_uc009vnf.1_Intron|CLCN6_uc009vng.1_Intron|CLCN6_uc009vnh.1_Intron|CLCN6_uc010oat.1_Intron|CLCN6_uc010oau.1_Intron	NM_001286	NP_001277			chloride channel 6 isoform ClC-6a						cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	11924692	11924693	+	IGR	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11924692_11924693delTC								NPPB (5700 upstream) : KIAA2013 (55431 downstream)																																			---	---	---	---
FHAD1	114827	broad.mit.edu	37	1	15720266	15720266	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15720266delT	uc001awb.2	+						FHAD1_uc010obl.1_Intron|FHAD1_uc001awe.1_Intron|FHAD1_uc001awg.2_Intron	NM_052929	NP_443161			forkhead-associated (FHA) phosphopeptide binding											skin(1)	1																		---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17098018	17098019	+	Intron	INS	-	ACAC	ACAC	rs72381779		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17098018_17098019insACAC	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	17523471	17523487	+	IGR	DEL	GGGGGATGCCCCACAGA	-	-	rs66555619		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17523471_17523487delGGGGGATGCCCCACAGA								PADI2 (77523 upstream) : PADI1 (8134 downstream)																																			---	---	---	---
ARHGEF10L	55160	broad.mit.edu	37	1	17884683	17884684	+	Intron	INS	-	CCAT	CCAT			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17884683_17884684insCCAT	uc001ban.2	+						ARHGEF10L_uc009vpe.1_Intron	NM_018125	NP_060595			Rho guanine nucleotide exchange factor (GEF)						regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)														---	---	---	---
CAPZB	832	broad.mit.edu	37	1	19717565	19717566	+	Intron	INS	-	T	T	rs11388908		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19717565_19717566insT	uc010ocz.1	-						CAPZB_uc001bce.2_Intron|CAPZB_uc009vpk.2_Intron|CAPZB_uc001bcd.2_Intron	NM_004930	NP_004921			F-actin capping protein beta subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement	cytosol|F-actin capping protein complex|WASH complex	actin binding				0		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	22271496	22271496	+	IGR	DEL	T	-	-	rs144390130		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22271496delT								HSPG2 (7746 upstream) : CELA3B (31922 downstream)																																			---	---	---	---
WNT4	54361	broad.mit.edu	37	1	22445681	22445682	+	3'UTR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22445681_22445682delGT	uc001bfs.3	-	5					WNT4_uc010odt.1_3'UTR	NM_030761	NP_110388			wingless-type MMTV integration site family,						adrenal gland development|androgen biosynthetic process|anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|dermatome development|endoderm development|epithelial to mesenchymal transition|establishment of protein localization in plasma membrane|female gonad development|female sex determination|liver development|male gonad development|mesonephric tubule development|metanephric mesenchymal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of male gonad development|negative regulation of testicular blood vessel morphogenesis|negative regulation of testosterone biosynthetic process|negative regulation of transcription, DNA-dependent|oocyte development|paramesonephric duct development|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of collagen biosynthetic process|positive regulation of cortisol biosynthetic process|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|protein palmitoylation|renal vesicle formation|smooth muscle cell differentiation|somatotropin secreting cell differentiation|tertiary branching involved in mammary gland duct morphogenesis|thyroid-stimulating hormone-secreting cell differentiation|Wnt receptor signaling pathway, calcium modulating pathway	cell surface|extracellular space|Golgi apparatus|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|signal transducer activity|transcription corepressor activity			ovary(1)	1		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)														---	---	---	---
ZBTB40	9923	broad.mit.edu	37	1	22839943	22839943	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22839943delA	uc001bft.2	+						ZBTB40_uc001bfu.2_Intron|ZBTB40_uc009vqi.1_Intron	NM_001083621	NP_001077090			zinc finger and BTB domain containing 40						bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)														---	---	---	---
CLIC4	25932	broad.mit.edu	37	1	25108160	25108160	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25108160delT	uc001bjo.2	+						CLIC4_uc001bjn.2_Intron|CLIC4_uc001bjp.1_Intron	NM_013943	NP_039234			chloride intracellular channel 4						cellular response to calcium ion|establishment or maintenance of apical/basal cell polarity|keratinocyte differentiation|negative regulation of cell migration|regulation of cytoskeleton organization	actin cytoskeleton|apical part of cell|cell surface|cell-cell junction|centrosome|chloride channel complex|cytoplasmic vesicle membrane|cytosol|microvillus|midbody|mitochondrion|nuclear matrix|perinuclear region of cytoplasm|soluble fraction	voltage-gated chloride channel activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000778)|all_lung(284;0.00106)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0479)|OV - Ovarian serous cystadenocarcinoma(117;1.06e-24)|Colorectal(126;1.03e-07)|COAD - Colon adenocarcinoma(152;4.93e-06)|STAD - Stomach adenocarcinoma(196;0.000418)|GBM - Glioblastoma multiforme(114;0.000451)|BRCA - Breast invasive adenocarcinoma(304;0.00215)|KIRC - Kidney renal clear cell carcinoma(1967;0.00216)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	26804238	26804239	+	IGR	INS	-	CC	CC	rs144509213	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26804238_26804239insCC								HMGN2 (1107 upstream) : RPS6KA1 (52010 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	26845586	26845587	+	IGR	INS	-	T	T	rs11247961	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26845586_26845587insT								HMGN2 (42455 upstream) : RPS6KA1 (10662 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	28687145	28687145	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28687145delA								MED18 (24668 upstream) : PHACTR4 (8948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	29780308	29780309	+	IGR	INS	-	CCTC	CCTC	rs148826493	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29780308_29780309insCCTC								PTPRU (126993 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	30575622	30575624	+	IGR	DEL	GAT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30575622_30575624delGAT								PTPRU (922307 upstream) : MATN1 (608502 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	31173948	31173949	+	IGR	INS	-	GCCCCCAAG	GCCCCCAAG	rs147204400	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31173948_31173949insGCCCCCAAG								None (None upstream) : MATN1 (10177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	31244651	31244744	+	IGR	DEL	ACTGCAACCTTTTCCCTCACTTTTTTTTTTCCCCTTTGGAGACAGGGTCTCACTCTGTCACCCAGACTGGAGTGCAGTGGTGCGATCACAGCTC	-	-	rs59493736	by1000genomes;by1000genomes;by1000genomes;by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31244651_31244744delACTGCAACCTTTTCCCTCACTTTTTTTTTTCCCCTTTGGAGACAGGGTCTCACTCTGTCACCCAGACTGGAGTGCAGTGGTGCGATCACAGCTC								LAPTM5 (13968 upstream) : SDC3 (97569 downstream)																																			---	---	---	---
FABP3	2170	broad.mit.edu	37	1	31838551	31838552	+	3'UTR	INS	-	A	A	rs5773353		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31838551_31838552insA	uc001bss.1	-	4						NM_004102	NP_004093			fatty acid binding protein 3						negative regulation of cell proliferation					ovary(1)	1		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0185)|READ - Rectum adenocarcinoma(331;0.149)														---	---	---	---
ZBTB8OS	339487	broad.mit.edu	37	1	33111925	33111925	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33111925delA	uc001bvp.2	-						ZBTB8OS_uc001bvo.1_Intron|ZBTB8OS_uc001bvq.2_Intron	NM_178547	NP_848642			zinc finger and BTB domain containing 8 opposite												0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)																---	---	---	---
RNF19B	127544	broad.mit.edu	37	1	33421350	33421350	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33421350delA	uc010oho.1	-						RNF19B_uc001bwm.3_Intron|RNF19B_uc010ohp.1_Intron	NM_153341	NP_699172			ring finger protein 19B isoform a							integral to membrane	ligase activity|protein binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)																---	---	---	---
PHC2	1912	broad.mit.edu	37	1	33859956	33859957	+	Intron	INS	-	A	A	rs140785638	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33859956_33859957insA	uc009vuh.1	-						PHC2_uc001bxi.1_Intron	NM_198040	NP_932157			polyhomeotic-like 2 isoform a						multicellular organismal development	PcG protein complex	DNA binding|identical protein binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	36261478	36261479	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36261478_36261479insA								CLSPN (25927 upstream) : EIF2C4 (12349 downstream)																																			---	---	---	---
STK40	83931	broad.mit.edu	37	1	36847787	36847787	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36847787delT	uc001cak.1	-						STK40_uc001cal.1_Intron|STK40_uc001cam.1_Intron|STK40_uc009vva.1_Intron	NM_032017	NP_114406			serine/threonine kinase 40							cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)																---	---	---	---
STK40	83931	broad.mit.edu	37	1	36853370	36853371	+	5'Flank	DEL	AC	-	-	rs113801278		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36853370_36853371delAC	uc001cak.1	-						STK40_uc001cal.1_5'Flank|STK40_uc001cam.1_5'Flank|STK40_uc009vva.1_5'Flank	NM_032017	NP_114406			serine/threonine kinase 40							cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	37079274	37079275	+	IGR	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37079274_37079275delAC								CSF3R (130765 upstream) : GRIK3 (181853 downstream)																																			---	---	---	---
ZMPSTE24	10269	broad.mit.edu	37	1	40732685	40732686	+	Intron	INS	-	TT	TT	rs145641819	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40732685_40732686insTT	uc001cfg.2	+							NM_005857	NP_005848			zinc metallopeptidase STE24							endoplasmic reticulum membrane|Golgi membrane|integral to membrane	metal ion binding|metalloexopeptidase activity				0	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)															---	---	---	---
ZNF642	339559	broad.mit.edu	37	1	40951956	40951956	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40951956delT	uc001cfo.2	+						ZNF642_uc009vwb.2_Intron|ZNF642_uc010ojk.1_Intron	NM_198494	NP_940896			zinc finger protein 642						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.81e-19)															---	---	---	---
CTPS	1503	broad.mit.edu	37	1	41453951	41453951	+	Intron	DEL	T	-	-	rs146232533		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41453951delT	uc001cgk.3	+						CTPS_uc010ojo.1_Intron|CTPS_uc010ojp.1_Intron|CTPS_uc001cgl.3_Intron|CTPS_uc010ojq.1_5'Flank	NM_001905	NP_001896			CTP synthase						CTP biosynthetic process|glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|response to drug	cytosol	ATP binding|CTP synthase activity|protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)			L-Glutamine(DB00130)													---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	42188456	42188456	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42188456delA	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron	NM_024503	NP_078779			human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
FOXJ3	22887	broad.mit.edu	37	1	42678198	42678198	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42678198delA	uc001che.2	-						FOXJ3_uc001chf.2_Intron|FOXJ3_uc001chg.2_Intron|FOXJ3_uc001chh.1_Intron	NM_014947	NP_055762			forkhead box J3						embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)	2	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
KDM4A	9682	broad.mit.edu	37	1	44127898	44127898	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44127898delT	uc001cjx.2	+						KDM4A_uc010oki.1_Intron	NM_014663	NP_055478			jumonji domain containing 2A						interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1																		---	---	---	---
EIF2B3	8891	broad.mit.edu	37	1	45427876	45427877	+	Intron	INS	-	CATCAT	CATCAT	rs138231502	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45427876_45427877insCATCAT	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron|EIF2B3_uc001cmw.2_Intron	NM_020365	NP_065098			eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
ZSWIM5	57643	broad.mit.edu	37	1	45528188	45528188	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45528188delT	uc001cnd.2	-							NM_020883	NP_065934			zinc finger, SWIM domain containing 5								zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
MAST2	23139	broad.mit.edu	37	1	46461758	46461759	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46461758_46461759insT	uc001cov.2	+						MAST2_uc001cow.2_Intron|MAST2_uc001cox.1_Intron|MAST2_uc001coy.1_Intron|MAST2_uc001coz.1_Intron|MAST2_uc009vya.2_Intron	NM_015112	NP_055927			microtubule associated serine/threonine kinase						regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|stomach(2)|breast(1)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)																	---	---	---	---
C1orf185	284546	broad.mit.edu	37	1	51578489	51578489	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51578489delT	uc001csh.2	+							NM_001136508	NP_001129980			hypothetical protein LOC284546							integral to membrane					0																		---	---	---	---
ORC1L	4998	broad.mit.edu	37	1	52845838	52845838	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52845838delT	uc001ctt.2	-						ORC1L_uc010oni.1_Intron|ORC1L_uc001ctu.2_Intron|ORC1L_uc009vzd.2_Intron	NM_004153	NP_004144			origin recognition complex, subunit 1						cell cycle checkpoint|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nuclear origin of replication recognition complex|nucleolus|nucleoplasm|plasma membrane	ATP binding|DNA binding|nucleoside-triphosphatase activity|protein binding				0																		---	---	---	---
GLIS1	148979	broad.mit.edu	37	1	54053326	54053326	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54053326delA	uc001cvr.1	-							NM_147193	NP_671726			GLIS family zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	54231850	54231851	+	IGR	INS	-	A	A	rs138220438	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54231850_54231851insA								GLIS1 (31973 upstream) : TMEM48 (1539 downstream)																																			---	---	---	---
LRRC42	115353	broad.mit.edu	37	1	54419410	54419411	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54419410_54419411insT	uc001cwj.1	+						LRRC42_uc001cwl.1_Intron|LRRC42_uc001cwk.1_Intron|LRRC42_uc009vzm.1_Intron	NM_052940	NP_443172			leucine rich repeat containing 42												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	56700728	56700729	+	IGR	DEL	TG	-	-	rs5774266		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56700728_56700729delTG								None (None upstream) : PPAP2B (259704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	60544914	60544915	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60544914_60544915delTG								C1orf87 (5488 upstream) : NFIA (998031 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	60597364	60597364	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60597364delA								C1orf87 (57938 upstream) : NFIA (945582 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	60881950	60881951	+	IGR	DEL	AT	-	-	rs147492999	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60881950_60881951delAT								C1orf87 (342524 upstream) : NFIA (660995 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	61404047	61404052	+	IGR	DEL	ACACAC	-	-	rs111239645		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61404047_61404052delACACAC								C1orf87 (864621 upstream) : NFIA (138894 downstream)																																			---	---	---	---
NFIA	4774	broad.mit.edu	37	1	61697520	61697523	+	Intron	DEL	AAAC	-	-	rs71753657		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61697520_61697523delAAAC	uc001czw.2	+						NFIA_uc001czy.2_Intron|NFIA_uc010oos.1_Intron|NFIA_uc001czv.2_Intron	NM_001134673	NP_001128145			nuclear factor I/A isoform 1						DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2																		---	---	---	---
KANK4	163782	broad.mit.edu	37	1	62720238	62720238	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62720238delT	uc001dah.3	-						KANK4_uc001dai.3_Intron|KANK4_uc001daf.3_Intron|KANK4_uc001dag.3_Intron	NM_181712	NP_859063			ankyrin repeat domain 38											ovary(3)|skin(2)|lung(1)	6																		---	---	---	---
DOCK7	85440	broad.mit.edu	37	1	62926276	62926285	+	Intron	DEL	ACACACACAC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62926276_62926285delACACACACAC	uc001daq.2	-						DOCK7_uc001dan.2_Intron|DOCK7_uc001dao.2_Intron|DOCK7_uc001dap.2_Intron|DOCK7_uc001dam.2_Intron|DOCK7_uc010oov.1_Intron	NM_033407	NP_212132			dedicator of cytokinesis 7						activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2																		---	---	---	---
DOCK7	85440	broad.mit.edu	37	1	62926336	62926336	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62926336delT	uc001daq.2	-						DOCK7_uc001dan.2_Intron|DOCK7_uc001dao.2_Intron|DOCK7_uc001dap.2_Intron|DOCK7_uc001dam.2_Intron|DOCK7_uc010oov.1_Intron	NM_033407	NP_212132			dedicator of cytokinesis 7						activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	63331691	63331691	+	IGR	DEL	A	-	-	rs11362515		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63331691delA								ATG4C (1642 upstream) : FOXD3 (457039 downstream)																																			---	---	---	---
ROR1	4919	broad.mit.edu	37	1	64469362	64469363	+	Intron	INS	-	CCT	CCT	rs149251617	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64469362_64469363insCCT	uc001dbj.2	+						ROR1_uc001dbi.3_Intron	NM_005012	NP_005003			receptor tyrosine kinase-like orphan receptor 1						transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|central_nervous_system(1)|skin(1)|kidney(1)	19																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	64644708	64644708	+	5'Flank	DEL	A	-	-	rs145798283		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64644708delA	uc001dbm.2	+											Homo sapiens cDNA FLJ20769 fis, clone COL06674.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	67984288	67984288	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67984288delG								SERBP1 (88165 upstream) : GADD45A (166595 downstream)																																			---	---	---	---
GNG12	55970	broad.mit.edu	37	1	68216868	68216869	+	Intron	DEL	AC	-	-	rs112598957		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68216868_68216869delAC	uc001dea.1	-							NM_018841	NP_061329			G-protein gamma-12 subunit precursor						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0																		---	---	---	---
LRRC7	57554	broad.mit.edu	37	1	70032701	70032702	+	5'Flank	INS	-	GT	GT	rs12043780		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70032701_70032702insGT	uc001deo.1	+											SubName: Full=Leucine rich repeat containing 7; SubName: Full=cDNA FLJ54846, highly similar to Leucine-rich repeat-containing protein 7;							centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14																		---	---	---	---
LRRC7	57554	broad.mit.edu	37	1	70328662	70328662	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70328662delT	uc001dep.2	+						LRRC7_uc001deo.1_Intron|LRRC7_uc009wbg.2_Intron	NM_020794	NP_065845			leucine rich repeat containing 7							centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14																		---	---	---	---
LRRC7	57554	broad.mit.edu	37	1	70343959	70343960	+	Intron	INS	-	AA	AA	rs139462719		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70343959_70343960insAA	uc001dep.2	+						LRRC7_uc009wbg.2_Intron	NM_020794	NP_065845			leucine rich repeat containing 7							centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	72853490	72853490	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72853490delA								NEGR1 (105085 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	73076116	73076118	+	IGR	DEL	TTC	-	-	rs72320236		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73076116_73076118delTTC								NEGR1 (327711 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	73604390	73604393	+	IGR	DEL	GTGT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73604390_73604393delGTGT								NEGR1 (855985 upstream) : LRRIQ3 (887311 downstream)																																			---	---	---	---
SLC44A5	204962	broad.mit.edu	37	1	76125136	76125137	+	Intron	INS	-	GGGAG	GGGAG			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76125136_76125137insGGGAG	uc010oqz.1	-						SLC44A5_uc010orb.1_Intron|uc001dgv.2_Intron	NM_001130058	NP_001123530			solute carrier family 44, member 5 isoform B							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4																		---	---	---	---
NEXN	91624	broad.mit.edu	37	1	78357767	78357768	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78357767_78357768insA	uc001dic.3	+						NEXN_uc001dia.3_Intron|NEXN_uc009wcb.1_Intron|NEXN_uc001dib.3_Intron	NM_144573	NP_653174			nexilin (F actin binding protein)						regulation of cell migration|regulation of cytoskeleton organization	cytoskeleton|Z disc	actin filament binding|structural constituent of muscle			ovary(2)	2				Colorectal(170;0.114)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	80841577	80841578	+	IGR	DEL	CA	-	-	rs141565927		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80841577_80841578delCA								None (None upstream) : LPHN2 (930267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	80870094	80870097	+	IGR	DEL	AAAT	-	-	rs10604366		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80870094_80870097delAAAT								None (None upstream) : LPHN2 (901748 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	82493915	82493915	+	IGR	DEL	A	-	-	rs142640427		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82493915delA								LPHN2 (35809 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	84039774	84039775	+	IGR	INS	-	T	T	rs150836158	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84039774_84039775insT								None (None upstream) : TTLL7 (295284 downstream)																																			---	---	---	---
WDR63	126820	broad.mit.edu	37	1	85598310	85598310	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85598310delT	uc001dkt.2	+						WDR63_uc009wcl.2_Intron	NM_145172	NP_660155			WD repeat domain 63											upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)														---	---	---	---
CLCA4	22802	broad.mit.edu	37	1	87024662	87024662	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87024662delT	uc009wcs.2	+						CLCA4_uc009wct.2_Intron|CLCA4_uc009wcu.2_Intron	NM_012128	NP_036260			chloride channel accessory 4							apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity			ovary(2)	2		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)														---	---	---	---
HS2ST1	9653	broad.mit.edu	37	1	87489148	87489149	+	Intron	INS	-	AA	AA	rs35738255		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87489148_87489149insAA	uc010osk.1	+						HS2ST1_uc001dmc.3_Intron|LOC339524_uc001dme.1_Intron	NM_012262	NP_036394			heparan sulfate 2-O-sulfotransferase 1 isoform							Golgi membrane|integral to membrane				central_nervous_system(1)	1		Lung NSC(277;0.153)		all cancers(265;0.00699)|Epithelial(280;0.0261)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	88904427	88904427	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88904427delG								None (None upstream) : PKN2 (245495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	89134780	89134780	+	IGR	DEL	A	-	-	rs111333987		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89134780delA								None (None upstream) : PKN2 (15142 downstream)																																			---	---	---	---
GBP1	2633	broad.mit.edu	37	1	89518866	89518866	+	3'UTR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89518866delT	uc001dmx.2	-	11						NM_002053	NP_002044			guanylate binding protein 1,						interferon-gamma-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	91259933	91259933	+	IGR	DEL	T	-	-	rs112228223		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91259933delT								BARHL2 (77139 upstream) : ZNF644 (120927 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	92034539	92034542	+	IGR	DEL	AAAA	-	-	rs72244198		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92034539_92034542delAAAA								CDC7 (43219 upstream) : HSP90B3P (66026 downstream)																																			---	---	---	---
CCDC18	343099	broad.mit.edu	37	1	93700547	93700547	+	Intron	DEL	C	-	-	rs28545502		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93700547delC	uc001dpq.2	+						CCDC18_uc009wdl.1_Intron	NM_206886	NP_996769			sarcoma antigen NY-SAR-41											ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	95112507	95112508	+	IGR	DEL	TC	-	-	rs71860500		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95112507_95112508delTC								F3 (105136 upstream) : SLC44A3 (173393 downstream)																																			---	---	---	---
PTBP2	58155	broad.mit.edu	37	1	97231264	97231265	+	Intron	INS	-	TAGA	TAGA	rs142433685	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97231264_97231265insTAGA	uc001drq.2	+						PTBP2_uc001drn.2_Intron|PTBP2_uc001dro.2_Intron|PTBP2_uc010otz.1_Intron|PTBP2_uc001drp.2_Intron|PTBP2_uc009wdw.2_Intron|PTBP2_uc001drr.2_Intron|PTBP2_uc010oua.1_Intron|PTBP2_uc001dru.2_Intron|PTBP2_uc001drm.2_Intron	NM_021190	NP_067013			polypyrimidine tract binding protein 2								nucleotide binding				0		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)														---	---	---	---
DPYD	1806	broad.mit.edu	37	1	98296264	98296264	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98296264delA	uc001drv.2	-						DPYD_uc010oub.1_Intron|DPYD_uc001drw.2_Intron	NM_000110	NP_000101			dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	99020604	99020604	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99020604delT								MIR137 (508877 upstream) : SNX7 (106632 downstream)																																			---	---	---	---
LPPR5	163404	broad.mit.edu	37	1	99391084	99391085	+	Intron	INS	-	G	G			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99391084_99391085insG	uc001dsb.2	-						LPPR5_uc001dsc.2_Intron	NM_001037317	NP_001032394			phosphatidic acid phosphatase type 2d isoform 1							integral to membrane	hydrolase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	99874087	99874088	+	IGR	INS	-	TG	TG	rs140442502	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99874087_99874088insTG								LPPR4 (98951 upstream) : PALMD (237343 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	99970555	99970556	+	IGR	INS	-	T	T	rs111823048		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99970555_99970556insT								LPPR4 (195419 upstream) : PALMD (140875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	104793872	104793872	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104793872delC								AMY1A (586700 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	104882611	104882613	+	IGR	DEL	GTT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104882611_104882613delGTT								AMY1A (675439 upstream) : None (None downstream)																																			---	---	---	---
NTNG1	22854	broad.mit.edu	37	1	107716349	107716350	+	Intron	INS	-	T	T	rs34761958		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107716349_107716350insT	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvd.1_Intron	NM_001113226	NP_001106697			netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)														---	---	---	---
WDR47	22911	broad.mit.edu	37	1	109518993	109518994	+	Intron	INS	-	A	A	rs76105975		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109518993_109518994insA	uc001dwj.2	-						WDR47_uc001dwl.2_Intron|WDR47_uc001dwi.2_Intron|WDR47_uc010ovf.1_Intron	NM_001142551	NP_001136023			WD repeat domain 47 isoform 3											ovary(1)	1		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)														---	---	---	---
SYPL2	284612	broad.mit.edu	37	1	110007916	110007917	+	5'Flank	DEL	CT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110007916_110007917delCT	uc001dxp.2	+						SYPL2_uc001dxo.2_5'Flank|SYPL2_uc010ovk.1_5'Flank	NM_001040709	NP_001035799			mitsugumin 29							integral to membrane|synaptic vesicle	transporter activity			ovary(1)	1		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	111534091	111534091	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111534091delT								C1orf103 (27525 upstream) : DRAM2 (125864 downstream)																																			---	---	---	---
CHIA	27159	broad.mit.edu	37	1	111831148	111831148	+	5'Flank	DEL	C	-	-	rs76998844		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111831148delC	uc001eas.2	+						CHIA_uc001ear.2_5'Flank|CHIA_uc001eaq.2_5'Flank|CHIA_uc009wgc.2_5'Flank|CHIA_uc001eat.2_5'Flank	NM_201653	NP_970615			acidic chitinase isoform c						apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding			ovary(1)	1		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)														---	---	---	---
RAP1A	5906	broad.mit.edu	37	1	112231434	112231444	+	Intron	DEL	TTTTTTTTTTG	-	-	rs140921538	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112231434_112231444delTTTTTTTTTTG	uc001ebi.2	+						RAP1A_uc001ebk.2_Intron|RAP1A_uc001ebl.2_Intron|RAP1A_uc001ebm.2_Intron	NM_002884	NP_002875			RAP1A, member of RAS oncogene family precursor						activation of MAPKK activity|blood coagulation|energy reserve metabolic process|nerve growth factor receptor signaling pathway|regulation of insulin secretion	cytosol|plasma membrane	GTP binding|GTPase activity				0		all_cancers(81;6.79e-06)|all_epithelial(167;2.42e-05)|all_lung(203;0.000105)|Lung NSC(277;0.00021)		Lung(183;0.0183)|Colorectal(144;0.0418)|LUSC - Lung squamous cell carcinoma(189;0.0966)|all cancers(265;0.098)|Epithelial(280;0.0981)|COAD - Colon adenocarcinoma(174;0.141)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	112689668	112689669	+	IGR	INS	-	T	T	rs148613185	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112689668_112689669insT								KCND3 (157891 upstream) : CTTNBP2NL (249131 downstream)																																			---	---	---	---
PTPN22	26191	broad.mit.edu	37	1	114401265	114401266	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114401265_114401266insT	uc001eds.2	-						uc001edv.1_Intron|PTPN22_uc009wgq.2_Intron|PTPN22_uc010owo.1_Intron|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Intron|PTPN22_uc009wgs.2_Intron|PTPN22_uc001edu.2_Intron	NM_015967	NP_057051			protein tyrosine phosphatase, non-receptor type						negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
SYT6	148281	broad.mit.edu	37	1	114658681	114658682	+	Intron	INS	-	T	T	rs144695318	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114658681_114658682insT	uc001eev.2	-							NM_205848	NP_995320			synaptotagmin VI						acrosomal vesicle exocytosis	cell junction|cytosol|integral to membrane|perinuclear endoplasmic reticulum|peripheral to membrane of membrane fraction|synaptic vesicle membrane	clathrin binding|metal ion binding|protein homodimerization activity|syntaxin binding|transporter activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
TRIM33	51592	broad.mit.edu	37	1	114946929	114946929	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114946929delT	uc001eew.2	-						TRIM33_uc010owr.1_Intron|TRIM33_uc010ows.1_Intron|TRIM33_uc001eex.2_Intron	NM_015906	NP_056990			tripartite motif-containing 33 protein isoform						negative regulation of BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	nucleus	co-SMAD binding|DNA binding|ligase activity|R-SMAD binding|zinc ion binding			lung(4)|central_nervous_system(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	11	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)				T	RET	papillary thyroid								---	---	---	---
TRIM33	51592	broad.mit.edu	37	1	115023029	115023031	+	Intron	DEL	CTT	-	-	rs73007268		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115023029_115023031delCTT	uc001eew.2	-						TRIM33_uc001eex.2_Intron	NM_015906	NP_056990			tripartite motif-containing 33 protein isoform						negative regulation of BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	nucleus	co-SMAD binding|DNA binding|ligase activity|R-SMAD binding|zinc ion binding			lung(4)|central_nervous_system(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	11	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)				T	RET	papillary thyroid								---	---	---	---
Unknown	0	broad.mit.edu	37	1	116621644	116621645	+	IGR	INS	-	GT	GT	rs145627072	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116621644_116621645insGT								SLC22A15 (8972 upstream) : C1orf161 (32731 downstream)																																			---	---	---	---
PTGFRN	5738	broad.mit.edu	37	1	117508246	117508246	+	Intron	DEL	C	-	-	rs34687952		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117508246delC	uc001egv.1	+							NM_020440	NP_065173			prostaglandin F2 receptor negative regulator							endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	protein binding			liver(1)	1	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)														---	---	---	---
TBX15	6913	broad.mit.edu	37	1	119516072	119516072	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119516072delA	uc001ehl.1	-							NM_152380	NP_689593			T-box 15							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)	2	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	119545143	119545143	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119545143delT								TBX15 (12964 upstream) : WARS2 (28698 downstream)																																			---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120607696	120607697	+	Intron	DEL	CC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120607696_120607697delCC	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719			notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120612003	120612004	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612003_120612004delGG	uc001eik.2	-	1	273_274	c.17_18delCC	c.(16-18)CCCfs	p.P6fs	NOTCH2_uc001eil.2_Frame_Shift_Del_p.P6fs|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	6					anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	1	120890531	120890532	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120890531_120890532insA								FAM72B (34851 upstream) : HIST2H2BA (15502 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142559278	142559279	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142559278_142559279insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142588368	142588369	+	IGR	INS	-	C	C	rs4847598		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142588368_142588369insC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142663441	142663442	+	Intron	INS	-	A	A	rs147458002		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142663441_142663442insA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142686987	142686989	+	Intron	DEL	CTT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142686987_142686989delCTT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143486948	143486957	+	IGR	DEL	TGTGTGTGTG	-	-	rs113342785		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143486948_143486957delTGTGTGTGTG								None (None upstream) : LOC100286793 (160682 downstream)																																			---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144530894	144530895	+	Intron	INS	-	TTT	TTT	rs79314376	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144530894_144530895insTTT	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144852877	144852877	+	Intron	DEL	T	-	-	rs71909310		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144852877delT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144853333	144853334	+	Intron	INS	-	AA	AA	rs149112816		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144853333_144853334insAA	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	145024587	145024590	+	Intron	DEL	ACAT	-	-	rs67086497		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145024587_145024590delACAT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145077022	145077026	+	Intron	DEL	TAGAT	-	-	rs3884082		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145077022_145077026delTAGAT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_5'Flank|PDE4DIP_uc001emh.2_5'Flank|PDE4DIP_uc001emk.2_5'Flank					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145099902	145099903	+	Intron	INS	-	A	A	rs139193649		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145099902_145099903insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145195793	145195793	+	Intron	DEL	G	-	-	rs71979687		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145195793delG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145208967	145208967	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145208967delG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'Flank|NOTCH2NL_uc001emn.3_5'Flank|NOTCH2NL_uc001emm.3_5'Flank|NOTCH2NL_uc001emo.2_5'Flank|NOTCH2NL_uc010oyh.1_5'Flank					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145249774	145249775	+	Intron	INS	-	T	T	rs139599590		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145249774_145249775insT	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145378949	145378950	+	Intron	INS	-	G	G	rs138005187	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145378949_145378950insG	uc001emp.3	+							NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	149335475	149335476	+	IGR	DEL	AC	-	-	rs35995909		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149335475_149335476delAC								LOC388692 (43733 upstream) : FCGR1C (33818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149691600	149691601	+	IGR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149691600_149691601delGT								HIST2H2BF (292371 upstream) : FCGR1A (62649 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149731754	149731755	+	IGR	DEL	TT	-	-	rs10580354		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149731754_149731755delTT								HIST2H2BF (332525 upstream) : FCGR1A (22495 downstream)																																			---	---	---	---
GABPB2	126626	broad.mit.edu	37	1	151080412	151080412	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151080412delA	uc001ewr.2	+						GABPB2_uc001ews.2_Intron|GABPB2_uc001ewt.2_Intron	NM_144618	NP_653219			GA repeat binding protein, beta 2						positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	protein heterodimerization activity|transcription regulatory region DNA binding				0				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	152170253	152170254	+	IGR	DEL	CT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152170253_152170254delCT								RPTN (38549 upstream) : HRNR (14304 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	152892499	152892500	+	IGR	INS	-	T	T	rs76636381	byFrequency;by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152892499_152892500insT								IVL (8138 upstream) : SPRR4 (50628 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	152952307	152952308	+	IGR	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152952307_152952308delTC								SPRR4 (7238 upstream) : SPRR1A (4249 downstream)																																			---	---	---	---
TDRD10	126668	broad.mit.edu	37	1	154492241	154492242	+	Intron	DEL	TG	-	-	rs72365002		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154492241_154492242delTG	uc009wow.2	+						TDRD10_uc001ffd.2_Intron|TDRD10_uc001ffe.2_5'Flank	NM_001098475	NP_001091945			tudor domain containing 10 isoform a								nucleotide binding|RNA binding			ovary(1)	1	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)															---	---	---	---
ADAR	103	broad.mit.edu	37	1	154580968	154580969	+	5'Flank	INS	-	T	T	rs67463447		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154580968_154580969insT	uc001ffh.2	-						ADAR_uc001ffj.2_5'Flank|ADAR_uc001ffi.2_5'Flank|ADAR_uc001ffk.2_Intron|ADAR_uc001ffl.1_5'Flank|ADAR_uc001ffm.1_5'Flank|ADAR_uc001ffn.1_5'Flank	NM_001111	NP_001102			adenosine deaminase, RNA-specific isoform a						adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)														---	---	---	---
SEMA4A	64218	broad.mit.edu	37	1	156136720	156136720	+	Intron	DEL	A	-	-	rs111620474		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156136720delA	uc001fnl.2	+						SEMA4A_uc009wrq.2_Intron|SEMA4A_uc001fnm.2_Intron|SEMA4A_uc001fnn.2_Intron|SEMA4A_uc001fno.2_Intron	NM_022367	NP_071762			semaphorin B precursor						axon guidance	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)																	---	---	---	---
NTRK1	4914	broad.mit.edu	37	1	156800194	156800195	+	Intron	INS	-	G	G			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156800194_156800195insG	uc001fqf.1	+						NTRK1_uc009wsi.1_Intron	NM_001007792	NP_001007793			neurotrophic tyrosine kinase, receptor, type 1						activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			---	---	---	---
ETV3	2117	broad.mit.edu	37	1	157099644	157099645	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157099644_157099645insT	uc001fqr.2	-							NM_001145312	NP_001138784			ets variant gene 3 isoform 1								sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(266;0.158)	Prostate(1639;0.174)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	157195924	157195925	+	IGR	INS	-	C	C	rs146653842	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157195924_157195925insC								ETV3 (87541 upstream) : FCRL5 (287243 downstream)																																			---	---	---	---
CASQ1	844	broad.mit.edu	37	1	160167985	160167985	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160167985delA	uc010pja.1	+							NM_001231	NP_001222			calsequestrin 1							mitochondrial matrix|sarcoplasmic reticulum lumen|smooth endoplasmic reticulum	calcium ion binding			central_nervous_system(1)	1	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)															---	---	---	---
ATF6	22926	broad.mit.edu	37	1	161782574	161782575	+	Intron	INS	-	TGTG	TGTG	rs150236858	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161782574_161782575insTGTG	uc001gbr.2	+						ATF6_uc001gbq.1_Intron	NM_007348	NP_031374			activating transcription factor 6						positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)															---	---	---	---
NOS1AP	9722	broad.mit.edu	37	1	162071563	162071563	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162071563delT	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512			nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)															---	---	---	---
NOS1AP	9722	broad.mit.edu	37	1	162299151	162299152	+	Intron	INS	-	AG	AG	rs145316732	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162299151_162299152insAG	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512			nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	164943323	164943323	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164943323delT								PBX1 (89023 upstream) : LMX1A (227782 downstream)																																			---	---	---	---
MPZL1	9019	broad.mit.edu	37	1	167756243	167756243	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167756243delC	uc001geo.2	+						MPZL1_uc001gep.2_Intron|MPZL1_uc001geq.2_Intron|MPZL1_uc009wvh.2_Intron	NM_003953	NP_003944			myelin protein zero-like 1 isoform a						cell-cell signaling|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	protein binding|structural molecule activity			ovary(2)	2	all_hematologic(923;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	168780757	168780758	+	IGR	INS	-	TGTG	TGTG	rs147042581	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168780757_168780758insTGTG								MGC4473 (18637 upstream) : ATP1B1 (295189 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	168949453	168949459	+	IGR	DEL	CTCTCCC	-	-	rs11279428		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168949453_168949459delCTCTCCC								MGC4473 (187333 upstream) : ATP1B1 (126488 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	171260299	171260299	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171260299delT								FMO1 (5188 upstream) : FMO4 (23187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	171666848	171666849	+	IGR	INS	-	A	A	rs111486998		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171666848_171666849insA								MYOC (45025 upstream) : VAMP4 (2449 downstream)																																			---	---	---	---
ASTN1	460	broad.mit.edu	37	1	176952097	176952097	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176952097delG	uc001glc.2	-						ASTN1_uc001glb.1_Intron|ASTN1_uc001gld.1_Intron|ASTN1_uc009wwx.1_Intron|ASTN1_uc001gle.3_Intron	NM_004319	NP_004310			astrotactin isoform 1						cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	177550929	177550930	+	IGR	INS	-	A	A	rs35764936		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177550929_177550930insA								FAM5B (299372 upstream) : SEC16B (346559 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	178537000	178537001	+	IGR	INS	-	TG	TG	rs150602444	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178537000_178537001insTG								C1orf220 (18976 upstream) : RALGPS2 (157299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	178943820	178943820	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178943820delA								RALGPS2 (54585 upstream) : FAM20B (51254 downstream)																																			---	---	---	---
C1orf125	126859	broad.mit.edu	37	1	179335499	179335500	+	Intron	INS	-	T	T	rs35129223		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179335499_179335500insT	uc001gmo.2	+						C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmn.1_Intron|C1orf125_uc010pnl.1_Intron|C1orf125_uc001gmp.2_Intron	NM_144696	NP_653297			hypothetical protein LOC126859 isoform 1												0																		---	---	---	---
NPHS2	7827	broad.mit.edu	37	1	179530945	179530946	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179530945_179530946insT	uc001gmq.3	-						NPHS2_uc009wxi.2_Intron	NM_014625	NP_055440			podocin						excretion	integral to plasma membrane	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	180574060	180574061	+	IGR	DEL	AA	-	-	rs67865299		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180574060_180574061delAA								ACBD6 (102038 upstream) : XPR1 (27085 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	183119307	183119308	+	IGR	INS	-	CTG	CTG	rs72210292		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183119307_183119308insCTG								LAMC1 (4581 upstream) : LAMC2 (35866 downstream)																																			---	---	---	---
FAM129A	116496	broad.mit.edu	37	1	184771529	184771529	+	Intron	DEL	A	-	-	rs111998490		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184771529delA	uc001gra.2	-						FAM129A_uc001grb.1_Intron	NM_052966	NP_443198			niban protein isoform 2						negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4																		---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	185716687	185716688	+	Intron	DEL	AG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185716687_185716688delAG	uc001grq.1	+							NM_031935	NP_114141			hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	187487811	187487812	+	IGR	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187487811_187487812delAC								PLA2G4A (529706 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	187535325	187535326	+	IGR	DEL	AG	-	-	rs34848183		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187535325_187535326delAG								PLA2G4A (577220 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	188214446	188214447	+	IGR	INS	-	AC	AC	rs2931609	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188214446_188214447insAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	189448351	189448352	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189448351_189448352delTG								None (None upstream) : FAM5C (618445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	190618806	190618817	+	IGR	DEL	TTCCTTCCTTCT	-	-	rs150632663		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190618806_190618817delTTCCTTCCTTCT								FAM5C (172047 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	195480092	195480093	+	IGR	INS	-	T	T	rs11376452		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195480092_195480093insT								None (None upstream) : KCNT2 (714820 downstream)																																			---	---	---	---
CRB1	23418	broad.mit.edu	37	1	197428237	197428237	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197428237delT	uc001gtz.2	+						CRB1_uc010poz.1_Intron|CRB1_uc010ppa.1_Intron|CRB1_uc009wza.2_Intron|CRB1_uc010ppb.1_Intron|CRB1_uc010ppd.1_Intron	NM_201253	NP_957705			crumbs homolog 1 precursor						cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	200303949	200303949	+	IGR	DEL	A	-	-	rs35445793		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200303949delA								FAM58B (120306 upstream) : ZNF281 (71477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200480402	200480402	+	IGR	DEL	A	-	-	rs34175191		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200480402delA								ZNF281 (101236 upstream) : KIF14 (40223 downstream)																																			---	---	---	---
MDM4	4194	broad.mit.edu	37	1	204675970	204675970	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204675970delA	uc001hbd.1	+							NM_002393				mouse double minute 4 homolog						apoptosis|cell proliferation|cellular response to hypoxia|G0 to G1 transition|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of protein catabolic process|negative regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization	nucleus	enzyme binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)					A		GBM|bladder|retinoblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	1	204994497	204994500	+	5'Flank	DEL	CACA	-	-	rs6143581		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204994497_204994500delCACA	uc001hbp.1	-											Homo sapiens cDNA FLJ34019 fis, clone FCBBF2002898.																														---	---	---	---
TMCC2	9911	broad.mit.edu	37	1	205219677	205219678	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205219677_205219678insA	uc001hbz.1	+						TMCC2_uc010prf.1_Intron|TMCC2_uc001hca.2_Intron	NM_014858	NP_055673			transmembrane and coiled-coil domain family 2							integral to membrane	protein binding			pancreas(1)	1	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)															---	---	---	---
C1orf186	440712	broad.mit.edu	37	1	206284558	206284559	+	Intron	INS	-	A	A	rs35223668		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206284558_206284559insA	uc001hdt.1	-							NM_001007544	NP_001007545			hypothetical protein LOC440712							integral to membrane					0			BRCA - Breast invasive adenocarcinoma(75;0.0754)															---	---	---	---
SRGAP2	23380	broad.mit.edu	37	1	206530935	206530936	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206530935_206530936insT	uc001hdy.2	+						SRGAP2_uc009xbt.2_Intron|SRGAP2_uc010prt.1_Intron|SRGAP2_uc001hdx.2_Intron|SRGAP2_uc010pru.1_Intron	NM_015326	NP_056141			SLIT-ROBO Rho GTPase activating protein 2						axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding				0	Breast(84;0.137)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	207184902	207184903	+	IGR	INS	-	T	T	rs28407064		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207184902_207184903insT								FCAMR (40932 upstream) : C1orf116 (6963 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	207190231	207190231	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207190231delC								FCAMR (46261 upstream) : C1orf116 (1635 downstream)																																			---	---	---	---
CR1	1378	broad.mit.edu	37	1	207698403	207698404	+	Intron	DEL	GA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207698403_207698404delGA	uc001hfy.2	+						CR1_uc009xcl.1_Intron|CR1_uc001hfx.2_Intron|CR1_uc009xcj.1_Intron|CR1_uc009xck.1_Intron|CR1_uc010psh.1_5'Flank	NM_000573	NP_000564			complement receptor 1 isoform F precursor						complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	208143484	208143484	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208143484delC								CD34 (58801 upstream) : PLXNA2 (52106 downstream)																																			---	---	---	---
PLXNA2	5362	broad.mit.edu	37	1	208351464	208351465	+	Intron	DEL	CT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208351464_208351465delCT	uc001hgz.2	-							NM_025179	NP_079455			plexin A2 precursor						axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	208566313	208566313	+	IGR	DEL	A	-	-	rs68116219		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208566313delA								PLXNA2 (148648 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	209426500	209426500	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209426500delA								None (None upstream) : LOC642587 (175668 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	210397124	210397125	+	IGR	INS	-	TC	TC	rs138679888	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210397124_210397125insTC								SYT14 (59493 upstream) : C1orf133 (7679 downstream)																																			---	---	---	---
HHAT	55733	broad.mit.edu	37	1	210611518	210611519	+	Intron	INS	-	TG	TG	rs145144423	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210611518_210611519insTG	uc009xcx.2	+						HHAT_uc010psq.1_Intron|HHAT_uc001hhz.3_Intron|HHAT_uc010psr.1_Intron|HHAT_uc010pss.1_Intron|HHAT_uc009xcy.2_Intron|HHAT_uc010pst.1_Intron|HHAT_uc010psu.1_Intron|HHAT_uc001hia.3_5'Flank	NM_001122834	NP_001116306			hedgehog acyltransferase						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)														---	---	---	---
KCNH1	3756	broad.mit.edu	37	1	211088134	211088136	+	Intron	DEL	GGA	-	-	rs10590477		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211088134_211088136delGGA	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872			potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	212033438	212033438	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212033438delT								LPGAT1 (29324 upstream) : INTS7 (81260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	213624317	213624317	+	IGR	DEL	A	-	-	rs75585211		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213624317delA								RPS6KC1 (177510 upstream) : PROX1 (536969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	213842332	213842332	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213842332delG								RPS6KC1 (395525 upstream) : PROX1 (318954 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	218226220	218226221	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218226220_218226221insA								SPATA17 (185718 upstream) : RRP15 (232408 downstream)																																			---	---	---	---
TGFB2	7042	broad.mit.edu	37	1	218556405	218556405	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218556405delA	uc001hlm.2	+						TGFB2_uc001hll.2_Intron|TGFB2_uc001hln.2_Intron|TGFB2_uc010pue.1_Intron|TGFB2_uc001hlo.2_Intron	NM_003238	NP_003229			transforming growth factor, beta 2 isoform 2						activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding				0				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	218807505	218807506	+	IGR	INS	-	T	T	rs148306209		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218807505_218807506insT								TGFB2 (189546 upstream) : LYPLAL1 (539686 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	221503257	221503257	+	IGR	DEL	T	-	-	rs149427199		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221503257delT								HLX (444859 upstream) : LOC400804 (13 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	222270135	222270136	+	IGR	DEL	CT	-	-	rs74870021		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222270135_222270136delCT								DUSP10 (354674 upstream) : HHIPL2 (425466 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	222976462	222976462	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222976462delT								FAM177B (52461 upstream) : DISP1 (125321 downstream)																																			---	---	---	---
NUP133	55746	broad.mit.edu	37	1	229612873	229612873	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229612873delT	uc001htn.2	-							NM_018230	NP_060700			nucleoporin 133kDa						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			breast(4)|skin(2)|ovary(1)	7	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	230107531	230107532	+	IGR	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230107531_230107532delCA								URB2 (311585 upstream) : GALNT2 (86004 downstream)																																			---	---	---	---
COG2	22796	broad.mit.edu	37	1	230828474	230828475	+	Intron	DEL	TG	-	-	rs77522964		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230828474_230828475delTG	uc001htw.2	+						COG2_uc001htx.2_Intron|COG2_uc010pwc.1_Intron	NM_007357	NP_031383			component of oligomeric golgi complex 2 isoform						Golgi organization|intra-Golgi vesicle-mediated transport|intracellular protein transport|oligosaccharide biosynthetic process|protein glycosylation	Golgi membrane|Golgi stack|Golgi transport complex	protein binding|protein transporter activity				0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)																---	---	---	---
DISC1	27185	broad.mit.edu	37	1	232158847	232158847	+	Intron	DEL	T	-	-	rs35745969		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232158847delT	uc001huz.2	+						TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron	NM_018662	NP_061132			disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	232455823	232455824	+	IGR	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232455823_232455824delCA								DISC1 (278807 upstream) : SIPA1L2 (77890 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	232793753	232793753	+	IGR	DEL	C	-	-	rs67310958		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232793753delC								SIPA1L2 (142510 upstream) : KIAA1383 (146885 downstream)																																			---	---	---	---
KIAA1804	84451	broad.mit.edu	37	1	233475233	233475233	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233475233delT	uc001hvt.3	+						KIAA1804_uc001hvs.1_Intron	NM_032435	NP_115811			mixed lineage kinase 4						activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity			lung(5)|central_nervous_system(2)|skin(1)	8		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)																---	---	---	---
KCNK1	3775	broad.mit.edu	37	1	233746826	233746826	+	5'Flank	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233746826delG	uc010pxo.1	+							NM_002245	NP_002236			potassium channel, subfamily K, member 1							voltage-gated potassium channel complex	inward rectifier potassium channel activity			central_nervous_system(1)	1		all_cancers(173;0.00217)|all_epithelial(177;0.121)|Prostate(94;0.122)|Acute lymphoblastic leukemia(190;0.175)			Ibutilide(DB00308)|Quinidine(DB00908)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	234668009	234668012	+	5'Flank	DEL	AGAG	-	-	rs60571713		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234668009_234668012delAGAG	uc001hwe.2	-											Homo sapiens cDNA clone IMAGE:4816129.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	234928874	234928874	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234928874delT								IRF2BP2 (183603 upstream) : TOMM20 (343786 downstream)																																			---	---	---	---
ACTN2	88	broad.mit.edu	37	1	236926014	236926015	+	3'UTR	DEL	GA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236926014_236926015delGA	uc001hyf.2	+	21					ACTN2_uc001hyg.2_3'UTR|ACTN2_uc009xgi.1_3'UTR|ACTN2_uc010pxu.1_3'UTR|ACTN2_uc001hyh.2_3'UTR	NM_001103	NP_001094			actinin, alpha 2						focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	238954084	238954084	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238954084delT								LOC339535 (304767 upstream) : CHRM3 (595781 downstream)																																			---	---	---	---
CHRM3	1131	broad.mit.edu	37	1	239549887	239549887	+	RNA	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239549887delG	uc001hyo.1	+	1		c.23delG								Homo sapiens clone N10 NTera2D1 teratocarcinoma, m3 muscarinic acetylcholine receptor mRNA, partial cds.						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)													---	---	---	---
WDR64	128025	broad.mit.edu	37	1	241865824	241865824	+	Intron	DEL	A	-	-	rs36074533		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241865824delA	uc001hze.1	+						WDR64_uc001hzf.1_Intron					RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)															---	---	---	---
WDR64	128025	broad.mit.edu	37	1	241942554	241942554	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241942554delT	uc001hzf.1	+						WDR64_uc001hzg.1_Intron	NM_144625	NP_653226			WD repeat domain 64											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)															---	---	---	---
WDR64	128025	broad.mit.edu	37	1	241950662	241950663	+	Intron	INS	-	AA	AA	rs71822148		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241950662_241950663insAA	uc001hzf.1	+						WDR64_uc001hzg.1_Intron	NM_144625	NP_653226			WD repeat domain 64											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	242842958	242842965	+	IGR	DEL	AGGGAGGG	-	-	rs113984735		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242842958_242842965delAGGGAGGG								PLD5 (154960 upstream) : CEP170 (444766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	244143019	244143020	+	Intron	INS	-	TGT	TGT	rs71888390		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244143019_244143020insTGT	uc001iac.2	+											Homo sapiens cDNA clone IMAGE:5244187.																														---	---	---	---
C1orf101	257044	broad.mit.edu	37	1	244788106	244788106	+	Intron	DEL	A	-	-	rs79810023		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244788106delA	uc001iam.2	+						C1orf101_uc001ial.2_Intron|C1orf101_uc010pym.1_Intron|C1orf101_uc010pyn.1_Intron	NM_001130957	NP_001124429			hypothetical protein LOC257044 isoform 1							integral to membrane				ovary(1)|breast(1)	2	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)															---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245667743	245667744	+	Intron	INS	-	T	T	rs145517353	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245667743_245667744insT	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	248859611	248859611	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248859611delT								OR14I1 (14006 upstream) : LOC646627 (43107 downstream)																																			---	---	---	---
TMEM18	129787	broad.mit.edu	37	2	678423	678424	+	5'Flank	INS	-	C	C	rs146543657	by1000genomes;by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:678423_678424insC	uc002qwk.2	-						TMEM18_uc002qwl.2_5'Flank|uc002qwm.1_Intron					Homo sapiens cDNA FLJ43019 fis, clone BRTHA2018344.						cell migration	integral to membrane|nuclear membrane				ovary(1)	1	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;5.27e-05)|all_epithelial(98;2.11e-06)|Ovarian(717;0.0253)		all cancers(51;1.95e-21)|Epithelial(75;9.47e-21)|OV - Ovarian serous cystadenocarcinoma(76;8.15e-18)|GBM - Glioblastoma multiforme(21;0.0285)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	846712	846713	+	Intron	INS	-	CT	CT	rs142854634	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:846712_846713insCT	uc002qwn.1	-						uc002qwo.1_Intron					Homo sapiens cDNA clone IMAGE:5174186.																														---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	1999854	1999854	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1999854delG	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron|MYT1L_uc002qxf.1_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
TSSC1	7260	broad.mit.edu	37	2	3203578	3203579	+	Intron	INS	-	GA	GA	rs142971768	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3203578_3203579insGA	uc002qxj.2	-						TSSC1_uc002qxi.2_Intron	NM_003310	NP_003301			tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	3827365	3827366	+	IGR	INS	-	T	T	rs142140948	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3827365_3827366insT								ALLC (77107 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	3854674	3854674	+	IGR	DEL	T	-	-	rs67199037		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3854674delT								ALLC (104416 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	4469475	4469475	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4469475delA								ALLC (719217 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7978501	7978502	+	IGR	DEL	GT	-	-	rs34708723		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7978501_7978502delGT								RNF144A (794194 upstream) : LOC339788 (84056 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	12607546	12607549	+	Intron	DEL	CTAT	-	-	rs7568368		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12607546_12607549delCTAT	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	13360796	13360797	+	IGR	DEL	AC	-	-	rs138633556		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13360796_13360797delAC								TRIB2 (477940 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	15279626	15279627	+	IGR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15279626_15279627delGT								FAM84A (488693 upstream) : NBAS (27405 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16367901	16367902	+	IGR	INS	-	A	A	rs139514322		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16367901_16367902insA								MYCN (280773 upstream) : FAM49A (365999 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	18298011	18298012	+	IGR	INS	-	T	T	rs111253452		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18298011_18298012insT								KCNS3 (183787 upstream) : NT5C1B (437979 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	18554145	18554146	+	IGR	INS	-	A	A	rs150731839	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18554145_18554146insA								KCNS3 (439921 upstream) : NT5C1B (181845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19524022	19524023	+	IGR	DEL	GA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19524022_19524023delGA								NT5C1B (753184 upstream) : OSR1 (27224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	20303493	20303493	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20303493delT								LAPTM4A (51704 upstream) : SDC1 (97065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	21687993	21687993	+	IGR	DEL	A	-	-	rs67503706		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21687993delA								APOB (421048 upstream) : None (None downstream)																																			---	---	---	---
GPR113	165082	broad.mit.edu	37	2	26535144	26535145	+	Intron	INS	-	G	G	rs143473765	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26535144_26535145insG	uc002rhe.3	-						GPR113_uc010yky.1_Intron|GPR113_uc002rhb.1_Intron|GPR113_uc010eyk.1_Intron|GPR113_uc002rhc.1_Intron|GPR113_uc002rhd.1_Intron	NM_001145168	NP_001138640			G-protein coupled receptor 113 isoform 1						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	26977420	26977420	+	IGR	DEL	A	-	-	rs71956565		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26977420delA								KCNK3 (23354 upstream) : C2orf18 (9722 downstream)																																			---	---	---	---
MAPRE3	22924	broad.mit.edu	37	2	27249985	27249985	+	3'UTR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27249985delC	uc002rhw.2	+	7					MAPRE3_uc002rhx.2_3'UTR	NM_012326	NP_036458			microtubule-associated protein, RP/EB family,						cell division|mitosis|positive regulation of transcription, DNA-dependent	cytoplasm|cytoplasmic microtubule|microtubule|midbody|perinuclear region of cytoplasm	microtubule binding|protein binding|small GTPase regulator activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
EMILIN1	11117	broad.mit.edu	37	2	27301405	27301405	+	5'Flank	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27301405delA	uc002rii.3	+						EMILIN1_uc010eyq.1_5'Flank	NM_007046	NP_008977			elastin microfibril interfacer 1 precursor						cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	30392621	30392622	+	IGR	INS	-	T	T	rs141033341	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30392621_30392622insT								YPEL5 (9223 upstream) : LBH (61775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	31382574	31382575	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31382574_31382575insA								GALNT14 (4506 upstream) : CAPN14 (13349 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	34184028	34184028	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34184028delA								MYADML (230744 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	35899742	35899743	+	IGR	INS	-	TTCT	TTCT	rs145820356	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35899742_35899743insTTCT								None (None upstream) : CRIM1 (683654 downstream)																																			---	---	---	---
STRN	6801	broad.mit.edu	37	2	37115782	37115783	+	Intron	INS	-	TG	TG	rs144350718	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37115782_37115783insTG	uc002rpn.2	-						STRN_uc010ezx.2_Intron	NM_003162	NP_003153			striatin, calmodulin binding protein						dendrite development|locomotory behavior|negative regulation of cell proliferation|tight junction assembly|Wnt receptor signaling pathway	cytoplasm|dendritic spine|neuronal cell body|postsynaptic density|postsynaptic membrane|tight junction	armadillo repeat domain binding|calmodulin binding|estrogen receptor binding|protein complex binding|protein phosphatase 2A binding			skin(1)	1		Ovarian(717;0.0129)|all_hematologic(82;0.21)																---	---	---	---
QPCT	25797	broad.mit.edu	37	2	37575207	37575208	+	Intron	DEL	GT	-	-	rs150632517		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37575207_37575208delGT	uc002rqg.2	+						QPCT_uc002rqh.2_Intron	NM_012413	NP_036545			glutaminyl-peptide cyclotransferase precursor						peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase|proteolysis	extracellular region	acyltransferase activity|glutaminyl-peptide cyclotransferase activity|peptidase activity|zinc ion binding			central_nervous_system(1)	1		Ovarian(717;0.051)|all_hematologic(82;0.21)																---	---	---	---
SFRS7	6432	broad.mit.edu	37	2	38973132	38973132	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38973132delA	uc002rqz.2	-						SFRS7_uc002rra.2_Intron|SFRS7_uc010ynp.1_Intron	NM_001031684	NP_001026854			splicing factor, arginine/serine-rich 7						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding|zinc ion binding				0		all_hematologic(82;0.248)																---	---	---	---
SLC8A1	6546	broad.mit.edu	37	2	40566282	40566284	+	Intron	DEL	CTT	-	-	rs72393676		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40566282_40566284delCTT	uc002rrx.2	-						SLC8A1_uc002rry.2_Intron|SLC8A1_uc002rrz.2_Intron|SLC8A1_uc002rsa.2_Intron|SLC8A1_uc002rsd.3_Intron|SLC8A1_uc002rsb.1_Intron	NM_021097	NP_066920			solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	40752057	40752058	+	IGR	INS	-	A	A	rs34239925		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40752057_40752058insA								SLC8A1 (12482 upstream) : None (None downstream)																																			---	---	---	---
KCNG3	170850	broad.mit.edu	37	2	42716837	42716846	+	Intron	DEL	TAAGGGACAT	-	-	rs143425649		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42716837_42716846delTAAGGGACAT	uc002rsn.2	-						KCNG3_uc002rsm.2_Intron	NM_133329	NP_579875			potassium voltage-gated channel, subfamily G,							endoplasmic reticulum|voltage-gated potassium channel complex	protein binding			central_nervous_system(1)	1																		---	---	---	---
PRKCE	5581	broad.mit.edu	37	2	46014493	46014494	+	Intron	INS	-	AG	AG	rs146240095	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46014493_46014494insAG	uc002rut.2	+						PRKCE_uc002ruu.2_Intron	NM_005400	NP_005391			protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	47620234	47620234	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47620234delT								EPCAM (6069 upstream) : MSH2 (9972 downstream)																																			---	---	---	---
FSHR	2492	broad.mit.edu	37	2	49194411	49194411	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49194411delT	uc002rww.2	-						FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Intron	NM_000145	NP_000136			follicle stimulating hormone receptor isoform 1						female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)									Gonadal_Dysgenesis_46_XX				---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50361411	50361412	+	Intron	INS	-	A	A	rs11431677		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50361411_50361412insA	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron	NM_138735	NP_620072			neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	51550825	51550827	+	IGR	DEL	ATA	-	-	rs75525886		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51550825_51550827delATA								NRXN1 (291151 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53192828	53192828	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53192828delC								None (None upstream) : ASB3 (704290 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53241993	53241993	+	IGR	DEL	T	-	-	rs113469819		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53241993delT								None (None upstream) : ASB3 (655125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53408478	53408478	+	IGR	DEL	A	-	-	rs77247949		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53408478delA								None (None upstream) : ASB3 (488640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	54305110	54305110	+	IGR	DEL	T	-	-	rs112389287		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54305110delT								PSME4 (107133 upstream) : ACYP2 (37300 downstream)																																			---	---	---	---
SPTBN1	6711	broad.mit.edu	37	2	54833072	54833072	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54833072delG	uc002rxu.2	+						SPTBN1_uc002rxv.1_Intron|SPTBN1_uc002rxx.2_Intron	NM_003128	NP_003119			spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	55389011	55389011	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55389011delT								RTN4 (111277 upstream) : C2orf63 (10676 downstream)																																			---	---	---	---
CCDC88A	55704	broad.mit.edu	37	2	55593671	55593678	+	Intron	DEL	ACACACAC	-	-	rs7604746		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55593671_55593678delACACACAC	uc002ryv.2	-						CCDC88A_uc010yoz.1_Intron|CCDC88A_uc010ypa.1_Intron|CCDC88A_uc010ypb.1_Intron	NM_001135597	NP_001129069			coiled-coil domain containing 88A isoform 1						activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	56926841	56926844	+	IGR	DEL	TGTG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56926841_56926844delTGTG								CCDC85A (313533 upstream) : None (None downstream)																																			---	---	---	---
REL	5966	broad.mit.edu	37	2	61144816	61144817	+	Intron	DEL	TG	-	-	rs138205697		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61144816_61144817delTG	uc002sam.1	+						REL_uc002san.1_Intron	NM_002908	NP_002899			v-rel reticuloendotheliosis viral oncogene						positive regulation of I-kappaB kinase/NF-kappaB cascade	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|breast(1)	3	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)					A		Hodgkin Lymphoma								---	---	---	---
RAB1A	5861	broad.mit.edu	37	2	65336843	65336844	+	Intron	INS	-	A	A	rs77754420		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65336843_65336844insA	uc002sdm.2	-						RAB1A_uc002sdn.2_Intron|RAB1A_uc010yqe.1_Intron|RAB1A_uc002sdo.2_Intron	NM_004161	NP_004152			RAB1A, member RAS oncogene family isoform 1						protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	endoplasmic reticulum|Golgi apparatus	GTP binding|GTPase activity				0																		---	---	---	---
MEIS1	4211	broad.mit.edu	37	2	66694500	66694500	+	Intron	DEL	A	-	-	rs10165854		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66694500delA	uc002sdu.2	+						MEIS1_uc002sdt.2_Intron|MEIS1_uc002sdv.2_Intron|MEIS1_uc010yqh.1_Intron|MEIS1_uc010yqi.1_Intron|MEIS1_uc002sdw.1_Intron	NM_002398	NP_002389			Meis homeobox 1								sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
MEIS1	4211	broad.mit.edu	37	2	66747613	66747613	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66747613delA	uc002sdu.2	+						MEIS1_uc002sdt.2_Intron|MEIS1_uc002sdv.2_Intron|MEIS1_uc010yqh.1_Intron|MEIS1_uc010yqi.1_Intron|MEIS1_uc002sdw.1_Intron	NM_002398	NP_002389			Meis homeobox 1								sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	67570509	67570509	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67570509delA								MEIS1 (770619 upstream) : ETAA1 (53933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	67597265	67597267	+	IGR	DEL	CAT	-	-	rs71395909		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67597265_67597267delCAT								MEIS1 (797375 upstream) : ETAA1 (27175 downstream)																																			---	---	---	---
ARHGAP25	9938	broad.mit.edu	37	2	69038791	69038792	+	Intron	INS	-	A	A	rs142540798	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69038791_69038792insA	uc002seu.2	+						ARHGAP25_uc010yqk.1_Intron|ARHGAP25_uc010fdg.2_Intron|ARHGAP25_uc010yql.1_Intron|ARHGAP25_uc002sev.2_Intron|ARHGAP25_uc002sew.2_Intron|ARHGAP25_uc002sex.2_Intron|ARHGAP25_uc010fdh.1_Intron|ARHGAP25_uc002sey.2_Intron	NM_001007231	NP_001007232			Rho GTPase activating protein 25 isoform a						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|breast(2)	4																		---	---	---	---
ASPRV1	151516	broad.mit.edu	37	2	70292246	70292247	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70292246_70292247insA	uc002sga.2	-						uc002sgb.1_Intron|uc002sgd.2_Intron|uc002sge.1_Intron					Homo sapiens cDNA FLJ32260 fis, clone PROST1000334.						protein maturation by peptide bond cleavage|skin development		aspartic-type endopeptidase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	70798849	70798849	+	IGR	DEL	T	-	-	rs138301062		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70798849delT								TGFA (17744 upstream) : ADD2 (35901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	72004115	72004116	+	IGR	INS	-	T	T	rs67986234		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72004115_72004116insT								DYSF (90223 upstream) : CYP26B1 (352251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	73560703	73560704	+	IGR	INS	-	A	A	rs113844476		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73560703_73560704insA								EGR4 (39874 upstream) : ALMS1 (52182 downstream)																																			---	---	---	---
HK2	3099	broad.mit.edu	37	2	75088543	75088543	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75088543delA	uc002snd.2	+							NM_000189	NP_000180			hexokinase 2						apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity			ovary(1)|lung(1)	2																		---	---	---	---
C2orf3	6936	broad.mit.edu	37	2	75892702	75892702	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75892702delA	uc002sno.2	-						MRPL19_uc002snm.1_Intron|C2orf3_uc010ffs.2_Intron|C2orf3_uc002snn.2_Intron|C2orf3_uc010fft.2_Intron	NM_003203	NP_003194			hypothetical protein LOC6936						negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
LRRTM4	80059	broad.mit.edu	37	2	77716884	77716884	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77716884delA	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217			leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	79167131	79167131	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79167131delG								SNAR-H (984979 upstream) : REG3G (85695 downstream)																																			---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80822748	80822748	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80822748delT	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron|CTNNA2_uc010ysj.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	85332840	85332841	+	IGR	DEL	GA	-	-	rs35623389	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85332840_85332841delGA								KCMF1 (46246 upstream) : TCF7L1 (27893 downstream)																																			---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87858686	87858687	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87858686_87858687delAC	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	88603464	88603464	+	IGR	DEL	A	-	-	rs78977519		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88603464delA								THNSL2 (117319 upstream) : FOXI3 (144262 downstream)																																			---	---	---	---
FLJ40330	645784	broad.mit.edu	37	2	89076553	89076554	+	Intron	INS	-	TT	TT	rs139718494	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89076553_89076554insTT	uc002stf.2	+						FLJ40330_uc010fhf.2_Intron|FLJ40330_uc010fhg.2_Intron|FLJ40330_uc010fhh.2_Intron					Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	89876618	89876622	+	IGR	DEL	CGATG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89876618_89876622delCGATG								FLJ40330 (770493 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91599246	91599248	+	IGR	DEL	ATG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91599246_91599248delATG								None (None upstream) : LOC654342 (205944 downstream)																																			---	---	---	---
LOC654342	654342	broad.mit.edu	37	2	91822551	91822552	+	Intron	INS	-	A	A	rs146298710	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91822551_91822552insA	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	91869180	91869186	+	IGR	DEL	GTGAACC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91869180_91869186delGTGAACC								LOC654342 (21205 upstream) : GGT8P (94182 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91987417	91987418	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91987417_91987418insT								GGT8P (17264 upstream) : FKSG73 (141741 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92089509	92089509	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92089509delA								GGT8P (119356 upstream) : FKSG73 (39650 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	95408147	95408147	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95408147delT								None (None upstream) : ANKRD20B (18528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	96518290	96518292	+	IGR	DEL	ACA	-	-	rs71786585		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96518290_96518292delACA								TRIM43 (252823 upstream) : LOC729234 (158007 downstream)																																			---	---	---	---
FAM178B	51252	broad.mit.edu	37	2	97551744	97551745	+	Intron	INS	-	TT	TT	rs140637624	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97551744_97551745insTT	uc002sxl.3	-						FAM178B_uc002sxi.3_Intron|FAM178B_uc002sxk.3_Intron|FAM178B_uc002sxj.3_Intron	NM_001122646	NP_001116118			hypothetical protein LOC51252 isoform A												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	102254129	102254130	+	IGR	INS	-	TTG	TTG	rs143305472	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102254129_102254130insTTG								RFX8 (162964 upstream) : MAP4K4 (60358 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	103969303	103969303	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103969303delA								TMEM182 (535167 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	106272710	106272711	+	IGR	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106272710_106272711delTC								FHL2 (217480 upstream) : NCK2 (88643 downstream)																																			---	---	---	---
SULT1C4	27233	broad.mit.edu	37	2	109004252	109004252	+	3'UTR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109004252delT	uc002tea.1	+	7					SULT1C4_uc002teb.1_3'UTR	NM_006588	NP_006579			sulfotransferase family, cytosolic, 1C, member						3'-phosphoadenosine 5'-phosphosulfate metabolic process|sulfation|xenobiotic metabolic process	cytosol	sulfotransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	112481134	112481150	+	IGR	DEL	AAAGAAAAGAAAGAAAG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112481134_112481150delAAAGAAAAGAAAGAAAG								LOC541471 (228442 upstream) : ANAPC1 (45491 downstream)																																			---	---	---	---
ZC3H6	376940	broad.mit.edu	37	2	113047154	113047154	+	Intron	DEL	G	-	-	rs68017493		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113047154delG	uc002thq.1	+							NM_198581	NP_940983			zinc finger CCCH-type domain containing 6								nucleic acid binding|zinc ion binding			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
SLC35F5	80255	broad.mit.edu	37	2	114496237	114496237	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114496237delA	uc002tku.1	-						SLC35F5_uc002tkt.2_Intron	NM_025181	NP_079457			solute carrier family 35, member F5						transport	integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	119418791	119418791	+	IGR	DEL	C	-	-	rs5833758		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119418791delC								INSIG2 (551195 upstream) : EN1 (180957 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	121130165	121130166	+	IGR	INS	-	T	T	rs71396088		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121130165_121130166insT								INHBB (20782 upstream) : LOC84931 (91745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	121370255	121370255	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121370255delC								LOC84931 (146330 upstream) : GLI2 (122944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	122803195	122803195	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122803195delG								TSN (277769 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	122821290	122821291	+	IGR	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122821290_122821291delCA								TSN (295864 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126389781	126389781	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126389781delT								CNTNAP5 (716920 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	128803913	128803913	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128803913delT								SAP130 (18280 upstream) : UGGT1 (44841 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129097947	129097947	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129097947delG								HS6ST1 (21776 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129162903	129162904	+	IGR	INS	-	A	A	rs78151017	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129162903_129162904insA								HS6ST1 (86732 upstream) : None (None downstream)																																			---	---	---	---
ARHGEF4	50649	broad.mit.edu	37	2	131727543	131727543	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131727543delT	uc002tsa.1	+						ARHGEF4_uc010fmw.1_Intron|ARHGEF4_uc002tsb.1_Intron|ARHGEF4_uc010fmx.1_Intron	NM_015320	NP_056135			Rho guanine nucleotide exchange factor 4 isoform						apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|lamellipodium assembly|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|ruffle membrane	protein domain specific binding|Rac guanyl-nucleotide exchange factor activity			breast(3)|ovary(2)|skin(1)	6		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)														---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	132974712	132974712	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132974712delG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133025838	133025838	+	IGR	DEL	C	-	-	rs111657396		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133025838delC								NCRNA00164 (10296 upstream) : GPR39 (148309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133055010	133055011	+	IGR	INS	-	T	T	rs139949484	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133055010_133055011insT								NCRNA00164 (39468 upstream) : GPR39 (119136 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133105872	133105873	+	IGR	INS	-	G	G	rs144074690	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133105872_133105873insG								NCRNA00164 (90330 upstream) : GPR39 (68274 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133120664	133120672	+	IGR	DEL	AAGTAACAG	-	-	rs59596109		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133120664_133120672delAAGTAACAG								NCRNA00164 (105122 upstream) : GPR39 (53475 downstream)																																			---	---	---	---
TMEM163	81615	broad.mit.edu	37	2	135308850	135308851	+	Intron	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135308850_135308851delGT	uc002ttx.2	-						TMEM163_uc002tty.2_Intron	NM_030923	NP_112185			transmembrane protein 163							integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)														---	---	---	---
ZRANB3	84083	broad.mit.edu	37	2	136046444	136046445	+	Intron	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136046444_136046445delGT	uc002tum.2	-						ZRANB3_uc002tuk.2_Intron|ZRANB3_uc002tul.2_Intron|ZRANB3_uc002tun.1_Intron	NM_032143	NP_115519			zinc finger, RAN-binding domain containing 3							intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)														---	---	---	---
ZRANB3	84083	broad.mit.edu	37	2	136148180	136148181	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136148180_136148181delAC	uc002tum.2	-						ZRANB3_uc002tuk.2_Intron|ZRANB3_uc002tul.2_Intron|ZRANB3_uc002tun.1_Intron	NM_032143	NP_115519			zinc finger, RAN-binding domain containing 3							intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)														---	---	---	---
SPOPL	339745	broad.mit.edu	37	2	139319853	139319853	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139319853delT	uc002tvh.2	+							NM_001001664	NP_001001664			speckle-type POZ protein-like							nucleus				skin(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0296)														---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141344388	141344388	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141344388delC	uc002tvj.1	-							NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	142469522	142469523	+	Intron	DEL	AC	-	-	rs71998053		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142469522_142469523delAC	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
ZEB2	9839	broad.mit.edu	37	2	145276654	145276654	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145276654delT	uc002tvu.2	-						ZEB2_uc002tvv.2_Intron|ZEB2_uc010zbm.1_Intron|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_5'Flank|ZEB2_uc002tvw.2_Intron|ZEB2_uc002tvx.1_5'Flank|ZEB2_uc002tvy.2_5'Flank|ZEB2_uc002tvz.2_Intron|ZEB2_uc002twa.2_Intron	NM_014795	NP_055610			zinc finger homeobox 1b							cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	146173782	146173783	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:146173782_146173783insT								ZEB2 (895851 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	146964453	146964453	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:146964453delT								None (None upstream) : PABPC1P2 (380172 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	148191567	148191568	+	IGR	INS	-	T	T	rs78935055		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148191567_148191568insT								PABPC1P2 (843010 upstream) : ACVR2A (410518 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	150662572	150662572	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150662572delT								MMADHC (218242 upstream) : RND3 (662140 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	151833038	151833041	+	IGR	DEL	ATTA	-	-	rs146600212		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151833038_151833041delATTA								RND3 (488858 upstream) : RBM43 (271688 downstream)																																			---	---	---	---
FMNL2	114793	broad.mit.edu	37	2	153491440	153491440	+	Intron	DEL	C	-	-	rs2346533		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153491440delC	uc002tye.2	+						FMNL2_uc010fob.2_Intron|FMNL2_uc002tyf.2_Intron	NM_052905	NP_443137			formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	154584414	154584414	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154584414delT								RPRM (249092 upstream) : GALNT13 (144012 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	156787154	156787154	+	IGR	DEL	A	-	-	rs138833063		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156787154delA								None (None upstream) : NR4A2 (393792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	156902043	156902043	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156902043delC	uc002tyw.2	-											Homo sapiens cDNA clone IMAGE:5209417.																														---	---	---	---
ACVR1C	130399	broad.mit.edu	37	2	158474577	158474577	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158474577delA	uc002tzk.3	-						ACVR1C_uc002tzl.3_Intron|ACVR1C_uc010fof.2_Intron	NM_145259	NP_660302			activin A receptor, type IC isoform 1						apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7																		---	---	---	---
CCDC148	130940	broad.mit.edu	37	2	159262067	159262069	+	Intron	DEL	AAG	-	-	rs148675812		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159262067_159262069delAAG	uc002tzq.2	-						CCDC148_uc002tzr.2_Intron|CCDC148_uc010foh.2_Intron|CCDC148_uc010foi.1_Intron|CCDC148_uc010foj.1_Intron|CCDC148_uc010fok.1_Intron|CCDC148_uc002tzs.1_Intron	NM_138803	NP_620158			coiled-coil domain containing 148											ovary(2)	2																		---	---	---	---
TANK	10010	broad.mit.edu	37	2	162037951	162037951	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162037951delA	uc002ubr.1	+						TANK_uc002ubq.1_Intron|TANK_uc002ubs.2_Intron	NM_004180	NP_004171			TRAF interacting protein TANK isoform a							cytosol	metal ion binding|protein binding			ovary(1)	1																		---	---	---	---
KCNH7	90134	broad.mit.edu	37	2	163301432	163301432	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163301432delA	uc002uch.1	-						KCNH7_uc002uci.2_Intron	NM_033272	NP_150375			potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	165339061	165339062	+	IGR	INS	-	T	T	rs145713279	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165339061_165339062insT								FIGN (746548 upstream) : GRB14 (10271 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	165347664	165347665	+	IGR	INS	-	AC	AC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165347664_165347665insAC								FIGN (755151 upstream) : GRB14 (1668 downstream)																																			---	---	---	---
COBLL1	22837	broad.mit.edu	37	2	165570544	165570544	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165570544delA	uc010zcw.1	-						COBLL1_uc002ucp.2_Intron|COBLL1_uc002ucq.2_Intron|COBLL1_uc010zcx.1_Intron|COBLL1_uc002ucs.1_Intron|COBLL1_uc002uco.2_Intron	NM_014900	NP_055715			COBL-like 1											ovary(2)|pancreas(1)	3																		---	---	---	---
MYO3B	140469	broad.mit.edu	37	2	171076156	171076156	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171076156delA	uc002ufy.2	+						MYO3B_uc002ufv.2_Intron|MYO3B_uc010fqb.1_Intron|MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002uga.2_Intron	NM_138995	NP_620482			myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19																		---	---	---	---
GAD1	2571	broad.mit.edu	37	2	171684687	171684688	+	Intron	DEL	CT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171684687_171684688delCT	uc002ugi.2	+						GAD1_uc002ugh.2_Intron	NM_000817	NP_000808			glutamate decarboxylase 1 isoform GAD67						glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion|protein-pyridoxal-5-phosphate linkage	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|plasma membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)													---	---	---	---
PDK1	5163	broad.mit.edu	37	2	173472932	173472933	+	Intron	INS	-	G	G	rs138728030	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173472932_173472933insG	uc010zea.1	+							NM_002610				pyruvate dehydrogenase kinase 1 precursor						glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|small GTPase mediated signal transduction	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			lung(3)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.12)											Autosomal_Dominant_Polycystic_Kidney_Disease				---	---	---	---
Unknown	0	broad.mit.edu	37	2	174199558	174199560	+	IGR	DEL	CTT	-	-	rs142799208		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174199558_174199560delCTT								ZAK (66822 upstream) : CDCA7 (20001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	174580025	174580025	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174580025delC								CDCA7 (346307 upstream) : SP3 (193234 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	174585831	174585831	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174585831delA								CDCA7 (352113 upstream) : SP3 (187428 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	174928713	174928716	+	IGR	DEL	CCAA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174928713_174928716delCCAA								SP3 (98650 upstream) : OLA1 (8460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	176086924	176086924	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176086924delT								ATP5G3 (40434 upstream) : KIAA1715 (703486 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	176601213	176601214	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176601213_176601214insT								ATP5G3 (554723 upstream) : KIAA1715 (189196 downstream)																																			---	---	---	---
AGPS	8540	broad.mit.edu	37	2	178319499	178319499	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178319499delT	uc002ull.2	+						AGPS_uc010zfb.1_Intron	NM_003659	NP_003650			alkyldihydroxyacetone phosphate synthase						ether lipid biosynthetic process	peroxisomal matrix|peroxisomal membrane|plasma membrane	alkylglycerone-phosphate synthase activity|flavin adenine dinucleotide binding|oxidoreductase activity			ovary(2)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)															---	---	---	---
PDE11A	50940	broad.mit.edu	37	2	178493708	178493709	+	3'UTR	DEL	GG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178493708_178493709delGG	uc002ulq.2	-	20					PDE11A_uc010zfd.1_3'UTR|PDE11A_uc002ulp.2_3'UTR|PDE11A_uc002ulr.2_3'UTR	NM_016953	NP_058649			phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)											Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				---	---	---	---
Unknown	0	broad.mit.edu	37	2	182809399	182809400	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182809399_182809400insA								SSFA2 (13937 upstream) : PPP1R1C (9568 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	183981223	183981223	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183981223delC								DUSP19 (16503 upstream) : NUP35 (3527 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	189530001	189530001	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189530001delA								GULP1 (69351 upstream) : DIRC1 (68464 downstream)																																			---	---	---	---
DIRC1	116093	broad.mit.edu	37	2	189623108	189623108	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189623108delA	uc002uqi.1	-							NM_052952	NP_443184			disrupted in renal carcinoma 1												0			OV - Ovarian serous cystadenocarcinoma(117;0.00842)|Epithelial(96;0.102)															---	---	---	---
ORMDL1	94101	broad.mit.edu	37	2	190643120	190643121	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190643120_190643121insA	uc002urb.3	-						ORMDL1_uc002urc.3_Intron|ORMDL1_uc002urd.3_Intron|ORMDL1_uc002ure.3_Intron|ORMDL1_uc002urf.3_Intron	NM_016467	NP_057551			ORM1-like 1						ceramide metabolic process	endoplasmic reticulum membrane|integral to membrane					0			OV - Ovarian serous cystadenocarcinoma(117;0.00177)|Epithelial(96;0.0317)|all cancers(119;0.0889)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	191240984	191240984	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191240984delT								INPP1 (4594 upstream) : MFSD6 (32097 downstream)																																			---	---	---	---
TMEFF2	23671	broad.mit.edu	37	2	192985468	192985468	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192985468delT	uc002utc.2	-							NM_016192	NP_057276			transmembrane protein with EGF-like and two							extracellular region|integral to membrane				lung(2)|pancreas(1)|breast(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.0835)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	194520594	194520594	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:194520594delT								PCGEM1 (878973 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	194523067	194523070	+	IGR	DEL	AAGG	-	-	rs57226308	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:194523067_194523070delAAGG								PCGEM1 (881446 upstream) : None (None downstream)																																			---	---	---	---
ANKRD44	91526	broad.mit.edu	37	2	197835792	197835792	+	Intron	DEL	T	-	-	rs34902290		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197835792delT	uc002utz.3	-							NM_153697	NP_710181			ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)															---	---	---	---
ANKRD44	91526	broad.mit.edu	37	2	198052369	198052376	+	Intron	DEL	TCTCTCTC	-	-	rs72080059		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198052369_198052376delTCTCTCTC	uc002uuc.2	-						ANKRD44_uc002uua.1_Intron|ANKRD44_uc002uub.2_Intron|ANKRD44_uc010zgw.1_Intron|ANKRD44_uc002uud.1_Intron	NM_153697	NP_710181			ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	200077858	200077858	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200077858delA								None (None upstream) : SATB2 (56366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	200736716	200736717	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200736716_200736717insA								FLJ32063 (395058 upstream) : C2orf69 (39262 downstream)																																			---	---	---	---
FAM117B	150864	broad.mit.edu	37	2	203585124	203585125	+	Intron	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203585124_203585125delGT	uc010zhx.1	+						FAM117B_uc010zhw.1_Intron	NM_173511	NP_775782			amyotrophic lateral sclerosis 2 (juvenile)											ovary(1)	1																		---	---	---	---
ABI2	10152	broad.mit.edu	37	2	204224569	204224569	+	Intron	DEL	G	-	-	rs34499527		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204224569delG	uc002vaa.2	+						ABI2_uc010zig.1_Intron|ABI2_uc002uzz.2_Intron|ABI2_uc010zih.1_Intron|ABI2_uc010zii.1_Intron|ABI2_uc010zij.1_Intron	NM_005759	NP_005750			abl interactor 2						actin polymerization or depolymerization|cell migration|peptidyl-tyrosine phosphorylation	cytoskeleton|cytosol|filopodium|lamellipodium	cytoskeletal adaptor activity|DNA binding|kinase binding|proline-rich region binding|SH3 domain binding|ubiquitin protein ligase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	204636984	204636984	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204636984delT								CD28 (34428 upstream) : CTLA4 (95525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	204760410	204760411	+	IGR	INS	-	A	A	rs144704403	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204760410_204760411insA								CTLA4 (21727 upstream) : ICOS (41060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	205200069	205200072	+	IGR	DEL	CACA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205200069_205200072delCACA								ICOS (373773 upstream) : PARD3B (210444 downstream)																																			---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	206272533	206272534	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206272533_206272534insA	uc002var.1	+						PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
SPAG16	79582	broad.mit.edu	37	2	214683352	214683352	+	Intron	DEL	A	-	-	rs139996538		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214683352delA	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808			sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	216158398	216158399	+	IGR	INS	-	A	A	rs143114602	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216158398_216158399insA								ABCA12 (155247 upstream) : ATIC (18293 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	217983331	217983331	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217983331delC								TNP1 (258549 upstream) : DIRC3 (165417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	218046994	218046994	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218046994delT								TNP1 (322212 upstream) : DIRC3 (101754 downstream)																																			---	---	---	---
DIRC3	729582	broad.mit.edu	37	2	218586048	218586049	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218586048_218586049insA	uc002vgo.2	-							NR_026597				Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	220215559	220215560	+	IGR	DEL	GG	-	-	rs34405653		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220215559_220215560delGG								RESP18 (17660 upstream) : DNPEP (17513 downstream)																																			---	---	---	---
EPHA4	2043	broad.mit.edu	37	2	222375696	222375696	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222375696delA	uc002vmq.2	-						EPHA4_uc002vmr.2_Intron|EPHA4_uc010zlm.1_Intron|EPHA4_uc010zln.1_Intron	NM_004438	NP_004429			ephrin receptor EphA4 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	222513548	222513549	+	IGR	INS	-	AA	AA	rs141506051	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222513548_222513549insAA								EPHA4 (74626 upstream) : PAX3 (551058 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	224211848	224211849	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224211848_224211849insA								KCNE4 (291495 upstream) : SCG2 (249811 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	224274408	224274410	+	IGR	DEL	TTA	-	-	rs35318650		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224274408_224274410delTTA								KCNE4 (354055 upstream) : SCG2 (187250 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	224305421	224305422	+	IGR	INS	-	TCTTC	TCTTC	rs146982889	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224305421_224305422insTCTTC								KCNE4 (385068 upstream) : SCG2 (156238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	224311421	224311422	+	IGR	INS	-	A	A	rs144588960		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224311421_224311422insA								KCNE4 (391068 upstream) : SCG2 (150238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	225561468	225561468	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225561468delG								CUL3 (111358 upstream) : DOCK10 (68339 downstream)																																			---	---	---	---
DOCK10	55619	broad.mit.edu	37	2	225661983	225661983	+	Intron	DEL	T	-	-	rs113535092		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225661983delT	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504			dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)														---	---	---	---
DOCK10	55619	broad.mit.edu	37	2	225864908	225864909	+	Intron	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225864908_225864909delCA	uc010fwz.1	-						DOCK10_uc002vod.1_Intron	NM_014689	NP_055504			dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)														---	---	---	---
RHBDD1	84236	broad.mit.edu	37	2	227852056	227852056	+	Intron	DEL	A	-	-	rs77237654		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227852056delA	uc002voi.2	+						RHBDD1_uc010fxc.2_Intron|RHBDD1_uc002voj.2_Intron	NM_032276	NP_115652			rhomboid domain containing 1							integral to membrane	serine-type endopeptidase activity			ovary(1)	1		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	228586134	228586134	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228586134delT								SLC19A3 (3389 upstream) : CCL20 (92424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	228820461	228820462	+	IGR	INS	-	A	A	rs144815367	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228820461_228820462insA								WDR69 (31435 upstream) : SPHKAP (24208 downstream)																																			---	---	---	---
DNER	92737	broad.mit.edu	37	2	230443841	230443841	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230443841delC	uc002vpv.2	-						DNER_uc010zly.1_Intron	NM_139072	NP_620711			delta-notch-like EGF repeat-containing						central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			lung(5)|ovary(2)|skin(1)	8		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)														---	---	---	---
CAB39	51719	broad.mit.edu	37	2	231685174	231685174	+	3'UTR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231685174delA	uc002vqx.2	+	9					CAB39_uc010fxr.2_3'UTR|CAB39_uc010fxq.2_3'UTR|CAB39_uc002vqy.2_3'UTR	NM_016289	NP_057373			calcium binding protein 39						cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	kinase binding			central_nervous_system(1)	1		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	232253707	232253707	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232253707delG								ARMC9 (15101 upstream) : B3GNT7 (6628 downstream)																																			---	---	---	---
PDE6D	5147	broad.mit.edu	37	2	232599164	232599164	+	Intron	DEL	A	-	-	rs148615861		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232599164delA	uc002vse.1	-							NM_002601	NP_002592			phosphodiesterase 6D						regulation of GTP catabolic process|response to stimulus|visual perception		3',5'-cyclic-nucleotide phosphodiesterase activity|GTPase inhibitor activity|protein binding				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.142)		Epithelial(121;2.19e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00145)|LUSC - Lung squamous cell carcinoma(224;0.0125)|Lung(119;0.0154)														---	---	---	---
UGT1A8	54576	broad.mit.edu	37	2	234597503	234597503	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234597503delG	uc002vup.2	+						UGT1A8_uc010zmv.1_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_5'Flank	NM_019076	NP_061949			UDP glycosyltransferase 1 family, polypeptide A8						drug metabolic process|fatty acid metabolic process|flavone metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme inhibitor activity|fatty acid binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|steroid binding			ovary(2)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;2.56e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000482)|Lung(119;0.00404)|LUSC - Lung squamous cell carcinoma(224;0.008)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	235247745	235247746	+	IGR	INS	-	TC	TC	rs143803395	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235247745_235247746insTC								SPP2 (261969 upstream) : ARL4C (153942 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237853938	237853939	+	IGR	INS	-	T	T	rs142258517	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237853938_237853939insT								CXCR7 (362946 upstream) : COPS8 (140145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	239131994	239131997	+	IGR	DEL	TTTT	-	-	rs72247356		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239131994_239131997delTTTT								ILKAP (19670 upstream) : LOC151174 (1757 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	239887273	239887274	+	IGR	INS	-	T	T	rs72541496	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239887273_239887274insT								TWIST2 (55036 upstream) : HDAC4 (82591 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	241185561	241185562	+	IGR	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241185561_241185562delCA								OTOS (105488 upstream) : GPC1 (189553 downstream)																																			---	---	---	---
FARP2	9855	broad.mit.edu	37	2	242338396	242338398	+	Intron	DEL	TAC	-	-	rs139124590		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242338396_242338398delTAC	uc002wbi.1	+						FARP2_uc010zoq.1_Intron|FARP2_uc010zor.1_Intron	NM_014808	NP_055623			FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)														---	---	---	---
ING5	84289	broad.mit.edu	37	2	242648989	242648989	+	Intron	DEL	C	-	-	rs71874351		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242648989delC	uc002wcd.2	+						ING5_uc002wcc.1_Intron	NM_032329	NP_115705			inhibitor of growth family, member 5						DNA replication|histone H3 acetylation|negative regulation of cell proliferation|negative regulation of growth|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.16e-33)|all cancers(36;4.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	242853393	242853394	+	IGR	INS	-	CACACACC	CACACACC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242853393_242853394insCACACACC								C2orf85 (37911 upstream) : LOC728323 (177450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	653707	653708	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:653707_653708insA	uc003boy.1	+											Homo sapiens cDNA FLJ44328 fis, clone TRACH3002871.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	1096469	1096472	+	IGR	DEL	GTTA	-	-	rs3034217		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1096469_1096472delGTTA								CHL1 (645374 upstream) : CNTN6 (38148 downstream)																																			---	---	---	---
SUMF1	285362	broad.mit.edu	37	3	4487216	4487217	+	Intron	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4487216_4487217delTC	uc003bpz.1	-						SUMF1_uc003bps.1_Intron|SUMF1_uc011ass.1_Intron|SUMF1_uc010hby.1_Intron|SUMF1_uc011ast.1_Intron	NM_182760	NP_877437			sulfatase modifying factor 1 isoform 1							endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity			upper_aerodigestive_tract(1)	1		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)														---	---	---	---
LMCD1	29995	broad.mit.edu	37	3	8589571	8589572	+	Intron	INS	-	A	A	rs142688205	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8589571_8589572insA	uc003bqq.2	+						LMCD1_uc011atd.1_Intron|LMCD1_uc011ate.1_Intron|LMCD1_uc011atf.1_Intron	NM_014583	NP_055398			LIM and cysteine-rich domains 1						positive regulation of calcineurin-NFAT signaling pathway|regulation of cardiac muscle hypertrophy|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus	transcription corepressor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(96;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	10179541	10179541	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10179541delT								C3orf10 (10668 upstream) : VHL (3778 downstream)																																			---	---	---	---
ATP2B2	491	broad.mit.edu	37	3	10405392	10405392	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10405392delA	uc003bvt.2	-						ATP2B2_uc003bvv.2_Intron|ATP2B2_uc003bvw.2_Intron|ATP2B2_uc010hdo.2_Intron	NM_001001331	NP_001001331			plasma membrane calcium ATPase 2 isoform 1						ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
ATG7	10533	broad.mit.edu	37	3	11326535	11326536	+	Intron	INS	-	T	T	rs34240225		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11326535_11326536insT	uc003bwc.2	+						ATG7_uc003bwd.2_Intron|ATG7_uc011aum.1_Intron	NM_006395	NP_006386			APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	13338361	13338361	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13338361delC								IQSEC1 (223744 upstream) : NUP210 (19376 downstream)																																			---	---	---	---
GALNTL2	117248	broad.mit.edu	37	3	16065446	16065447	+	Intron	INS	-	G	G	rs139593267	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16065446_16065447insG	uc003caq.3	+							NM_054110	NP_473451			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1																		---	---	---	---
GALNTL2	117248	broad.mit.edu	37	3	16078231	16078232	+	Intron	INS	-	A	A	rs149258573	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16078231_16078232insA	uc003caq.3	+							NM_054110	NP_473451			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	16294014	16294014	+	IGR	DEL	A	-	-	rs34040080		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16294014delA								GALNTL2 (22762 upstream) : DPH3 (4555 downstream)																																			---	---	---	---
PLCL2	23228	broad.mit.edu	37	3	17038920	17038920	+	Intron	DEL	T	-	-	rs35045289		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17038920delT	uc011awc.1	+						PLCL2_uc010het.1_Intron|PLCL2_uc011awd.1_Intron	NM_001144382	NP_001137854			phospholipase C-like 2 isoform 1						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(2)|ovary(1)|lung(1)	4																		---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17482931	17482932	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17482931_17482932insA	uc003cbf.2	-						TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	18203412	18203412	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18203412delT	uc003cbg.2	+											Homo sapiens cDNA clone IMAGE:5584035.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	19640056	19640059	+	IGR	DEL	GAGA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19640056_19640059delGAGA								KCNH8 (62921 upstream) : EFHB (280909 downstream)																																			---	---	---	---
KAT2B	8850	broad.mit.edu	37	3	20146383	20146383	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20146383delT	uc003cbq.2	+							NM_003884	NP_003875			K(lysine) acetyltransferase 2B						cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	21700102	21700105	+	Intron	DEL	TATT	-	-	rs151225835		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21700102_21700105delTATT	uc003cce.2	-						ZNF385D_uc010hfb.1_Intron	NM_024697	NP_078973			zinc finger protein 385D							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	22428953	22428954	+	IGR	INS	-	A	A	rs143825831	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22428953_22428954insA								ZNF385D (14830 upstream) : UBE2E2 (815699 downstream)																																			---	---	---	---
UBE2E2	7325	broad.mit.edu	37	3	23559730	23559731	+	Intron	DEL	AT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23559730_23559731delAT	uc003ccg.2	+						UBE2E2_uc010hfc.2_Intron	NM_152653	NP_689866			ubiquitin-conjugating enzyme E2E 2						ISG15-protein conjugation|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination	nucleolus	ATP binding|ISG15 ligase activity|ubiquitin-protein ligase activity				0																		---	---	---	---
THRB	7068	broad.mit.edu	37	3	24203663	24203663	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24203663delT	uc003ccx.3	-						THRB_uc010hfe.2_Intron|THRB_uc003ccy.3_Intron|THRB_uc003ccz.3_Intron|THRB_uc003cdc.2_Intron|THRB_uc003cdd.2_Intron|THRB_uc003cde.1_Intron|THRB_uc003cda.1_Intron	NM_001128176	NP_001121648			thyroid hormone receptor, beta						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription corepressor activity|zinc ion binding			skin(2)|pancreas(1)	3					Levothyroxine(DB00451)|Liothyronine(DB00279)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	24892919	24892919	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24892919delA								THRB (356466 upstream) : RARB (322904 downstream)																																			---	---	---	---
RARB	5915	broad.mit.edu	37	3	25353843	25353844	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25353843_25353844insT	uc011awl.1	+							NM_016152	NP_057236			retinoic acid receptor, beta isoform 2						embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)													---	---	---	---
RARB	5915	broad.mit.edu	37	3	25489889	25489889	+	Intron	DEL	A	-	-	rs35745314		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25489889delA	uc011awl.1	+						RARB_uc003cdi.1_Intron|RARB_uc003cdh.2_Intron	NM_016152	NP_057236			retinoic acid receptor, beta isoform 2						embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)													---	---	---	---
RARB	5915	broad.mit.edu	37	3	25492838	25492838	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25492838delT	uc011awl.1	+						RARB_uc003cdi.1_Intron|RARB_uc003cdh.2_Intron	NM_016152	NP_057236			retinoic acid receptor, beta isoform 2						embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)													---	---	---	---
NGLY1	55768	broad.mit.edu	37	3	25767238	25767239	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25767238_25767239insA	uc003cdl.2	-						NGLY1_uc010hfg.2_Intron|NGLY1_uc003cdm.2_Intron|NGLY1_uc011awo.1_Intron|NGLY1_uc003cdk.2_Intron	NM_018297	NP_060767			N-glycanase 1 isoform 1						glycoprotein catabolic process	cytoplasm	metal ion binding|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity|protein binding			breast(1)	1																		---	---	---	---
ZCWPW2	152098	broad.mit.edu	37	3	28521900	28521901	+	Intron	INS	-	T	T	rs113156854		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28521900_28521901insT	uc003ceh.2	+						ZCWPW2_uc003cei.2_Intron|ZCWPW2_uc010hfo.2_Intron	NM_001040432	NP_001035522			zinc finger, CW type with PWWP domain 2								zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	30129240	30129241	+	IGR	INS	-	CTC	CTC	rs138245228	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30129240_30129241insCTC								RBMS3 (82621 upstream) : TGFBR2 (518753 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	30423805	30423805	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30423805delG								RBMS3 (377186 upstream) : TGFBR2 (224189 downstream)																																			---	---	---	---
OSBPL10	114884	broad.mit.edu	37	3	31795002	31795003	+	Intron	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31795002_31795003delCA	uc003cev.2	-						OSBPL10_uc003ceu.1_Intron|OSBPL10_uc011axf.1_Intron	NM_017784	NP_060254			oxysterol-binding protein-like protein 10						lipid transport		lipid binding			skin(1)	1				STAD - Stomach adenocarcinoma(1;0.00406)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	32428804	32428804	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32428804delA								CMTM8 (16993 upstream) : CMTM7 (4359 downstream)																																			---	---	---	---
CMTM7	112616	broad.mit.edu	37	3	32463513	32463513	+	Intron	DEL	G	-	-	rs5847763		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32463513delG	uc003cey.1	+						CMTM7_uc003cez.1_Intron	NM_138410	NP_612419			CKLF-like MARVEL transmembrane domain containing						chemotaxis	extracellular space|integral to membrane	cytokine activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	32943339	32943339	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32943339delT								TRIM71 (9569 upstream) : CCR4 (49727 downstream)																																			---	---	---	---
CLASP2	23122	broad.mit.edu	37	3	33652090	33652090	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33652090delA	uc003cfu.2	-						CLASP2_uc003cft.2_Intron|CLASP2_uc010hgb.2_Intron|CLASP2_uc003cfv.2_Intron|CLASP2_uc011axu.1_Intron|CLASP2_uc003cfw.2_Intron|CLASP2_uc011axt.1_Intron	NM_015097	NP_055912			CLIP-associating protein 2											ovary(3)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	34216751	34216751	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34216751delC								PDCD6IP (305557 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	34609886	34609886	+	IGR	DEL	A	-	-	rs34411289		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34609886delA								PDCD6IP (698692 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	34925703	34925703	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34925703delT								None (None upstream) : ARPP21 (755378 downstream)																																			---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41886459	41886460	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41886459_41886460insT	uc003ckv.3	-						ULK4_uc003ckw.2_Intron	NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	42014256	42014257	+	IGR	INS	-	AAAC	AAAC	rs147683053	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42014256_42014257insAAAC								ULK4 (10596 upstream) : TRAK1 (118489 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	43118446	43118446	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43118446delT								FAM198A (16743 upstream) : C3orf39 (2283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	44003120	44003121	+	IGR	INS	-	C	C	rs72581908	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44003120_44003121insC								ABHD5 (238904 upstream) : MIR138-1 (152583 downstream)																																			---	---	---	---
KIF15	56992	broad.mit.edu	37	3	44879107	44879110	+	Intron	DEL	TATA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44879107_44879110delTATA	uc003cnx.3	+						KIF15_uc010hiq.2_Intron|KIF15_uc010hir.2_Intron	NM_020242	NP_064627			kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)														---	---	---	---
CCR9	10803	broad.mit.edu	37	3	45928743	45928744	+	Intron	INS	-	TG	TG	rs142787788	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45928743_45928744insTG	uc003coz.1	+						LZTFL1_uc003coy.1_Intron|LZTFL1_uc011bak.1_Intron|CCR9_uc010hiv.1_Intron|CCR9_uc003cpa.1_Intron	NM_031200	NP_112477			chemokine (C-C motif) receptor 9 isoform A						cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|immune response	integral to plasma membrane				ovary(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00118)|KIRC - Kidney renal clear cell carcinoma(197;0.0182)|Kidney(197;0.0214)														---	---	---	---
CCR3	1232	broad.mit.edu	37	3	46250419	46250420	+	Intron	INS	-	AG	AG			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46250419_46250420insAG	uc003cpg.1	+						CCR1_uc003cph.1_5'Flank	NM_178329	NP_847899			CC chemokine receptor 3 isoform 1						cell adhesion|cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|inflammatory response|interspecies interaction between organisms|positive regulation of angiogenesis	integral to plasma membrane				ovary(3)|lung(3)|breast(1)|kidney(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	46319892	46319893	+	IGR	INS	-	A	A	rs145687534	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46319892_46319893insA								CCR3 (11730 upstream) : CCR2 (75342 downstream)																																			---	---	---	---
KLHL18	23276	broad.mit.edu	37	3	47361525	47361526	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47361525_47361526insT	uc003crd.2	+						KLHL18_uc003crc.2_Intron|KLHL18_uc011bav.1_Intron	NM_025010	NP_079286			kelch-like 18												0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)														---	---	---	---
SCAP	22937	broad.mit.edu	37	3	47466549	47466549	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47466549delA	uc003crh.1	-						SCAP_uc011baz.1_Intron|SCAP_uc003crg.2_Intron	NM_012235	NP_036367			SREBF chaperone protein						cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)														---	---	---	---
CSPG5	10675	broad.mit.edu	37	3	47607172	47607175	+	Intron	DEL	AAAA	-	-	rs71977129		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47607172_47607175delAAAA	uc003crp.3	-						CSPG5_uc003crm.2_5'Flank|CSPG5_uc003crn.2_Intron|CSPG5_uc003cro.3_Intron|CSPG5_uc011bbb.1_Intron	NM_006574	NP_006565			chondroitin sulfate proteoglycan 5 (neuroglycan						cell differentiation|intracellular transport|nervous system development|regulation of growth	endoplasmic reticulum membrane|Golgi-associated vesicle membrane|integral to plasma membrane|membrane fraction	growth factor activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)														---	---	---	---
DHX30	22907	broad.mit.edu	37	3	47852443	47852443	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47852443delT	uc003cru.2	+						DHX30_uc003crr.3_Intron|DHX30_uc003crs.2_Intron|DHX30_uc003crt.2_Intron	NM_138615	NP_619520			DEAH (Asp-Glu-Ala-His) box polypeptide 30							mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)														---	---	---	---
P4HTM	54681	broad.mit.edu	37	3	49040446	49040446	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49040446delC	uc003cvg.2	+						P4HTM_uc003cvh.2_Intron|P4HTM_uc010hkm.1_3'UTR	NM_177939	NP_808808			hypoxia-inducible factor prolyl 4-hydroxylase							endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)													---	---	---	---
DOCK3	1795	broad.mit.edu	37	3	50740363	50740363	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50740363delA	uc011bds.1	+							NM_004947	NP_004938			dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)														---	---	---	---
DCP1A	55802	broad.mit.edu	37	3	53323035	53323036	+	Intron	INS	-	T	T	rs113070074		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53323035_53323036insT	uc003dgs.3	-						DCP1A_uc003dgt.3_Intron	NM_018403	NP_060873			DCP1 decapping enzyme homolog A						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus	hydrolase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	54144232	54144232	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54144232delT								SELK (218243 upstream) : CACNA2D3 (12461 downstream)																																			---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56415802	56415802	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56415802delA	uc003dhr.1	-							NM_015576	NP_056391			cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	57686892	57686892	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57686892delT								FAM116A (8076 upstream) : SLMAP (56282 downstream)																																			---	---	---	---
FAM107A	11170	broad.mit.edu	37	3	58568901	58568902	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58568901_58568902delAC	uc003dko.2	-						FAM107A_uc010hnm.2_Intron	NM_007177	NP_009108			downregulated in renal cell carcinoma						regulation of cell growth	nucleus	protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000189)|Kidney(10;0.000536)|KIRC - Kidney renal clear cell carcinoma(10;0.000716)|OV - Ovarian serous cystadenocarcinoma(275;0.154)														---	---	---	---
FHIT	2272	broad.mit.edu	37	3	60510454	60510455	+	Intron	INS	-	TC	TC	rs147689445	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60510454_60510455insTC	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
FHIT	2272	broad.mit.edu	37	3	60581360	60581361	+	Intron	INS	-	TG	TG	rs142401029	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60581360_60581361insTG	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	61779426	61779427	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61779426_61779427insT	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron	NM_002841	NP_002832			protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	62247271	62247271	+	Intron	DEL	T	-	-	rs34913030		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62247271delT	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron|PTPRG_uc011bfi.1_Intron	NM_002841	NP_002832			protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
CADPS	8618	broad.mit.edu	37	3	62829168	62829169	+	Intron	DEL	GT	-	-	rs79327609		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62829168_62829169delGT	uc003dll.2	-						CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707			Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)														---	---	---	---
CADPS	8618	broad.mit.edu	37	3	62838073	62838073	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62838073delT	uc003dll.2	-						CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707			Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)														---	---	---	---
CADPS	8618	broad.mit.edu	37	3	62838279	62838280	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62838279_62838280insA	uc003dll.2	-						CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707			Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)														---	---	---	---
SYNPR	132204	broad.mit.edu	37	3	63266402	63266403	+	Intron	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63266402_63266403delGT	uc003dlp.2	+						SYNPR_uc011bfk.1_Intron|SYNPR_uc011bfl.1_Intron	NM_001130003	NP_001123475			synaptoporin isoform 1							cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	transporter activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)														---	---	---	---
ATXN7	6314	broad.mit.edu	37	3	63880612	63880613	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63880612_63880613insT	uc003dlw.3	+						ATXN7_uc003dlv.2_Intron|ATXN7_uc010hnv.2_Intron|ATXN7_uc010hnu.1_Intron	NM_000333	NP_000324			ataxin 7 isoform a						cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	64813572	64813572	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64813572delC	uc003dml.2	+											Homo sapiens cDNA FLJ25194 fis, clone REC04095.																														---	---	---	---
MAGI1	9223	broad.mit.edu	37	3	66001136	66001136	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66001136delA	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229			membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)														---	---	---	---
LRIG1	26018	broad.mit.edu	37	3	66468540	66468541	+	Intron	DEL	AG	-	-	rs141461600		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66468540_66468541delAG	uc003dmx.2	-						LRIG1_uc010hnz.2_Intron|LRIG1_uc010hoa.2_Intron	NM_015541	NP_056356			leucine-rich repeats and immunoglobulin-like							integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)														---	---	---	---
LRIG1	26018	broad.mit.edu	37	3	66521803	66521803	+	Intron	DEL	T	-	-	rs60204675		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66521803delT	uc003dmx.2	-						LRIG1_uc010hoa.2_Intron	NM_015541	NP_056356			leucine-rich repeats and immunoglobulin-like							integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	67834498	67834500	+	Intron	DEL	GCT	-	-	rs77438812		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67834498_67834500delGCT	uc003dnc.2	+											Homo sapiens mRNA; cDNA DKFZp686F1220 (from clone DKFZp686F1220).																														---	---	---	---
FAM19A1	407738	broad.mit.edu	37	3	68580717	68580717	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68580717delT	uc003dnd.2	+						FAM19A1_uc003dne.2_Intron|FAM19A1_uc003dng.2_Intron	NM_213609	NP_998774			family with sequence similarity 19 (chemokine							endoplasmic reticulum|extracellular region				ovary(1)	1		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	70468129	70468130	+	IGR	DEL	CT	-	-	rs10552149	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70468129_70468130delCT								MITF (450643 upstream) : FOXP1 (536607 downstream)																																			---	---	---	---
FOXP1	27086	broad.mit.edu	37	3	71575279	71575282	+	Intron	DEL	ATAA	-	-	rs151187342		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71575279_71575282delATAA	uc003dop.2	-						FOXP1_uc003doo.2_Intron|FOXP1_uc003dos.2_Intron	NM_032682	NP_116071			forkhead box P1 isoform 1						cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)				T	PAX5	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	3	72246696	72246696	+	IGR	DEL	A	-	-	rs76601028		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72246696delA								PROK2 (412339 upstream) : RYBP (177055 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	72697354	72697354	+	IGR	DEL	T	-	-	rs34747404		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72697354delT								RYBP (201580 upstream) : SHQ1 (101076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	72797841	72797842	+	IGR	INS	-	AAACA	AAACA	rs146210833	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72797841_72797842insAAACA								RYBP (302067 upstream) : SHQ1 (588 downstream)																																			---	---	---	---
SHQ1	55164	broad.mit.edu	37	3	72840872	72840873	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72840872_72840873insT	uc003dpf.2	-						SHQ1_uc010hod.2_Intron	NM_018130	NP_060600			SHQ1 homolog						ribonucleoprotein complex assembly	cytosol|nucleoplasm	protein binding			ovary(2)|large_intestine(1)	3		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)														---	---	---	---
ZNF717	100131827	broad.mit.edu	37	3	75822907	75822908	+	Intron	DEL	AC	-	-	rs79915476		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75822907_75822908delAC	uc011bgi.1	-						ZNF717_uc003dpw.3_Intron	NM_001128223	NP_001121695			zinc finger protein 717						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	75989690	75989693	+	IGR	DEL	TCTG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75989690_75989693delTCTG								ZNF717 (155020 upstream) : None (None downstream)																																			---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77663873	77663874	+	Intron	INS	-	AACC	AACC	rs141770814	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77663873_77663874insAACC	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron|ROBO2_uc003dqa.2_Intron	NM_002942	NP_002933			roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	77710244	77710244	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77710244delC								ROBO2 (13583 upstream) : ROBO1 (936144 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	77842837	77842838	+	IGR	INS	-	T	T	rs140788758	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77842837_77842838insT								ROBO2 (146176 upstream) : ROBO1 (803550 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	82899420	82899422	+	IGR	DEL	CTT	-	-	rs13067064		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:82899420_82899422delCTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	87588733	87588734	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87588733_87588734insT								POU1F1 (262996 upstream) : HTR1F (442992 downstream)																																			---	---	---	---
CGGBP1	8545	broad.mit.edu	37	3	88143254	88143255	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88143254_88143255insT	uc003dqu.2	-							NM_003663	NP_003654			CGG triplet repeat binding protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding				0		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	88597813	88597813	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88597813delT								C3orf38 (390700 upstream) : EPHA3 (558861 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	89629288	89629289	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89629288_89629289insT								EPHA3 (98006 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	89925278	89925278	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89925278delT								EPHA3 (393996 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	90354369	90354370	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90354369_90354370insA								EPHA3 (823087 upstream) : None (None downstream)																																			---	---	---	---
PROS1	5627	broad.mit.edu	37	3	93672478	93672478	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93672478delA	uc003drb.3	-						PROS1_uc003dqz.3_Intron	NM_000313	NP_000304			protein S, alpha preproprotein						leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	95133788	95133788	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95133788delA								LOC255025 (238709 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	95645648	95645648	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95645648delT								LOC255025 (750569 upstream) : EPHA6 (887777 downstream)																																			---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	97065511	97065512	+	Intron	INS	-	T	T	rs111292808		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97065511_97065512insT	uc010how.1	+							NM_001080448	NP_001073917			EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
ABI3BP	25890	broad.mit.edu	37	3	100657215	100657215	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100657215delA	uc003dun.2	-						ABI3BP_uc003duo.2_Intron|ABI3BP_uc003dup.3_Intron	NM_015429	NP_056244			ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	103858176	103858176	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103858176delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	104776533	104776533	+	IGR	DEL	T	-	-	rs147321647		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104776533delT								None (None upstream) : ALCAM (309180 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	105365966	105365966	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105365966delA								ALCAM (70223 upstream) : CBLB (11144 downstream)																																			---	---	---	---
LOC100302640	100302640	broad.mit.edu	37	3	106855007	106855007	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106855007delA	uc003dwf.3	-						LOC100302640_uc011bhk.1_Intron					Homo sapiens cDNA clone IMAGE:5284861.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	109587300	109587300	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109587300delA								FLJ25363 (373286 upstream) : None (None downstream)																																			---	---	---	---
PHLDB2	90102	broad.mit.edu	37	3	111458445	111458445	+	Intron	DEL	A	-	-	rs76563606		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111458445delA	uc003dyc.2	+						PLCXD2_uc003dya.2_Intron|PLCXD2_uc003dxz.2_Intron	NM_001134437	NP_001127909			pleckstrin homology-like domain, family B,							cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6																		---	---	---	---
CCDC52	152185	broad.mit.edu	37	3	113209495	113209496	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113209495_113209496insA	uc003eag.3	-						CCDC52_uc003eaf.3_Intron|CCDC52_uc003eah.1_Intron	NM_144718	NP_653319			coiled-coil domain containing 52						cell division|mitosis	centriole|spindle	protein binding				0																		---	---	---	---
ZBTB20	26137	broad.mit.edu	37	3	114303374	114303374	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114303374delA	uc003ebj.2	-						ZBTB20_uc010hqp.2_Intron|ZBTB20_uc003ebk.2_Intron|ZBTB20_uc003ebl.2_Intron|ZBTB20_uc003ebm.2_Intron|ZBTB20_uc003ebn.2_Intron	NM_015642	NP_056457			zinc finger and BTB domain containing 20 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	116315906	116315906	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116315906delT								LSAMP (791888 upstream) : LOC285194 (112729 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	116588157	116588158	+	IGR	INS	-	TG	TG	rs147071516	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116588157_116588158insTG								LOC285194 (152272 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	117347720	117347720	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117347720delC								LOC285194 (911835 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	118463485	118463486	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118463485_118463486insA	uc011biu.1	-											Homo sapiens clone HA_003061 mRNA sequence.																														---	---	---	---
IGSF11	152404	broad.mit.edu	37	3	118845678	118845680	+	Intron	DEL	CAA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118845678_118845680delCAA	uc003eby.2	-						IGSF11_uc003ebz.2_Intron|IGSF11_uc010hqs.2_Intron	NM_152538	NP_689751			immunoglobulin superfamily, member 11 isoform a						cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0																		---	---	---	---
NR1I2	8856	broad.mit.edu	37	3	119516033	119516034	+	Intron	INS	-	TG	TG	rs149026227	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119516033_119516034insTG	uc003edj.2	+						NR1I2_uc003edi.2_Intron|NR1I2_uc003edk.2_Intron	NM_003889	NP_003880			nuclear receptor subfamily 1, group I, member 2						drug export|exogenous drug catabolic process|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid metabolic process|xenobiotic metabolic process|xenobiotic transport	nucleoplasm	drug binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(114;0.175)	Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Rifampin(DB01045)|Vitamin E(DB00163)													---	---	---	---
GSK3B	2932	broad.mit.edu	37	3	119548106	119548106	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119548106delA	uc003edo.2	-						GSK3B_uc003edn.2_Intron|GSK3B_uc003edm.2_Intron	NM_001146156	NP_001139628			glycogen synthase kinase 3 beta isoform 2						axon guidance|epithelial to mesenchymal transition|ER overload response|glycogen metabolic process|hippocampus development|negative regulation of apoptosis|negative regulation of protein binding|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|positive regulation of cell-matrix adhesion|positive regulation of protein complex assembly|positive regulation of protein export from nucleus|positive regulation of Rac GTPase activity|regulation of microtubule-based process|superior temporal gyrus development	Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|nucleus|plasma membrane	ATP binding|beta-catenin binding|NF-kappaB binding|p53 binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|RNA polymerase II transcription factor binding|tau-protein kinase activity|ubiquitin protein ligase binding			lung(2)	2				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)													---	---	---	---
GSK3B	2932	broad.mit.edu	37	3	119625647	119625647	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119625647delA	uc003edo.2	-						GSK3B_uc003edn.2_Intron	NM_001146156	NP_001139628			glycogen synthase kinase 3 beta isoform 2						axon guidance|epithelial to mesenchymal transition|ER overload response|glycogen metabolic process|hippocampus development|negative regulation of apoptosis|negative regulation of protein binding|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|positive regulation of cell-matrix adhesion|positive regulation of protein complex assembly|positive regulation of protein export from nucleus|positive regulation of Rac GTPase activity|regulation of microtubule-based process|superior temporal gyrus development	Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|nucleus|plasma membrane	ATP binding|beta-catenin binding|NF-kappaB binding|p53 binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|RNA polymerase II transcription factor binding|tau-protein kinase activity|ubiquitin protein ligase binding			lung(2)	2				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)													---	---	---	---
GPR156	165829	broad.mit.edu	37	3	119935267	119935267	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119935267delA	uc011bjf.1	-						GPR156_uc011bjg.1_Intron	NM_153002	NP_694547			G protein-coupled receptor 156							integral to membrane|plasma membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.19)														---	---	---	---
GOLGB1	2804	broad.mit.edu	37	3	121390705	121390705	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121390705delT	uc003eei.3	-						GOLGB1_uc010hrc.2_Intron|GOLGB1_uc003eej.3_Intron	NM_004487	NP_004478			golgi autoantigen, golgin subfamily b,						Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)														---	---	---	---
ILDR1	286676	broad.mit.edu	37	3	121742730	121742730	+	5'Flank	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121742730delC	uc003ees.2	-						ILDR1_uc003eer.2_5'Flank|ILDR1_uc010hrg.2_5'Flank	NM_175924	NP_787120			immunoglobulin-like domain containing receptor							cytosol|integral to membrane|plasma membrane	receptor activity			skin(1)	1				GBM - Glioblastoma multiforme(114;0.156)														---	---	---	---
KPNA1	3836	broad.mit.edu	37	3	122190366	122190367	+	Intron	INS	-	AT	AT			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122190366_122190367insAT	uc003efd.1	-						KPNA1_uc011bjr.1_Intron|KPNA1_uc010hrh.2_Intron|KPNA1_uc003efe.2_Intron	NM_002264	NP_002255			karyopherin alpha 1						DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|regulation of DNA recombination|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein binding|protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.0898)														---	---	---	---
ADCY5	111	broad.mit.edu	37	3	123105137	123105137	+	Intron	DEL	T	-	-	rs78115248		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123105137delT	uc003egh.1	-						ADCY5_uc003egg.1_Intron|ADCY5_uc003egi.1_Intron	NM_183357	NP_899200			adenylate cyclase 5						activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)														---	---	---	---
KALRN	8997	broad.mit.edu	37	3	123861406	123861406	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123861406delA	uc003ehg.2	+						KALRN_uc003ehd.2_Intron|KALRN_uc003ehe.2_Intron|KALRN_uc010hru.1_Intron|KALRN_uc010hrv.1_Intron|KALRN_uc010hrw.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron	NM_001024660	NP_001019831			kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
KALRN	8997	broad.mit.edu	37	3	123917551	123917552	+	Intron	INS	-	ATGT	ATGT	rs139315685	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123917551_123917552insATGT	uc003ehg.2	+						KALRN_uc010hrv.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron	NM_001024660	NP_001019831			kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	125951116	125951116	+	IGR	DEL	T	-	-	rs111653608		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125951116delT								ALDH1L1 (51631 upstream) : KLF15 (110362 downstream)																																			---	---	---	---
CHCHD6	84303	broad.mit.edu	37	3	126611796	126611797	+	Intron	INS	-	TT	TT	rs63517060		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126611796_126611797insTT	uc003ejf.1	+						CHCHD6_uc010hsj.1_Intron	NM_032343	NP_115719			coiled-coil-helix-coiled-coil-helix domain												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	126873920	126873923	+	IGR	DEL	TGTG	-	-	rs117555868		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126873920_126873923delTGTG								PLXNA1 (117692 upstream) : TPRA1 (417985 downstream)																																			---	---	---	---
RPN1	6184	broad.mit.edu	37	3	128366537	128366537	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128366537delA	uc003ekr.1	-						RPN1_uc011bkq.1_Intron	NM_002950	NP_002941			ribophorin I precursor						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|melanosome|oligosaccharyltransferase complex|rough microsome	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(114;0.189)				T	EVI1	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	3	128441197	128441198	+	IGR	INS	-	A	A	rs71618161	byFrequency	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128441197_128441198insA								RPN1 (41279 upstream) : RAB7A (3781 downstream)																																			---	---	---	---
ATP2C1	27032	broad.mit.edu	37	3	130687307	130687307	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130687307delG	uc003enl.2	+						ATP2C1_uc011blg.1_Intron|ATP2C1_uc011blh.1_Intron|ATP2C1_uc011bli.1_Intron|ATP2C1_uc003enk.2_Intron|ATP2C1_uc003enm.2_Intron|ATP2C1_uc003enn.2_Intron|ATP2C1_uc003eno.2_Intron|ATP2C1_uc003enp.2_Intron|ATP2C1_uc003enq.2_Intron|ATP2C1_uc003enr.2_Intron|ATP2C1_uc003ens.2_Intron|ATP2C1_uc003ent.2_Intron|ATP2C1_uc003enu.2_Intron	NM_014382	NP_055197			calcium-transporting ATPase 2C1 isoform 1a						actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)									Hailey-Hailey_disease				---	---	---	---
ACAD11	84129	broad.mit.edu	37	3	132358962	132358963	+	Intron	INS	-	T	T	rs72028687		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132358962_132358963insT	uc003eov.3	-						ACAD11_uc003eoy.2_Intron	NM_032169	NP_115545			putative acyl-CoA dehydrogenase							peroxisome	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|transferase activity, transferring phosphorus-containing groups			ovary(1)	1																		---	---	---	---
STAG1	10274	broad.mit.edu	37	3	136103304	136103304	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136103304delA	uc003era.1	-						STAG1_uc003erb.1_Intron|STAG1_uc003erc.1_Intron	NM_005862	NP_005853			stromal antigen 1						cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2																		---	---	---	---
NCK1	4690	broad.mit.edu	37	3	136595417	136595417	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136595417delT	uc003erh.2	+							NM_006153	NP_006144			NCK adaptor protein 1						axon guidance|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of translation|signal complex assembly|T cell activation|T cell receptor signaling pathway	cytosol|endoplasmic reticulum|nucleus	cytoskeletal adaptor activity|receptor binding|receptor signaling complex scaffold activity			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	137671935	137671935	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137671935delT								SOX14 (187539 upstream) : CLDN18 (45723 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	137897653	137897654	+	IGR	INS	-	AAAG	AAAG	rs139212512	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137897653_137897654insAAAG								DBR1 (3880 upstream) : ARMC8 (8494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	138521392	138521392	+	IGR	DEL	A	-	-	rs112331747		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138521392delA								PIK3CB (43207 upstream) : FOXL2 (141675 downstream)																																			---	---	---	---
PRR23C	389152	broad.mit.edu	37	3	138761230	138761231	+	3'UTR	INS	-	TT	TT	rs150653509	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138761230_138761231insTT	uc011bmt.1	-	1						NM_001134657	NP_001128129			proline rich 23C											skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	140520336	140520336	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140520336delT								TRIM42 (100345 upstream) : SLC25A36 (140326 downstream)																																			---	---	---	---
RASA2	5922	broad.mit.edu	37	3	141240963	141240963	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141240963delT	uc003etz.1	+						RASA2_uc010huq.1_Intron|RASA2_uc003eua.1_Intron|RASA2_uc011bnc.1_Intron	NM_006506	NP_006497			RAS p21 protein activator 2						intracellular signal transduction|negative regulation of Ras protein signal transduction	intracellular membrane-bounded organelle|intrinsic to internal side of plasma membrane|perinuclear region of cytoplasm	metal ion binding|Ras GTPase activator activity			ovary(2)|lung(2)|breast(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	144340977	144340980	+	IGR	DEL	AAAG	-	-	rs72361150		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144340977_144340980delAAAG								C3orf58 (629768 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	144362829	144362833	+	IGR	DEL	CTGAC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144362829_144362833delCTGAC								C3orf58 (651620 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145148847	145148850	+	IGR	DEL	AGAG	-	-	rs138898943		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145148847_145148850delAGAG								None (None upstream) : PLOD2 (638378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	147438313	147438314	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147438313_147438314delTG								ZIC1 (303809 upstream) : AGTR1 (977344 downstream)																																			---	---	---	---
TM4SF18	116441	broad.mit.edu	37	3	149045254	149045254	+	Intron	DEL	A	-	-	rs112443035		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149045254delA	uc003exa.2	-							NM_138786	NP_620141			transmembrane 4 L six family member 18							integral to membrane				ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)															---	---	---	---
WWTR1	25937	broad.mit.edu	37	3	149283095	149283095	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149283095delT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron	NM_015472	NP_056287			WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)															---	---	---	---
C3orf16	389161	broad.mit.edu	37	3	149493692	149493693	+	Intron	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149493692_149493693delGT	uc003exl.2	-						C3orf16_uc011bnt.1_Intron	NM_001144960	NP_001138432			hypothetical protein LOC389161												0																		---	---	---	---
GPR149	344758	broad.mit.edu	37	3	154091764	154091764	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154091764delA	uc003faa.2	-							NM_001038705	NP_001033794			G protein-coupled receptor 149							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)															---	---	---	---
PLCH1	23007	broad.mit.edu	37	3	155314941	155314942	+	Intron	INS	-	T	T	rs139355668	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155314941_155314942insT	uc011bok.1	-						PLCH1_uc011boj.1_Intron|PLCH1_uc011bol.1_Intron	NM_001130960	NP_001124432			phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)															---	---	---	---
KCNAB1	7881	broad.mit.edu	37	3	156229476	156229478	+	Intron	DEL	ACA	-	-	rs140049063		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156229476_156229478delACA	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron|KCNAB1_uc003fat.2_Intron|KCNAB1_uc010hvt.1_Intron|KCNAB1_uc011boo.1_Intron	NM_172160	NP_751892			potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	158612051	158612052	+	IGR	DEL	AA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158612051_158612052delAA								MFSD1 (64547 upstream) : SCHIP1 (175065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	158620338	158620338	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158620338delG								MFSD1 (72834 upstream) : SCHIP1 (166779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	158651392	158651393	+	IGR	INS	-	T	T	rs148373835	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158651392_158651393insT								MFSD1 (103888 upstream) : SCHIP1 (135724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	161104641	161104642	+	IGR	INS	-	T	T	rs144102408	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161104641_161104642insT								C3orf57 (14770 upstream) : OTOL1 (109954 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	161434198	161434199	+	IGR	INS	-	CACTAAA	CACTAAA			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161434198_161434199insCACTAAA								OTOL1 (212470 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	161520586	161520586	+	IGR	DEL	G	-	-	rs4856727	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161520586delG								OTOL1 (298858 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	162395468	162395468	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162395468delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	164372640	164372642	+	IGR	DEL	AAC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164372640_164372642delAAC								MIR720 (313402 upstream) : SI (324045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166160531	166160532	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166160531_166160532insT								BCHE (605278 upstream) : ZBBX (797549 downstream)																																			---	---	---	---
PDCD10	11235	broad.mit.edu	37	3	167447999	167448000	+	Intron	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167447999_167448000delTG	uc003fex.2	-						PDCD10_uc003fez.2_Intron|PDCD10_uc003fey.2_Intron	NM_007217	NP_009148			programmed cell death 10						angiogenesis|apoptosis|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of MAP kinase activity	cytosol|Golgi membrane|plasma membrane	protein homodimerization activity|protein N-terminus binding			lung(1)|central_nervous_system(1)	2														Familial_Cerebral_Cavernous_Angioma				---	---	---	---
CLDN11	5010	broad.mit.edu	37	3	170407273	170407274	+	Intron	INS	-	T	T	rs151187772	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170407273_170407274insT	uc011bpt.1	+						uc003fha.1_Intron	NM_005602	NP_005593			claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)															---	---	---	---
TNIK	23043	broad.mit.edu	37	3	171173048	171173049	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171173048_171173049insT	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron|TNIK_uc003fhq.2_Intron	NM_015028	NP_055843			TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)															---	---	---	---
NLGN1	22871	broad.mit.edu	37	3	173590881	173590881	+	Intron	DEL	T	-	-	rs71702635		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173590881delT	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747			neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---
NLGN1	22871	broad.mit.edu	37	3	173899569	173899570	+	Intron	DEL	AC	-	-	rs150666223		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173899569_173899570delAC	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747			neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	174070125	174070126	+	IGR	INS	-	AGGA	AGGA	rs144262512	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174070125_174070126insAGGA								NLGN1 (69009 upstream) : NAALADL2 (506985 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	174534204	174534205	+	IGR	DEL	GT	-	-	rs72019233		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174534204_174534205delGT								NLGN1 (533088 upstream) : NAALADL2 (42906 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	176402604	176402604	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176402604delC								NAALADL2 (879178 upstream) : TBL1XR1 (335939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	176518371	176518371	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176518371delA								NAALADL2 (994945 upstream) : TBL1XR1 (220172 downstream)																																			---	---	---	---
PIK3CA	5290	broad.mit.edu	37	3	178914825	178914826	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178914825_178914826insT	uc003fjk.2	+							NM_006218	NP_006209			phosphoinositide-3-kinase, catalytic, alpha						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)				57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	180130614	180130615	+	IGR	INS	-	A	A	rs113561247		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180130614_180130615insA								PEX5L (376097 upstream) : TTC14 (189303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	180611205	180611205	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180611205delC								CCDC39 (155543 upstream) : FXR1 (19247 downstream)																																			---	---	---	---
SOX2OT	347689	broad.mit.edu	37	3	181403482	181403483	+	Intron	INS	-	AAAC	AAAC	rs142832919	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181403482_181403483insAAAC	uc003fkv.2	+						SOX2OT_uc003fkw.3_Intron					Homo sapiens cDNA FLJ12764 fis, clone NT2RP2001506.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	183778476	183778479	+	IGR	DEL	GTTT	-	-	rs111532443		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183778476_183778479delGTTT								HTR3C (17 upstream) : HTR3E (36373 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	183924219	183924220	+	IGR	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183924219_183924220delTC								ABCF3 (12424 upstream) : VWA5B2 (24097 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	184193621	184193635	+	IGR	DEL	TCTTCCTCCTCCTTC	-	-	rs146724679		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184193621_184193635delTCTTCCTCCTCCTTC								CHRD (86002 upstream) : EPHB3 (85952 downstream)																																			---	---	---	---
IGF2BP2	10644	broad.mit.edu	37	3	185404173	185404173	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185404173delA	uc003fpo.2	-						IGF2BP2_uc010hyi.2_Intron|IGF2BP2_uc010hyj.2_Intron|IGF2BP2_uc010hyk.2_Intron|IGF2BP2_uc010hyl.2_Intron|IGF2BP2_uc003fpp.2_Intron|IGF2BP2_uc003fpq.2_Intron	NM_006548	NP_006539			insulin-like growth factor 2 mRNA binding						anatomical structure morphogenesis|negative regulation of translation	cytoskeletal part|cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity				0	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	185732908	185732922	+	IGR	DEL	TCTTTCCTTCCTTCT	-	-	rs74217042		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185732908_185732922delTCTTTCCTTCCTTCT								TRA2B (76984 upstream) : ETV5 (31186 downstream)																																			---	---	---	---
TBCCD1	55171	broad.mit.edu	37	3	186266202	186266202	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186266202delA	uc003fqg.2	-						CRYGS_uc003fqf.2_5'Flank|TBCCD1_uc011bry.1_Intron|TBCCD1_uc003fqh.2_Intron	NM_018138	NP_060608			TBCC domain containing 1						cell morphogenesis|maintenance of centrosome location|maintenance of Golgi location|regulation of cell migration|regulation of cell shape	spindle pole centrosome	binding			large_intestine(1)|ovary(1)	2	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	189326740	189326741	+	IGR	INS	-	T	T	rs140085842	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189326740_189326741insT								TPRG1 (285470 upstream) : TP63 (22475 downstream)																																			---	---	---	---
IL1RAP	3556	broad.mit.edu	37	3	190233040	190233041	+	Intron	INS	-	A	A	rs144239393	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190233040_190233041insA	uc003fsm.1	+						IL1RAP_uc003fsk.2_Intron|IL1RAP_uc003fsl.2_Intron|IL1RAP_uc010hzf.2_Intron|IL1RAP_uc010hzg.1_Intron|IL1RAP_uc003fsn.1_Intron|IL1RAP_uc003fso.1_Intron|IL1RAP_uc003fsp.1_Intron|IL1RAP_uc003fsq.2_Intron	NM_002182	NP_002173			interleukin 1 receptor accessory protein isoform						inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)														---	---	---	---
FGF12	2257	broad.mit.edu	37	3	191991696	191991696	+	Intron	DEL	A	-	-	rs67157460		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191991696delA	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360			fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)														---	---	---	---
ATP13A5	344905	broad.mit.edu	37	3	193012026	193012027	+	Intron	INS	-	T	T	rs141923704	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193012026_193012027insT	uc011bsq.1	-							NM_198505	NP_940907			ATPase type 13A5						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	195353385	195353386	+	IGR	DEL	CG	-	-	rs111429267		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195353385_195353386delCG								APOD (42309 upstream) : SDHAP2 (31524 downstream)																																			---	---	---	---
SDHAP2	727956	broad.mit.edu	37	3	195412015	195412015	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195412015delT	uc003fuw.2	+						SDHAP2_uc003fuv.2_Intron					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	195909242	195909242	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195909242delT								TFRC (100210 upstream) : ZDHHC19 (15082 downstream)																																			---	---	---	---
PIGZ	80235	broad.mit.edu	37	3	196684043	196684044	+	Intron	DEL	TG	-	-	rs112403220		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196684043_196684044delTG	uc003fxh.2	-							NM_025163	NP_079439			phosphatidylinositol glycan anchor biosynthesis,						GPI anchor biosynthetic process	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			ovary(3)	3	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)														---	---	---	---
BDH1	622	broad.mit.edu	37	3	197273972	197273973	+	Intron	INS	-	AC	AC	rs145315402	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197273972_197273973insAC	uc003fxr.2	-						BDH1_uc003fxs.2_Intron|BDH1_uc003fxt.2_Intron|BDH1_uc003fxu.2_Intron	NM_203314	NP_976059			3-hydroxybutyrate dehydrogenase, type 1						cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity			ovary(1)	1	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	NADH(DB00157)													---	---	---	---
ZNF876P	642280	broad.mit.edu	37	4	241850	241850	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:241850delA	uc010iba.2	+							NR_027481				Homo sapiens cDNA clone IMAGE:4828836.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	560544	560544	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:560544delC								PIGG (27225 upstream) : PDE6B (58819 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3583605	3583606	+	Intron	INS	-	GGGGCAG	GGGGCAG	rs139506506	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3583605_3583606insGGGGCAG	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3586790	3586791	+	Intron	INS	-	AT	AT	rs151172681	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3586790_3586791insAT	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3608456	3608467	+	IGR	DEL	TGAATGAATGAG	-	-	rs143833629	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3608456_3608467delTGAATGAATGAG								LRPAP1 (74232 upstream) : ADRA2C (159608 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3619299	3619300	+	IGR	INS	-	CCTT	CCTT	rs144281803	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3619299_3619300insCCTT								LRPAP1 (85075 upstream) : ADRA2C (148775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3913246	3913247	+	IGR	DEL	AT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3913246_3913247delAT								ADRA2C (142995 upstream) : LOC348926 (30423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3970016	3970017	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3970016_3970017insT								LOC348926 (12868 upstream) : OTOP1 (220513 downstream)																																			---	---	---	---
STK32B	55351	broad.mit.edu	37	4	5192984	5192984	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5192984delT	uc003gih.1	+						STK32B_uc010ida.1_Intron	NM_018401	NP_060871			serine/threonine kinase 32B								ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	11860077	11860078	+	IGR	INS	-	TTT	TTT	rs143768359	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11860077_11860078insTTT								HS3ST1 (429540 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	12427430	12427430	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12427430delT								HS3ST1 (996893 upstream) : HSP90AB2P (907607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	12956353	12956353	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12956353delA								None (None upstream) : HSP90AB2P (378684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	12961424	12961425	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12961424_12961425delTG								None (None upstream) : HSP90AB2P (373612 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13561093	13561093	+	IGR	DEL	A	-	-	rs34650452		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13561093delA								LOC285548 (11645 upstream) : BOD1L (9273 downstream)																																			---	---	---	---
CC2D2A	57545	broad.mit.edu	37	4	15471030	15471030	+	5'Flank	DEL	T	-	-	rs113272246		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15471030delT	uc010idv.2	+						CC2D2A_uc003gns.3_5'Flank|CC2D2A_uc003gnt.3_5'Flank|CC2D2A_uc003gnq.3_5'Flank|CC2D2A_uc003gnr.3_5'Flank|CC2D2A_uc003gnu.2_5'Flank|CC2D2A_uc003gnv.2_5'Flank	NM_001080522	NP_001073991			coiled-coil and C2 domain containing 2A isoform						cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	15873974	15873975	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15873974_15873975insA								CD38 (23268 upstream) : FGFBP1 (63220 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	16092089	16092089	+	IGR	DEL	T	-	-	rs76743510		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16092089delT								PROM1 (6466 upstream) : TAPT1 (70039 downstream)																																			---	---	---	---
LDB2	9079	broad.mit.edu	37	4	16820716	16820717	+	Intron	DEL	TG	-	-	rs35865583		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16820716_16820717delTG	uc003goz.2	-						LDB2_uc003gpa.2_Intron|LDB2_uc003gpb.2_Intron|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Intron	NM_001290	NP_001281			LIM domain binding 2 isoform a								LIM domain binding|transcription cofactor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	19911256	19911257	+	IGR	DEL	AT	-	-	rs59416326		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19911256_19911257delAT								None (None upstream) : SLIT2 (343978 downstream)																																			---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	20849173	20849174	+	Intron	INS	-	G	G	rs139769723	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20849173_20849174insG	uc003gqe.2	-						KCNIP4_uc003gqf.1_Intron|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqh.1_Intron|KCNIP4_uc003gqi.1_Intron|KCNIP4_uc010iel.2_Intron|KCNIP4_uc003gqd.3_Intron	NM_147182	NP_671711			Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	22635262	22635263	+	IGR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22635262_22635263delGT								GPR125 (117590 upstream) : GBA3 (59285 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	26050686	26050687	+	IGR	INS	-	A	A	rs138206723	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26050686_26050687insA								C4orf52 (119186 upstream) : RBPJ (270645 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	27166547	27166547	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27166547delG								STIM2 (140739 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	28321798	28321798	+	IGR	DEL	T	-	-	rs72233897		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28321798delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	31919852	31919853	+	IGR	INS	-	TTG	TTG	rs140620624	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31919852_31919853insTTG								PCDH7 (771431 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	33231007	33231008	+	IGR	INS	-	T	T	rs145927599	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33231007_33231008insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	34326622	34326622	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:34326622delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	35449377	35449380	+	IGR	DEL	AAAA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:35449377_35449380delAAAA								None (None upstream) : ARAP2 (500464 downstream)																																			---	---	---	---
ARAP2	116984	broad.mit.edu	37	4	36090070	36090070	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36090070delA	uc003gsq.1	-							NM_015230	NP_056045			ArfGAP with RhoGAP domain, ankyrin repeat and PH						regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
TBC1D1	23216	broad.mit.edu	37	4	37996260	37996261	+	Intron	INS	-	C	C	rs139308342	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37996260_37996261insC	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron|TBC1D1_uc011byf.1_Intron	NM_015173	NP_055988			TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
TBC1D1	23216	broad.mit.edu	37	4	38080727	38080728	+	Intron	INS	-	T	T	rs145262624	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38080727_38080728insT	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron|TBC1D1_uc011byf.1_Intron	NM_015173	NP_055988			TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
TMEM156	80008	broad.mit.edu	37	4	39007182	39007182	+	Intron	DEL	G	-	-	rs13125737	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39007182delG	uc003gto.2	-						TMEM156_uc010ifj.2_Intron	NM_024943	NP_079219			transmembrane protein 156							integral to membrane				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	39984048	39984048	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39984048delA								PDS5A (4472 upstream) : LOC344967 (60489 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	40673108	40673109	+	IGR	INS	-	T	T	rs112241988	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40673108_40673109insT								RBM47 (40468 upstream) : NSUN7 (78805 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	42328693	42328695	+	IGR	DEL	AGG	-	-	rs112399853		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42328693_42328695delAGG								BEND4 (173798 upstream) : SHISA3 (71161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	43149408	43149409	+	IGR	INS	-	T	T	rs150938866		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43149408_43149409insT								GRXCR1 (116735 upstream) : None (None downstream)																																			---	---	---	---
KCTD8	386617	broad.mit.edu	37	4	44233800	44233801	+	Intron	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44233800_44233801delTC	uc003gwu.2	-							NM_198353	NP_938167			potassium channel tetramerisation domain							cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(2)|ovary(1)	3															HNSCC(17;0.042)			---	---	---	---
KCTD8	386617	broad.mit.edu	37	4	44363227	44363227	+	Intron	DEL	A	-	-	rs11358993		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44363227delA	uc003gwu.2	-							NM_198353	NP_938167			potassium channel tetramerisation domain							cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(2)|ovary(1)	3															HNSCC(17;0.042)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	45833718	45833718	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45833718delT								None (None upstream) : GABRG1 (204071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	45870024	45870024	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45870024delT								None (None upstream) : GABRG1 (167765 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	46725772	46725772	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46725772delG								GABRA2 (333351 upstream) : COX7B2 (11077 downstream)																																			---	---	---	---
NFXL1	152518	broad.mit.edu	37	4	47856958	47856958	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47856958delA	uc010igh.2	-						NFXL1_uc003gxo.2_Intron|NFXL1_uc003gxp.2_Intron|NFXL1_uc003gxq.3_Intron|NFXL1_uc010igi.2_Intron	NM_152995	NP_694540			nuclear transcription factor, X-box binding-like							integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	49220204	49220204	+	IGR	DEL	G	-	-	rs73152053	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49220204delG								CWH43 (156111 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49242061	49242061	+	IGR	DEL	C	-	-	rs61467355		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49242061delC								CWH43 (177968 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49300630	49300631	+	IGR	INS	-	GGC	GGC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49300630_49300631insGGC								CWH43 (236537 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49573452	49573452	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49573452delC								CWH43 (509359 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	53338243	53338243	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53338243delT								SPATA18 (374786 upstream) : USP46 (118886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	55246618	55246619	+	IGR	DEL	TT	-	-	rs5858269		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55246618_55246619delTT								PDGFRA (82207 upstream) : KIT (277476 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	55631288	55631290	+	IGR	DEL	CAA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55631288_55631290delCAA								KIT (24409 upstream) : KDR (313137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	55754016	55754016	+	IGR	DEL	A	-	-	rs11289959		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55754016delA								KIT (147137 upstream) : KDR (190411 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	56142486	56142486	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56142486delA								KDR (150724 upstream) : SRD5A3 (69923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	56908706	56908707	+	IGR	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56908706_56908707delTC								CEP135 (9180 upstream) : KIAA1211 (127654 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	56936468	56936468	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56936468delT								CEP135 (36942 upstream) : KIAA1211 (99893 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	58568696	58568697	+	IGR	INS	-	TTT	TTT	rs143568973	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58568696_58568697insTTT								IGFBP7 (592157 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	61937210	61937211	+	IGR	INS	-	TATT	TATT	rs151159029	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61937210_61937211insTATT								None (None upstream) : LPHN3 (129763 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	64128214	64128215	+	IGR	DEL	TG	-	-	rs113436157		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:64128214_64128215delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	64968188	64968188	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:64968188delA								None (None upstream) : TECRL (175997 downstream)																																			---	---	---	---
EPHA5	2044	broad.mit.edu	37	4	66499087	66499087	+	Intron	DEL	A	-	-	rs75839110		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66499087delA	uc003hcy.2	-						EPHA5_uc003hcx.2_Intron|EPHA5_uc003hcz.2_Intron|EPHA5_uc011cah.1_Intron|EPHA5_uc011cai.1_Intron|EPHA5_uc003hda.2_Intron	NM_004439	NP_004430			ephrin receptor EphA5 isoform a precursor						cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24															TSP Lung(17;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	68098210	68098211	+	IGR	INS	-	C	C	rs138766902	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68098210_68098211insC								MIR1269 (955564 upstream) : CENPC1 (239778 downstream)																																			---	---	---	---
STAP1	26228	broad.mit.edu	37	4	68456464	68456465	+	Intron	DEL	TT	-	-	rs143322410		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68456464_68456465delTT	uc003hde.3	+						STAP1_uc003hdf.2_Intron	NM_012108	NP_036240			signal transducing adaptor family member 1						cellular membrane fusion|intracellular protein transport	cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	70045368	70045369	+	IGR	INS	-	A	A	rs139811783	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70045368_70045369insA								UGT2B7 (66664 upstream) : UGT2B11 (20684 downstream)																																			---	---	---	---
AMBN	258	broad.mit.edu	37	4	71455146	71455146	+	5'Flank	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71455146delA	uc003hfl.2	+							NM_016519	NP_057603			ameloblastin precursor						bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)															---	---	---	---
RUFY3	22902	broad.mit.edu	37	4	71609515	71609515	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71609515delA	uc003hfq.2	+						RUFY3_uc003hfp.3_Intron|RUFY3_uc011cax.1_Intron|RUFY3_uc003hfr.2_Intron|RUFY3_uc011cay.1_Intron	NM_014961	NP_055776			RUN and FYVE domain containing 3 isoform 2						negative regulation of axonogenesis	filopodium|growth cone					0		all_hematologic(202;0.248)	Lung(101;0.235)															---	---	---	---
NPFFR2	10886	broad.mit.edu	37	4	73005341	73005341	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73005341delT	uc003hgg.2	+						NPFFR2_uc010iig.1_Intron|NPFFR2_uc003hgi.2_Intron|NPFFR2_uc003hgh.2_Intron	NM_004885	NP_004876			neuropeptide FF receptor 2 isoform 1						detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	73603937	73603937	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73603937delA								ADAMTS3 (169421 upstream) : COX18 (316479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	74140404	74140404	+	IGR	DEL	A	-	-	rs35534723		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74140404delA								ANKRD17 (15902 upstream) : ALB (129568 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	74402215	74402216	+	IGR	INS	-	T	T	rs72203521		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74402215_74402216insT								AFM (32498 upstream) : RASSF6 (36646 downstream)																																			---	---	---	---
USO1	8615	broad.mit.edu	37	4	76710435	76710436	+	Intron	INS	-	TGT	TGT	rs141890872	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76710435_76710436insTGT	uc003hiu.2	+						USO1_uc003hiv.2_Intron|USO1_uc003hiw.2_Intron	NM_003715	NP_003706			USO1 homolog, vesicle docking protein						intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)															---	---	---	---
NUP54	53371	broad.mit.edu	37	4	77052191	77052192	+	Intron	INS	-	T	T	rs147143586	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77052191_77052192insT	uc003hjs.2	-						NUP54_uc010ije.2_Intron|NUP54_uc011cbs.1_Intron|NUP54_uc011cbt.1_Intron|NUP54_uc003hjt.2_Intron	NM_017426	NP_059122			nucleoporin 54kDa						carbohydrate metabolic process|glucose transport|mRNA transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleoplasm				ovary(1)|lung(1)	2																		---	---	---	---
SCARB2	950	broad.mit.edu	37	4	77095024	77095025	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77095024_77095025insT	uc003hju.1	-						SCARB2_uc011cbu.1_Intron	NM_005506	NP_005497			scavenger receptor class B, member 2						cell adhesion|protein targeting to lysosome	integral to plasma membrane|lysosomal lumen|lysosomal membrane|membrane fraction	enzyme binding|receptor activity				0			Lung(101;0.196)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	78176784	78176785	+	IGR	INS	-	G	G	rs138946415	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78176784_78176785insG								CCNG2 (85574 upstream) : CXCL13 (256122 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	80497667	80497668	+	IGR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80497667_80497668delGT								GK2 (168295 upstream) : GDEP (250957 downstream)																																			---	---	---	---
C4orf22	255119	broad.mit.edu	37	4	81398115	81398116	+	Intron	DEL	GT	-	-	rs72214889		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81398115_81398116delGT	uc003hmf.2	+						C4orf22_uc010ijp.2_Intron	NM_152770	NP_689983			hypothetical protein LOC255119											skin(2)	2																		---	---	---	---
C4orf22	255119	broad.mit.edu	37	4	81410020	81410020	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81410020delA	uc003hmf.2	+						C4orf22_uc010ijp.2_Intron	NM_152770	NP_689983			hypothetical protein LOC255119											skin(2)	2																		---	---	---	---
RASGEF1B	153020	broad.mit.edu	37	4	82371687	82371688	+	Intron	INS	-	TTG	TTG	rs138342332	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82371687_82371688insTTG	uc003hmi.1	-						RASGEF1B_uc003hmj.1_Intron|RASGEF1B_uc010ijq.1_Intron	NM_152545	NP_689758			RasGEF domain family, member 1B						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0																		---	---	---	---
TMEM150C	441027	broad.mit.edu	37	4	83450619	83450619	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83450619delT	uc003hmy.1	-						TMEM150C_uc011ccj.1_Intron	NM_001080506	NP_001073975			transmembrane protein 150C							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	84936504	84936505	+	Intron	INS	-	TGTAAA	TGTAAA	rs142685260	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84936504_84936505insTGTAAA	uc010ikd.1	-						uc003hoz.1_Intron					Homo sapiens cDNA FLJ37966 fis, clone CTONG2009871.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	86355428	86355429	+	IGR	INS	-	C	C	rs143411335	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86355428_86355429insC								C4orf12 (427260 upstream) : ARHGAP24 (40855 downstream)																																			---	---	---	---
ARHGAP24	83478	broad.mit.edu	37	4	86455440	86455447	+	Intron	DEL	CTTTGACA	-	-	rs56033686		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86455440_86455447delCTTTGACA	uc003hpk.2	+						ARHGAP24_uc003hpi.1_Intron|ARHGAP24_uc003hpj.2_Intron	NM_001025616	NP_001020787			Rho GTPase activating protein 24 isoform 1						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)														---	---	---	---
FAM190A	401145	broad.mit.edu	37	4	91397172	91397173	+	Intron	INS	-	GT	GT	rs148001576	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91397172_91397173insGT	uc003hsv.3	+						FAM190A_uc010ikv.2_Intron|FAM190A_uc003hsw.2_Intron	NM_001145065	NP_001138537			KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2																		---	---	---	---
FAM190A	401145	broad.mit.edu	37	4	92023185	92023186	+	Intron	DEL	GG	-	-	rs148407113		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:92023185_92023186delGG	uc003hsv.3	+						FAM190A_uc003hsx.2_Intron	NM_001145065	NP_001138537			KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2																		---	---	---	---
GRID2	2895	broad.mit.edu	37	4	93751251	93751251	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93751251delA	uc011cdt.1	+						GRID2_uc010ikx.2_Intron|GRID2_uc011cdu.1_Intron|GRID2_uc011cdv.1_Intron	NM_001510	NP_001501			glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
GRID2	2895	broad.mit.edu	37	4	93978313	93978314	+	Intron	INS	-	TGTG	TGTG	rs139689521	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93978313_93978314insTGTG	uc011cdt.1	+						GRID2_uc010ikx.2_Intron|GRID2_uc011cdu.1_Intron|GRID2_uc011cdv.1_Intron	NM_001510	NP_001501			glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
GRID2	2895	broad.mit.edu	37	4	94657496	94657497	+	Intron	INS	-	A	A	rs139805227	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94657496_94657497insA	uc011cdt.1	+						GRID2_uc011cdu.1_Intron	NM_001510	NP_001501			glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
UNC5C	8633	broad.mit.edu	37	4	96315980	96315981	+	Intron	INS	-	A	A	rs71583702		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96315980_96315981insA	uc003htp.1	-						UNC5C_uc010ilc.1_Intron|UNC5C_uc003htq.2_Intron	NM_003728	NP_003719			unc5C precursor						apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	99644348	99644349	+	IGR	DEL	CA	-	-	rs148260531		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99644348_99644349delCA								TSPAN5 (64621 upstream) : EIF4E (155258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	100091059	100091060	+	Intron	DEL	TA	-	-	rs146547308		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100091059_100091060delTA	uc003hum.1	+											Homo sapiens full length insert cDNA clone ZD94A03.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	105006576	105006577	+	IGR	DEL	AG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105006576_105006577delAG								TACR3 (365603 upstream) : CXXC4 (386768 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	105179489	105179489	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105179489delC								TACR3 (538516 upstream) : CXXC4 (213856 downstream)																																			---	---	---	---
TET2	54790	broad.mit.edu	37	4	106117322	106117323	+	Intron	INS	-	T	T	rs34207927		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106117322_106117323insT	uc003hxk.2	+						TET2_uc011cez.1_Intron|TET2_uc010ilp.1_Intron|TET2_uc003hxi.1_Intron	NM_001127208	NP_001120680			tet oncogene family member 2 isoform a						cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)				Mis N|F		MDS								---	---	---	---
Unknown	0	broad.mit.edu	37	4	107548174	107548175	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107548174_107548175insT								AIMP1 (277795 upstream) : DKK2 (294785 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	108845811	108845813	+	Intron	DEL	ACA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108845811_108845813delACA	uc003hym.1	-											Homo sapiens cDNA FLJ41298 fis, clone BRAMY2040478.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	111142001	111142001	+	IGR	DEL	T	-	-	rs34578972		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111142001delT								ELOVL6 (22181 upstream) : ENPEP (255228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	111670060	111670061	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111670060_111670061insT								PITX2 (106943 upstream) : MIR297 (111677 downstream)																																	OREG0004184	type=REGULATORY REGION|EvidenceSubtype=Dual luciferase reporter gene assay; In-vivo GFP Expression Assay	---	---	---	---
Unknown	0	broad.mit.edu	37	4	112160579	112160579	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112160579delC								MIR297 (378776 upstream) : C4orf32 (905974 downstream)																																			---	---	---	---
ANK2	287	broad.mit.edu	37	4	114107717	114107718	+	Intron	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114107717_114107718delTC	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc003ibc.2_Intron|ANK2_uc011cgb.1_Intron	NM_001148	NP_001139			ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)														---	---	---	---
ANK2	287	broad.mit.edu	37	4	114119996	114119996	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114119996delT	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc003ibc.2_Intron|ANK2_uc011cgb.1_Intron	NM_001148	NP_001139			ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	115110682	115110682	+	IGR	DEL	A	-	-	rs5861163		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115110682delA								ARSJ (209804 upstream) : UGT8 (408929 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	115488128	115488128	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115488128delT								ARSJ (587250 upstream) : UGT8 (31483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	116227615	116227616	+	IGR	DEL	CC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116227615_116227616delCC								NDST4 (192583 upstream) : MIR1973 (993265 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	116539618	116539619	+	IGR	INS	-	GA	GA	rs149448378	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116539618_116539619insGA								NDST4 (504586 upstream) : MIR1973 (681262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	116948579	116948579	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116948579delC								NDST4 (913547 upstream) : MIR1973 (272302 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	117084480	117084480	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117084480delA								None (None upstream) : MIR1973 (136401 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	117102619	117102620	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117102619_117102620insT								None (None upstream) : MIR1973 (118261 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	118258706	118258706	+	IGR	DEL	A	-	-	rs143342057		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118258706delA								TRAM1L1 (251970 upstream) : NDST3 (696067 downstream)																																			---	---	---	---
NDST3	9348	broad.mit.edu	37	4	119042840	119042840	+	Intron	DEL	C	-	-	rs11322429		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119042840delC	uc003ibx.2	+						NDST3_uc011cgf.1_Intron	NM_004784	NP_004775			N-deacetylase/N-sulfotransferase (heparan							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	121168864	121168867	+	IGR	DEL	ACAC	-	-	rs59427056		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121168864_121168867delACAC								MAD2L1 (180851 upstream) : PRDM5 (447063 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	121409731	121409732	+	IGR	INS	-	AAGC	AAGC	rs138358189	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121409731_121409732insAAGC								MAD2L1 (421718 upstream) : PRDM5 (206198 downstream)																																			---	---	---	---
PRDM5	11107	broad.mit.edu	37	4	121641129	121641130	+	Intron	INS	-	TG	TG	rs143790337	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121641129_121641130insTG	uc003idn.2	-						PRDM5_uc003ido.2_Intron|PRDM5_uc010ine.2_Intron	NM_018699	NP_061169			PR domain containing 5						histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	121938576	121938577	+	IGR	INS	-	AAA	AAA	rs71599106		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121938576_121938577insAAA								PRDM5 (94563 upstream) : C4orf31 (18205 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	124885299	124885304	+	IGR	DEL	ACACAC	-	-	rs71583321		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124885299_124885304delACACAC								LOC285419 (33781 upstream) : ANKRD50 (700164 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	126121302	126121302	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126121302delA								ANKRD50 (487415 upstream) : FAT4 (116265 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	127748454	127748455	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:127748454_127748455insT								None (None upstream) : INTU (805665 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	127951414	127951414	+	IGR	DEL	C	-	-	rs147847021		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:127951414delC								None (None upstream) : INTU (602706 downstream)																																			---	---	---	---
LARP1B	55132	broad.mit.edu	37	4	129113987	129113988	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129113987_129113988insT	uc003iga.2	+						LARP1B_uc003igc.2_Intron|LARP1B_uc010ioa.1_Intron|LARP1B_uc003ige.2_Intron|LARP1B_uc003igd.2_Intron	NM_018078	NP_060548			La ribonucleoprotein domain family member 2								RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	130863884	130863884	+	Intron	DEL	A	-	-	rs35646077		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130863884delA	uc003igw.1	+											Homo sapiens cDNA clone IMAGE:5170949, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	131871483	131871484	+	IGR	INS	-	T	T	rs145459994	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131871483_131871484insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	134485869	134485869	+	IGR	DEL	A	-	-	rs72363657		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134485869delA								PCDH10 (373138 upstream) : PABPC4L (631622 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	136805554	136805554	+	IGR	DEL	T	-	-	rs75873506		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:136805554delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	138082774	138082774	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138082774delA								None (None upstream) : PCDH18 (357302 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	139028634	139028635	+	Intron	INS	-	T	T	rs148301491	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139028634_139028635insT	uc003ihi.1	+						uc003ihh.2_Intron					Homo sapiens hypothetical protein LOC641364, mRNA (cDNA clone IMAGE:5273158).																														---	---	---	---
ELF2	1998	broad.mit.edu	37	4	140073494	140073494	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140073494delT	uc003ihq.2	-											Homo sapiens ets family transcription factor ELF2A (ELF2) mRNA, complete cds, alternatively spliced.						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2	all_hematologic(180;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	140342378	140342378	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140342378delT								NAA15 (30443 upstream) : RAB33B (32583 downstream)																																			---	---	---	---
RNF150	57484	broad.mit.edu	37	4	141833084	141833084	+	Intron	DEL	T	-	-	rs33941367		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141833084delT	uc003iio.1	-						RNF150_uc010iok.1_Intron|RNF150_uc003iip.1_Intron	NM_020724	NP_065775			ring finger protein 150 precursor							integral to membrane	zinc ion binding			ovary(1)	1	all_hematologic(180;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	142180200	142180200	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142180200delG								ZNF330 (24352 upstream) : IL15 (377554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	145281880	145281880	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145281880delA								GYPA (219976 upstream) : HHIP (285293 downstream)																																			---	---	---	---
ANAPC10	10393	broad.mit.edu	37	4	145975821	145975822	+	Intron	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145975821_145975822delTG	uc003iju.3	-						ANAPC10_uc003ijv.3_Intron|ANAPC10_uc003ijw.3_Intron	NM_014885	NP_055700			anaphase promoting complex subunit 10						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	ubiquitin-protein ligase activity				0	all_hematologic(180;0.151)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	146195524	146195525	+	IGR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146195524_146195525delGT								OTUD4 (94692 upstream) : SMAD1 (207426 downstream)																																			---	---	---	---
SLC10A7	84068	broad.mit.edu	37	4	147281399	147281400	+	Intron	INS	-	TAAA	TAAA	rs144215743	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147281399_147281400insTAAA	uc010ioz.2	-						SLC10A7_uc003ikr.2_Intron|SLC10A7_uc010ipa.2_Intron|SLC10A7_uc003iks.2_Intron	NM_001029998	NP_001025169			solute carrier family 10 (sodium/bile acid							integral to membrane	bile acid:sodium symporter activity				0	all_hematologic(180;0.151)																	---	---	---	---
SLC10A7	84068	broad.mit.edu	37	4	147285286	147285289	+	Intron	DEL	AAAT	-	-	rs137901705		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147285286_147285289delAAAT	uc010ioz.2	-						SLC10A7_uc003ikr.2_Intron|SLC10A7_uc010ipa.2_Intron|SLC10A7_uc003iks.2_Intron	NM_001029998	NP_001025169			solute carrier family 10 (sodium/bile acid							integral to membrane	bile acid:sodium symporter activity				0	all_hematologic(180;0.151)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	148148375	148148376	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148148375_148148376insT								TTC29 (281341 upstream) : MIR548G (117405 downstream)																																			---	---	---	---
LRBA	987	broad.mit.edu	37	4	151848231	151848231	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151848231delA	uc010ipj.2	-						LRBA_uc003ilu.3_Intron|LRBA_uc010ipk.1_Intron	NM_006726	NP_006717			LPS-responsive vesicle trafficking, beach and							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)																	---	---	---	---
SH3D19	152503	broad.mit.edu	37	4	152046203	152046204	+	Intron	INS	-	TTTC	TTTC	rs140237288	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152046203_152046204insTTTC	uc010ipl.1	-						SH3D19_uc003imb.2_Intron|SH3D19_uc003imc.2_Intron|SH3D19_uc003ime.2_Intron|SH3D19_uc010ipm.2_Intron	NM_001009555	NP_001009555			SH3 domain containing 19 isoform a						cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding			ovary(1)|skin(1)	2	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	152824122	152824123	+	IGR	DEL	TA	-	-	rs150733237	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152824122_152824123delTA								PET112L (141976 upstream) : FBXW7 (418288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	154050993	154051004	+	IGR	DEL	ATCACTACCACC	-	-	rs141932694	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154050993_154051004delATCACTACCACC								FHDC1 (150145 upstream) : TRIM2 (23266 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	154373879	154373880	+	IGR	DEL	CA	-	-	rs113440442		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154373879_154373880delCA								MND1 (37636 upstream) : KIAA0922 (13618 downstream)																																			---	---	---	---
SFRP2	6423	broad.mit.edu	37	4	154707626	154707626	+	Intron	DEL	A	-	-	rs34176108		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154707626delA	uc003inv.1	-							NM_003013	NP_003004			secreted frizzled-related protein 2 precursor						brain development|cardiac left ventricle morphogenesis|cell-cell signaling|dermatome development|hemopoietic stem cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell growth|negative regulation of cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|outflow tract morphogenesis|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell adhesion mediated by integrin|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of fat cell differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of stem cell division|sclerotome development	cytoplasm|extracellular matrix|extracellular space|plasma membrane	fibronectin binding|integrin binding|PDZ domain binding|receptor agonist activity|Wnt receptor activity|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.093)	Renal(120;0.117)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	154828509	154828509	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154828509delT								SFRP2 (118281 upstream) : DCHS2 (327018 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	155874279	155874279	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155874279delG								RBM46 (124315 upstream) : NPY2R (255502 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	157502276	157502280	+	IGR	DEL	CTTTG	-	-	rs71881508		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157502276_157502280delCTTTG								CTSO (627228 upstream) : PDGFC (180484 downstream)																																			---	---	---	---
GRIA2	2891	broad.mit.edu	37	4	158232619	158232619	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158232619delT	uc003ipm.3	+						GRIA2_uc011cit.1_Intron|GRIA2_uc003ipl.3_Intron|GRIA2_uc003ipk.3_Intron|GRIA2_uc010iqh.1_Intron	NM_001083619	NP_001077088			glutamate receptor, ionotropic, AMPA 2 isoform 2						synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	158435468	158435469	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158435468_158435469insT								GRIA2 (148244 upstream) : LOC340017 (58173 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	159388796	159388796	+	IGR	DEL	A	-	-	rs74997000		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159388796delA								TMEM144 (212358 upstream) : RXFP1 (54251 downstream)																																			---	---	---	---
C4orf45	152940	broad.mit.edu	37	4	159914853	159914853	+	Intron	DEL	G	-	-	rs71587497		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159914853delG	uc003iqf.1	-						C4orf45_uc010iqt.1_Intron	NM_152543	NP_689756			hypothetical protein LOC152940												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	166465950	166465950	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166465950delA								CPE (46469 upstream) : TLL1 (328460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	170252586	170252586	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170252586delT								SH3RF1 (60337 upstream) : NEK1 (61843 downstream)																																			---	---	---	---
NEK1	4750	broad.mit.edu	37	4	170522990	170522990	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170522990delA	uc003isb.1	-						NEK1_uc003isc.1_Intron|NEK1_uc003isd.1_Intron|NEK1_uc003ise.1_Intron|NEK1_uc003isf.1_Intron|NEK1_uc003isg.1_5'Flank	NM_012224	NP_036356			NIMA-related kinase 1						cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)														---	---	---	---
GALNT7	51809	broad.mit.edu	37	4	174103813	174103814	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174103813_174103814delAC	uc003isz.3	+							NM_017423	NP_059119			polypeptide N-acetylgalactosaminyltransferase 7						protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			central_nervous_system(1)	1		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	177595119	177595120	+	IGR	INS	-	C	C	rs143522657	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177595119_177595120insC								SPCS3 (341725 upstream) : VEGFC (9571 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	178213743	178213744	+	IGR	DEL	CA	-	-	rs35979678		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178213743_178213744delCA								VEGFC (499848 upstream) : NEIL3 (17247 downstream)																																			---	---	---	---
NEIL3	55247	broad.mit.edu	37	4	178264068	178264068	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178264068delT	uc003iut.2	+						NEIL3_uc010irs.2_Intron	NM_018248	NP_060718			nei endonuclease VIII-like 3						base-excision repair|nucleotide-excision repair	nucleus	bubble DNA binding|damaged DNA binding|DNA N-glycosylase activity|DNA-(apurinic or apyrimidinic site) lyase activity|double-stranded DNA binding|single-stranded DNA binding|zinc ion binding			lung(2)|ovary(1)|central_nervous_system(1)	4		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)									BER_DNA_glycosylases					---	---	---	---
Unknown	0	broad.mit.edu	37	4	180235884	180235885	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180235884_180235885insA								None (None upstream) : None (None downstream)																																			---	---	---	---
ENPP6	133121	broad.mit.edu	37	4	185022458	185022461	+	Intron	DEL	TGTG	-	-	rs113852492		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185022458_185022461delTGTG	uc003iwc.2	-							NM_153343	NP_699174			ectonucleotide pyrophosphatase/phosphodiesterase						lipid catabolic process	extracellular region|integral to membrane|plasma membrane				central_nervous_system(1)	1		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	185873070	185873070	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185873070delG								ACSL1 (125855 upstream) : HELT (66925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	186501277	186501277	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186501277delT								PDLIM3 (44565 upstream) : SORBS2 (5322 downstream)																																			---	---	---	---
SORBS2	8470	broad.mit.edu	37	4	186748223	186748224	+	Intron	INS	-	CAT	CAT	rs144017246	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186748223_186748224insCAT	uc003iyl.2	-						SORBS2_uc003iym.2_Intron|SORBS2_uc011cky.1_Intron	NM_021069	NP_066547			sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)														---	---	---	---
SORBS2	8470	broad.mit.edu	37	4	186859544	186859547	+	Intron	DEL	ACAC	-	-	rs77365997	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186859544_186859547delACAC	uc003iyl.2	-						SORBS2_uc003iym.2_Intron|SORBS2_uc011cky.1_Intron	NM_021069	NP_066547			sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	188656085	188656086	+	IGR	DEL	AC	-	-	rs33995647		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188656085_188656086delAC								None (None upstream) : ZFP42 (260839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	188826072	188826072	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188826072delA								None (None upstream) : ZFP42 (90853 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190563755	190563756	+	IGR	INS	-	T	T	rs140889127		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190563755_190563756insT								None (None upstream) : FRG1 (298218 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190678249	190678249	+	IGR	DEL	T	-	-	rs33920189		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190678249delT								None (None upstream) : FRG1 (183725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	957675	957675	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:957675delT								TRIP13 (39517 upstream) : NKD2 (51493 downstream)																																			---	---	---	---
NKD2	85409	broad.mit.edu	37	5	1026394	1026395	+	Intron	INS	-	A	A	rs142195086		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1026394_1026395insA	uc003jbt.1	+						NKD2_uc010itf.1_Intron	NM_033120	NP_149111			naked cuticle homolog 2						exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding				0	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)															---	---	---	---
TERT	7015	broad.mit.edu	37	5	1292643	1292644	+	Intron	INS	-	A	A	rs146680232	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1292643_1292644insA	uc003jcb.1	-						TERT_uc003jca.1_Intron|TERT_uc003jcc.1_Intron|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	NM_198253	NP_937983			telomerase reverse transcriptase isoform 1						anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)											TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				---	---	---	---
Unknown	0	broad.mit.edu	37	5	3234478	3234478	+	IGR	DEL	G	-	-	rs149239852	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3234478delG								C5orf38 (478966 upstream) : IRX1 (361690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3475274	3475275	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3475274_3475275delAC	uc003jdd.2	-											Homo sapiens cDNA clone IMAGE:4823480.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	7039636	7039636	+	IGR	DEL	A	-	-	rs71743097		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7039636delA								PAPD7 (282475 upstream) : ADCY2 (356707 downstream)																																			---	---	---	---
ADCY2	108	broad.mit.edu	37	5	7653720	7653720	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7653720delA	uc003jdz.1	+						ADCY2_uc011cmo.1_5'Flank	NM_020546	NP_065433			adenylate cyclase 2						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	8813186	8813187	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8813186_8813187insA								MTRR (911953 upstream) : SEMA5A (221951 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	8924084	8924084	+	IGR	DEL	C	-	-	rs77015498		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8924084delC								None (None upstream) : SEMA5A (111054 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	10670197	10670198	+	IGR	INS	-	TGA	TGA	rs144059332	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10670197_10670198insTGA								ROPN1L (205060 upstream) : DAP (9145 downstream)																																			---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11412900	11412900	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11412900delT	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	12433746	12433751	+	IGR	DEL	CTCCTC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12433746_12433751delCTCCTC								CTNND2 (529636 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	12827511	12827512	+	IGR	INS	-	T	T	rs145845263		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12827511_12827512insT								CTNND2 (923401 upstream) : DNAH5 (862925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	13032070	13032071	+	IGR	INS	-	AGAA	AGAA	rs5866014		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13032070_13032071insAGAA								None (None upstream) : DNAH5 (658366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	16383702	16383703	+	IGR	INS	-	TGTTTT	TGTTTT	rs141345483	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16383702_16383703insTGTTTT								MARCH11 (203805 upstream) : ZNF622 (67926 downstream)																																			---	---	---	---
FAM134B	54463	broad.mit.edu	37	5	16606482	16606482	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16606482delC	uc003jfs.2	-							NM_001034850	NP_001030022			hypothetical protein LOC54463 isoform 1						sensory perception of pain	cis-Golgi network|endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	17351535	17351535	+	5'Flank	DEL	T	-	-	rs112049534		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17351535delT	uc003jfz.2	+											full-length cDNA clone CS0DK001YG07 of HeLa cells Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	18077434	18077437	+	IGR	DEL	GGTC	-	-	rs76470391		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18077434_18077437delGGTC								BASP1 (800499 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	18245014	18245019	+	IGR	DEL	GTGTGT	-	-	rs145545914		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18245014_18245019delGTGTGT								BASP1 (968079 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	19356007	19356007	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19356007delA								None (None upstream) : CDH18 (117150 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	20463411	20463412	+	IGR	INS	-	A	A	rs140023840		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20463411_20463412insA								CDH18 (475104 upstream) : GUSBP1 (878530 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	20643914	20643915	+	Intron	INS	-	A	A	rs75537993		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20643914_20643915insA	uc003jge.1	+											Homo sapiens cDNA FLJ36043 fis, clone TESTI2017582.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	20876564	20876564	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20876564delA	uc003jge.1	+											Homo sapiens cDNA FLJ36043 fis, clone TESTI2017582.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	21157284	21157284	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21157284delA								None (None upstream) : GUSBP1 (184658 downstream)																																			---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21570911	21570911	+	Intron	DEL	T	-	-	rs66508635		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21570911delT	uc003jgh.3	+							NR_027026				Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	23337616	23337616	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23337616delA								CDH12 (483885 upstream) : PRDM9 (170108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	23676065	23676065	+	IGR	DEL	T	-	-	rs77153261		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23676065delT								PRDM9 (147361 upstream) : CDH10 (811145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	25411486	25411489	+	IGR	DEL	CACA	-	-	rs72363421		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25411486_25411489delCACA								CDH10 (766575 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	25973890	25973891	+	IGR	INS	-	AA	AA	rs33977964		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25973890_25973891insAA								None (None upstream) : CDH9 (906818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	29429861	29429866	+	IGR	DEL	AAAAAC	-	-	rs71838573		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29429861_29429866delAAAAAC								None (None upstream) : None (None downstream)																																			---	---	---	---
RNASEN	29102	broad.mit.edu	37	5	31467202	31467202	+	Intron	DEL	T	-	-	rs33955141		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31467202delT	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron|RNASEN_uc003jhi.2_Intron	NM_013235	NP_037367			ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	32906297	32906297	+	IGR	DEL	G	-	-	rs34556505		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32906297delG								C5orf23 (114478 upstream) : TARS (534505 downstream)																																			---	---	---	---
SPEF2	79925	broad.mit.edu	37	5	35736571	35736572	+	Intron	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35736571_35736572delGT	uc003jjo.2	+						SPEF2_uc003jjp.1_Intron	NM_024867	NP_079143			KPL2 protein isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
SPEF2	79925	broad.mit.edu	37	5	35741540	35741540	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35741540delA	uc003jjo.2	+						SPEF2_uc003jjp.1_Intron	NM_024867	NP_079143			KPL2 protein isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
NIPBL	25836	broad.mit.edu	37	5	36977704	36977705	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36977704_36977705insT	uc003jkl.3	+						NIPBL_uc003jkk.3_Intron|NIPBL_uc003jkm.1_Intron	NM_133433	NP_597677			delangin isoform A						brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)															---	---	---	---
C5orf42	65250	broad.mit.edu	37	5	37194760	37194760	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37194760delT	uc011cpa.1	-						C5orf42_uc003jks.2_Intron|C5orf42_uc011coz.1_Intron|C5orf42_uc011cpb.1_Intron	NM_023073	NP_075561			hypothetical protein LOC65250											ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	37876214	37876215	+	IGR	INS	-	CTCC	CTCC	rs150505261	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37876214_37876215insCTCC								GDNF (36432 upstream) : EGFLAM (382318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	37889530	37889530	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37889530delG								GDNF (49748 upstream) : EGFLAM (369003 downstream)																																			---	---	---	---
EGFLAM	133584	broad.mit.edu	37	5	38397719	38397719	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38397719delG	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron	NM_152403	NP_689616			EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	39649132	39649132	+	IGR	DEL	T	-	-	rs74957573		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39649132delT								DAB2 (223797 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	40420883	40420883	+	IGR	DEL	T	-	-	rs137960197		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40420883delT								DAB2 (995548 upstream) : PTGER4 (259149 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	41658922	41658926	+	IGR	DEL	TGGTT	-	-	rs112832027		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41658922_41658926delTGGTT								PLCXD3 (148192 upstream) : OXCT1 (71242 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	41689782	41689782	+	IGR	DEL	T	-	-	rs113530970		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41689782delT								PLCXD3 (179052 upstream) : OXCT1 (40386 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	42071988	42071989	+	IGR	INS	-	GT	GT	rs141745716	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42071988_42071989insGT								FBXO4 (130325 upstream) : GHR (352037 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	42202114	42202120	+	IGR	DEL	ACAGGCC	-	-	rs139179153		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42202114_42202120delACAGGCC								FBXO4 (260451 upstream) : GHR (221906 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	42308986	42308987	+	IGR	INS	-	A	A	rs151101310	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42308986_42308987insA								FBXO4 (367323 upstream) : GHR (115039 downstream)																																			---	---	---	---
GHR	2690	broad.mit.edu	37	5	42509830	42509830	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42509830delT	uc003jmt.2	+						uc003jmu.2_Intron	NM_000163	NP_000154			growth hormone receptor precursor						2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)													---	---	---	---
MGC42105	167359	broad.mit.edu	37	5	43277847	43277848	+	Intron	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43277847_43277848delTC	uc003jno.2	+							NM_153361	NP_699192			serine/threonine-protein kinase NIM1								ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|stomach(1)|large_intestine(1)|breast(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	43586071	43586074	+	Intron	DEL	AAAC	-	-	rs10568881		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43586071_43586074delAAAC	uc003jod.1	-											Homo sapiens cDNA FLJ39349 fis, clone PEBLM1000071, moderately similar to Leptin receptor.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	44472178	44472178	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44472178delA								FGF10 (83394 upstream) : MRPS30 (336849 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	45203542	45203543	+	IGR	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45203542_45203543delAC								MRPS30 (387928 upstream) : HCN1 (55810 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	45827519	45827520	+	IGR	DEL	GT	-	-	rs67854366		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45827519_45827520delGT								HCN1 (131299 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	46194504	46194504	+	IGR	DEL	C	-	-	rs71000663		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46194504delC								HCN1 (498284 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	50340785	50340786	+	IGR	INS	-	T	T	rs151000729	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50340785_50340786insT								PARP8 (202616 upstream) : ISL1 (338172 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	51984531	51984531	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51984531delT								None (None upstream) : ITGA1 (99243 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	53171261	53171261	+	5'Flank	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53171261delA	uc003jpf.2	+											Homo sapiens cDNA clone IMAGE:4798845.																														---	---	---	---
ARL15	54622	broad.mit.edu	37	5	53501552	53501552	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53501552delG	uc003jpg.1	-						ARL15_uc010ivs.1_Intron	NM_019087	NP_061960			ADP-ribosylation factor-like 15								GTP binding			ovary(1)	1		Lung NSC(810;0.000779)																---	---	---	---
SLC38A9	153129	broad.mit.edu	37	5	54945329	54945330	+	Intron	INS	-	A	A	rs142108347	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54945329_54945330insA	uc003jqf.2	-						SLC38A9_uc003jqd.2_Intron|SLC38A9_uc010ivx.2_Intron|SLC38A9_uc003jqe.2_Intron|SLC38A9_uc010ivy.2_Intron	NM_173514	NP_775785			solute carrier family 38, member 9						amino acid transport|sodium ion transport	integral to membrane					0		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	55114392	55114393	+	IGR	INS	-	T	T	rs35998784		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55114392_55114393insT								DDX4 (1419 upstream) : IL31RA (32941 downstream)																																			---	---	---	---
IL31RA	133396	broad.mit.edu	37	5	55145950	55145951	+	5'Flank	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55145950_55145951insT	uc003jql.2	+						IL31RA_uc003jqk.2_5'Flank|IL31RA_uc011cqj.1_5'Flank|IL31RA_uc003jqm.2_5'Flank|IL31RA_uc003jqn.2_5'Flank	NM_139017	NP_620586			gp130-like monocyte receptor						anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity			ovary(1)	1		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)																---	---	---	---
ANKRD55	79722	broad.mit.edu	37	5	55413970	55413970	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55413970delA	uc003jqu.2	-						ANKRD55_uc003jqt.2_5'Flank	NM_024669	NP_078945			ankyrin repeat domain 55 isoform 1											skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	55725031	55725031	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55725031delT								ANKRD55 (195845 upstream) : MAP3K1 (385869 downstream)																																			---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58313489	58313489	+	Intron	DEL	C	-	-	rs5868151		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58313489delC	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jrt.2_Intron|PDE4D_uc003jru.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc010iwi.1_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58622559	58622559	+	Intron	DEL	A	-	-	rs139304192		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58622559delA	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron|PDE4D_uc003jrw.2_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	61218472	61218472	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61218472delT								FLJ37543 (216110 upstream) : KIF2A (383517 downstream)																																			---	---	---	---
IPO11	51194	broad.mit.edu	37	5	61821184	61821184	+	Intron	DEL	T	-	-	rs113596556		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61821184delT	uc003jtc.2	+						IPO11_uc011cqr.1_Intron|IPO11_uc003jtd.1_Intron|IPO11_uc010iwr.2_Intron	NM_016338	NP_057422			Ran binding protein 11 isoform 2							cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)														---	---	---	---
ADAMTS6	11174	broad.mit.edu	37	5	64677193	64677193	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64677193delT	uc003jtp.2	-						ADAMTS6_uc003jto.2_Intron|ADAMTS6_uc003jtq.2_Intron|ADAMTS6_uc003jtr.1_Intron	NM_197941	NP_922932			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	67019757	67019757	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67019757delT								CD180 (527140 upstream) : PIK3R1 (491847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	67186390	67186390	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67186390delC								CD180 (693773 upstream) : PIK3R1 (325214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	67480850	67480851	+	IGR	INS	-	A	A	rs72326412		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67480850_67480851insA								CD180 (988233 upstream) : PIK3R1 (30753 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	68180795	68180795	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68180795delA								PIK3R1 (583148 upstream) : SLC30A5 (209023 downstream)																																			---	---	---	---
CDK7	1022	broad.mit.edu	37	5	68545386	68545387	+	Intron	INS	-	A	A	rs142502587	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68545386_68545387insA	uc003jvs.3	+						CDK7_uc010ixd.1_Intron|CDK7_uc003jvt.3_Intron|CDK7_uc003jvu.3_Intron	NM_001799	NP_001790			cyclin-dependent kinase 7						androgen receptor signaling pathway|cell division|cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex|mitochondrion	androgen receptor binding|ATP binding|cyclin-dependent protein kinase activity|DNA-dependent ATPase activity|protein C-terminus binding|RNA polymerase II carboxy-terminal domain kinase activity|transcription coactivator activity			lung(1)	1		Lung NSC(167;7.26e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.98e-56)|Epithelial(20;3.54e-52)|all cancers(19;9.11e-48)|Lung(70;0.0185)									NER					---	---	---	---
Unknown	0	broad.mit.edu	37	5	71904433	71904434	+	IGR	DEL	AC	-	-	rs111714581		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71904433_71904434delAC								ZNF366 (101184 upstream) : TNPO1 (207984 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	72105961	72105961	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72105961delT								ZNF366 (302712 upstream) : TNPO1 (6457 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	73327589	73327589	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73327589delT								RGNEF (90176 upstream) : ENC1 (595646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	74341757	74341758	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74341757_74341758insT								GCNT4 (15033 upstream) : ANKRD31 (101304 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	74576858	74576859	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74576858_74576859insA								ANKRD31 (44155 upstream) : HMGCR (55295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	75671127	75671143	+	IGR	DEL	TCCAGGCCCACTGTTGT	-	-	rs142227385		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75671127_75671143delTCCAGGCCCACTGTTGT								SV2C (49711 upstream) : IQGAP2 (28006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	77148700	77148701	+	IGR	DEL	CA	-	-	rs35170907		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77148700_77148701delCA								TBCA (76515 upstream) : AP3B1 (149450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	79583197	79583197	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79583197delA								SERINC5 (31327 upstream) : LOC644936 (11722 downstream)																																			---	---	---	---
RASGRF2	5924	broad.mit.edu	37	5	80436809	80436810	+	Intron	INS	-	T	T	rs150145022		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80436809_80436810insT	uc003kha.1	+						RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840			Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)														---	---	---	---
ATG10	83734	broad.mit.edu	37	5	81337621	81337622	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81337621_81337622insT	uc003khs.2	+						ATG10_uc003khq.2_Intron|ATG10_uc003khr.2_Intron|ATG10_uc010jas.2_Intron	NM_001131028	NP_001124500			APG10 autophagy 10-like						autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	82710939	82710939	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82710939delT								XRCC4 (61362 upstream) : VCAN (56554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	83151645	83151645	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83151645delG								HAPLN1 (134749 upstream) : EDIL3 (86481 downstream)																																			---	---	---	---
EDIL3	10085	broad.mit.edu	37	5	83527390	83527391	+	Intron	INS	-	CATCTG	CATCTG	rs147570556	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83527390_83527391insCATCTG	uc003kio.1	-						EDIL3_uc003kip.1_Intron	NM_005711	NP_005702			EGF-like repeats and discoidin I-like						cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	84092823	84092823	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84092823delA								EDIL3 (412212 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	84971422	84971422	+	IGR	DEL	T	-	-	rs71607764		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84971422delT								None (None upstream) : NBPF22P (606840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	87452207	87452210	+	IGR	DEL	TGTG	-	-	rs34265838		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87452207_87452210delTGTG								CCNH (743371 upstream) : TMEM161B (38814 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	88451374	88451374	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88451374delT								MEF2C (251505 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	88763426	88763426	+	IGR	DEL	A	-	-	rs68135458		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88763426delA								MEF2C (563557 upstream) : CETN3 (926105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	92022299	92022299	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92022299delA								None (None upstream) : FLJ42709 (722766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	92940465	92940468	+	IGR	DEL	TCCC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92940465_92940468delTCCC								NR2F1 (10687 upstream) : FAM172A (12964 downstream)																																			---	---	---	---
FAM172A	83989	broad.mit.edu	37	5	93275661	93275662	+	Intron	DEL	TT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93275661_93275662delTT	uc010jbd.2	-						FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron|FAM172A_uc003kkm.3_Intron	NM_032042	NP_114431			hypothetical protein LOC83989 isoform 1							endoplasmic reticulum|extracellular region					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	95781883	95781884	+	IGR	INS	-	A	A	rs34333349		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95781883_95781884insA								PCSK1 (12931 upstream) : CAST (215893 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	99417113	99417114	+	IGR	DEL	TG	-	-	rs71710180		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99417113_99417114delTG								None (None upstream) : LOC100133050 (298095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	104855643	104855644	+	IGR	INS	-	A	A	rs150086539	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:104855643_104855644insA								RAB9BP1 (419845 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	105045076	105045077	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105045076_105045077insT								RAB9BP1 (609278 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	105580649	105580650	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105580649_105580650delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	105767533	105767533	+	IGR	DEL	A	-	-	rs72790764	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105767533delA								None (None upstream) : EFNA5 (945058 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	106296483	106296484	+	IGR	INS	-	A	A	rs144236269	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106296483_106296484insA								None (None upstream) : EFNA5 (416107 downstream)																																			---	---	---	---
TMEM232	642987	broad.mit.edu	37	5	109650311	109650311	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109650311delA	uc003kov.1	-											Homo sapiens cDNA FLJ35903 fis, clone TESTI2009585.							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	114975948	114975953	+	IGR	DEL	GTGTGC	-	-	rs147936935		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114975948_114975953delGTGTGC								TMED7-TICAM2 (14078 upstream) : CDO1 (164479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	117067722	117067723	+	IGR	DEL	TG	-	-	rs66958828		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117067722_117067723delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	117519932	117519933	+	IGR	INS	-	T	T	rs148025179	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117519932_117519933insT								None (None upstream) : DTWD2 (652638 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	119193717	119193718	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:119193717_119193718insT								FAM170A (222201 upstream) : PRR16 (606301 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	119518537	119518538	+	IGR	DEL	AG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:119518537_119518538delAG								FAM170A (547021 upstream) : PRR16 (281481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	121092794	121092795	+	IGR	DEL	AC	-	-	rs112246942	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121092794_121092795delAC								None (None upstream) : FTMT (94855 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	123104441	123104441	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123104441delT								CSNK1G3 (151979 upstream) : ZNF608 (868169 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	123907411	123907411	+	IGR	DEL	T	-	-	rs11292919		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123907411delT								CSNK1G3 (954949 upstream) : ZNF608 (65199 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	125171212	125171213	+	IGR	INS	-	TT	TT	rs140831411	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125171212_125171213insTT								None (None upstream) : GRAMD3 (524575 downstream)																																	OREG0016749	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PHAX	51808	broad.mit.edu	37	5	125938921	125938922	+	Intron	INS	-	A	A	rs112769671		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125938921_125938922insA	uc003kua.1	+							NM_032177	NP_115553			RNA U, small nuclear RNA export adaptor						ncRNA metabolic process|protein transport|snRNA export from nucleus|spliceosomal snRNP assembly	Cajal body|cytosol	RNA binding				0																		---	---	---	---
SLC27A6	28965	broad.mit.edu	37	5	128301215	128301215	+	5'UTR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128301215delG	uc003kuy.2	+	1					SLC27A6_uc003kuz.2_5'UTR	NM_014031	NP_054750			solute carrier family 27 (fatty acid						long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	130089843	130089844	+	IGR	DEL	TT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130089843_130089844delTT								CHSY3 (567517 upstream) : HINT1 (405031 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	130466607	130466607	+	IGR	DEL	A	-	-	rs145310143		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130466607delA								CHSY3 (944281 upstream) : HINT1 (28268 downstream)																																			---	---	---	---
RAPGEF6	51735	broad.mit.edu	37	5	130835297	130835297	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130835297delG	uc003kvn.1	-						RAPGEF6_uc003kvp.1_Intron|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Intron|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvq.2_Intron|RAPGEF6_uc003kvr.2_Intron|RAPGEF6_uc011cxe.1_Intron|RAPGEF6_uc010jdk.2_Intron	NM_016340	NP_057424			PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)														---	---	---	---
RAPGEF6	51735	broad.mit.edu	37	5	130935197	130935198	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130935197_130935198delAC	uc003kvn.1	-						RAPGEF6_uc003kvp.1_Intron|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Intron|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvr.2_Intron|RAPGEF6_uc011cxe.1_Intron|RAPGEF6_uc010jdk.2_Intron	NM_016340	NP_057424			PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)														---	---	---	---
ACSL6	23305	broad.mit.edu	37	5	131259748	131259748	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131259748delA	uc003kvv.1	-							NM_015256				acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
FSTL4	23105	broad.mit.edu	37	5	132885322	132885323	+	Intron	DEL	TG	-	-	rs77059843		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132885322_132885323delTG	uc003kyn.1	-							NM_015082	NP_055897			follistatin-like 4 precursor							extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	133016620	133016621	+	IGR	DEL	CA	-	-	rs10532102		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133016620_133016621delCA								FSTL4 (68397 upstream) : C5orf15 (274578 downstream)																																			---	---	---	---
SPOCK1	6695	broad.mit.edu	37	5	136423730	136423730	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136423730delA	uc003lbo.2	-						SPOCK1_uc003lbp.2_Intron	NM_004598	NP_004589			sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
KLHL3	26249	broad.mit.edu	37	5	136956922	136956926	+	3'UTR	DEL	TTTTG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136956922_136956926delTTTTG	uc010jek.2	-	15					KLHL3_uc011cyc.1_3'UTR|KLHL3_uc003lbr.3_3'UTR|KLHL3_uc011cyd.1_RNA	NM_017415	NP_059111			kelch-like 3							cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)														---	---	---	---
KLHL3	26249	broad.mit.edu	37	5	137009531	137009532	+	Intron	INS	-	AGT	AGT	rs142079310		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137009531_137009532insAGT	uc010jek.2	-						KLHL3_uc011cyc.1_5'Flank|KLHL3_uc003lbr.3_Intron|KLHL3_uc011cyd.1_Intron|KLHL3_uc010jel.1_5'UTR|KLHL3_uc010jem.1_Intron|KLHL3_uc010jen.1_Intron|KLHL3_uc003lbs.1_Intron	NM_017415	NP_059111			kelch-like 3							cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)														---	---	---	---
UBE2D2	7322	broad.mit.edu	37	5	138949871	138949872	+	Intron	INS	-	G	G			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138949871_138949872insG	uc003ler.2	+						UBE2D2_uc003leq.2_Intron	NM_003339	NP_003330			ubiquitin-conjugating enzyme E2D 2 isoform 1						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|protein binding|ubiquitin-protein ligase activity			central_nervous_system(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
UBE2D2	7322	broad.mit.edu	37	5	138970711	138970712	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138970711_138970712insT	uc003ler.2	+						UBE2D2_uc003leq.2_Intron	NM_003339	NP_003330			ubiquitin-conjugating enzyme E2D 2 isoform 1						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|protein binding|ubiquitin-protein ligase activity			central_nervous_system(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	141209629	141209643	+	IGR	DEL	TTTTTTTTTTTTTTT	-	-	rs67440579		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141209629_141209643delTTTTTTTTTTTTTTT								ARAP3 (147829 upstream) : PCDH1 (23040 downstream)																																			---	---	---	---
KIAA0141	9812	broad.mit.edu	37	5	141313480	141313481	+	Intron	INS	-	C	C	rs75485408		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141313480_141313481insC	uc003lls.2	+						KIAA0141_uc003llt.2_Intron|KIAA0141_uc003llu.1_5'Flank	NM_001142603	NP_001136075			hypothetical protein LOC9812 precursor						apoptosis|regulation of caspase activity	mitochondrion	protein binding			skin(1)	1		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	141414694	141414695	+	IGR	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141414694_141414695delTC								GNPDA1 (22074 upstream) : NDFIP1 (73629 downstream)																																			---	---	---	---
ARHGAP26	23092	broad.mit.edu	37	5	142364487	142364488	+	Intron	INS	-	A	A	rs139936967	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142364487_142364488insA	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886			GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	142960527	142960528	+	IGR	INS	-	AAG	AAG	rs144787126	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142960527_142960528insAAG								NR3C1 (145450 upstream) : HMHB1 (231198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	145693294	145693297	+	IGR	DEL	AAGA	-	-	rs68123907		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145693294_145693297delAAGA								RBM27 (24512 upstream) : POU4F3 (25290 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	145742601	145742602	+	IGR	INS	-	AAAACA	AAAACA	rs147342869	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145742601_145742602insAAAACA								POU4F3 (22518 upstream) : TCERG1 (84271 downstream)																																			---	---	---	---
PPP2R2B	5521	broad.mit.edu	37	5	146371256	146371256	+	Intron	DEL	A	-	-	rs77378010		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146371256delA	uc011dbv.1	-						PPP2R2B_uc003loi.3_Intron|PPP2R2B_uc003loh.3_Intron|PPP2R2B_uc003loj.3_Intron|PPP2R2B_uc003lok.3_Intron|PPP2R2B_uc011dbu.1_Intron	NM_181675	NP_858061			beta isoform of regulatory subunit B55, protein						apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
PDE6A	5145	broad.mit.edu	37	5	149303064	149303064	+	Intron	DEL	T	-	-	rs74856164		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149303064delT	uc003lrg.3	-							NM_000440	NP_000431			phosphodiesterase 6A						cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	150479693	150479693	+	IGR	DEL	A	-	-	rs5872190		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150479693delA								TNIP1 (12974 upstream) : ANXA6 (575 downstream)																																			---	---	---	---
CCDC69	26112	broad.mit.edu	37	5	150605082	150605082	+	5'Flank	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150605082delT	uc003ltq.2	-						CCDC69_uc010jhu.2_5'Flank	NM_015621	NP_056436			coiled-coil domain containing 69											ovary(2)	2		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
GLRA1	2741	broad.mit.edu	37	5	151292803	151292803	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151292803delA	uc003lut.2	-						GLRA1_uc003lur.2_Intron|GLRA1_uc003lus.2_Intron	NM_001146040	NP_001139512			glycine receptor, alpha 1 isoform 1 precursor						muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	151750635	151750635	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151750635delT								GLRA1 (446238 upstream) : NMUR2 (20467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	152605960	152605960	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152605960delT								NMUR2 (821120 upstream) : GRIA1 (263215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	153823112	153823113	+	Intron	INS	-	CA	CA	rs148886327	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153823112_153823113insCA	uc003lvi.2	-						SAP30L_uc003lvm.3_5'Flank|SAP30L_uc003lvk.2_5'Flank|SAP30L_uc011ddc.1_5'Flank|SAP30L_uc011ddd.1_5'Flank					Homo sapiens cDNA FLJ38109 fis, clone D3OST2001788.																														---	---	---	---
LARP1	23367	broad.mit.edu	37	5	154143043	154143044	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154143043_154143044insT	uc003lvp.2	+						LARP1_uc003lvo.2_Intron|LARP1_uc010jie.1_Intron	NM_033551	NP_291029			la related protein isoform 2								protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	154504379	154504380	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154504379_154504380insA								KIF4B (106694 upstream) : SGCD (630683 downstream)																																			---	---	---	---
SGCD	6444	broad.mit.edu	37	5	155397030	155397031	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155397030_155397031delAC	uc003lwa.1	+							NM_172244	NP_758447			delta-sarcoglycan isoform 2						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	157045844	157045844	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157045844delA								ADAM19 (43076 upstream) : SOX30 (6843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	157341661	157341661	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157341661delC								CLINT1 (55493 upstream) : EBF1 (781263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	157666832	157666832	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157666832delA								CLINT1 (380664 upstream) : EBF1 (456092 downstream)																																			---	---	---	---
EBF1	1879	broad.mit.edu	37	5	158381780	158381780	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158381780delG	uc010jip.2	-						EBF1_uc011ddw.1_Intron|EBF1_uc011ddx.1_Intron|EBF1_uc003lxl.3_Intron	NM_024007	NP_076870			early B-cell factor						multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)					T	HMGA2	lipoma								---	---	---	---
RNF145	153830	broad.mit.edu	37	5	158639846	158639846	+	5'Flank	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158639846delA	uc010jiq.1	-							NM_144726	NP_653327			ring finger protein 145							integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	159931582	159931583	+	IGR	INS	-	GT	GT	rs139288859	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159931582_159931583insGT								MIR146A (19125 upstream) : ATP10B (58544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	164033777	164033777	+	IGR	DEL	T	-	-	rs111335720		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164033777delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	165750487	165750487	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165750487delA								None (None upstream) : ODZ2 (961356 downstream)																																			---	---	---	---
ODZ2	57451	broad.mit.edu	37	5	167496075	167496075	+	Intron	DEL	A	-	-	rs33917157		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167496075delA	uc010jjd.2	+						ODZ2_uc003lzq.2_Intron|ODZ2_uc003lzr.3_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)														---	---	---	---
WWC1	23286	broad.mit.edu	37	5	167827825	167827826	+	Intron	DEL	GA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167827825_167827826delGA	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron	NM_015238	NP_056053			WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)														---	---	---	---
SLIT3	6586	broad.mit.edu	37	5	168264896	168264896	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168264896delT	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron|SLIT3_uc003mac.1_Intron	NM_003062	NP_003053			slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
SLIT3	6586	broad.mit.edu	37	5	168268605	168268608	+	Intron	DEL	CATA	-	-	rs147709397		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168268605_168268608delCATA	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron|SLIT3_uc003mac.1_Intron	NM_003062	NP_003053			slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
SLIT3	6586	broad.mit.edu	37	5	168426198	168426199	+	Intron	INS	-	GT	GT	rs142802347	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168426198_168426199insGT	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053			slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	170275195	170275196	+	IGR	INS	-	A	A	rs141384099		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170275195_170275196insA								GABRP (34147 upstream) : RANBP17 (13826 downstream)																																			---	---	---	---
RANBP17	64901	broad.mit.edu	37	5	170687622	170687622	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170687622delA	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048			RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)					T	TRD@	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	5	171033660	171033661	+	IGR	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171033660_171033661delAC								FGF18 (149498 upstream) : FBXW11 (254895 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	171241632	171241632	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171241632delT								FGF18 (357470 upstream) : FBXW11 (46924 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	171275949	171275949	+	IGR	DEL	T	-	-	rs66817605		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171275949delT								FGF18 (391787 upstream) : FBXW11 (12607 downstream)																																			---	---	---	---
NEURL1B	54492	broad.mit.edu	37	5	172114268	172114269	+	3'UTR	INS	-	GGGA	GGGA	rs150190348	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172114268_172114269insGGGA	uc003mbt.2	+	5						NM_001142651	NP_001136123			neuralized homolog 1B								ligase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	173702743	173702744	+	IGR	INS	-	T	T	rs145636667		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173702743_173702744insT								HMP19 (166562 upstream) : MSX2 (448831 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174379993	174379993	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174379993delA								MSX2 (222092 upstream) : DRD1 (487683 downstream)																																			---	---	---	---
HRH2	3274	broad.mit.edu	37	5	175103225	175103225	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175103225delT	uc003mdc.3	+							NM_001131055	NP_001124527			histamine receptor H2 isoform 1						G-protein signaling, coupled to cyclic nucleotide second messenger|immune response	integral to plasma membrane	histamine receptor activity			ovary(1)	1	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Nizatidine(DB00585)|Ranitidine(DB00863)													---	---	---	---
ZNF346	23567	broad.mit.edu	37	5	176486611	176486612	+	Intron	INS	-	CCC	CCC	rs138679920		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176486611_176486612insCCC	uc003mfi.2	+						ZNF346_uc011dfr.1_Intron|ZNF346_uc011dfs.1_Intron|ZNF346_uc003mfj.2_Intron|ZNF346_uc003mfk.1_Intron|ZNF346_uc011dft.1_Intron	NM_012279	NP_036411			zinc finger protein 346							cytoplasm|nucleolus	double-stranded RNA binding|zinc ion binding				0	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
ZNF346	23567	broad.mit.edu	37	5	176487837	176487838	+	Intron	INS	-	C	C	rs139817348		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176487837_176487838insC	uc003mfi.2	+						ZNF346_uc011dfr.1_Intron|ZNF346_uc011dfs.1_Intron|ZNF346_uc003mfj.2_Intron|ZNF346_uc003mfk.1_Intron|ZNF346_uc011dft.1_Intron	NM_012279	NP_036411			zinc finger protein 346							cytoplasm|nucleolus	double-stranded RNA binding|zinc ion binding				0	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	177671148	177671149	+	Intron	DEL	TT	-	-	rs66645220		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177671148_177671149delTT	uc003mje.2	-						COL23A1_uc010jkt.2_Intron	NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	177681281	177681282	+	Intron	INS	-	CGT	CGT	rs140409132	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177681281_177681282insCGT	uc003mje.2	-						COL23A1_uc010jkt.2_Intron	NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	177709054	177709054	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177709054delA	uc003mje.2	-							NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
LOC285768	285768	broad.mit.edu	37	6	981634	981635	+	Intron	DEL	TT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:981634_981635delTT	uc011dhp.1	-						LOC285768_uc010jnf.1_Intron|LOC285768_uc003mtj.2_Intron	NR_027115				Homo sapiens cDNA clone IMAGE:5272115.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	1587533	1587536	+	IGR	DEL	TGTA	-	-	rs113281678		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1587533_1587536delTGTA								FOXF2 (191702 upstream) : FOXC1 (23145 downstream)																																			---	---	---	---
GMDS	2762	broad.mit.edu	37	6	2202032	2202032	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2202032delT	uc003mtq.2	-							NM_001500	NP_001491			GDP-mannose 4,6-dehydratase						'de novo' GDP-L-fucose biosynthetic process|GDP-mannose metabolic process|leukocyte cell-cell adhesion		coenzyme binding|GDP-mannose 4,6-dehydratase activity			central_nervous_system(1)	1	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	2861824	2861825	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2861824_2861825insA	uc003mud.2	-											Homo sapiens hypothetical protein MGC39372, mRNA (cDNA clone IMAGE:5089466), complete cds.																														---	---	---	---
C6orf146	222826	broad.mit.edu	37	6	4067019	4067020	+	Intron	INS	-	A	A	rs145405556	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4067019_4067020insA	uc010jnq.1	-											Homo sapiens cDNA FLJ40107 fis, clone TESTI2006677.											ovary(1)	1	Ovarian(93;0.0925)	all_hematologic(90;0.108)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	4428115	4428115	+	IGR	DEL	A	-	-	rs5873932		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4428115delA								PECI (292284 upstream) : CDYL (278278 downstream)																																			---	---	---	---
CDYL	9425	broad.mit.edu	37	6	4706661	4706661	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4706661delG	uc003mwi.2	+							NM_001143971	NP_001137443			chromodomain protein, Y chromosome-like isoform						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)														---	---	---	---
LOC285780	285780	broad.mit.edu	37	6	6507755	6507756	+	Intron	INS	-	AAGG	AAGG	rs142779234	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6507755_6507756insAAGG	uc003mww.3	-						LOC285780_uc003mwx.2_Intron	NR_026970				Homo sapiens cDNA FLJ33708 fis, clone BRAWH2007862.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	7073433	7073433	+	IGR	DEL	C	-	-	rs575187	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7073433delC								LY86 (418217 upstream) : RREB1 (34755 downstream)																																			---	---	---	---
TXNDC5	81567	broad.mit.edu	37	6	7898297	7898297	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7898297delT	uc003mxv.2	-						TXNDC5_uc003mxw.2_Intron|TXNDC5_uc010jnz.2_Intron|TXNDC5_uc010joa.1_Intron	NM_030810	NP_110437			thioredoxin domain containing 5 isoform 1						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)																	---	---	---	---
TXNDC5	81567	broad.mit.edu	37	6	8018361	8018361	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8018361delG	uc003mxw.2	-						MUTED_uc003mxy.2_Intron|MUTED_uc010joc.2_Intron|MUTED_uc010job.2_Intron	NM_001145549	NP_001139021			thioredoxin domain containing 5 isoform 3						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	9136869	9136870	+	IGR	INS	-	TG	TG	rs140621589	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9136869_9136870insTG								HULC (482792 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	10180343	10180344	+	Intron	DEL	TC	-	-	rs139133617		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10180343_10180344delTC	uc003myp.1	-											Homo sapiens clone 958LR MRDS1 protein (MRDS1) mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	10341749	10341749	+	IGR	DEL	A	-	-	rs76524820		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10341749delA								None (None upstream) : TFAP2A (55168 downstream)																																			---	---	---	---
GCNT2	2651	broad.mit.edu	37	6	10493942	10493942	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10493942delA	uc010jol.2	+						GCNT2_uc010jom.2_Intron					SubName: Full=Glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group); SubName: Full=Putative uncharacterized protein GCNT2;							Golgi membrane|integral to membrane	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)	2	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	16208293	16208293	+	IGR	DEL	A	-	-	rs75305085		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16208293delA								MYLIP (59817 upstream) : GMPR (30518 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	16802276	16802276	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16802276delA								ATXN1 (40555 upstream) : RBM24 (479533 downstream)																																			---	---	---	---
DEK	7913	broad.mit.edu	37	6	18247910	18247910	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18247910delT	uc003ncr.1	-						DEK_uc011djf.1_Intron|DEK_uc011djg.1_Intron	NM_003472	NP_003463			DEK oncogene isoform 1						chromatin modification|regulation of transcription from RNA polymerase II promoter|signal transduction|transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|histone binding			kidney(1)	1	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)					T	NUP214	AML								---	---	---	---
E2F3	1871	broad.mit.edu	37	6	20443551	20443552	+	Intron	DEL	AA	-	-	rs34874121		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20443551_20443552delAA	uc003nda.2	+						E2F3_uc003ncz.2_Intron	NM_001949	NP_001940			E2F transcription factor 3						G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|transcription initiation from RNA polymerase II promoter	transcription factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	21471473	21471473	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21471473delT								CDKAL1 (238841 upstream) : SOX4 (122499 downstream)																																			---	---	---	---
FLJ22536	401237	broad.mit.edu	37	6	22051689	22051689	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22051689delT	uc003ndj.2	+						FLJ22536_uc011djk.1_Intron|FLJ22536_uc003ndl.2_Intron	NR_015410				Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	23394252	23394253	+	IGR	INS	-	AGGA	AGGA	rs60995179		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23394252_23394253insAGGA								HDGFL1 (823503 upstream) : NRSN1 (732161 downstream)																																			---	---	---	---
DCDC2	51473	broad.mit.edu	37	6	24255599	24255600	+	Intron	DEL	AA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24255599_24255600delAA	uc003ndx.2	-						DCDC2_uc003ndy.2_Intron	NM_016356	NP_057440			doublecortin domain containing 2						cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)																---	---	---	---
ALDH5A1	7915	broad.mit.edu	37	6	24530235	24530236	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24530235_24530236insT	uc003neg.2	+						ALDH5A1_uc003nef.2_Intron	NM_001080	NP_001071			aldehyde dehydrogenase 5A1 isoform 2 precursor						acetate metabolic process|central nervous system development|galactosylceramide metabolic process|gamma-aminobutyric acid catabolic process|glucose metabolic process|glutamate metabolic process|glutamine metabolic process|glutathione metabolic process|glycerophospholipid metabolic process|neurotransmitter catabolic process|neurotransmitter secretion|protein homotetramerization|respiratory electron transport chain|short-chain fatty acid metabolic process|succinate metabolic process	mitochondrial matrix|soluble fraction	succinate-semialdehyde dehydrogenase activity				0					Chlormerodrin(DB00534)|NADH(DB00157)|Succinic acid(DB00139)													---	---	---	---
FAM65B	9750	broad.mit.edu	37	6	24843927	24843930	+	Intron	DEL	GTGT	-	-	rs34540028		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24843927_24843930delGTGT	uc003neo.1	-						FAM65B_uc011djs.1_Intron|FAM65B_uc011dju.1_Intron|FAM65B_uc003nep.2_Intron|FAM65B_uc011djt.1_Intron	NM_014722	NP_055537			hypothetical protein LOC9750 isoform 1						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	25060060	25060062	+	IGR	DEL	AAC	-	-	rs67430280		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25060060_25060062delAAC								FAM65B (17662 upstream) : CMAH (21235 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	30563266	30563266	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30563266delA								ABCF1 (3959 upstream) : PPP1R10 (4916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	30789966	30789967	+	Intron	INS	-	AC	AC	rs144349350		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30789966_30789967insAC	uc003nrp.1	-											RecName: Full=Putative uncharacterized protein C6orf214;																														---	---	---	---
HLA-B	3106	broad.mit.edu	37	6	31324372	31324373	+	Intron	DEL	GA	-	-	rs71955092		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31324372_31324373delGA	uc003nth.2	-						HLA-C_uc003ntb.2_5'Flank|HLA-C_uc003ntc.1_5'Flank|HLA-B_uc010jsm.1_5'Flank|HLA-B_uc011dnk.1_5'Flank|HLA-B_uc003ntf.2_Intron|HLA-B_uc003ntg.1_5'UTR|HLA-B_uc003nti.1_5'Flank|HLA-B_uc010jsn.1_5'Flank|HLA-B_uc010jso.2_Intron	NM_005514	NP_005505			major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0														Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				---	---	---	---
HSPA1L	3305	broad.mit.edu	37	6	31783185	31783185	+	5'Flank	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31783185delG	uc003nxh.2	-						HSPA1L_uc010jte.2_Intron|HSPA1A_uc003nxj.2_5'Flank|HSPA1A_uc011doj.1_5'Flank|HSPA1A_uc003nxi.1_5'Flank	NM_005527	NP_005518			heat shock 70kDa protein 1-like						response to unfolded protein		ATP binding			ovary(3)|pleura(1)|kidney(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	32213117	32213118	+	IGR	INS	-	TAA	TAA	rs151099271	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32213117_32213118insTAA								NOTCH4 (21273 upstream) : C6orf10 (43185 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	32660301	32660302	+	IGR	DEL	AC	-	-	rs35608544		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32660301_32660302delAC								HLA-DQB1 (25835 upstream) : HLA-DQA2 (48861 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	32686573	32686574	+	IGR	INS	-	AAGA	AAGA	rs144984744	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32686573_32686574insAAGA								HLA-DQB1 (52107 upstream) : HLA-DQA2 (22589 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	33332334	33332335	+	IGR	DEL	TT	-	-	rs11350357		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33332334_33332335delTT								DAXX (41541 upstream) : LYPLA2P1 (180 downstream)																																			---	---	---	---
HMGA1	3159	broad.mit.edu	37	6	34207474	34207475	+	Intron	INS	-	AA	AA	rs75359838		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34207474_34207475insAA	uc003oit.2	+						HMGA1_uc011dso.1_Intron|HMGA1_uc003oiv.2_Intron|HMGA1_uc003oiw.2_Intron|HMGA1_uc003oiu.2_Intron|HMGA1_uc003oiy.2_Intron|HMGA1_uc003oiz.2_Intron|HMGA1_uc003oja.2_Intron|HMGA1_uc003oix.2_Intron|HMGA1_uc010jvl.2_Intron|HMGA1_uc003ojc.2_Intron|HMGA1_uc011dsp.1_Intron|HMGA1_uc003ojd.2_5'Flank	NM_145899	NP_665906			high mobility group AT-hook 1 isoform a						DNA unwinding involved in replication|initiation of viral infection|interspecies interaction between organisms|loss of chromatin silencing|nucleosome disassembly|protein complex assembly|provirus integration	chromatin|cytosol|transcription factor complex	AT DNA binding|enzyme binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|protein binding|retinoid X receptor binding|sequence-specific DNA binding transcription factor activity				0								T	?	microfollicular thyroid adenoma| various benign mesenchymal tumors,								---	---	---	---
PNPLA1	285848	broad.mit.edu	37	6	36222360	36222360	+	Intron	DEL	A	-	-	rs34826596		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36222360delA	uc010jwe.1	+						PNPLA1_uc003olw.1_Intron	NM_001145716	NP_001139188			patatin-like phospholipase domain containing 1						lipid catabolic process		hydrolase activity			large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	37307806	37307807	+	IGR	DEL	AC	-	-	rs149092089		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37307806_37307807delAC								TBC1D22B (7061 upstream) : RNF8 (13941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37520466	37520473	+	IGR	DEL	TCCCTCCC	-	-	rs12665287	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37520466_37520473delTCCCTCCC								C6orf129 (52766 upstream) : MDGA1 (79811 downstream)																																			---	---	---	---
DAAM2	23500	broad.mit.edu	37	6	39780923	39780924	+	Intron	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39780923_39780924delTG	uc003oow.2	+						DAAM2_uc010jxc.2_Intron|DAAM2_uc003oox.2_Intron|DAAM2_uc003oov.3_Intron	NM_015345	NP_056160			dishevelled associated activator of						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)																	---	---	---	---
DAAM2	23500	broad.mit.edu	37	6	39812148	39812149	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39812148_39812149delAC	uc003oow.2	+						DAAM2_uc010jxc.2_Intron|DAAM2_uc003oox.2_Intron|DAAM2_uc003oov.3_Intron	NM_015345	NP_056160			dishevelled associated activator of						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)																	---	---	---	---
DAAM2	23500	broad.mit.edu	37	6	39813148	39813150	+	Intron	DEL	ATA	-	-	rs146859904		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39813148_39813150delATA	uc003oow.2	+						DAAM2_uc010jxc.2_Intron|DAAM2_uc003oox.2_Intron|DAAM2_uc003oov.3_Intron	NM_015345	NP_056160			dishevelled associated activator of						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	43262162	43262164	+	IGR	DEL	ATT	-	-	rs138311262		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43262162_43262164delATT								TTBK1 (6165 upstream) : SLC22A7 (3834 downstream)																																			---	---	---	---
CLIC5	53405	broad.mit.edu	37	6	45876778	45876778	+	Intron	DEL	T	-	-	rs112595867		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45876778delT	uc003oxv.3	-						CLIC5_uc003oxu.3_Intron	NM_001114086	NP_001107558			chloride intracellular channel 5 isoform a						female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2																		---	---	---	---
RCAN2	10231	broad.mit.edu	37	6	46199150	46199150	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46199150delT	uc003oyb.1	-						RCAN2_uc003oyc.1_Intron|RCAN2_uc003oyd.1_Intron	NM_005822	NP_005813			Down syndrome critical region gene 1-like 1						calcium-mediated signaling|central nervous system development		nucleotide binding|protein phosphatase 2B binding				0																		---	---	---	---
GPR116	221395	broad.mit.edu	37	6	46881237	46881237	+	Intron	DEL	A	-	-	rs35172164		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46881237delA	uc003oyo.3	-						GPR116_uc003oyp.3_Intron|GPR116_uc003oyq.3_Intron|GPR116_uc003oyr.2_Intron	NM_001098518	NP_001091988			G-protein coupled receptor 116 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)															---	---	---	---
GPR115	221393	broad.mit.edu	37	6	47662280	47662280	+	Intron	DEL	C	-	-	rs11293482		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47662280delC	uc003oyz.1	+						GPR111_uc003oyy.2_Intron	NM_153838	NP_722580			G-protein coupled receptor 115 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8																		---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51879495	51879498	+	Intron	DEL	GATA	-	-	rs71809241	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51879495_51879498delGATA	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639			fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	51977172	51977172	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51977172delT								PKHD1 (24749 upstream) : MIR206 (31975 downstream)																																			---	---	---	---
MCM3	4172	broad.mit.edu	37	6	52150192	52150193	+	5'Flank	INS	-	A	A	rs147089738	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52150192_52150193insA	uc003pan.1	-						MCM3_uc011dwu.1_5'Flank	NM_002388	NP_002379			minichromosome maintenance complex component 3						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	alpha DNA polymerase:primase complex|centrosome|MCM complex|perinuclear region of cytoplasm	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)|lung(1)|skin(1)	3	Lung NSC(77;0.0931)																	---	---	---	---
ICK	22858	broad.mit.edu	37	6	52887735	52887736	+	Intron	INS	-	T	T	rs146212761		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52887735_52887736insT	uc003pbh.2	-						ICK_uc003pbi.2_Intron|ICK_uc003pbj.2_Intron	NM_016513	NP_057597			intestinal cell kinase						intracellular protein kinase cascade|multicellular organismal development	cytosol|nucleus	ATP binding|cyclin-dependent protein kinase activity|magnesium ion binding			ovary(1)|large_intestine(1)|lung(1)|kidney(1)|central_nervous_system(1)	5	Lung NSC(77;0.103)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	53060099	53060099	+	IGR	DEL	T	-	-	rs112631553		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53060099delT								GCM1 (46475 upstream) : ELOVL5 (72097 downstream)																																			---	---	---	---
COL21A1	81578	broad.mit.edu	37	6	55995457	55995457	+	Intron	DEL	A	-	-	rs71808256		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55995457delA	uc003pcs.2	-						COL21A1_uc003pct.1_Intron|COL21A1_uc011dxi.1_Intron|COL21A1_uc003pcu.1_Intron	NM_030820	NP_110447			collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)															---	---	---	---
COL21A1	81578	broad.mit.edu	37	6	56004492	56004492	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56004492delG	uc003pcs.2	-						COL21A1_uc003pct.1_Intron|COL21A1_uc011dxi.1_Intron|COL21A1_uc003pcu.1_Intron	NM_030820	NP_110447			collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)															---	---	---	---
BEND6	221336	broad.mit.edu	37	6	56829307	56829307	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56829307delT	uc010kab.2	+						BEND6_uc003pdg.2_Intron	NM_152731	NP_689944			BEN domain containing 6												0																		---	---	---	---
ZNF451	26036	broad.mit.edu	37	6	57031981	57031982	+	Intron	DEL	AC	-	-	rs74345588	byFrequency;by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57031981_57031982delAC	uc003pdm.1	+						ZNF451_uc003pdn.1_Intron|uc003pdq.1_Intron	NM_001031623	NP_001026794			zinc finger protein 451 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)															---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57238018	57238019	+	Intron	INS	-	GA	GA	rs149497221		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57238018_57238019insGA	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57325208	57325209	+	Intron	INS	-	T	T	rs139197745	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57325208_57325209insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57340797	57340798	+	Intron	INS	-	TGT	TGT	rs112489174		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57340797_57340798insTGT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57359669	57359670	+	Intron	INS	-	AATATTA	AATATTA	rs142753141	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57359669_57359670insAATATTA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57373241	57373241	+	Intron	DEL	A	-	-	rs67451303		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57373241delA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57375548	57375549	+	Intron	INS	-	TTA	TTA	rs150899802		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57375548_57375549insTTA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57404193	57404193	+	Intron	DEL	T	-	-	rs11331163		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57404193delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57432144	57432145	+	Intron	INS	-	T	T	rs11435895		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57432144_57432145insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57464582	57464583	+	Intron	DEL	TG	-	-	rs141821542		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57464582_57464583delTG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57509525	57509525	+	Intron	DEL	T	-	-	rs11307740		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57509525delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57515066	57515070	+	IGR	DEL	TGTCA	-	-	rs138941800		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57515066_57515070delTGTCA								PRIM2 (1691 upstream) : GUSBL2 (731089 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57552362	57552363	+	IGR	INS	-	TTA	TTA	rs145796484	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57552362_57552363insTTA								PRIM2 (38987 upstream) : GUSBL2 (693796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57553541	57553542	+	IGR	DEL	AG	-	-	rs113085434		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57553541_57553542delAG								PRIM2 (40166 upstream) : GUSBL2 (692617 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57561998	57561998	+	IGR	DEL	A	-	-	rs111734895		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57561998delA								PRIM2 (48623 upstream) : GUSBL2 (684161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57608402	57608403	+	IGR	INS	-	GGA	GGA	rs146024593	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57608402_57608403insGGA								PRIM2 (95027 upstream) : GUSBL2 (637756 downstream)																																			---	---	---	---
KHDRBS2	202559	broad.mit.edu	37	6	62507631	62507632	+	Intron	DEL	TG	-	-	rs71744843		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62507631_62507632delTG	uc003peg.2	-							NM_152688	NP_689901			KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)														---	---	---	---
EYS	346007	broad.mit.edu	37	6	64582205	64582206	+	Intron	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64582205_64582206delGT	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	64794178	64794180	+	Intron	DEL	TTG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64794178_64794180delTTG	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	66164458	66164458	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66164458delA	uc011dxu.1	-						EYS_uc003peq.2_Intron|EYS_uc003per.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	66298457	66298457	+	Intron	DEL	T	-	-	rs35933552		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66298457delT	uc011dxu.1	-						EYS_uc003peq.2_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	68855988	68855989	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:68855988_68855989delTG								None (None upstream) : BAI3 (489643 downstream)																																			---	---	---	---
BAI3	577	broad.mit.edu	37	6	69394189	69394189	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69394189delT	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695			brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
MYO6	4646	broad.mit.edu	37	6	76470468	76470468	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76470468delT	uc003pih.1	+						MYO6_uc003pig.1_Intron	NM_004999	NP_004990			myosin VI						actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	77832736	77832736	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77832736delA								None (None upstream) : HTR1B (339212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	79198568	79198568	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79198568delA								None (None upstream) : IRAK1BP1 (378621 downstream)																																			---	---	---	---
PHIP	55023	broad.mit.edu	37	6	79761637	79761638	+	Intron	INS	-	T	T	rs139023986	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79761637_79761638insT	uc003pir.2	-						PHIP_uc011dyp.1_Intron	NM_017934	NP_060404			pleckstrin homology domain interacting protein						insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	80578078	80578078	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80578078delT								RNY4 (126409 upstream) : ELOVL4 (46458 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	83433199	83433199	+	IGR	DEL	A	-	-	rs138104442		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83433199delA								TPBG (356585 upstream) : UBE2CBP (168987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	83589074	83589075	+	IGR	INS	-	T	T	rs149264111	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83589074_83589075insT								TPBG (512460 upstream) : UBE2CBP (13111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	84479101	84479102	+	IGR	DEL	AG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84479101_84479102delAG								SNAP91 (59974 upstream) : RIPPLY2 (83883 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	87480523	87480523	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87480523delA								None (None upstream) : HTR1E (166501 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	88986900	88986925	+	IGR	DEL	TTTCTTTCTTTCTTTCTTTCTTTCTT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88986900_88986925delTTTCTTTCTTTCTTTCTTTCTTTCTT								CNR1 (111133 upstream) : RNGTT (333064 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	89192138	89192139	+	IGR	INS	-	T	T	rs66586727		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89192138_89192139insT								CNR1 (316371 upstream) : RNGTT (127850 downstream)																																			---	---	---	---
BACH2	60468	broad.mit.edu	37	6	90646431	90646432	+	Intron	INS	-	AAC	AAC	rs144787301	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90646431_90646432insAAC	uc011eab.1	-						BACH2_uc003pnw.2_Intron	NM_021813	NP_068585			BTB and CNC homology 1, basic leucine zipper							nucleus	protein dimerization activity|sequence-specific DNA binding			ovary(3)|pancreas(1)|lung(1)|skin(1)	6		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	92394623	92394624	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92394623_92394624delAC	uc003pod.2	-											Homo sapiens cDNA clone IMAGE:5284581.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	92735471	92735471	+	IGR	DEL	T	-	-	rs67364515		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92735471delT								None (None upstream) : None (None downstream)																																			---	---	---	---
EPHA7	2045	broad.mit.edu	37	6	93972141	93972142	+	Intron	INS	-	T	T	rs140821833	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93972141_93972142insT	uc003poe.2	-						EPHA7_uc003pof.2_Intron|EPHA7_uc011eac.1_Intron	NM_004440	NP_004431			ephrin receptor EphA7 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)														---	---	---	---
EPHA7	2045	broad.mit.edu	37	6	94080979	94080979	+	Intron	DEL	A	-	-	rs71542017		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:94080979delA	uc003poe.2	-						EPHA7_uc003pof.2_Intron|EPHA7_uc011eac.1_Intron	NM_004440	NP_004431			ephrin receptor EphA7 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)														---	---	---	---
TSG1	643432	broad.mit.edu	37	6	94443853	94443853	+	Intron	DEL	T	-	-	rs112421771		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:94443853delT	uc003poh.2	+						TSG1_uc003poj.2_Intron|TSG1_uc010kci.1_Intron|TSG1_uc003poi.2_Intron|TSG1_uc003pok.2_Intron|TSG1_uc003pol.1_Intron|TSG1_uc003pom.1_Intron					Homo sapiens tumor suppressor gene locus (TSG1) mRNA, alternatively spliced isoform A.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	98652988	98652988	+	IGR	DEL	T	-	-	rs67135769		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98652988delT								MIR2113 (180491 upstream) : POU3F2 (629592 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	98975448	98975448	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98975448delT								MIR2113 (502951 upstream) : POU3F2 (307132 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	99074921	99074922	+	IGR	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99074921_99074922delAC								MIR2113 (602424 upstream) : POU3F2 (207658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	99601712	99601712	+	IGR	DEL	A	-	-	rs113158895		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99601712delA								FBXL4 (205863 upstream) : C6orf168 (119082 downstream)																																			---	---	---	---
ASCC3	10973	broad.mit.edu	37	6	101043083	101043083	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101043083delT	uc003pqk.2	-							NM_006828	NP_006819			activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)														---	---	---	---
ASCC3	10973	broad.mit.edu	37	6	101064869	101064871	+	Intron	DEL	GTT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101064869_101064871delGTT	uc003pqk.2	-							NM_006828	NP_006819			activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)														---	---	---	---
GRIK2	2898	broad.mit.edu	37	6	102370016	102370017	+	Intron	INS	-	TCCCTTCCT	TCCCTTCCT	rs145647959	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102370016_102370017insTCCCTTCCT	uc003pqp.3	+						GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775			glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	106497559	106497560	+	IGR	INS	-	CA	CA	rs150242366	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106497559_106497560insCA								PREP (646590 upstream) : PRDM1 (36635 downstream)																																			---	---	---	---
SNX3	8724	broad.mit.edu	37	6	108580248	108580249	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108580248_108580249insA	uc003psh.2	-						SNX3_uc003psi.2_Intron|SNX3_uc010kdi.2_Intron	NM_003795	NP_003786			sorting nexin 3 isoform a						cell communication|endocytosis|protein transport	early endosome|endosome membrane	phosphatidylinositol-3-phosphate binding|protein phosphatase binding				0		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0136)|Epithelial(106;0.0564)|OV - Ovarian serous cystadenocarcinoma(136;0.0717)|all cancers(137;0.0743)														---	---	---	---
SESN1	27244	broad.mit.edu	37	6	109406332	109406332	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109406332delA	uc003psu.2	-							NM_014454	NP_055269			sestrin 1						cell cycle arrest|negative regulation of cell proliferation|response to DNA damage stimulus	nucleus				ovary(1)	1		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)														---	---	---	---
FIG4	9896	broad.mit.edu	37	6	110114522	110114522	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110114522delG	uc003ptt.2	+						FIG4_uc011eau.1_Intron	NM_014845	NP_055660			Sac domain-containing inositol phosphatase 3						cell death	endosome membrane	protein binding			ovary(1)	1		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)														---	---	---	---
AMD1	262	broad.mit.edu	37	6	111192054	111192054	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111192054delC	uc011eay.1	+							NM_001033059	NP_001028231			adenosylmethionine decarboxylase 1 isoform 2						spermidine biosynthetic process|spermine biosynthetic process	cytosol	adenosylmethionine decarboxylase activity			upper_aerodigestive_tract(1)	1		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	111386805	111386805	+	IGR	DEL	T	-	-	rs111450220		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111386805delT								GSTM2P1 (18048 upstream) : SLC16A10 (21976 downstream)																																			---	---	---	---
SLC16A10	117247	broad.mit.edu	37	6	111453389	111453390	+	Intron	DEL	AG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111453389_111453390delAG	uc003pus.2	+						SLC16A10_uc003pur.3_Intron	NM_018593	NP_061063			solute carrier family 16, member 10						aromatic amino acid transport|cellular nitrogen compound metabolic process|ion transport	basolateral plasma membrane|integral to membrane	amino acid transmembrane transporter activity				0		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	116165652	116165653	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116165652_116165653insA								None (None upstream) : FRK (97040 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	120030744	120030745	+	IGR	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120030744_120030745delAC								MAN1A1 (359818 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	120357180	120357181	+	IGR	INS	-	T	T	rs142811227	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120357180_120357181insT								MAN1A1 (686254 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	120949130	120949131	+	IGR	INS	-	A	A	rs150866402	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120949130_120949131insA								None (None upstream) : C6orf170 (451496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	121279390	121279391	+	IGR	INS	-	TG	TG	rs138721291	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121279390_121279391insTG								None (None upstream) : C6orf170 (121236 downstream)																																			---	---	---	---
GJA1	2697	broad.mit.edu	37	6	121766728	121766729	+	Intron	INS	-	A	A	rs151122556	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121766728_121766729insA	uc003pyr.2	+						GJA1_uc011ebo.1_Intron|GJA1_uc011ebp.1_Intron	NM_000165	NP_000156			connexin 43						cell-cell signaling|cellular membrane organization|gap junction assembly|heart development|muscle contraction|positive regulation of I-kappaB kinase/NF-kappaB cascade	connexon complex|Golgi-associated vesicle membrane|integral to plasma membrane|membrane raft	ion transmembrane transporter activity|signal transducer activity			ovary(2)	2				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	122056091	122056091	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122056091delT								GJA1 (285219 upstream) : HSF2 (664605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122518922	122518923	+	IGR	INS	-	AG	AG	rs151178955	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122518922_122518923insAG								GJA1 (748050 upstream) : HSF2 (201773 downstream)																																			---	---	---	---
PKIB	5570	broad.mit.edu	37	6	122866985	122866985	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122866985delA	uc003pyz.2	+							NM_181794	NP_861459			cAMP-dependent protein kinase inhibitor beta								cAMP-dependent protein kinase inhibitor activity				0				GBM - Glioblastoma multiforme(226;0.164)														---	---	---	---
PKIB	5570	broad.mit.edu	37	6	122965900	122965905	+	Intron	DEL	TTAAAC	-	-	rs145733512		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122965900_122965905delTTAAAC	uc003pyz.2	+						PKIB_uc003pza.2_Intron|PKIB_uc003pzb.2_Intron	NM_181794	NP_861459			cAMP-dependent protein kinase inhibitor beta								cAMP-dependent protein kinase inhibitor activity				0				GBM - Glioblastoma multiforme(226;0.164)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	124075395	124075395	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124075395delT								TRDN (117453 upstream) : NKAIN2 (49674 downstream)																																			---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124477109	124477109	+	Intron	DEL	A	-	-	rs112070072		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124477109delA	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010kep.1_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	125055208	125055211	+	Intron	DEL	CACA	-	-	rs149083306		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125055208_125055211delCACA	uc003pzo.2	+						NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	125919223	125919224	+	IGR	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125919223_125919224delAC								HDDC2 (295941 upstream) : HEY2 (149556 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	125943920	125943921	+	IGR	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125943920_125943921delTC								HDDC2 (320638 upstream) : HEY2 (124859 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	127674029	127674032	+	IGR	DEL	TAGC	-	-	rs143552423		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127674029_127674032delTAGC								ECHDC1 (9275 upstream) : C6orf174 (85520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	128885215	128885216	+	IGR	INS	-	G	G			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128885215_128885216insG								PTPRK (43345 upstream) : LAMA2 (319070 downstream)																																			---	---	---	---
LOC285733	285733	broad.mit.edu	37	6	131154691	131154691	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131154691delA	uc011ebx.1	+							NR_015397				Homo sapiens cDNA FLJ34581 fis, clone KIDNE2008480.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	132937017	132937020	+	IGR	DEL	ACAC	-	-	rs71671350		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132937017_132937020delACAC								TAAR5 (26140 upstream) : TAAR2 (1269 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	133241308	133241309	+	IGR	INS	-	A	A	rs150103319	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133241308_133241309insA								RPS12 (102606 upstream) : LOC285735 (167910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	136646507	136646507	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136646507delT								BCLAF1 (35518 upstream) : MAP7 (17366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	138338421	138338421	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138338421delA								TNFAIP3 (133976 upstream) : PERP (71221 downstream)																																			---	---	---	---
REPS1	85021	broad.mit.edu	37	6	139307925	139307925	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139307925delA	uc003qii.2	-						REPS1_uc003qig.3_Intron|REPS1_uc011edr.1_Intron|REPS1_uc003qij.2_Intron|REPS1_uc003qik.2_Intron	NM_031922	NP_114128			RALBP1 associated Eps domain containing 1							coated pit|plasma membrane	calcium ion binding|SH3 domain binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	142165621	142165622	+	Intron	INS	-	A	A	rs149254302	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142165621_142165622insA	uc003qit.1	-											SubName: Full=ORF2-like protein; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	143363819	143363819	+	IGR	DEL	A	-	-	rs72084959		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143363819delA								HIVEP2 (97481 upstream) : AIG1 (16681 downstream)																																			---	---	---	---
STX11	8676	broad.mit.edu	37	6	144499071	144499071	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144499071delT	uc003qks.3	+							NM_003764	NP_003755			syntaxin 11						cellular membrane fusion|intracellular protein transport|vesicle-mediated transport	Golgi apparatus|membrane	SNAP receptor activity			ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)										Familial_Hemophagocytic_Lymphohistiocytosis				---	---	---	---
Unknown	0	broad.mit.edu	37	6	145198575	145198576	+	IGR	INS	-	TC	TC	rs139523778	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145198575_145198576insTC								UTRN (24407 upstream) : EPM2A (747870 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	145216714	145216715	+	IGR	INS	-	A	A	rs141440853	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145216714_145216715insA								UTRN (42546 upstream) : EPM2A (729731 downstream)																																			---	---	---	---
SHPRH	257218	broad.mit.edu	37	6	146242677	146242677	+	Intron	DEL	T	-	-	rs146207931		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146242677delT	uc003qlf.2	-						SHPRH_uc003qld.2_Intron|SHPRH_uc003qle.2_Intron|SHPRH_uc003qlg.1_Intron|SHPRH_uc003qlh.2_Intron|SHPRH_uc003qli.1_Intron	NM_001042683	NP_001036148			SNF2 histone linker PHD RING helicase isoform a						DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	147185564	147185568	+	Intron	DEL	ACTTC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147185564_147185568delACTTC	uc003qls.1	-						uc003qlt.1_Intron|uc003qlu.1_Intron|uc003qlv.2_RNA					Homo sapiens cDNA FLJ34275 fis, clone FEBRA2003454.																														---	---	---	---
SASH1	23328	broad.mit.edu	37	6	148793582	148793582	+	Intron	DEL	A	-	-	rs67727590		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148793582delA	uc003qme.1	+							NM_015278	NP_056093			SAM and SH3 domain containing 1								protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	149411511	149411512	+	IGR	DEL	AC	-	-	rs34505742		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149411511_149411512delAC								UST (13386 upstream) : TAB2 (128247 downstream)																																			---	---	---	---
PPIL4	85313	broad.mit.edu	37	6	149806181	149806182	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149806181_149806182insT	uc010kic.2	-						ZC3H12D_uc003qmm.2_5'Flank|ZC3H12D_uc010kid.2_5'Flank	NM_139126				peptidylprolyl isomerase-like 4						protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)														---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152084643	152084643	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152084643delT	uc003qom.3	+							NM_001122742	NP_001116214			estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	153002335	153002338	+	5'Flank	DEL	AGAA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153002335_153002338delAGAA	uc003qpb.1	+											full-length cDNA clone CS0DL011YN21 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	153520606	153520607	+	IGR	DEL	TT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153520606_153520607delTT								RGS17 (68217 upstream) : OPRM1 (811029 downstream)																																			---	---	---	---
ZDHHC14	79683	broad.mit.edu	37	6	157838441	157838441	+	Intron	DEL	T	-	-	rs11306285		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157838441delT	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron	NM_024630	NP_078906			zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)														---	---	---	---
ZDHHC14	79683	broad.mit.edu	37	6	158078086	158078087	+	Intron	INS	-	T	T	rs139925636		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158078086_158078087insT	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron|ZDHHC14_uc010kjn.2_Intron	NM_024630	NP_078906			zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)														---	---	---	---
TMEM181	57583	broad.mit.edu	37	6	159037018	159037024	+	Intron	DEL	TAAACTT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159037018_159037024delTAAACTT	uc003qrm.3	+						TMEM181_uc010kjr.1_Intron	NM_020823	NP_065874			G protein-coupled receptor 178						pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)														---	---	---	---
TAGAP	117289	broad.mit.edu	37	6	159459426	159459426	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159459426delT	uc003qrz.2	-						TAGAP_uc011eft.1_Intron|TAGAP_uc003qsa.2_Intron	NM_054114	NP_473455			T-cell activation Rho GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)														---	---	---	---
FNDC1	84624	broad.mit.edu	37	6	159639209	159639211	+	Intron	DEL	TGT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159639209_159639211delTGT	uc010kjv.2	+						FNDC1_uc010kjw.1_Intron	NM_032532	NP_115921			fibronectin type III domain containing 1							extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)														---	---	---	---
PNLDC1	154197	broad.mit.edu	37	6	160222849	160222850	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160222849_160222850insT	uc003qsx.1	+						PNLDC1_uc003qsy.1_Intron	NM_173516	NP_775787			poly(A)-specific ribonuclease (PARN)-like domain							integral to membrane|nucleus	nucleic acid binding				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)														---	---	---	---
IGF2R	3482	broad.mit.edu	37	6	160446193	160446193	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160446193delT	uc003qta.2	+							NM_000876	NP_000867			insulin-like growth factor 2 receptor precursor						receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)														---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162713803	162713804	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162713803_162713804insA	uc003qtx.3	-						PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
PDE10A	10846	broad.mit.edu	37	6	165774418	165774418	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165774418delG	uc003qun.2	-						PDE10A_uc011egj.1_Intron|PDE10A_uc011egk.1_Intron|PDE10A_uc003quo.2_Intron	NM_006661	NP_006652			phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)													---	---	---	---
PDE10A	10846	broad.mit.edu	37	6	166055732	166055732	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166055732delG	uc003qun.2	-						PDE10A_uc003quo.2_Intron	NM_006661	NP_006652			phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	166413869	166413869	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166413869delA								LOC441177 (10766 upstream) : T (157217 downstream)																																			---	---	---	---
RPS6KA2	6196	broad.mit.edu	37	6	166927705	166927705	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166927705delC	uc003qvb.1	-						RPS6KA2_uc011ego.1_Intron|RPS6KA2_uc010kkl.1_Intron|RPS6KA2_uc003qvc.1_Intron|RPS6KA2_uc003qvd.1_Intron	NM_021135	NP_066958			ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)														---	---	---	---
RNASET2	8635	broad.mit.edu	37	6	167395868	167395869	+	Intron	DEL	TT	-	-	rs72348176		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167395868_167395869delTT	uc003qvh.2	-											Homo sapiens mRNA for extra-cellular ribonuclease (RNASE6PL gene).						RNA catabolic process	extracellular region	ribonuclease T2 activity|RNA binding				0		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;1.53e-19)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00665)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	167920680	167920696	+	IGR	DEL	GTCCCCTCTCCTCCCCT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167920680_167920696delGTCCCCTCTCCTCCCCT								TCP10 (122682 upstream) : C6orf123 (264525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	168659356	168659356	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168659356delT								FRMD1 (179517 upstream) : DACT2 (48230 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	169706622	169706623	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169706622_169706623insA								THBS2 (52485 upstream) : WDR27 (150684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	170421464	170421465	+	IGR	DEL	TG	-	-	rs5881851		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170421464_170421465delTG								C6orf208 (218495 upstream) : LOC154449 (141957 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	581945	581946	+	IGR	INS	-	C	C	rs68030641		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:581945_581946insC								PDGFA (22464 upstream) : PRKAR1B (7441 downstream)																																			---	---	---	---
MAFK	7975	broad.mit.edu	37	7	1568459	1568459	+	5'Flank	DEL	A	-	-	rs150169717		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1568459delA	uc003skr.2	+							NM_002360	NP_002351			v-maf musculoaponeurotic fibrosarcoma oncogene						blood coagulation	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.75e-15)														---	---	---	---
MAD1L1	8379	broad.mit.edu	37	7	2056602	2056602	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2056602delT	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron	NM_001013836	NP_001013858			MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)														---	---	---	---
SDK1	221935	broad.mit.edu	37	7	4045026	4045029	+	Intron	DEL	GTGT	-	-	rs72329212		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4045026_4045029delGTGT	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	5319264	5319264	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5319264delA								WIPI2 (45779 upstream) : SLC29A4 (3297 downstream)																																			---	---	---	---
TNRC18	84629	broad.mit.edu	37	7	5398447	5398450	+	Intron	DEL	AAAC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5398447_5398450delAAAC	uc003soi.3	-						TNRC18_uc003soj.2_5'Flank	NM_001080495	NP_001073964			trinucleotide repeat containing 18								DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)														---	---	---	---
TNRC18	84629	broad.mit.edu	37	7	5404094	5404103	+	Intron	DEL	ACACACACAC	-	-	rs56661449		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5404094_5404103delACACACACAC	uc003soi.3	-							NM_001080495	NP_001073964			trinucleotide repeat containing 18								DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)														---	---	---	---
C7orf26	79034	broad.mit.edu	37	7	6630475	6630476	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6630475_6630476insT	uc003sqo.1	+						uc011jwy.1_5'Flank|C7orf26_uc003sqp.1_Intron|C7orf26_uc003sqq.1_Intron	NM_024067	NP_076972			hypothetical protein LOC79034											ovary(1)	1		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)														---	---	---	---
GLCCI1	113263	broad.mit.edu	37	7	8103781	8103781	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8103781delG	uc003srk.2	+							NM_138426	NP_612435			glucocorticoid induced transcript 1												0		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	9027956	9027956	+	IGR	DEL	A	-	-	rs111924485		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9027956delA								NXPH1 (235364 upstream) : PER4 (645944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	10380295	10380296	+	IGR	INS	-	TGTG	TGTG	rs144548247	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10380295_10380296insTGTG								PER4 (704848 upstream) : NDUFA4 (592519 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	10709670	10709671	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10709670_10709671insA								None (None upstream) : NDUFA4 (263144 downstream)																																			---	---	---	---
PHF14	9678	broad.mit.edu	37	7	11128029	11128030	+	Intron	DEL	AA	-	-	rs2995885	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11128029_11128030delAA	uc003sry.1	+						PHF14_uc011jxi.1_Intron|PHF14_uc003srz.2_Intron|PHF14_uc011jxj.1_Intron	NM_014660	NP_055475			PHD finger protein 14 isoform 2								zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	12521617	12521622	+	IGR	DEL	TTAAGA	-	-	rs68187428		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12521617_12521622delTTAAGA								VWDE (77765 upstream) : SCIN (74565 downstream)																																			---	---	---	---
DGKB	1607	broad.mit.edu	37	7	14339549	14339550	+	Intron	INS	-	A	A	rs144190729	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14339549_14339550insA	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071			diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)													---	---	---	---
TMEM195	392636	broad.mit.edu	37	7	15544405	15544405	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15544405delA	uc003stb.1	-							NM_001004320	NP_001004320			transmembrane protein 195						ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0																		---	---	---	---
ISPD	729920	broad.mit.edu	37	7	16208160	16208165	+	Intron	DEL	ACACAC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16208160_16208165delACACAC	uc010ktx.2	-						ISPD_uc010kty.2_Intron	NM_001101426	NP_001094896			notch1-induced protein isoform a						isoprenoid biosynthetic process		nucleotidyltransferase activity			ovary(1)	1															Multiple Myeloma(15;0.18)			---	---	---	---
SOSTDC1	25928	broad.mit.edu	37	7	16546186	16546187	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16546186_16546187insA	uc003sth.2	-							NM_015464	NP_056279			sclerostin domain containing 1 precursor						Wnt receptor signaling pathway					ovary(2)|central_nervous_system(1)	3	Lung NSC(10;0.185)			UCEC - Uterine corpus endometrioid carcinoma (126;0.177)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	16607046	16607046	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16607046delT								SOSTDC1 (36841 upstream) : ANKMY2 (32367 downstream)																																			---	---	---	---
SNX13	23161	broad.mit.edu	37	7	17885869	17885869	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17885869delA	uc003stw.1	-						SNX13_uc003stv.2_Intron|SNX13_uc010kuc.2_Intron					SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;						cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	19080436	19080436	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19080436delG								HDAC9 (43452 upstream) : TWIST1 (74657 downstream)																																			---	---	---	---
ABCB5	340273	broad.mit.edu	37	7	20669409	20669411	+	Intron	DEL	AGA	-	-	rs35282965		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20669409_20669411delAGA	uc010kuh.2	+							NM_001163941	NP_001157413			ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	21265184	21265184	+	IGR	DEL	A	-	-	rs11980211		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21265184delA								RPL23P8 (397745 upstream) : SP4 (202505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	21415569	21415570	+	IGR	DEL	GT	-	-	rs142303810		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21415569_21415570delGT								RPL23P8 (548130 upstream) : SP4 (52119 downstream)																																			---	---	---	---
RAPGEF5	9771	broad.mit.edu	37	7	22193724	22193724	+	Intron	DEL	T	-	-	rs35254223		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22193724delT	uc003svg.2	-						RAPGEF5_uc011jyl.1_Intron	NM_012294	NP_036426			Rap guanine nucleotide exchange factor (GEF) 5						nervous system development|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	nucleus	GTP-dependent protein binding|Rap guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	22720020	22720023	+	IGR	DEL	TGTG	-	-	rs140089498		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22720020_22720023delTGTG								MGC87042 (180222 upstream) : IL6 (45480 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	22906852	22906852	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22906852delT								SNORD93 (10548 upstream) : FAM126A (74035 downstream)																																			---	---	---	---
STK31	56164	broad.mit.edu	37	7	23880975	23880976	+	Intron	INS	-	TGTGTGTG	TGTGTGTG	rs138944479	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23880975_23880976insTGTGTGTG	uc003swv.1	+											SubName: Full=Putative uncharacterized protein STK31;								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9																		---	---	---	---
C7orf31	136895	broad.mit.edu	37	7	25188914	25188915	+	Intron	INS	-	C	C	rs140926720	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25188914_25188915insC	uc003sxn.1	-						C7orf31_uc003sxm.1_Intron	NM_138811	NP_620166			hypothetical protein LOC136895												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	25337977	25337977	+	IGR	DEL	T	-	-	rs11300761		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25337977delT								NPVF (69872 upstream) : MIR148A (651562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	25533957	25533958	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25533957_25533958insA								NPVF (265852 upstream) : MIR148A (455581 downstream)																																			---	---	---	---
HOXA3	3200	broad.mit.edu	37	7	27151105	27151110	+	Intron	DEL	GTGTGT	-	-	rs67931563		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27151105_27151110delGTGTGT	uc011jzl.1	-						HOXA3_uc011jzk.1_Intron|HOXA3_uc003syk.2_Intron	NM_030661	NP_109377			homeobox A3 isoform a						angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(2)	2																		---	---	---	---
CHN2	1124	broad.mit.edu	37	7	29443287	29443287	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29443287delA	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron	NM_004067	NP_004058			beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	31325637	31325638	+	IGR	INS	-	T	T	rs141231909	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31325637_31325638insT								ADCYAP1R1 (179326 upstream) : NEUROD6 (51444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	31720681	31720681	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31720681delA								CCDC129 (22348 upstream) : C7orf16 (6118 downstream)																																			---	---	---	---
PDE1C	5137	broad.mit.edu	37	7	32006307	32006307	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32006307delC	uc003tcm.1	-						PDE1C_uc003tcn.1_Intron|PDE1C_uc003tco.1_Intron|PDE1C_uc003tcr.2_Intron|PDE1C_uc003tcs.2_Intron	NM_005020	NP_005011			phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	32407560	32407560	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32407560delA								PDE1C (68619 upstream) : LSM5 (117385 downstream)																																			---	---	---	---
BBS9	27241	broad.mit.edu	37	7	33576105	33576105	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33576105delA	uc003tdn.1	+						BBS9_uc003tdo.1_Intron|BBS9_uc003tdp.1_Intron|BBS9_uc003tdq.1_Intron|BBS9_uc010kwn.1_Intron|BBS9_uc003tdr.1_Intron|BBS9_uc003tds.1_Intron|BBS9_uc003tdt.2_Intron	NM_198428	NP_940820			parathyroid hormone-responsive B1 isoform 2						fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)											Bardet-Biedl_syndrome				---	---	---	---
BMPER	168667	broad.mit.edu	37	7	34112702	34112702	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34112702delT	uc011kap.1	+							NM_133468	NP_597725			BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	35564141	35564142	+	IGR	INS	-	A	A	rs147342979	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35564141_35564142insA								TBX20 (270899 upstream) : HERPUD2 (108130 downstream)																																			---	---	---	---
ELMO1	9844	broad.mit.edu	37	7	37143915	37143915	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37143915delA	uc003tfk.1	-						ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615			engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
C7orf10	79783	broad.mit.edu	37	7	40429041	40429042	+	Intron	INS	-	AAACAAACAAAC	AAACAAACAAAC	rs112529175		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40429041_40429042insAAACAAACAAAC	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004			dermal papilla derived protein 13								transferase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	43610661	43610662	+	IGR	DEL	AC	-	-	rs71563908		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43610661_43610662delAC								HECW1 (7723 upstream) : STK17A (12030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	45907980	45907980	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45907980delC								SEPT7P2 (99363 upstream) : IGFBP1 (19979 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	45923555	45923558	+	IGR	DEL	TCTT	-	-	rs71935217		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45923555_45923558delTCTT								SEPT7P2 (114938 upstream) : IGFBP1 (4401 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	46984705	46984706	+	IGR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46984705_46984706delGT								None (None upstream) : TNS3 (330047 downstream)																																			---	---	---	---
TNS3	64759	broad.mit.edu	37	7	47593391	47593392	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47593391_47593392insT	uc003tnw.2	-							NM_022748	NP_073585			tensin 3							focal adhesion	protein binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	47660282	47660283	+	IGR	INS	-	T	T	rs112092478		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47660282_47660283insT								TNS3 (38540 upstream) : C7orf65 (34559 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	48955230	48955231	+	IGR	INS	-	GT	GT	rs151136640	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48955230_48955231insGT								ABCA13 (268139 upstream) : CDC14C (8926 downstream)																																			---	---	---	---
GRB10	2887	broad.mit.edu	37	7	50702782	50702783	+	Intron	INS	-	T	T	rs147122444	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50702782_50702783insT	uc003tpi.2	-						GRB10_uc003tph.3_Intron|GRB10_uc003tpj.2_Intron|GRB10_uc003tpk.2_Intron|GRB10_uc010kzb.2_Intron|GRB10_uc003tpl.2_Intron|GRB10_uc003tpm.2_Intron|GRB10_uc003tpn.2_Intron	NM_005311	NP_005302			growth factor receptor-bound protein 10 isoform						insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)													Russell-Silver_syndrome				---	---	---	---
GRB10	2887	broad.mit.edu	37	7	50793170	50793171	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50793170_50793171delAC	uc003tpi.2	-						GRB10_uc003tpj.2_Intron|GRB10_uc003tpk.2_Intron|GRB10_uc010kzb.2_Intron|GRB10_uc003tpl.2_Intron|GRB10_uc003tpm.2_Intron|GRB10_uc003tpn.2_Intron	NM_005311	NP_005302			growth factor receptor-bound protein 10 isoform						insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)													Russell-Silver_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	7	52603030	52603031	+	IGR	DEL	TG	-	-	rs67839112		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52603030_52603031delTG								None (None upstream) : POM121L12 (500318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53446252	53446253	+	IGR	INS	-	A	A	rs144030136	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53446252_53446253insA								POM121L12 (341635 upstream) : HPVC1 (822664 downstream)																																			---	---	---	---
GBAS	2631	broad.mit.edu	37	7	56060668	56060668	+	Intron	DEL	T	-	-	rs78745830		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56060668delT	uc003tre.1	+						GBAS_uc003trf.1_Intron	NM_001483	NP_001474			nipsnap homolog 2							integral to plasma membrane|membrane fraction|mitochondrion	protein binding			central_nervous_system(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	56939029	56939029	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56939029delA								DKFZp434L192 (374052 upstream) : ZNF479 (248299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57017246	57017247	+	IGR	INS	-	CTC	CTC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57017246_57017247insCTC								DKFZp434L192 (452269 upstream) : ZNF479 (170081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57647874	57647875	+	IGR	DEL	GC	-	-	rs79799878		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57647874_57647875delGC								ZNF716 (114609 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57918643	57918643	+	IGR	DEL	C	-	-	rs77154328		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57918643delC								ZNF716 (385378 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57936923	57936923	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57936923delT								ZNF716 (403658 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	58029320	58029321	+	IGR	INS	-	G	G			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:58029320_58029321insG								ZNF716 (496055 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61081494	61081494	+	IGR	DEL	A	-	-	rs34475736		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61081494delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61749684	61749684	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61749684delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61911784	61911785	+	IGR	INS	-	A	A	rs149066577		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61911784_61911785insA								None (None upstream) : LOC643955 (839887 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62335996	62335996	+	IGR	DEL	T	-	-	rs113770933		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62335996delT								None (None upstream) : LOC643955 (415676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62627217	62627217	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62627217delT								None (None upstream) : LOC643955 (124455 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64740133	64740133	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64740133delC								INTS4L1 (45534 upstream) : ZNF92 (98635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	66356688	66356688	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66356688delG								LOC729156 (46875 upstream) : C7orf42 (29515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	66804597	66804597	+	Intron	DEL	T	-	-	rs35084328		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66804597delT	uc003tvu.2	+											Homo sapiens, clone IMAGE:4288206, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	67444624	67444624	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67444624delC								STAG3L4 (658112 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68195058	68195058	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68195058delG								None (None upstream) : AUTS2 (868847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68906961	68906962	+	IGR	INS	-	G	G	rs144860356	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68906961_68906962insG								None (None upstream) : AUTS2 (156943 downstream)																																			---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69463345	69463346	+	Intron	INS	-	A	A	rs112941250		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69463345_69463346insA	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
WBSCR17	64409	broad.mit.edu	37	7	70606827	70606828	+	Intron	DEL	TG	-	-	rs34121771		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70606827_70606828delTG	uc003tvy.2	+							NM_022479	NP_071924			UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)																---	---	---	---
CALN1	83698	broad.mit.edu	37	7	71639756	71639764	+	Intron	DEL	GCAAGGACC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71639756_71639764delGCAAGGACC	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440			calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)																---	---	---	---
CALN1	83698	broad.mit.edu	37	7	71748514	71748514	+	Intron	DEL	T	-	-	rs5884882		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71748514delT	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440			calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)																---	---	---	---
HIP1	3092	broad.mit.edu	37	7	75189544	75189545	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75189544_75189545insT	uc003uds.1	-						HIP1_uc011kfz.1_Intron	NM_005338	NP_005329			huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8								T	PDGFRB	CMML								---	---	---	---
ZP3	7784	broad.mit.edu	37	7	76046112	76046113	+	Intron	DEL	TC	-	-	rs71562422		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76046112_76046113delTC	uc003ufc.3	+							NM_007155	NP_009086			zona pellucida glycoprotein 3 isoform 2						binding of sperm to zona pellucida|blastocyst formation|egg coat formation|humoral immune response mediated by circulating immunoglobulin|intracellular protein transport|negative regulation of binding of sperm to zona pellucida|negative regulation of transcription, DNA-dependent|oocyte development|phosphatidylinositol-mediated signaling|positive regulation of acrosomal vesicle exocytosis|positive regulation of acrosome reaction|positive regulation of antral ovarian follicle growth|positive regulation of calcium ion import|positive regulation of calcium ion transport via store-operated calcium channel activity|positive regulation of humoral immune response|positive regulation of interferon-gamma production|positive regulation of interleukin-4 production|positive regulation of leukocyte migration|positive regulation of ovarian follicle development|positive regulation of phosphatidylinositol biosynthetic process|positive regulation of protein kinase activity|positive regulation of protein kinase B signaling cascade|positive regulation of T cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of type IV hypersensitivity|protein kinase C signaling cascade	endoplasmic reticulum|extracellular space|Golgi apparatus|integral to membrane|multivesicular body|outer acrosomal membrane|perinuclear region of cytoplasm|plasma membrane|proteinaceous extracellular matrix	acrosin binding|manganese ion transmembrane transporter activity|receptor activity|sugar binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	79319127	79319128	+	IGR	INS	-	A	A	rs149100481	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79319127_79319128insA								MAGI2 (236237 upstream) : GNAI1 (445012 downstream)																																			---	---	---	---
CACNA2D1	781	broad.mit.edu	37	7	81611455	81611455	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81611455delT	uc003uhr.1	-							NM_000722	NP_000713			calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)													---	---	---	---
CACNA2D1	781	broad.mit.edu	37	7	81757412	81757413	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81757412_81757413insT	uc003uhr.1	-							NM_000722	NP_000713			calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)													---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82447512	82447512	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82447512delT	uc003uhx.2	-							NM_033026	NP_149015			piccolo isoform 1						cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82690145	82690145	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82690145delA	uc003uhx.2	-						PCLO_uc003uhv.2_Intron	NM_033026	NP_149015			piccolo isoform 1						cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	88303846	88303851	+	IGR	DEL	GCAGGT	-	-	rs58246408		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88303846_88303851delGCAGGT								STEAP4 (367637 upstream) : ZNF804B (84902 downstream)																																			---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88578078	88578078	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88578078delT	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88609219	88609219	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88609219delT	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
CALCR	799	broad.mit.edu	37	7	93109063	93109064	+	Intron	INS	-	AC	AC	rs146212549	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93109063_93109064insAC	uc003umv.1	-						CALCR_uc003ums.1_Intron|CALCR_uc003umt.1_Intron|CALCR_uc003umu.1_Intron|CALCR_uc003umw.2_Intron	NM_001742	NP_001733			calcitonin receptor isoform 2 precursor						activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)													---	---	---	---
PON1	5444	broad.mit.edu	37	7	94937788	94937789	+	Intron	DEL	GT	-	-	rs150885796		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94937788_94937789delGT	uc003uns.2	-						PON1_uc011kih.1_Intron	NM_000446	NP_000437			paraoxonase 1 precursor						aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)													---	---	---	---
DLX6AS	285987	broad.mit.edu	37	7	96625861	96625862	+	Intron	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96625861_96625862delGT	uc003uok.2	-						DLX6AS_uc003uol.2_Intron|DLX6AS_uc010lfo.1_Intron					Homo sapiens cDNA FLJ34048 fis, clone FCBBF3000102.												0																		---	---	---	---
BAIAP2L1	55971	broad.mit.edu	37	7	97960955	97960955	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97960955delT	uc003upj.2	-							NM_018842	NP_061330			BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	98227588	98227588	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98227588delC								BAIAP2L1 (197161 upstream) : NPTX2 (19009 downstream)																																			---	---	---	---
TRRAP	8295	broad.mit.edu	37	7	98510933	98510933	+	Intron	DEL	T	-	-	rs143025018	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98510933delT	uc003upp.2	+						TRRAP_uc011kis.1_Intron|TRRAP_uc003upr.2_Intron	NM_003496	NP_003487			transformation/transcription domain-associated						histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
KPNA7	402569	broad.mit.edu	37	7	98778126	98778127	+	Intron	INS	-	TC	TC	rs149529881	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98778126_98778127insTC	uc010lft.2	-							NM_001145715	NP_001139187			karyopherin 7						protein import into nucleus	cytoplasm|nuclear pore	binding|protein transporter activity			kidney(1)|skin(1)	2																		---	---	---	---
ZSCAN21	7589	broad.mit.edu	37	7	99653570	99653571	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99653570_99653571insT	uc003uso.2	+						ZSCAN21_uc011kje.1_Intron|ZSCAN21_uc003usn.1_Intron	NM_145914	NP_666019			zinc finger protein 38						positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)															---	---	---	---
MOSPD3	64598	broad.mit.edu	37	7	100207344	100207344	+	5'Flank	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100207344delT	uc003uvq.2	+						MOSPD3_uc003uvr.2_5'Flank|MOSPD3_uc003uvs.2_5'Flank|MOSPD3_uc003uvt.2_5'Flank	NM_001040097	NP_001035186			motile sperm domain containing 3 isoform a							integral to membrane	structural molecule activity			ovary(2)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	100614843	100614843	+	IGR	DEL	C	-	-	rs67310012		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100614843delC								ACHE (120304 upstream) : MUC12 (33232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	100615378	100615378	+	IGR	DEL	C	-	-	rs33957279		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100615378delC								ACHE (120839 upstream) : MUC12 (32697 downstream)																																			---	---	---	---
MUC17	140453	broad.mit.edu	37	7	100667175	100667175	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100667175delT	uc003uxp.1	+						MUC17_uc010lho.1_Intron	NM_001040105	NP_001035194			mucin 17 precursor							extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)																	---	---	---	---
ZNHIT1	10467	broad.mit.edu	37	7	100864439	100864439	+	Intron	DEL	T	-	-	rs34356868		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100864439delT	uc003uye.2	+						ZNHIT1_uc003uyf.2_RNA	NM_006349	NP_006340			zinc finger, HIT domain containing 1								metal ion binding|protein binding			large_intestine(1)	1	Lung NSC(181;0.168)|all_lung(186;0.215)																	---	---	---	---
RELN	5649	broad.mit.edu	37	7	103258549	103258549	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103258549delA	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036			reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	104022437	104022438	+	Intron	INS	-	G	G	rs141950841	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104022437_104022438insG	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351			lipoma HMGIC fusion partner-like 3							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	109963622	109963623	+	IGR	INS	-	TC	TC	rs142763084		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109963622_109963623insTC								EIF3IP1 (363352 upstream) : IMMP2L (339487 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	109986637	109986645	+	IGR	DEL	TGTTTAAAC	-	-	rs143839260		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109986637_109986645delTGTTTAAAC								EIF3IP1 (386367 upstream) : IMMP2L (316465 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	110176863	110176863	+	IGR	DEL	T	-	-	rs35865341		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110176863delT								EIF3IP1 (576593 upstream) : IMMP2L (126247 downstream)																																			---	---	---	---
IMMP2L	83943	broad.mit.edu	37	7	110317799	110317800	+	Intron	DEL	AA	-	-	rs76882311		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110317799_110317800delAA	uc003vfq.1	-						IMMP2L_uc010ljr.1_Intron	NM_032549	NP_115938			IMP2 inner mitochondrial membrane protease-like						protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)														---	---	---	---
IMMP2L	83943	broad.mit.edu	37	7	110634189	110634190	+	Intron	INS	-	T	T	rs143251467	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110634189_110634190insT	uc003vfq.1	-						IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron	NM_032549	NP_115938			IMP2 inner mitochondrial membrane protease-like						protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	111277102	111277103	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111277102_111277103delTG								IMMP2L (74564 upstream) : DOCK4 (89062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	115368098	115368099	+	IGR	INS	-	T	T	rs71885194		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115368098_115368099insT								MDFIC (708835 upstream) : TFEC (207103 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	115823620	115823621	+	IGR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115823620_115823621delGT								TFEC (23670 upstream) : TES (26960 downstream)																																			---	---	---	---
ST7	7982	broad.mit.edu	37	7	116749385	116749387	+	Intron	DEL	AGA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116749385_116749387delAGA	uc003vin.2	+						ST7_uc011knl.1_Intron|ST7_uc003vio.2_Intron|ST7_uc003viq.2_Intron|ST7_uc011knm.1_Intron|ST7_uc003vir.2_Intron|ST7OT2_uc003viu.2_Intron|ST7_uc011knn.1_Intron	NM_021908	NP_068708			suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
ST7	7982	broad.mit.edu	37	7	116777989	116777989	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116777989delT	uc003vin.2	+						ST7_uc011knl.1_Intron|ST7_uc003vio.2_Intron|ST7_uc003viq.2_Intron|ST7_uc011knm.1_Intron|ST7_uc003vir.2_Intron|ST7OT2_uc003viu.2_Intron|ST7_uc011knn.1_Intron|ST7OT2_uc003viw.2_Intron|ST7_uc003vix.1_Intron	NM_021908	NP_068708			suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
CTTNBP2	83992	broad.mit.edu	37	7	117462286	117462286	+	Intron	DEL	C	-	-	rs147841048		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117462286delC	uc003vjf.2	-							NM_033427	NP_219499			cortactin binding protein 2											ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	117737640	117737640	+	IGR	DEL	A	-	-	rs35541508		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117737640delA								CTTNBP2 (224079 upstream) : NAA38 (86446 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	118928800	118928801	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118928800_118928801delTG								None (None upstream) : KCND2 (984921 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	119469615	119469618	+	IGR	DEL	GTGT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119469615_119469618delGTGT								None (None upstream) : KCND2 (444104 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	121407050	121407050	+	IGR	DEL	T	-	-	rs113635452		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121407050delT								FAM3C (370628 upstream) : PTPRZ1 (106109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	123757291	123757292	+	Intron	INS	-	T	T	rs147230501	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123757291_123757292insT	uc011koc.1	+											Homo sapiens disrupted in Rett 1 mRNA sequence.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	124447069	124447069	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124447069delA								GPR37 (41388 upstream) : POT1 (15372 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	124635668	124635669	+	Intron	INS	-	A	A	rs149217975	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124635668_124635669insA	uc010lkx.1	+						uc003vlp.2_Intron|uc003vlq.1_Intron					Homo sapiens cDNA FLJ33356 fis, clone BRACE2005160.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	125182931	125182931	+	IGR	DEL	G	-	-	rs111445325		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125182931delG								POT1 (612894 upstream) : GRM8 (895721 downstream)																																			---	---	---	---
PAX4	5078	broad.mit.edu	37	7	127252522	127252525	+	Intron	DEL	TGGA	-	-	rs68012321		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127252522_127252525delTGGA	uc010lld.1	-						PAX4_uc003vmf.2_Intron|PAX4_uc003vmg.1_Intron|PAX4_uc003vmh.2_Intron	NM_006193	NP_006184			paired box 4						cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	128465854	128465854	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128465854delT								CCDC136 (3671 upstream) : FLNC (4629 downstream)																																			---	---	---	---
AHCYL2	23382	broad.mit.edu	37	7	128868903	128868912	+	Intron	DEL	TTTTTTTTTT	-	-	rs112833440		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128868903_128868912delTTTTTTTTTT	uc011kov.1	+						AHCYL2_uc003vot.2_Intron	NM_015328	NP_056143			S-adenosylhomocysteine hydrolase-like 2 isoform						one-carbon metabolic process		adenosylhomocysteinase activity			ovary(2)	2																		---	---	---	---
UBE2H	7328	broad.mit.edu	37	7	129579798	129579799	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129579798_129579799insA	uc003vpf.1	-						UBE2H_uc003vpg.1_Intron	NM_003344	NP_003335			ubiquitin-conjugating enzyme E2H isoform 1						protein K11-linked ubiquitination|protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin-protein ligase activity			skin(1)	1	Melanoma(18;0.0435)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	129610297	129610298	+	IGR	INS	-	T	T	rs35922236		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129610297_129610298insT								UBE2H (17508 upstream) : ZC3HC1 (47829 downstream)																																			---	---	---	---
KLHDC10	23008	broad.mit.edu	37	7	129760285	129760285	+	Intron	DEL	T	-	-	rs11313553		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129760285delT	uc003vpj.1	+						KLHDC10_uc003vpk.1_Intron|KLHDC10_uc010lmb.1_Intron	NM_014997	NP_055812			kelch domain containing 10												0																		---	---	---	---
FLJ43663	378805	broad.mit.edu	37	7	130792087	130792087	+	5'Flank	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130792087delA	uc011kpk.1	-						MKLN1_uc011kpl.1_5'Flank|FLJ43663_uc003vqo.1_5'Flank|FLJ43663_uc003vqp.2_Intron|FLJ43663_uc003vqq.2_Intron	NR_024153				Homo sapiens cDNA FLJ43663 fis, clone SYNOV4005989.												0																		---	---	---	---
MKLN1	4289	broad.mit.edu	37	7	130965409	130965409	+	Intron	DEL	T	-	-	rs147597893		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130965409delT	uc011kpl.1	+							NM_001145354	NP_001138826			muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	131458803	131458804	+	IGR	INS	-	T	T	rs140370648	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131458803_131458804insT								PODXL (217427 upstream) : PLXNA4 (349288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	132382225	132382226	+	Intron	INS	-	T	T	rs146210045		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132382225_132382226insT	uc003vrd.1	+											Homo sapiens cDNA FLJ40288 fis, clone TESTI2028098.																														---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133718827	133718828	+	Intron	INS	-	A	A	rs149551842	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133718827_133718828insA	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron|EXOC4_uc011kpq.1_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	135989025	135989026	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135989025_135989026insT								LUZP6 (326821 upstream) : CHRM2 (564373 downstream)																																			---	---	---	---
DGKI	9162	broad.mit.edu	37	7	137368585	137368586	+	Intron	DEL	AG	-	-	rs72200843		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137368585_137368586delAG	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708			diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
CREB3L2	64764	broad.mit.edu	37	7	137631834	137631835	+	Intron	DEL	CT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137631834_137631835delCT	uc003vtw.2	-						CREB3L2_uc003vtx.1_Intron|CREB3L2_uc003vty.3_Intron	NM_194071	NP_919047			cAMP responsive element binding protein 3-like						chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160								T	FUS	fibromyxoid sarcoma								---	---	---	---
KIAA1549	57670	broad.mit.edu	37	7	138586073	138586074	+	Intron	DEL	TT	-	-	rs67139075		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138586073_138586074delTT	uc011kql.1	-						KIAA1549_uc011kqi.1_5'Flank|KIAA1549_uc003vuk.3_Intron|KIAA1549_uc011kqj.1_Intron|KIAA1549_uc011kqk.1_5'Flank	NM_020910	NP_065961			hypothetical protein LOC57670 isoform 1							integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230								O	BRAF	pilocytic astrocytoma								---	---	---	---
TBXAS1	6916	broad.mit.edu	37	7	139491608	139491608	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139491608delT	uc003vvh.2	+						TBXAS1_uc010lne.2_Intron	NM_001130966	NP_001124438			thromboxane A synthase 1, platelet isoform						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)																	---	---	---	---
TBXAS1	6916	broad.mit.edu	37	7	139514711	139514711	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139514711delG	uc003vvh.2	+						TBXAS1_uc010lne.2_Intron	NM_001130966	NP_001124438			thromboxane A synthase 1, platelet isoform						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	140857228	140857229	+	IGR	DEL	CA	-	-	rs111942925		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140857228_140857229delCA								MRPS33 (142447 upstream) : AGK (393849 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	141131209	141131209	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141131209delG								MRPS33 (416428 upstream) : AGK (119869 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	142039884	142039885	+	Intron	INS	-	A	A	rs147927937	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142039884_142039885insA	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	143844318	143844318	+	IGR	DEL	C	-	-	rs35439320		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143844318delC								OR2A14 (17181 upstream) : CTAGE4 (36230 downstream)																																			---	---	---	---
OR2A9P	441295	broad.mit.edu	37	7	144049837	144049847	+	Intron	DEL	TACTAGTTGAA	-	-	rs67718616		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144049837_144049847delTACTAGTTGAA	uc003wec.1	-						ARHGEF5_uc003wek.2_5'Flank|ARHGEF5_uc003wel.2_5'Flank					SubName: Full=Seven transmembrane helix receptor;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	145438228	145438229	+	IGR	INS	-	T	T	rs146407474	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145438228_145438229insT								TPK1 (905082 upstream) : CNTNAP2 (375224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	145544535	145544536	+	IGR	DEL	TG	-	-	rs77595842		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145544535_145544536delTG								None (None upstream) : CNTNAP2 (268917 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	145574189	145574189	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145574189delT								None (None upstream) : CNTNAP2 (239264 downstream)																																			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	145919750	145919751	+	Intron	INS	-	T	T	rs145075805		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145919750_145919751insT	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	146348113	146348113	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146348113delT	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	146676754	146676754	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146676754delA	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147575242	147575243	+	Intron	INS	-	A	A	rs72573431		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147575242_147575243insA	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	148925848	148925849	+	IGR	DEL	AG	-	-	rs72124544		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148925848_148925849delAG								ZNF282 (2511 upstream) : ZNF212 (10925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	149596848	149596849	+	IGR	INS	-	A	A	rs140226956	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149596848_149596849insA								ATP6V0E2 (19062 upstream) : ACTR3C (347453 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	149802175	149802175	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149802175delT								ATP6V0E2 (224389 upstream) : ACTR3C (142127 downstream)																																			---	---	---	---
CRYGN	155051	broad.mit.edu	37	7	151140603	151140603	+	5'Flank	DEL	A	-	-	rs149527582		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151140603delA	uc003wkg.2	-											Homo sapiens gammaN-crystallin variant (CRYGN) mRNA, complete cds.												0			OV - Ovarian serous cystadenocarcinoma(82;0.00358)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152113031	152113032	+	Intron	INS	-	GACTA	GACTA	rs147318691		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152113031_152113032insGACTA	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	7	152775206	152775207	+	IGR	INS	-	GA	GA	rs138877604	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152775206_152775207insGA								ACTR3B (222743 upstream) : DPP6 (809212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	153162988	153162988	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153162988delG								ACTR3B (610525 upstream) : DPP6 (421431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155682618	155682619	+	IGR	INS	-	G	G	rs140584759	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155682618_155682619insG								SHH (77651 upstream) : C7orf4 (650566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155853798	155853799	+	IGR	INS	-	TA	TA	rs71749354		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155853798_155853799insTA								SHH (248831 upstream) : C7orf4 (479386 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	156362322	156362323	+	IGR	DEL	AA	-	-	rs35394572		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156362322_156362323delAA								C7orf4 (28527 upstream) : C7orf13 (68739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	156379294	156379294	+	IGR	DEL	T	-	-	rs34718107		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156379294delT								C7orf4 (45499 upstream) : C7orf13 (51768 downstream)																																			---	---	---	---
LMBR1	64327	broad.mit.edu	37	7	156677374	156677375	+	Intron	INS	-	C	C	rs141311090	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156677374_156677375insC	uc003wmw.3	-						LMBR1_uc003wmx.3_Intron|LMBR1_uc010lqn.2_Intron|LMBR1_uc011kvx.1_Intron|LMBR1_uc010lqo.2_Intron	NM_022458	NP_071903			limb region 1 protein							integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)														---	---	---	---
NOM1	64434	broad.mit.edu	37	7	156744408	156744408	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156744408delT	uc003wmy.2	+							NM_138400	NP_612409			nucleolar protein with MIF4G domain 1						RNA metabolic process	nucleolus	protein binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	157254059	157254060	+	IGR	INS	-	C	C			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157254059_157254060insC								DNAJB6 (43927 upstream) : PTPRN2 (77691 downstream)																																			---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157948296	157948297	+	Intron	INS	-	CAT	CAT	rs62639095		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157948296_157948297insCAT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	158041777	158041778	+	Intron	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158041777_158041778delCA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	158234535	158234540	+	Intron	DEL	TGGTGA	-	-	rs148348650	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158234535_158234540delTGGTGA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	209203	209203	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:209203delT								ZNF596 (11871 upstream) : FBXO25 (147605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	736808	736808	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:736808delT	uc003wpj.1	+											Homo sapiens cDNA clone IMAGE:4824304.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	826287	826287	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:826287delT	uc003wpj.1	+											Homo sapiens cDNA clone IMAGE:4824304.																														---	---	---	---
MYOM2	9172	broad.mit.edu	37	8	2018743	2018746	+	Intron	DEL	CTAT	-	-	rs3837174		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2018743_2018746delCTAT	uc003wpx.3	+						MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961			myomesin 2						muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	2224572	2224573	+	IGR	INS	-	CTGTGATA	CTGTGATA	rs143997057	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2224572_2224573insCTGTGATA								MYOM2 (131193 upstream) : CSMD1 (568303 downstream)																																			---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	4483861	4483861	+	Intron	DEL	T	-	-	rs146359340	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4483861delT	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	6185633	6185633	+	IGR	DEL	A	-	-	rs67343301		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6185633delA								None (None upstream) : MCPH1 (78488 downstream)																																			---	---	---	---
MCPH1	79648	broad.mit.edu	37	8	6364425	6364425	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6364425delT	uc003wqi.2	+						ANGPT2_uc003wqj.3_Intron|ANGPT2_uc003wqk.3_Intron|ANGPT2_uc010lri.2_Intron	NM_024596	NP_078872			microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	8308147	8308147	+	IGR	DEL	A	-	-	rs75720425		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8308147delA								SGK223 (68890 upstream) : CLDN23 (251519 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	8506272	8506275	+	IGR	DEL	AGAG	-	-	rs72000522		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8506272_8506275delAGAG								SGK223 (267015 upstream) : CLDN23 (53391 downstream)																																			---	---	---	---
MFHAS1	9258	broad.mit.edu	37	8	8698977	8698978	+	Intron	INS	-	A	A	rs140607386		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8698977_8698978insA	uc003wsj.1	-							NM_004225	NP_004216			malignant fibrous histiocytoma amplified												0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)														---	---	---	---
ERI1	90459	broad.mit.edu	37	8	8870531	8870532	+	Intron	INS	-	T	T	rs146429223	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8870531_8870532insT	uc011kwu.1	+						ERI1_uc003wsk.2_Intron	NM_153332	NP_699163			three prime histone mRNA exonuclease 1						gene silencing by RNA|rRNA 3'-end processing	cytoplasm|histone pre-mRNA 3'end processing complex|nucleolus	3'-5' exonuclease activity|histone pre-mRNA stem-loop binding|metal ion binding|ribosome binding|rRNA binding				0					Adenosine monophosphate(DB00131)													---	---	---	---
TNKS	8658	broad.mit.edu	37	8	9534196	9534197	+	Intron	INS	-	TGTGTG	TGTGTG	rs147459978	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9534196_9534197insTGTGTG	uc003wss.2	+						TNKS_uc011kwv.1_Intron|TNKS_uc011kww.1_Intron	NM_003747	NP_003738			tankyrase, TRF1-interacting ankyrin-related						mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)														---	---	---	---
MSRA	4482	broad.mit.edu	37	8	10157634	10157635	+	Intron	INS	-	TG	TG	rs138787043	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10157634_10157635insTG	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc011kwy.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463			methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)													---	---	---	---
SOX7	83595	broad.mit.edu	37	8	10694196	10694197	+	Intron	INS	-	G	G	rs140427114	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10694196_10694197insG	uc011kwz.1	-						PINX1_uc003wth.2_Intron|PINX1_uc003wti.2_Intron	NM_031439	NP_113627			SRY-box 7						endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding			breast(1)	1				COAD - Colon adenocarcinoma(149;0.0732)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	11110975	11110976	+	IGR	INS	-	A	A	rs144738991	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11110975_11110976insA								XKR6 (52100 upstream) : MTMR9 (31024 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	11136213	11136214	+	IGR	INS	-	AG	AG	rs149636132	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11136213_11136214insAG								XKR6 (77338 upstream) : MTMR9 (5786 downstream)																																			---	---	---	---
BLK	640	broad.mit.edu	37	8	11392729	11392732	+	Intron	DEL	AGAA	-	-	rs4642601		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11392729_11392732delAGAA	uc003wty.2	+						BLK_uc003wtz.2_Intron	NM_001715	NP_001706			B lymphoid tyrosine kinase						intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	11477898	11477901	+	IGR	DEL	GTGT	-	-	rs144150835		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11477898_11477901delGTGT								BLK (55791 upstream) : GATA4 (56567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	12514752	12514756	+	Intron	DEL	TTTTG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12514752_12514756delTTTTG	uc003wvy.3	-						uc003wwc.3_Intron					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	12716467	12716468	+	IGR	INS	-	A	A	rs111369842		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12716467_12716468insA								LOC340357 (47557 upstream) : C8orf79 (86683 downstream)																																			---	---	---	---
C8orf48	157773	broad.mit.edu	37	8	13422262	13422262	+	5'Flank	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13422262delG	uc003wwp.2	+							NM_001007090	NP_001007091			hypothetical protein LOC157773								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	15130756	15130756	+	IGR	DEL	A	-	-	rs138559900		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15130756delA								SGCZ (34964 upstream) : TUSC3 (266974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	16449221	16449222	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16449221_16449222insA								MSR1 (398921 upstream) : FGF20 (401112 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	17338398	17338398	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17338398delC								MTMR7 (67358 upstream) : SLC7A2 (16202 downstream)																																			---	---	---	---
MTUS1	57509	broad.mit.edu	37	8	17593534	17593534	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17593534delT	uc003wxv.2	-						MTUS1_uc010lsy.2_Intron|MTUS1_uc003wxw.2_Intron|MTUS1_uc010lsz.2_Intron	NM_001001924	NP_001001924			mitochondrial tumor suppressor 1 isoform 1							Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)														---	---	---	---
MTUS1	57509	broad.mit.edu	37	8	17640588	17640589	+	Intron	INS	-	AAAC	AAAC	rs146414696	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17640588_17640589insAAAC	uc003wxv.2	-						MTUS1_uc003wxw.2_Intron|MTUS1_uc010lsz.2_Intron	NM_001001924	NP_001001924			mitochondrial tumor suppressor 1 isoform 1							Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)														---	---	---	---
PSD3	23362	broad.mit.edu	37	8	18496773	18496773	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18496773delT	uc003wza.2	-						PSD3_uc003wyx.3_Intron|PSD3_uc003wyy.2_Intron|PSD3_uc003wyz.2_Intron	NM_015310	NP_056125			ADP-ribosylation factor guanine nucleotide						regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)														---	---	---	---
CSGALNACT1	55790	broad.mit.edu	37	8	19361081	19361082	+	Intron	DEL	TT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19361081_19361082delTT	uc011kyn.1	-						CSGALNACT1_uc011kyo.1_Intron|CSGALNACT1_uc003wzg.2_Intron|CSGALNACT1_uc011kyp.1_Intron|CSGALNACT1_uc003wzh.2_Intron	NM_001130518	NP_001123990			chondroitin sulfate						anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)														---	---	---	---
CSGALNACT1	55790	broad.mit.edu	37	8	19509957	19509957	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19509957delT	uc011kyo.1	-						CSGALNACT1_uc003wzg.2_Intron|CSGALNACT1_uc011kyp.1_Intron	NM_018371	NP_060841			chondroitin sulfate						anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	20284941	20284942	+	IGR	INS	-	A	A	rs148621735		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20284941_20284942insA								LZTS1 (172138 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	20570795	20570795	+	IGR	DEL	T	-	-	rs66885242		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20570795delT								LZTS1 (457992 upstream) : GFRA2 (978735 downstream)																																			---	---	---	---
SLC39A14	23516	broad.mit.edu	37	8	22239667	22239668	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22239667_22239668insA	uc003xbq.3	+						SLC39A14_uc011kzg.1_Intron|SLC39A14_uc003xbp.3_Intron|SLC39A14_uc011kzh.1_Intron	NM_001128431	NP_001121903			solute carrier family 39 (zinc transporter),							endoplasmic reticulum|Golgi apparatus|integral to membrane|lamellipodium|plasma membrane	zinc ion transmembrane transporter activity				0				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	23603853	23603854	+	IGR	INS	-	TTTCTTTTCTTTTC	TTTCTTTTCTTTTC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23603853_23603854insTTTCTTTTCTTTTC								NKX2-6 (39931 upstream) : STC1 (95580 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	24667648	24667648	+	IGR	DEL	A	-	-	rs74582007		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24667648delA								ADAM7 (283167 upstream) : NEFM (103626 downstream)																																			---	---	---	---
EBF2	64641	broad.mit.edu	37	8	25753440	25753443	+	Intron	DEL	TGTG	-	-	rs141675919		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25753440_25753443delTGTG	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron	NM_022659	NP_073150			early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	28123682	28123702	+	IGR	DEL	AACGGAGACGGGGTTATTTAT	-	-	rs140538122		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28123682_28123702delAACGGAGACGGGGTTATTTAT								ELP3 (75015 upstream) : PNOC (50947 downstream)																																			---	---	---	---
INTS9	55756	broad.mit.edu	37	8	28681113	28681113	+	Intron	DEL	C	-	-	rs75083899		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28681113delC	uc003xha.2	-						INTS9_uc011lav.1_Intron|INTS9_uc011law.1_Intron|INTS9_uc011lax.1_Intron|INTS9_uc010lvc.2_Intron|INTS9_uc003xhb.2_Intron	NM_018250	NP_060720			integrator complex subunit 9 isoform 1						snRNA processing	integrator complex	protein binding			central_nervous_system(1)|pancreas(1)	2		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	29756957	29756958	+	IGR	INS	-	A	A	rs139907068		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29756957_29756958insA								C8orf75 (151332 upstream) : LOC286135 (22071 downstream)																																			---	---	---	---
UBXN8	7993	broad.mit.edu	37	8	30612474	30612474	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30612474delT	uc003xii.2	+						UBXN8_uc010lvi.2_Intron|UBXN8_uc011lbb.1_Intron|UBXN8_uc003xij.2_Intron	NM_005671	NP_005662			reproduction 8						single fertilization						0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	30818240	30818242	+	IGR	DEL	GAG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30818240_30818242delGAG								TEX15 (72018 upstream) : PURG (35079 downstream)																																			---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32598905	32598905	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32598905delT	uc003xiv.2	+						NRG1_uc003xip.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc003xix.2_Intron|NRG1_uc003xiy.2_Intron|NRG1_uc010lvt.2_Intron|NRG1_uc011lbg.1_Intron|NRG1_uc011lbh.1_Intron|NRG1_uc003xiz.1_Intron|NRG1_uc003xja.2_Intron	NM_013964	NP_039258			neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
FUT10	84750	broad.mit.edu	37	8	33287710	33287713	+	Intron	DEL	AGAC	-	-	rs140486250		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33287710_33287713delAGAC	uc003xje.2	-						FUT10_uc003xjc.2_Intron|FUT10_uc003xjd.2_Intron|FUT10_uc011lbi.1_Intron|FUT10_uc003xjf.2_Intron|FUT10_uc003xjg.2_Intron|FUT10_uc003xjh.2_Intron	NM_032664	NP_116053			fucosyltransferase 10						embryo development|fertilization|hemopoiesis|L-fucose catabolic process|nervous system development|protein folding|protein glycosylation|protein targeting|wound healing	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			ovary(1)|pancreas(1)	2				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	33780295	33780295	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33780295delT								DUSP26 (322856 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	34591990	34591990	+	IGR	DEL	T	-	-	rs66494757		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34591990delT								None (None upstream) : UNC5D (500985 downstream)																																			---	---	---	---
UNC5D	137970	broad.mit.edu	37	8	35503045	35503046	+	Intron	INS	-	TG	TG	rs140501800	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35503045_35503046insTG	uc003xjr.1	+						UNC5D_uc003xjs.1_Intron	NM_080872	NP_543148			unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	36224645	36224646	+	IGR	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36224645_36224646delAC								UNC5D (572465 upstream) : KCNU1 (417196 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	36904437	36904437	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36904437delT								KCNU1 (110796 upstream) : ZNF703 (648864 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	37543992	37543992	+	IGR	DEL	A	-	-	rs34152979		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37543992delA								KCNU1 (750351 upstream) : ZNF703 (9309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	40781208	40781211	+	IGR	DEL	GTTT	-	-	rs139006987		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40781208_40781211delGTTT								ZMAT4 (25865 upstream) : SFRP1 (338268 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	41771166	41771166	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41771166delA								ANK1 (16886 upstream) : MYST3 (15832 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	43773492	43773493	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43773492_43773493insT								POTEA (555164 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	43826359	43826360	+	IGR	INS	-	T	T	rs150763522		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43826359_43826360insT								POTEA (608031 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	46949714	46949715	+	IGR	DEL	AG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:46949714_46949715delAG								None (None upstream) : BEYLA (802793 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	48901464	48901464	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48901464delA								MCM4 (11396 upstream) : UBE2V2 (19531 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	49104926	49104926	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49104926delC								UBE2V2 (130474 upstream) : EFCAB1 (518425 downstream)																																			---	---	---	---
SNTG1	54212	broad.mit.edu	37	8	51676417	51676438	+	Intron	DEL	ACACACACACACACACACACAC	-	-	rs71837907		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51676417_51676438delACACACACACACACACACACAC	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840			syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)																---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52240811	52240811	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52240811delT	uc003xqu.3	-						PXDNL_uc003xqt.3_Intron	NM_144651	NP_653252			peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	54028648	54028649	+	IGR	INS	-	TG	TG	rs56166315		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54028648_54028649insTG								NPBWR1 (175195 upstream) : OPRK1 (109627 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	56783782	56783782	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56783782delA								TGS1 (45779 upstream) : LYN (8604 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	57609795	57609796	+	IGR	DEL	CT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57609795_57609796delCT								PENK (250513 upstream) : IMPAD1 (260695 downstream)																																			---	---	---	---
SDCBP	6386	broad.mit.edu	37	8	59490371	59490371	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59490371delT	uc003xtn.2	+						SDCBP_uc003xto.2_Intron|SDCBP_uc003xtr.2_Intron|SDCBP_uc003xtp.2_Intron|SDCBP_uc003xtq.2_Intron|SDCBP_uc003xts.2_Intron|SDCBP_uc011led.1_Intron	NM_005625	NP_005616			syntenin isoform 1						actin cytoskeleton organization|axon guidance|positive regulation of phosphorylation|protein targeting to membrane|substrate-dependent cell migration, cell extension|synaptic transmission	cytoskeleton|cytosol|endoplasmic reticulum membrane|focal adhesion|interleukin-5 receptor complex|melanosome|nucleus	cytoskeletal adaptor activity|frizzled binding|interleukin-5 receptor binding|protein heterodimerization activity|protein N-terminus binding|syndecan binding				0		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	60136021	60136022	+	IGR	INS	-	A	A	rs76235167		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60136021_60136022insA								TOX (104254 upstream) : CA8 (965401 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	60317489	60317490	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60317489_60317490insA								TOX (285722 upstream) : CA8 (783933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	60558893	60558893	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60558893delC								TOX (527126 upstream) : CA8 (542530 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	61823451	61823452	+	IGR	INS	-	T	T	rs34504322		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61823451_61823452insT								CHD7 (43988 upstream) : CLVS1 (377073 downstream)																																			---	---	---	---
ASPH	444	broad.mit.edu	37	8	62438951	62438951	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62438951delT	uc003xuj.2	-						ASPH_uc011leg.1_Intron	NM_004318	NP_004309			aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)													---	---	---	---
NKAIN3	286183	broad.mit.edu	37	8	63527368	63527368	+	Intron	DEL	G	-	-	rs113818044		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63527368delG	uc010lyq.1	+							NM_173688	NP_775959			Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	64508328	64508329	+	IGR	INS	-	C	C	rs147231272	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64508328_64508329insC								YTHDF3 (382983 upstream) : MIR124-2 (783377 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	65414474	65414475	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65414474_65414475insA								MIR124-2 (122660 upstream) : LOC401463 (72393 downstream)																																			---	---	---	---
SGK3	23678	broad.mit.edu	37	8	67658795	67658795	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67658795delT	uc003xwr.2	+						SGK3_uc003xwp.2_Intron	NM_001033578	NP_001028750			serum/glucocorticoid regulated kinase 3 isoform						cell communication|response to stress	cytoplasmic membrane-bounded vesicle|early endosome	ATP binding|phosphatidylinositol binding|protein serine/threonine kinase activity			ovary(1)|large_intestine(1)|lung(1)|breast(1)	4	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)															---	---	---	---
PREX2	80243	broad.mit.edu	37	8	68907311	68907311	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68907311delC	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146			DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	71438568	71438569	+	IGR	DEL	GT	-	-	rs71739247		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71438568_71438569delGT								NCOA2 (122548 upstream) : TRAM1 (47104 downstream)																																			---	---	---	---
TRAM1	23471	broad.mit.edu	37	8	71494998	71494998	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71494998delA	uc003xyo.1	-						TRAM1_uc011lfc.1_Intron	NM_014294	NP_055109			translocation associated membrane protein 1						cotranslational protein targeting to membrane|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	protein binding|receptor activity			ovary(1)	1			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	72803758	72803759	+	Intron	INS	-	TG	TG	rs143649563	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72803758_72803759insTG	uc011lff.1	+						uc003xyy.2_Intron					Homo sapiens cDNA FLJ41321 fis, clone BRAMY2045299.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	74854632	74854634	+	IGR	DEL	AGA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74854632_74854634delAGA								UBE2W (63522 upstream) : TCEB1 (4000 downstream)																																			---	---	---	---
GDAP1	54332	broad.mit.edu	37	8	75260461	75260461	+	5'Flank	DEL	A	-	-	rs113167117		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75260461delA	uc003yah.2	+						GDAP1_uc011lfj.1_5'Flank|GDAP1_uc003yai.2_5'Flank	NM_018972	NP_061845			ganglioside-induced differentiation-associated							cytoplasm					0	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	75871169	75871170	+	IGR	DEL	AT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75871169_75871170delAT								PI15 (103907 upstream) : CRISPLD1 (25673 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	77061507	77061507	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77061507delG								HNF4G (582448 upstream) : LOC100192378 (461608 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78924702	78924705	+	IGR	DEL	CTTC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78924702_78924705delCTTC								None (None upstream) : PKIA (503631 downstream)																																			---	---	---	---
TPD52	7163	broad.mit.edu	37	8	81033317	81033317	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81033317delA	uc003ybs.1	-						TPD52_uc010lzs.1_Intron|TPD52_uc003ybt.1_Intron	NM_001025253	NP_001020424			tumor protein D52 isoform 2						anatomical structure morphogenesis|B cell differentiation|secretion	endoplasmic reticulum|perinuclear region of cytoplasm	calcium ion binding|protein heterodimerization activity|protein homodimerization activity			ovary(1)	1	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	81821846	81821846	+	IGR	DEL	T	-	-	rs11307071		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81821846delT								ZNF704 (34830 upstream) : PAG1 (58202 downstream)																																			---	---	---	---
PAG1	55824	broad.mit.edu	37	8	81904094	81904094	+	Intron	DEL	T	-	-	rs112853594		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81904094delT	uc003ybz.2	-							NM_018440	NP_060910			phosphoprotein associated with glycosphingolipid						epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity				0	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	83688432	83688432	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83688432delA								SNX16 (933911 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84526578	84526579	+	IGR	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84526578_84526579delTC								None (None upstream) : RALYL (568874 downstream)																																			---	---	---	---
RALYL	138046	broad.mit.edu	37	8	85790841	85790842	+	Intron	INS	-	A	A	rs141814068	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85790841_85790842insA	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_Intron|RALYL_uc010lzy.2_Intron|RALYL_uc003yct.3_Intron|RALYL_uc003ycu.3_Intron|RALYL_uc003ycv.3_Intron	NM_001100392	NP_001093862			RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	86563684	86563685	+	IGR	INS	-	T	T	rs148473022		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86563684_86563685insT								CA2 (169963 upstream) : REXO1L1 (4879 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	89677444	89677444	+	IGR	DEL	A	-	-	rs111608481		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89677444delA								MMP16 (337727 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	89723904	89723904	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89723904delA								MMP16 (384187 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	92468138	92468138	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92468138delA								SLC26A7 (57758 upstream) : RUNX1T1 (503014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	92757625	92757626	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92757625_92757626insA								SLC26A7 (347245 upstream) : RUNX1T1 (213526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	93365833	93365833	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93365833delC								RUNX1T1 (258127 upstream) : C8orf83 (530032 downstream)																																			---	---	---	---
CDH17	1015	broad.mit.edu	37	8	95197505	95197508	+	Intron	DEL	ACAC	-	-	rs113893372		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95197505_95197508delACAC	uc003ygh.2	-						CDH17_uc011lgo.1_Intron|CDH17_uc011lgp.1_Intron	NM_004063	NP_004054			cadherin 17 precursor							integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	95610903	95610903	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95610903delA								KIAA1429 (45215 upstream) : ESRP1 (42461 downstream)																																			---	---	---	---
ESRP1	54845	broad.mit.edu	37	8	95661668	95661669	+	Intron	INS	-	CTC	CTC	rs112016373		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95661668_95661669insCTC	uc003ygq.3	+						ESRP1_uc003ygr.3_Intron|ESRP1_uc003ygs.3_Intron|ESRP1_uc003ygt.3_Intron|ESRP1_uc003ygu.3_Intron|ESRP1_uc003ygv.2_Intron|ESRP1_uc003ygw.2_Intron	NM_017697	NP_060167			RNA binding motif protein 35A isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	nucleus|plasma membrane	mRNA binding|nucleotide binding		ESRP1/RAF1(4)	prostate(4)	4																		---	---	---	---
ESRP1	54845	broad.mit.edu	37	8	95667316	95667316	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95667316delT	uc003ygq.3	+						ESRP1_uc003ygr.3_Intron|ESRP1_uc003ygs.3_Intron|ESRP1_uc003ygt.3_Intron|ESRP1_uc003ygu.3_Intron|ESRP1_uc003ygv.2_Intron|ESRP1_uc003ygw.2_Intron	NM_017697	NP_060167			RNA binding motif protein 35A isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	nucleus|plasma membrane	mRNA binding|nucleotide binding		ESRP1/RAF1(4)	prostate(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	97125658	97125658	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97125658delA								C8orf37 (844221 upstream) : GDF6 (28902 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	97471013	97471015	+	IGR	DEL	TTT	-	-	rs33965900		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97471013_97471015delTTT								PTDSS1 (124239 upstream) : SDC2 (34867 downstream)																																			---	---	---	---
PGCP	10404	broad.mit.edu	37	8	98104113	98104114	+	Intron	DEL	AG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98104113_98104114delAG	uc003yhw.2	+							NM_016134	NP_057218			plasma glutamate carboxypeptidase precursor						peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity			upper_aerodigestive_tract(1)	1	Breast(36;1.86e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	98316615	98316615	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98316615delA								TSPYL5 (26439 upstream) : MTDH (339792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	99999379	99999380	+	IGR	INS	-	TG	TG	rs140963837	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99999379_99999380insTG								OSR2 (35055 upstream) : VPS13B (26114 downstream)																																			---	---	---	---
VPS13B	157680	broad.mit.edu	37	8	100119738	100119738	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100119738delT	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron|VPS13B_uc003yit.2_Intron|VPS13B_uc003yiu.1_Intron|VPS13B_uc003yis.2_Intron|VPS13B_uc011lgy.1_Intron	NM_017890	NP_060360			vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	100938107	100938107	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100938107delG								COX6C (32212 upstream) : RGS22 (35169 downstream)																																			---	---	---	---
NCALD	83988	broad.mit.edu	37	8	102819093	102819093	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102819093delA	uc003ykf.2	-						NCALD_uc003ykg.2_Intron|NCALD_uc003ykh.2_Intron|NCALD_uc003yki.2_Intron|NCALD_uc003ykj.2_Intron|NCALD_uc003ykk.2_Intron|NCALD_uc003ykl.2_Intron	NM_001040628	NP_001035718			neurocalcin delta						synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)															---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104591487	104591488	+	Intron	DEL	TC	-	-	rs140184895		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104591487_104591488delTC	uc003ylp.2	+							NM_001100117	NP_001093587			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104980647	104980647	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104980647delT	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron|RIMS2_uc003ylt.2_Intron	NM_014677	NP_055492			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	105729162	105729162	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105729162delG								LRP12 (127942 upstream) : ZFPM2 (601985 downstream)																																			---	---	---	---
OXR1	55074	broad.mit.edu	37	8	107593333	107593333	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107593333delC	uc011lht.1	+						OXR1_uc003ymf.2_Intron	NM_018002	NP_060472			oxidation resistance 1 isoform 1						cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	108833953	108833953	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108833953delT								ANGPT1 (323699 upstream) : RSPO2 (77592 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	109195267	109195268	+	IGR	INS	-	A	A	rs142375037	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109195267_109195268insA								RSPO2 (99354 upstream) : EIF3E (18705 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	110184373	110184374	+	IGR	INS	-	T	T	rs34593995		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110184373_110184374insT								TRHR (52563 upstream) : NUDCD1 (68775 downstream)																																			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113602957	113602958	+	Intron	INS	-	T	T	rs138492542	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113602957_113602958insT	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	114390991	114390992	+	Intron	INS	-	GT	GT	rs143016847	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114390991_114390992insGT	uc003ynu.2	-						CSMD3_uc003ynt.2_5'Flank|CSMD3_uc011lhx.1_Intron|CSMD3_uc010mcx.1_Intron|CSMD3_uc003ynx.3_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116097379	116097379	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116097379delA								None (None upstream) : TRPS1 (323346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116105552	116105553	+	IGR	INS	-	T	T	rs148728832	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116105552_116105553insT								None (None upstream) : TRPS1 (315172 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	117046455	117046455	+	IGR	DEL	G	-	-	rs6469621	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117046455delG								TRPS1 (365227 upstream) : EIF3H (610601 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	117363567	117363572	+	IGR	DEL	GAATAA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117363567_117363572delGAATAA								TRPS1 (682339 upstream) : EIF3H (293484 downstream)																																			---	---	---	---
EXT1	2131	broad.mit.edu	37	8	118826473	118826474	+	Intron	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs138277007	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118826473_118826474insGTGTGTGTGT	uc003yok.1	-							NM_000127	NP_000118			exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)					Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	8	119200277	119200278	+	IGR	DEL	AG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119200277_119200278delAG								EXT1 (76219 upstream) : SAMD12 (1417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	119982864	119982864	+	IGR	DEL	T	-	-	rs112439234		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119982864delT								TNFRSF11B (18481 upstream) : COLEC10 (96560 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	120002321	120002322	+	IGR	INS	-	C	C	rs140410251	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120002321_120002322insC								TNFRSF11B (37938 upstream) : COLEC10 (77102 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	120461744	120461745	+	IGR	INS	-	T	T	rs145180180	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120461744_120461745insT								NOV (25066 upstream) : ENPP2 (107574 downstream)																																			---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125693622	125693622	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125693622delT	uc003yrk.2	-						MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566			metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
NSMCE2	286053	broad.mit.edu	37	8	126150634	126150635	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126150634_126150635insT	uc003yrw.2	+						NSMCE2_uc003yrv.2_Intron	NM_173685	NP_775956			non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)															---	---	---	---
NSMCE2	286053	broad.mit.edu	37	8	126269532	126269533	+	Intron	INS	-	A	A	rs112767956		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126269532_126269533insA	uc003yrw.2	+							NM_173685	NP_775956			non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	127119790	127119791	+	IGR	INS	-	T	T	rs144609475	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127119790_127119791insT								TRIB1 (669148 upstream) : FAM84B (444896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128068836	128068838	+	IGR	DEL	ATT	-	-	rs138595902		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128068836_128068838delATT								FAM84B (498370 upstream) : LOC727677 (233224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128227023	128227024	+	Intron	INS	-	GT	GT	rs145286614	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128227023_128227024insGT	uc003ysa.1	-											Homo sapiens cDNA FLJ43320 fis, clone NT2RI2024935.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	128566191	128566191	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128566191delT								LOC727677 (71807 upstream) : MYC (181574 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129241721	129241722	+	IGR	INS	-	A	A	rs148713896	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129241721_129241722insA								MIR1208 (79287 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129485945	129485946	+	IGR	INS	-	T	T	rs142378654	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129485945_129485946insT								MIR1208 (323511 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	130488365	130488365	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130488365delT								None (None upstream) : GSDMC (272078 downstream)																																			---	---	---	---
ASAP1	50807	broad.mit.edu	37	8	131412737	131412738	+	Intron	INS	-	A	A	rs150863722		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131412737_131412738insA	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952			development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	132623654	132623655	+	IGR	INS	-	T	T	rs148393511	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132623654_132623655insT								ADCY8 (570819 upstream) : EFR3A (292704 downstream)																																			---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133195130	133195131	+	Intron	DEL	CA	-	-	rs72408873		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133195130_133195131delCA	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133493789	133493795	+	5'Flank	DEL	TCCCTCT	-	-	rs3840713		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133493789_133493795delTCCCTCT	uc003ytj.2	-						KCNQ3_uc010mdt.2_5'Flank	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
NDRG1	10397	broad.mit.edu	37	8	134281106	134281107	+	Intron	INS	-	CACA	CACA	rs139920944	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134281106_134281107insCACA	uc003yuh.2	-						NDRG1_uc003yug.2_Intron|NDRG1_uc010mee.2_Intron|NDRG1_uc010mef.2_Intron|NDRG1_uc011ljh.1_Intron|NDRG1_uc011lji.1_Intron	NM_001135242	NP_001128714			N-myc downstream regulated 1						cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)															---	---	---	---
ST3GAL1	6482	broad.mit.edu	37	8	134502557	134502558	+	Intron	INS	-	CT	CT	rs143140431	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134502557_134502558insCT	uc003yuk.2	-						ST3GAL1_uc003yum.2_Intron	NM_173344	NP_775479			ST3 beta-galactoside alpha-2,3-sialyltransferase						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	135010133	135010134	+	IGR	DEL	GA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135010133_135010134delGA								ST3GAL1 (425950 upstream) : ZFAT (479899 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135365926	135365927	+	IGR	INS	-	G	G	rs146340159	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135365926_135365927insG								ST3GAL1 (781743 upstream) : ZFAT (124106 downstream)																																			---	---	---	---
ZFAT	57623	broad.mit.edu	37	8	135602887	135602895	+	Intron	DEL	CACCACCAC	-	-	rs59042601		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135602887_135602895delCACCACCAC	uc003yup.2	-						ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron	NM_020863	NP_065914			zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)															---	---	---	---
ZFAT	57623	broad.mit.edu	37	8	135603038	135603049	+	Intron	DEL	CACCACCACCAC	-	-	rs34831588		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135603038_135603049delCACCACCACCAC	uc003yup.2	-						ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron	NM_020863	NP_065914			zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	135855056	135855056	+	IGR	DEL	A	-	-	rs34143263		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135855056delA								MIR30D (37868 upstream) : LOC286094 (391318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	136186456	136186456	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136186456delA								MIR30D (369268 upstream) : LOC286094 (59918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	137426483	137426484	+	IGR	INS	-	T	T	rs150838891	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137426483_137426484insT								KHDRBS3 (766637 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	137848709	137848709	+	IGR	DEL	T	-	-	rs34144447		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137848709delT								None (None upstream) : None (None downstream)																																			---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139453968	139453968	+	Intron	DEL	T	-	-	rs113874347		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139453968delT	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996			hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139637569	139637570	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139637569_139637570insA	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139704136	139704137	+	Intron	INS	-	GT	GT			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139704136_139704137insGT	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	140055636	140055637	+	IGR	INS	-	T	T	rs111229901		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140055636_140055637insT								COL22A1 (129400 upstream) : KCNK9 (557445 downstream)																																			---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141047684	141047685	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141047684_141047685delAC	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	142065927	142065928	+	IGR	INS	-	C	C	rs150595124	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142065927_142065928insC								PTK2 (54595 upstream) : DENND3 (72792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	142953653	142953653	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142953653delG								MIR1302-7 (85979 upstream) : NCRNA00051 (326064 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	145569911	145569911	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145569911delC								SCRT1 (9968 upstream) : C8ORFK29 (6976 downstream)																																			---	---	---	---
ZNF16	7564	broad.mit.edu	37	8	146167054	146167054	+	Intron	DEL	T	-	-	rs113061574		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146167054delT	uc003zet.2	-						ZNF16_uc003zeu.2_Intron	NM_001029976	NP_001025147			zinc finger protein 16						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)														---	---	---	---
FLJ35024	401491	broad.mit.edu	37	9	2582311	2582313	+	Intron	DEL	TTT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2582311_2582313delTTT	uc003zhh.1	-						FLJ35024_uc003zhi.2_Intron|FLJ35024_uc003zhj.3_Intron					Homo sapiens cDNA FLJ35024 fis, clone OCBBF2015233.												0																		---	---	---	---
GLIS3	169792	broad.mit.edu	37	9	4138513	4138513	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4138513delT	uc003zhw.1	-						GLIS3_uc003zhx.1_Intron|GLIS3_uc003zic.1_Intron|GLIS3_uc003zie.1_Intron|GLIS3_uc010mhh.1_Intron|GLIS3_uc003zid.1_Intron|GLIS3_uc010mhi.1_Intron|GLIS3_uc003zif.1_Intron|GLIS3_uc003zig.1_Intron|GLIS3_uc003zih.1_Intron|GLIS3_uc003zib.1_Intron|GLIS3_uc010mhg.1_Intron	NM_152629	NP_689842			GLIS family zinc finger 3 isoform b						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)														---	---	---	---
RCL1	10171	broad.mit.edu	37	9	4864704	4864705	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4864704_4864705insA	uc003ziv.1	+											Homo sapiens cDNA FLJ11677 fis, clone HEMBA1004778.						ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	6129399	6129404	+	IGR	DEL	CAGAGG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6129399_6129404delCAGAGG								RANBP6 (113759 upstream) : IL33 (86403 downstream)																																			---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	6754235	6754235	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6754235delG	uc010mhu.2	+							NM_001146696	NP_001140168			jumonji domain containing 2C isoform 4						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	7775794	7775795	+	IGR	DEL	AA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7775794_7775795delAA								KDM4C (600147 upstream) : C9orf123 (20698 downstream)																																			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	9710787	9710788	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9710787_9710788delAC	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	9	11116255	11116256	+	IGR	INS	-	A	A	rs150873848	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11116255_11116256insA								PTPRD (503532 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	12829991	12829991	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12829991delC								C9orf150 (6933 upstream) : MPDZ (275718 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	12960497	12960497	+	IGR	DEL	T	-	-	rs71489595		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12960497delT								C9orf150 (137439 upstream) : MPDZ (145212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13865182	13865184	+	IGR	DEL	GAA	-	-	rs141055428		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13865182_13865184delGAA								MPDZ (585619 upstream) : NFIB (216664 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	16236315	16236315	+	IGR	DEL	G	-	-	rs57400103		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16236315delG								C9orf93 (264420 upstream) : BNC2 (173187 downstream)																																			---	---	---	---
BNC2	54796	broad.mit.edu	37	9	16626677	16626678	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16626677_16626678delAC	uc003zml.2	-						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc003zmq.1_Intron|BNC2_uc003zmr.1_Intron|BNC2_uc003zmp.1_Intron|BNC2_uc010mij.1_Intron|BNC2_uc003zmu.1_Intron|BNC2_uc010mim.1_Intron|BNC2_uc010min.1_Intron|BNC2_uc003zmo.1_Intron|BNC2_uc003zms.1_Intron|BNC2_uc010mik.1_Intron|BNC2_uc010mil.1_Intron|BNC2_uc003zmt.1_Intron	NM_017637	NP_060107			basonuclin 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)														---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18510515	18510515	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18510515delT	uc003zne.3	+						ADAMTSL1_uc003znb.2_Intron|ADAMTSL1_uc003znc.3_Intron	NM_001040272	NP_001035362			ADAMTS-like 1 isoform 4 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
HAUS6	54801	broad.mit.edu	37	9	19082433	19082434	+	Intron	DEL	TT	-	-	rs33944072		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19082433_19082434delTT	uc003znk.2	-						HAUS6_uc011lmz.1_Intron|HAUS6_uc003znl.1_Intron|HAUS6_uc003znm.1_Intron	NM_017645	NP_060115			HAUS augmin-like complex, subunit 6						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2																		---	---	---	---
ACER2	340485	broad.mit.edu	37	9	19426226	19426227	+	Intron	INS	-	A	A	rs116119251	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19426226_19426227insA	uc003zny.1	+						ACER2_uc003znx.1_Intron|ACER2_uc003znz.1_Intron	NM_001010887	NP_001010887			alkaline ceramidase 2						ceramide metabolic process|negative regulation of cell adhesion mediated by integrin|negative regulation of cell-matrix adhesion|negative regulation of protein glycosylation in Golgi|positive regulation of cell proliferation|response to retinoic acid|sphingosine biosynthetic process	integral to Golgi membrane	ceramidase activity			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2																		---	---	---	---
MTAP	4507	broad.mit.edu	37	9	22028213	22028214	+	Intron	DEL	AT	-	-	rs142048183		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22028213_22028214delAT	uc003zpi.1	+						CDKN2BAS_uc010miw.1_Intron|CDKN2BAS_uc010mix.1_Intron|CDKN2BAS_uc003zpm.2_Intron	NM_002451	NP_002442			5'-methylthioadenosine phosphorylase						nucleoside metabolic process	cytoplasm	phosphorylase activity|S-methyl-5-thioadenosine phosphorylase activity			central_nervous_system(1)	1		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)	Adenine(DB00173)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	22850670	22850670	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22850670delC								DMRTA1 (398198 upstream) : ELAVL2 (839435 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	26290836	26290836	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26290836delA								TUSC1 (611980 upstream) : C9orf82 (549848 downstream)																																			---	---	---	---
LINGO2	158038	broad.mit.edu	37	9	28409619	28409620	+	Intron	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28409619_28409620delGT	uc010mjf.1	-						LINGO2_uc003zqv.1_Intron	NM_152570	NP_689783			leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	29745227	29745228	+	IGR	DEL	CT	-	-	rs4007426		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29745227_29745228delCT								MIR873 (856274 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	31129620	31129620	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31129620delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32246882	32246882	+	IGR	DEL	T	-	-	rs151090188		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32246882delT								None (None upstream) : ACO1 (137719 downstream)																																			---	---	---	---
DDX58	23586	broad.mit.edu	37	9	32482185	32482186	+	Intron	INS	-	TG	TG			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32482185_32482186insTG	uc003zra.2	-						DDX58_uc010mjj.2_Intron|DDX58_uc010mjk.1_Intron|DDX58_uc011lnr.1_Intron|DDX58_uc010mji.2_Intron	NM_014314	NP_055129			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide						detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	32629292	32629292	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32629292delT								NDUFB6 (56110 upstream) : TAF1L (160 downstream)																																			---	---	---	---
SUGT1P1	441394	broad.mit.edu	37	9	33231350	33231351	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33231350_33231351insT	uc010mjq.1	-							NR_003667				Homo sapiens suppressor of G2 allele of SKP1 pseudogene (S. cerevisiae) (SUGT1P), non-coding RNA.												0																		---	---	---	---
DNAI1	27019	broad.mit.edu	37	9	34471765	34471766	+	Intron	INS	-	A	A	rs74700204		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34471765_34471766insA	uc003zum.2	+						DNAI1_uc011lom.1_Intron	NM_012144	NP_036276			dynein, axonemal, intermediate chain 1						cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)										Kartagener_syndrome				---	---	---	---
UNC13B	10497	broad.mit.edu	37	9	35206405	35206406	+	Intron	INS	-	TAA	TAA			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35206405_35206406insTAA	uc003zwq.2	+						UNC13B_uc010mkl.1_Intron|UNC13B_uc003zwr.2_Intron	NM_006377	NP_006368			UNC13 (C. elegans)-like						excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
GNE	10020	broad.mit.edu	37	9	36231128	36231131	+	Intron	DEL	GAAG	-	-	rs10972803		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36231128_36231131delGAAG	uc010mlh.2	-						CLTA_uc003zzf.1_Intron|GNE_uc010mlg.2_Intron|GNE_uc011lpl.1_Intron|GNE_uc010mli.2_Intron|GNE_uc010mlj.2_Intron	NM_005476	NP_005467			UDP-N-acetylglucosamine-2-epimerase/N-						cell adhesion|lipopolysaccharide biosynthetic process|N-acetylneuraminate metabolic process|UDP-N-acetylglucosamine metabolic process		ATP binding|N-acylmannosamine kinase activity|UDP-N-acetylglucosamine 2-epimerase activity				0			STAD - Stomach adenocarcinoma(86;0.228)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	36520446	36520447	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36520446_36520447insT								RNF38 (119251 upstream) : MELK (52458 downstream)																																			---	---	---	---
FRMPD1	22844	broad.mit.edu	37	9	37652666	37652666	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37652666delT	uc004aag.1	+							NM_014907	NP_055722			FERM and PDZ domain containing 1							cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)														---	---	---	---
CNTNAP3	79937	broad.mit.edu	37	9	39121762	39121763	+	Intron	INS	-	A	A	rs147030010	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39121762_39121763insA	uc004abi.2	-						CNTNAP3_uc004abj.2_Intron|CNTNAP3_uc011lqr.1_Intron|CNTNAP3_uc004abk.1_Intron|CNTNAP3_uc011lqs.1_Intron	NM_033655	NP_387504			cell recognition molecule CASPR3 precursor						cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	44743040	44743041	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44743040_44743041insT								None (None upstream) : FAM27C (247195 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	46876643	46876644	+	IGR	INS	-	TG	TG			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:46876643_46876644insTG								KGFLP1 (128258 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66844022	66844022	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66844022delC								LOC442421 (340995 upstream) : AQP7P1 (410245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66852704	66852704	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66852704delT								LOC442421 (349677 upstream) : AQP7P1 (401563 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68390420	68390421	+	IGR	INS	-	T	T	rs145073692	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68390420_68390421insT								FAM27B (596231 upstream) : MIR1299 (611818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68406889	68406889	+	IGR	DEL	G	-	-	rs113316891		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68406889delG								FAM27B (612700 upstream) : MIR1299 (595350 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68409070	68409070	+	5'Flank	DEL	T	-	-	rs62545660	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68409070delT	uc004aew.1	+											Homo sapiens cDNA, FLJ98602.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	68473077	68473077	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68473077delT								FAM27B (678888 upstream) : MIR1299 (529162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68989138	68989141	+	IGR	DEL	CCCT	-	-	rs138958079		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68989138_68989141delCCCT								None (None upstream) : MIR1299 (13098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	70839244	70839245	+	IGR	DEL	GA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70839244_70839245delGA								CBWD3 (339181 upstream) : FOXD4L3 (78538 downstream)																																			---	---	---	---
PGM5	5239	broad.mit.edu	37	9	71140971	71140972	+	Intron	INS	-	A	A	rs75191867		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71140971_71140972insA	uc004agr.2	+							NM_021965	NP_068800			phosphoglucomutase 5						cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity			ovary(1)|pancreas(1)	2																		---	---	---	---
PIP5K1B	8395	broad.mit.edu	37	9	71559983	71559983	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71559983delT	uc004agu.2	+						PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_003558	NP_003549			phosphatidylinositol-4-phosphate 5-kinase, type							endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	74886336	74886346	+	IGR	DEL	CAGTGAGCCGA	-	-	rs139469328		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74886336_74886346delCAGTGAGCCGA								GDA (17859 upstream) : ZFAND5 (79995 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	74894360	74894360	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74894360delC								GDA (25883 upstream) : ZFAND5 (71981 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	74904772	74904772	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74904772delC								GDA (36295 upstream) : ZFAND5 (61569 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	75122234	75122235	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75122234_75122235insT								ZFAND5 (142071 upstream) : TMC1 (14482 downstream)																																			---	---	---	---
TMC1	117531	broad.mit.edu	37	9	75451137	75451137	+	3'UTR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75451137delT	uc004aiz.1	+	24					TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_3'UTR|TMC1_uc010mpa.1_3'UTR	NM_138691	NP_619636			transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	78937448	78937448	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78937448delG	uc004akc.1	+											Homo sapiens cDNA FLJ16215 fis, clone CTONG2025610, moderately similar to PC6B.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	81923479	81923479	+	IGR	DEL	C	-	-	rs273434	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81923479delC								PSAT1 (978472 upstream) : TLE4 (263399 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83302813	83302813	+	IGR	DEL	C	-	-	rs56007212		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83302813delC								TLE4 (961156 upstream) : TLE1 (895787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83332978	83332978	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83332978delC								TLE4 (991321 upstream) : TLE1 (865622 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	84857019	84857019	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84857019delT								FLJ46321 (246849 upstream) : RASEF (740298 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	87753548	87753549	+	IGR	DEL	AA	-	-	rs72147679		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87753548_87753549delAA								NTRK2 (115043 upstream) : AGTPBP1 (407906 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	88466513	88466513	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88466513delT								AGTPBP1 (109569 upstream) : NAA35 (89544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	89759792	89759799	+	IGR	DEL	AAGGAAGG	-	-	rs13297001		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89759792_89759799delAAGGAAGG								LOC440173 (102751 upstream) : C9orf170 (3760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	90084091	90084092	+	IGR	INS	-	A	A	rs146737921	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90084091_90084092insA								C9orf170 (309450 upstream) : DAPK1 (28566 downstream)																																			---	---	---	---
LOC100129066	100129066	broad.mit.edu	37	9	92322513	92322514	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92322513_92322514insT	uc004aqs.2	+							NR_024280				Homo sapiens cDNA FLJ42342 fis, clone UTERU2000794.												0																		---	---	---	---
AUH	549	broad.mit.edu	37	9	94022683	94022686	+	Intron	DEL	TTCT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94022683_94022686delTTCT	uc004arf.3	-						AUH_uc004arg.3_Intron	NM_001698	NP_001689			AU RNA binding protein/enoyl-Coenzyme A						branched chain family amino acid catabolic process|mRNA catabolic process	mitochondrial matrix	enoyl-CoA hydratase activity|methylglutaconyl-CoA hydratase activity|mRNA 3'-UTR binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	98145128	98145128	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98145128delT								FANCC (65137 upstream) : PTCH1 (60138 downstream)																																			---	---	---	---
SLC35D2	11046	broad.mit.edu	37	9	99140551	99140552	+	Intron	DEL	AA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99140551_99140552delAA	uc004awc.2	-						SLC35D2_uc010msd.2_Intron|SLC35D2_uc010mse.2_Intron|SLC35D2_uc010msf.2_Intron|SLC35D2_uc004awd.2_Intron|SLC35D2_uc004awe.2_Intron	NM_007001	NP_008932			solute carrier family 35, member D2							Golgi membrane|integral to membrane	nucleotide-sugar transmembrane transporter activity				0		Acute lymphoblastic leukemia(62;0.0167)																---	---	---	---
Unknown	0	broad.mit.edu	37	9	99387790	99387790	+	IGR	DEL	C	-	-	rs56216852	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99387790delC								CDC14B (5678 upstream) : C9orf21 (15744 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	99685055	99685056	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99685055_99685056insA								LOC441454 (12319 upstream) : FAM22G (5536 downstream)																																			---	---	---	---
HIATL2	84278	broad.mit.edu	37	9	99716992	99716993	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99716992_99716993insT	uc004aws.2	-						HIATL2_uc004awr.1_Intron	NR_002894				RecName: Full=Hippocampus abundant transcript-like protein 2;												0																		---	---	---	---
GABBR2	9568	broad.mit.edu	37	9	101200455	101200458	+	Intron	DEL	ATCC	-	-	rs34647195		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101200455_101200458delATCC	uc004ays.2	-							NM_005458	NP_005449			G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	102208926	102208926	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102208926delC								SEC61B (216026 upstream) : NR4A3 (375211 downstream)																																			---	---	---	---
ERP44	23071	broad.mit.edu	37	9	102770092	102770092	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102770092delA	uc004bam.2	-						ERP44_uc010msy.2_Intron|ERP44_uc010msz.2_Intron	NM_015051	NP_055866			thioredoxin domain containing 4 (endoplasmic						cell redox homeostasis|glycoprotein metabolic process|protein folding|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|ER-Golgi intermediate compartment	protein binding|protein disulfide isomerase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	105141384	105141385	+	IGR	INS	-	TT	TT	rs35184837		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105141384_105141385insTT								GRIN3A (640522 upstream) : CYLC2 (616208 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	106556173	106556176	+	IGR	DEL	CACA	-	-	rs139360988		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106556173_106556176delCACA								CYLC2 (775403 upstream) : SMC2 (300365 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	108547521	108547521	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108547521delC								TMEM38B (10077 upstream) : None (None downstream)																																			---	---	---	---
EPB41L4B	54566	broad.mit.edu	37	9	112057643	112057643	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112057643delT	uc004bdz.1	-						EPB41L4B_uc004bea.2_Intron	NM_019114	NP_061987			erythrocyte membrane protein band 4.1 like 4B							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	112282439	112282439	+	IGR	DEL	A	-	-	rs71730641		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112282439delA								PTPN3 (21846 upstream) : PALM2 (120633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	112363478	112363481	+	IGR	DEL	TGTG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112363478_112363481delTGTG								PTPN3 (102885 upstream) : PALM2 (39591 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	114378412	114378412	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114378412delC	uc004bfk.3	-											Homo sapiens chromosome 9 open reading frame 29, mRNA (cDNA clone MGC:39589 IMAGE:4838739), complete cds.																														---	---	---	---
C9orf84	158401	broad.mit.edu	37	9	114457367	114457367	+	Intron	DEL	A	-	-	rs75955176		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114457367delA	uc004bfr.2	-						C9orf84_uc011lwt.1_Intron|C9orf84_uc004bfq.2_Intron|C9orf84_uc010mug.2_Intron	NM_173521	NP_775792			hypothetical protein LOC158401 isoform 1											ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	114598358	114598361	+	IGR	DEL	TGTG	-	-	rs151033289		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114598358_114598361delTGTG								C9orf84 (41135 upstream) : UGCG (60845 downstream)																																			---	---	---	---
C9orf80	58493	broad.mit.edu	37	9	115459226	115459226	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115459226delT	uc004bgg.2	-						C9orf80_uc010muk.2_Intron	NM_021218	NP_067041			SOSSC protein						DNA repair|response to ionizing radiation	SOSS complex	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	116887532	116887532	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116887532delA								KIF12 (26025 upstream) : COL27A1 (30699 downstream)																																			---	---	---	---
DEC1	50514	broad.mit.edu	37	9	118086692	118086692	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118086692delA	uc004bjk.1	+						DEC1_uc004bjl.1_Intron	NM_017418	NP_059114			deleted in esophageal cancer 1						negative regulation of cell proliferation					ovary(1)	1																		---	---	---	---
PAPPA	5069	broad.mit.edu	37	9	118967349	118967349	+	Intron	DEL	T	-	-	rs113492648		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118967349delT	uc004bjn.2	+						PAPPA_uc011lxp.1_Intron|PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572			pregnancy-associated plasma protein A						cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9																		---	---	---	---
PAPPA	5069	broad.mit.edu	37	9	119067751	119067752	+	Intron	DEL	CA	-	-	rs151141208		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119067751_119067752delCA	uc004bjn.2	+						PAPPA_uc011lxp.1_Intron|PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572			pregnancy-associated plasma protein A						cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	121423661	121423661	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121423661delC								TLR4 (943897 upstream) : DBC1 (505247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	121437787	121437790	+	IGR	DEL	TCTC	-	-	rs35149545		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121437787_121437790delTCTC								TLR4 (958023 upstream) : DBC1 (491118 downstream)																																			---	---	---	---
OR1J2	26740	broad.mit.edu	37	9	125270421	125270422	+	Intron	DEL	GA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125270421_125270422delGA	uc004bmj.1	+						OR1J2_uc011lyv.1_5'Flank	NM_054107	NP_473448			olfactory receptor, family 1, subfamily J,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|pancreas(1)|breast(1)	5																		---	---	---	---
MAPKAP1	79109	broad.mit.edu	37	9	128343017	128343018	+	Intron	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128343017_128343018delTG	uc004bpv.2	-						MAPKAP1_uc011lzt.1_Intron|MAPKAP1_uc010mwz.2_Intron|MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron|MAPKAP1_uc010mxb.1_Intron|MAPKAP1_uc004bqa.2_Intron|MAPKAP1_uc010mxc.1_Intron	NM_001006617	NP_001006618			mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	130896109	130896110	+	IGR	INS	-	A	A	rs139916387		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130896109_130896110insA								LOC389791 (3198 upstream) : LCN2 (15622 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	132263890	132263890	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132263890delC	uc004bxv.2	+						uc004bxw.2_Intron|uc004bxx.2_Intron|uc004bxy.1_Intron|uc004bxz.1_5'Flank					Homo sapiens cDNA FLJ35367 fis, clone SKMUS2001323.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	132297639	132297640	+	IGR	INS	-	AA	AA	rs145163570	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132297639_132297640insAA								C9orf106 (212757 upstream) : C9orf50 (76866 downstream)																																			---	---	---	---
RAPGEF1	2889	broad.mit.edu	37	9	134586748	134586749	+	Intron	INS	-	TT	TT			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134586748_134586749insTT	uc004cbc.2	-						RAPGEF1_uc004cbb.2_5'Flank|RAPGEF1_uc010mzn.2_Intron|RAPGEF1_uc004cbd.2_Intron	NM_005312	NP_005303			guanine nucleotide-releasing factor 2 isoform a						activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)														---	---	---	---
SLC2A6	11182	broad.mit.edu	37	9	136344891	136344891	+	5'Flank	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136344891delG	uc004cee.2	-						SLC2A6_uc004cef.2_5'Flank|SLC2A6_uc004ceg.2_5'Flank|SLC2A6_uc011mdj.1_5'Flank	NM_017585	NP_060055			solute carrier family 2 (facilitated glucose							integral to membrane|plasma membrane	D-glucose transmembrane transporter activity				0				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	137029553	137029554	+	IGR	INS	-	A	A	rs111509558		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137029553_137029554insA								WDR5 (4460 upstream) : RNU6ATAC (8 downstream)																																			---	---	---	---
RXRA	6256	broad.mit.edu	37	9	137224375	137224375	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137224375delG	uc004cfb.2	+						RXRA_uc004cfa.1_Intron	NM_002957	NP_002948			retinoid X receptor, alpha						cellular lipid metabolic process|cholesterol metabolic process|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid|vitamin metabolic process	nuclear chromatin|nucleoplasm	enzyme binding|ligand-regulated transcription factor activity|protein heterodimerization activity|retinoic acid-responsive element binding|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|transcription coactivator activity|vitamin D receptor binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)													---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137577138	137577139	+	Intron	INS	-	T	T	rs140995492		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137577138_137577139insT	uc004cfe.2	+							NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137577353	137577354	+	Intron	INS	-	C	C	rs143525729		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137577353_137577354insC	uc004cfe.2	+							NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	138309645	138309645	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138309645delT								OLFM1 (296614 upstream) : KIAA0649 (62003 downstream)																																			---	---	---	---
GLT6D1	360203	broad.mit.edu	37	9	138526559	138526560	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138526559_138526560insT	uc010nbd.1	-							NM_182974	NP_892019			glycosyltransferase 6 domain containing 1						carbohydrate metabolic process	integral to membrane	transferase activity, transferring hexosyl groups			ovary(1)	1		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;4.3e-07)|Epithelial(140;1.58e-06)|all cancers(34;5.36e-05)														---	---	---	---
LCN10	414332	broad.mit.edu	37	9	139635199	139635200	+	Intron	INS	-	TCCTGGG	TCCTGGG	rs145287279	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139635199_139635200insTCCTGGG	uc010nbq.2	-						LCN10_uc004civ.2_Intron|LCN10_uc011med.1_Intron|LCN10_uc011mee.1_Intron|LCN10_uc011mef.1_Intron|LCN10_uc004ciw.2_Intron					SubName: Full=LCN10 protein;						transport	extracellular region	binding			large_intestine(1)	1	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.32e-06)|Epithelial(140;7.83e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	160262	160263	+	IGR	INS	-	T	T	rs72770953		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:160262_160263insT								TUBB8 (64758 upstream) : ZMYND11 (20161 downstream)																																			---	---	---	---
DIP2C	22982	broad.mit.edu	37	10	491540	491540	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:491540delG	uc001ifp.2	-						DIP2C_uc009xhk.1_Intron	NM_014974	NP_055789			DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)														---	---	---	---
NCRNA00200	399706	broad.mit.edu	37	10	1204320	1204323	+	5'Flank	DEL	CTCC	-	-	rs112299213		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1204320_1204323delCTCC	uc010qag.1	+							NR_015376				Homo sapiens cDNA FLJ40354 fis, clone TESTI2033641.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	1224090	1224091	+	RNA	INS	-	C	C	rs36093407		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1224090_1224091insC	uc001igj.1	-	1		c.2494_2495insG								Homo sapiens cDNA FLJ41340 fis, clone BRASW1000125.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	2783735	2783736	+	IGR	INS	-	T	T	rs147902324	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2783735_2783736insT								None (None upstream) : PFKP (326016 downstream)																																			---	---	---	---
AKR1E2	83592	broad.mit.edu	37	10	4901717	4901718	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4901717_4901718insT	uc001ihl.1	+											Homo sapiens mRNA for aldo-keto reductase related protein 1, complete cds.							cytoplasm	1,5-anhydro-D-fructose reductase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	5295057	5295058	+	IGR	INS	-	A	A	rs71950377		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5295057_5295058insA								AKR1C4 (34147 upstream) : UCN3 (111918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	5343781	5343781	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5343781delA								AKR1C4 (82871 upstream) : UCN3 (63195 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6121704	6121706	+	IGR	DEL	AAT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6121704_6121706delAAT								IL2RA (17432 upstream) : RBM17 (9243 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6327189	6327189	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6327189delT								PFKFB3 (49684 upstream) : PRKCQ (141916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6358203	6358204	+	IGR	INS	-	A	A	rs142100156	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6358203_6358204insA								PFKFB3 (80698 upstream) : PRKCQ (110901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6835081	6835082	+	Intron	DEL	AC	-	-	rs77635277	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6835081_6835082delAC	uc001ijm.2	+											Homo sapiens cDNA FLJ36835 fis, clone ASTRO2010996.																														---	---	---	---
SFMBT2	57713	broad.mit.edu	37	10	7249421	7249422	+	Intron	INS	-	AAAGAAAGAAAGAAAGAG	AAAGAAAGAAAGAAAGAG	rs146151665	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7249421_7249422insAAAGAAAGAAAGAAAGAG	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051			Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8																		---	---	---	---
SFMBT2	57713	broad.mit.edu	37	10	7351628	7351629	+	Intron	INS	-	G	G	rs143969371	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7351628_7351629insG	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron|SFMBT2_uc001ijo.1_Intron	NM_001029880	NP_001025051			Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8																		---	---	---	---
SFMBT2	57713	broad.mit.edu	37	10	7402140	7402141	+	Intron	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7402140_7402141delGT	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron|SFMBT2_uc001ijo.1_Intron	NM_001029880	NP_001025051			Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8																		---	---	---	---
ITIH5	80760	broad.mit.edu	37	10	7608881	7608885	+	Intron	DEL	AAGAA	-	-	rs113070710		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7608881_7608885delAAGAA	uc001ijq.2	-						ITIH5_uc001ijp.2_Intron	NM_030569	NP_085046			inter-alpha trypsin inhibitor heavy chain						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
ITIH2	3698	broad.mit.edu	37	10	7760909	7760909	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7760909delT	uc001ijs.2	+							NM_002216	NP_002207			inter-alpha globulin inhibitor H2 polypeptide						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
ATP5C1	509	broad.mit.edu	37	10	7836984	7836984	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7836984delT	uc001iju.2	+						ATP5C1_uc010qbb.1_Intron|ATP5C1_uc009xiq.1_Intron|ATP5C1_uc010qbc.1_Intron|ATP5C1_uc001ijv.2_Intron	NM_001001973	NP_001001973			ATP synthase, H+ transporting, mitochondrial F1						oxidative phosphorylation|respiratory electron transport chain	mitochondrial matrix|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1)	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	10635707	10635707	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10635707delA								None (None upstream) : SFTA1P (190695 downstream)																																			---	---	---	---
CELF2	10659	broad.mit.edu	37	10	11225962	11225962	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11225962delA	uc001iki.3	+						CELF2_uc010qbi.1_Intron|CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron|CELF2_uc010qbk.1_Intron|CELF2_uc010qbl.1_Intron|CELF2_uc010qbm.1_Intron|CELF2_uc001iko.3_Intron|CELF2_uc001ikp.3_Intron|CELF2_uc010qbn.1_Intron|CELF2_uc009xiw.1_Intron|CELF2_uc010qbo.1_Intron|CELF2_uc010qbp.1_Intron	NM_001025077	NP_001020248			CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
CELF2	10659	broad.mit.edu	37	10	11362790	11362790	+	Intron	DEL	T	-	-	rs150676695		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11362790delT	uc001iki.3	+						CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron|CELF2_uc010qbl.1_Intron|CELF2_uc010qbm.1_Intron|CELF2_uc001iko.3_Intron|CELF2_uc001ikp.3_Intron|CELF2_uc010qbn.1_Intron|CELF2_uc010qbo.1_Intron|CELF2_uc010qbp.1_Intron	NM_001025077	NP_001020248			CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	11951163	11951164	+	IGR	INS	-	TCC	TCC	rs137936153	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11951163_11951164insTCC								C10orf47 (36889 upstream) : UPF2 (10858 downstream)																																			---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	13792110	13792113	+	Intron	DEL	AAGA	-	-	rs59377985		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13792110_13792113delAAGA	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497			FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	13796568	13796571	+	Intron	DEL	GTGT	-	-	rs111292013		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13796568_13796571delGTGT	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497			FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	13976470	13976471	+	Intron	DEL	TT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13976470_13976471delTT	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497			FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
CACNB2	783	broad.mit.edu	37	10	18554079	18554079	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18554079delT	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron	NM_201596	NP_963890			calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	20034150	20034151	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20034150_20034151insT								None (None upstream) : PLXDC2 (71221 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	21014701	21014702	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21014701_21014702delTG								PLXDC2 (445586 upstream) : NEBL (54203 downstream)																																			---	---	---	---
PIP4K2A	5305	broad.mit.edu	37	10	22851162	22851165	+	Intron	DEL	AAAC	-	-	rs111709375		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22851162_22851165delAAAC	uc001irl.3	-						PIP4K2A_uc010qcu.1_Intron	NM_005028	NP_005019			phosphatidylinositol-5-phosphate 4-kinase, type								1-phosphatidylinositol-4-phosphate 5-kinase activity|1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	23126881	23126881	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23126881delA								PIP4K2A (123378 upstream) : ARMC3 (90073 downstream)																																			---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24305970	24305970	+	Intron	DEL	T	-	-	rs67377033		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24305970delT	uc001irs.2	+							NM_001098500	NP_001091970			sickle tail isoform 2						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
APBB1IP	54518	broad.mit.edu	37	10	26725612	26725613	+	5'Flank	DEL	GA	-	-	rs57692128		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26725612_26725613delGA	uc001iss.2	+						APBB1IP_uc001isr.2_5'Flank|APBB1IP_uc009xks.1_5'Flank	NM_019043	NP_061916			amyloid beta (A4) precursor protein-binding,						blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7																		---	---	---	---
MPP7	143098	broad.mit.edu	37	10	28564339	28564340	+	Intron	INS	-	T	T	rs111692769		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28564339_28564340insT	uc001iua.1	-						MPP7_uc001iub.1_Intron|MPP7_uc009xla.2_Intron|MPP7_uc010qdv.1_Intron	NM_173496	NP_775767			palmitoylated membrane protein 7						establishment of cell polarity|positive regulation of protein complex assembly|protein localization to adherens junction|tight junction assembly	MPP7-DLG1-LIN7 complex|tight junction	protein complex scaffold|protein domain specific binding|protein heterodimerization activity|signaling adaptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	28733038	28733038	+	IGR	DEL	A	-	-	rs111910234		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28733038delA								MPP7 (141043 upstream) : WAC (88389 downstream)																																			---	---	---	---
WAC	51322	broad.mit.edu	37	10	28904906	28904906	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28904906delT	uc001iuf.2	+						WAC_uc001iud.2_Intron|WAC_uc001iue.2_Intron|WAC_uc001iug.2_Intron|WAC_uc001iuh.2_Intron	NM_016628	NP_057712			WW domain-containing adapter with a coiled-coil						cell cycle checkpoint|histone H2B conserved C-terminal lysine ubiquitination|histone monoubiquitination|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nuclear speck	chromatin binding|RNA polymerase II core binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	29528530	29528533	+	IGR	DEL	ACTC	-	-	rs112480021		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29528530_29528533delACTC								BAMBI (556662 upstream) : LYZL1 (49457 downstream)																																			---	---	---	---
SVIL	6840	broad.mit.edu	37	10	29796527	29796528	+	Intron	DEL	CA	-	-	rs71841478		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29796527_29796528delCA	uc001iut.1	-						SVIL_uc010qdw.1_Intron|SVIL_uc001iuu.1_Intron	NM_021738	NP_068506			supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	31113979	31113979	+	IGR	DEL	T	-	-	rs5784224		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31113979delT								LYZL2 (195332 upstream) : ZNF438 (19588 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	31393762	31393763	+	IGR	INS	-	T	T	rs138529235	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31393762_31393763insT								ZNF438 (72896 upstream) : LOC220930 (211695 downstream)																																			---	---	---	---
PARD3	56288	broad.mit.edu	37	10	34964519	34964520	+	Intron	INS	-	T	T	rs112555249		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34964519_34964520insT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565			partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	35281168	35281169	+	IGR	DEL	AC	-	-	rs113555585		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35281168_35281169delAC								PARD3 (177245 upstream) : CUL2 (17639 downstream)																																			---	---	---	---
CCNY	219771	broad.mit.edu	37	10	35533575	35533575	+	5'Flank	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35533575delT	uc001iyu.3	+							NM_181698	NP_859049			cyclin Y isoform 2						cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0																		---	---	---	---
ZNF248	57209	broad.mit.edu	37	10	38139001	38139001	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38139001delA	uc001izd.1	-						ZNF248_uc009xmc.2_Intron|ZNF248_uc001izb.2_Intron|ZNF248_uc001izc.2_Intron|ZNF248_uc010qeu.1_Intron	NM_021045	NP_066383			zinc finger protein 248						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	39014540	39014540	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39014540delT								LOC399744 (273460 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39098376	39098376	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39098376delA								LOC399744 (357296 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42667544	42667545	+	IGR	INS	-	ATC	ATC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42667544_42667545insATC								None (None upstream) : LOC441666 (159770 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	43440536	43440537	+	IGR	DEL	AT	-	-	rs146008184	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43440536_43440537delAT								BMS1 (110153 upstream) : RET (131980 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	43837362	43837362	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43837362delT								RASGEF1A (74995 upstream) : FXYD4 (29730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	43873993	43873994	+	IGR	INS	-	A	A	rs145735912	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43873993_43873994insA								FXYD4 (2210 upstream) : HNRNPF (7071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	45445927	45445927	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45445927delT	uc001jbk.1	-						uc001jbl.2_Intron					Homo sapiens cDNA FLJ31956 fis, clone NT2RP7007359.																														---	---	---	---
LOC100133308	100133308	broad.mit.edu	37	10	45621124	45621124	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45621124delA	uc001jbz.2	-						LOC100133308_uc009xmq.1_Intron					Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	45706723	45706724	+	IGR	DEL	AA	-	-	rs34293259		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45706723_45706724delAA								LOC100133308 (56679 upstream) : OR13A1 (91378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	46977838	46977839	+	IGR	INS	-	A	A	rs146963725		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46977838_46977839insA								SYT15 (7237 upstream) : GPRIN2 (15707 downstream)																																			---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47035929	47035930	+	Intron	INS	-	CA	CA	rs143198470		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47035929_47035930insCA	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	48878594	48878595	+	IGR	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48878594_48878595delAC								FRMPD2L1 (14962 upstream) : FRMPD2 (486013 downstream)																																			---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	52750384	52750385	+	5'Flank	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52750384_52750385delCA	uc001jjm.2	+						PRKG1_uc010qhp.1_5'Flank	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	52943313	52943314	+	Intron	INS	-	TTT	TTT	rs146855190	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52943313_52943314insTTT	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	55287251	55287254	+	IGR	DEL	AAGG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55287251_55287254delAAGG								MBL2 (755791 upstream) : PCDH15 (275281 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	55446767	55446768	+	IGR	INS	-	T	T	rs35484869		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55446767_55446768insT								MBL2 (915307 upstream) : PCDH15 (115767 downstream)																																			---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	56293475	56293475	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:56293475delC	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045			protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	56373265	56373266	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:56373265_56373266delAC	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045			protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58355613	58355613	+	IGR	DEL	T	-	-	rs148395622		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58355613delT								ZWINT (234579 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58927844	58927846	+	IGR	DEL	AAT	-	-	rs141475149		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58927844_58927846delAAT								ZWINT (806810 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58990512	58990513	+	IGR	INS	-	AC	AC	rs146855764	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58990512_58990513insAC								ZWINT (869478 upstream) : IPMK (965105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	59481947	59481947	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59481947delA								None (None upstream) : IPMK (473671 downstream)																																			---	---	---	---
ANK3	288	broad.mit.edu	37	10	61889348	61889348	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61889348delA	uc001jky.2	-						ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jla.1_Intron|ANK3_uc001jlb.1_Intron	NM_020987	NP_066267			ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	66183717	66183718	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66183717_66183718insA								REEP3 (801746 upstream) : ANXA2P3 (401567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	66536151	66536151	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66536151delA								None (None upstream) : ANXA2P3 (49134 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	67618447	67618448	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67618447_67618448insT								None (None upstream) : CTNNA3 (61277 downstream)																																			---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68647278	68647279	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68647278_68647279insA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
DNAJC12	56521	broad.mit.edu	37	10	69579524	69579537	+	Intron	DEL	GGAAGGAAGGAAGG	-	-	rs12572272	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69579524_69579537delGGAAGGAAGGAAGG	uc001jnb.2	-						DNAJC12_uc001jnc.2_Intron	NM_021800	NP_068572			J domain containing protein 1 isoform a						protein folding		heat shock protein binding|unfolded protein binding			breast(1)	1																		---	---	---	---
DNAJC12	56521	broad.mit.edu	37	10	69595505	69595506	+	Intron	INS	-	AT	AT	rs144958941	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69595505_69595506insAT	uc001jnb.2	-						DNAJC12_uc001jnc.2_Intron	NM_021800	NP_068572			J domain containing protein 1 isoform a						protein folding		heat shock protein binding|unfolded protein binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	70794817	70794818	+	IGR	INS	-	A	A	rs112373909		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70794817_70794818insA								KIAA1279 (18083 upstream) : SRGN (53010 downstream)																																			---	---	---	---
TSPAN15	23555	broad.mit.edu	37	10	71263991	71263992	+	Intron	INS	-	T	T	rs144107835	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71263991_71263992insT	uc001jpo.1	+							NM_012339	NP_036471			transmembrane 4 superfamily member 15							integral to plasma membrane|membrane fraction					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	71344824	71344825	+	IGR	INS	-	TGCC	TGCC	rs146849288	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71344824_71344825insTGCC								NEUROG3 (11702 upstream) : C10orf35 (45178 downstream)																																			---	---	---	---
TYSND1	219743	broad.mit.edu	37	10	71901893	71901894	+	Intron	DEL	TG	-	-	rs144146881		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71901893_71901894delTG	uc001jqr.2	-						TYSND1_uc001jqq.2_Intron|TYSND1_uc001jqs.2_Intron|TYSND1_uc001jqt.2_Intron	NM_173555	NP_775826			trypsin domain containing 1 isoform a						proteolysis	peroxisome	serine-type endopeptidase activity			large_intestine(1)	1																		---	---	---	---
CDH23	64072	broad.mit.edu	37	10	73296592	73296592	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73296592delG	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc001jrv.2_Intron|CDH23_uc009xql.2_Intron	NM_022124	NP_071407			cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11																		---	---	---	---
ANXA7	310	broad.mit.edu	37	10	75136534	75136534	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75136534delA	uc001jtz.2	-						ANXA7_uc001jua.2_Intron|ANXA7_uc001jub.2_Intron|ANXA7_uc010qki.1_Intron	NM_004034	NP_004025			annexin VII isoform 2								calcium ion binding|calcium-dependent phospholipid binding|calcium-dependent protein binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	75380240	75380241	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75380240_75380241insT								USP54 (28942 upstream) : MYOZ1 (11174 downstream)																																			---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	79303907	79303908	+	Intron	INS	-	CT	CT	rs35370605		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79303907_79303908insCT	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	80697372	80697373	+	IGR	INS	-	GGTGGT	GGTGGT	rs139261335	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80697372_80697373insGGTGGT								RPS24 (880802 upstream) : LOC283050 (5711 downstream)																																			---	---	---	---
LOC283050	283050	broad.mit.edu	37	10	80763329	80763329	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80763329delG	uc001jzz.2	-						LOC283050_uc001jzx.2_Intron|LOC283050_uc001jzy.2_Intron|uc001kaa.1_Frame_Shift_Del_p.P50fs	NR_024431				Homo sapiens cDNA FLJ40604 fis, clone THYMU2011806.												0																		---	---	---	---
ZMIZ1	57178	broad.mit.edu	37	10	80968856	80968857	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80968856_80968857insA	uc001kaf.2	+						ZMIZ1_uc001kae.2_Intron	NM_020338	NP_065071			retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	83173743	83173743	+	IGR	DEL	T	-	-	rs60125535		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83173743delT								SH2D4B (767427 upstream) : NRG3 (461327 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	83206181	83206183	+	IGR	DEL	TCT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83206181_83206183delTCT								SH2D4B (799865 upstream) : NRG3 (428887 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	85087665	85087666	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85087665_85087666insA								NRG3 (340730 upstream) : GHITM (811519 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	86585001	86585002	+	IGR	DEL	TG	-	-	rs72157313		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86585001_86585002delTG								FAM190B (306725 upstream) : GRID1 (774310 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	88150212	88150212	+	IGR	DEL	A	-	-	rs10564271		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88150212delA								GRID1 (23962 upstream) : WAPAL (44802 downstream)																																			---	---	---	---
ATAD1	84896	broad.mit.edu	37	10	89553691	89553691	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89553691delA	uc001key.1	-						ATAD1_uc010qmr.1_5'Flank|ATAD1_uc009xth.1_Intron|ATAD1_uc001kez.1_Intron	NM_032810	NP_116199			ATPase family, AAA domain containing 1							peroxisome	ATP binding|nucleoside-triphosphatase activity			large_intestine(1)|ovary(1)	2		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	90794005	90794006	+	IGR	INS	-	GT	GT	rs139446523	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90794005_90794006insGT								FAS (18464 upstream) : CH25H (171690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	91954998	91954999	+	IGR	INS	-	ACACACACACACACAC	ACACACACACACACAC	rs143544940	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91954998_91954999insACACACACACACACAC								KIF20B (420298 upstream) : HTR7 (545579 downstream)																																			---	---	---	---
TNKS2	80351	broad.mit.edu	37	10	93594953	93594954	+	Intron	INS	-	A	A	rs149150226	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93594953_93594954insA	uc001khp.2	+							NM_025235	NP_079511			tankyrase, TRF1-interacting ankyrin-related						positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding			kidney(3)|skin(3)|ovary(1)|lung(1)	8		Colorectal(252;0.162)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	94171312	94171312	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94171312delA								MARCH5 (57591 upstream) : IDE (42288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	95047898	95047899	+	IGR	INS	-	TTCT	TTCT	rs148551063	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95047898_95047899insTTCT								CYP26A1 (210257 upstream) : MYOF (18288 downstream)																																			---	---	---	---
CEP55	55165	broad.mit.edu	37	10	95264230	95264230	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95264230delA	uc009xug.2	+						CEP55_uc001kiq.3_Intron	NM_001127182	NP_001120654			centrosomal protein 55kDa						cell division|mitosis	centriole|cleavage furrow|midbody					0		Colorectal(252;0.207)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	95496211	95496211	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95496211delA								C10orf4 (33298 upstream) : LGI1 (21355 downstream)																																			---	---	---	---
TBC1D12	23232	broad.mit.edu	37	10	96247620	96247621	+	Intron	INS	-	T	T	rs73327474	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96247620_96247621insT	uc001kjr.2	+							NM_015188	NP_056003			TBC1 domain family, member 12							intracellular	Rab GTPase activator activity				0		Colorectal(252;0.0429)																---	---	---	---
CYP2C8	1558	broad.mit.edu	37	10	96820622	96820622	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96820622delT	uc001kkb.2	-						CYP2C8_uc001kkc.2_Intron|CYP2C8_uc010qoa.1_Intron|CYP2C8_uc010qob.1_Intron|CYP2C8_uc010qoc.1_Intron|CYP2C8_uc010qod.1_Intron	NM_000770	NP_000761			cytochrome P450, family 2, subfamily C,						exogenous drug catabolic process|organic acid metabolic process|oxidative demethylation|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|electron carrier activity|heme binding|oxygen binding				0		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Aminophenazone(DB01424)|Amiodarone(DB01118)|Amodiaquine(DB00613)|Benzphetamine(DB00865)|Carbamazepine(DB00564)|Cerivastatin(DB00439)|Diclofenac(DB00586)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lovastatin(DB00227)|Midazolam(DB00683)|Montelukast(DB00471)|Nicardipine(DB00622)|Paclitaxel(DB01229)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rifampin(DB01045)|Rosiglitazone(DB00412)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Tolbutamide(DB01124)|Torasemide(DB00214)|Tretinoin(DB00755)|Trimethoprim(DB00440)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zopiclone(DB01198)													---	---	---	---
ARHGAP19	84986	broad.mit.edu	37	10	98978389	98978390	+	Intron	DEL	TG	-	-	rs60630859		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98978389_98978390delTG	uc001kmy.2	-							NM_032900				Rho GTPase activating protein 19						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	GTPase activator activity				0		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)														---	---	---	---
HPSE2	60495	broad.mit.edu	37	10	100272341	100272342	+	Intron	INS	-	A	A	rs144283345		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100272341_100272342insA	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600			heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)														---	---	---	---
HPSE2	60495	broad.mit.edu	37	10	100416969	100416970	+	Intron	INS	-	AAA	AAA	rs57694497		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100416969_100416970insAAA	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600			heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)														---	---	---	---
HPSE2	60495	broad.mit.edu	37	10	100429866	100429866	+	Intron	DEL	G	-	-	rs78441097	byFrequency;by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100429866delG	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600			heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)														---	---	---	---
BTRC	8945	broad.mit.edu	37	10	103238966	103238968	+	Intron	DEL	CCT	-	-	rs67537209		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103238966_103238968delCCT	uc001kta.2	+						BTRC_uc001ksz.1_Intron|BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Intron	NM_033637	NP_378663			beta-transducin repeat containing protein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)														---	---	---	---
PCGF6	84108	broad.mit.edu	37	10	105082660	105082661	+	Intron	INS	-	A	A	rs76636588		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105082660_105082661insA	uc001kwt.2	-						PCGF6_uc001kwu.2_Intron|PCGF6_uc009xxk.2_Intron|PCGF6_uc009xxl.2_Intron|PCGF6_uc009xxm.2_Intron	NM_001011663	NP_001011663			polycomb group ring finger 6 isoform a						negative regulation of transcription, DNA-dependent	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			kidney(1)	1		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)														---	---	---	---
SH3PXD2A	9644	broad.mit.edu	37	10	105391924	105391924	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105391924delA	uc001kxj.1	-						SH3PXD2A_uc010qqr.1_Intron|SH3PXD2A_uc010qqs.1_Intron|SH3PXD2A_uc010qqt.1_Intron|SH3PXD2A_uc009xxn.1_Intron|SH3PXD2A_uc010qqu.1_Intron	NM_014631	NP_055446			SH3 multiple domains 1						cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)														---	---	---	---
SLK	9748	broad.mit.edu	37	10	105782975	105782976	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105782975_105782976insT	uc001kxo.1	+						SLK_uc001kxp.1_Intron	NM_014720	NP_055535			serine/threonine kinase 2						apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity			ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)														---	---	---	---
CCDC147	159686	broad.mit.edu	37	10	106193265	106193265	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106193265delC	uc001kyh.2	+							NM_001008723	NP_001008723			coiled-coil domain containing 147											ovary(2)|central_nervous_system(2)|skin(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)														---	---	---	---
SORCS3	22986	broad.mit.edu	37	10	106450579	106450590	+	Intron	DEL	ACCCTGATAGCA	-	-	rs145792964		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106450579_106450590delACCCTGATAGCA	uc001kyi.1	+							NM_014978	NP_055793			VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	109609405	109609407	+	IGR	DEL	TGT	-	-	rs145467597		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:109609405_109609407delTGT								SORCS1 (685113 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	109740574	109740574	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:109740574delC								SORCS1 (816282 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	110274263	110274263	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110274263delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	111490794	111490796	+	IGR	DEL	TTG	-	-	rs113818631		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111490794_111490796delTTG								None (None upstream) : XPNPEP1 (133728 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	111537698	111537698	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111537698delT								None (None upstream) : XPNPEP1 (86826 downstream)																																			---	---	---	---
VTI1A	143187	broad.mit.edu	37	10	114484546	114484546	+	Intron	DEL	A	-	-	rs5787971		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114484546delA	uc001kzy.2	+						VTI1A_uc001kzz.2_Intron	NM_145206	NP_660207			SNARE Vti1a-beta protein						intracellular protein transport|retrograde transport, endosome to Golgi	SNARE complex	protein transporter activity|SNAP receptor activity			ovary(1)	1		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	114647984	114647985	+	IGR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114647984_114647985delGT								LOC143188 (32857 upstream) : TCF7L2 (62024 downstream)																																			---	---	---	---
TCF7L2	6934	broad.mit.edu	37	10	114752528	114752528	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114752528delT	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron	NM_001146274	NP_001139746			transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)														---	---	---	---
CASP7	840	broad.mit.edu	37	10	115447595	115447595	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115447595delC	uc001lan.2	+						CASP7_uc001lam.2_Intron|CASP7_uc001lao.2_Intron|CASP7_uc001lap.2_Intron|CASP7_uc001laq.2_Intron|CASP7_uc010qsa.1_Intron	NM_033339	NP_203125			caspase 7 isoform alpha						activation of caspase activity by cytochrome c|cellular component disassembly involved in apoptosis|induction of apoptosis by intracellular signals|proteolysis	cytosol|endoplasmic reticulum membrane|mitochondrial membrane|nucleoplasm	cysteine-type endopeptidase activity|protein binding			ovary(1)	1		Colorectal(252;0.0946)|Breast(234;0.188)		Epithelial(162;0.012)|all cancers(201;0.014)														---	---	---	---
C10orf118	55088	broad.mit.edu	37	10	115918325	115918325	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115918325delA	uc001lbb.1	-						C10orf118_uc001lbc.1_Intron|C10orf118_uc009xye.1_Intron	NM_018017	NP_060487			CTCL tumor antigen L14-2											ovary(2)	2		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)														---	---	---	---
KIAA1598	57698	broad.mit.edu	37	10	118761394	118761394	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118761394delA	uc009xyw.2	-						KIAA1598_uc001lcz.3_Intron|KIAA1598_uc010qso.1_Intron|KIAA1598_uc010qsp.1_Intron|KIAA1598_uc010qsq.1_Intron	NM_001127211	NP_001120683			shootin1 isoform a						axon guidance	axon					0				all cancers(201;0.00494)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	119627828	119627829	+	IGR	INS	-	TG	TG	rs139569607	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119627828_119627829insTG								EMX2 (318772 upstream) : RAB11FIP2 (136600 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	120856213	120856214	+	IGR	INS	-	A	A	rs139133122	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120856213_120856214insA								EIF3A (15879 upstream) : FAM45A (7397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122556378	122556381	+	Intron	DEL	GAAA	-	-	rs71862150		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122556378_122556381delGAAA	uc001lfb.1	-											Homo sapiens cDNA FLJ37330 fis, clone BRAMY2019509.																														---	---	---	---
WDR11	55717	broad.mit.edu	37	10	122635325	122635326	+	Intron	INS	-	T	T	rs143951370	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122635325_122635326insT	uc010qtf.1	+						WDR11_uc010qte.1_Intron|WDR11_uc001lfd.1_Intron	NM_018117	NP_060587			bromodomain and WD repeat domain containing 2							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	122763185	122763186	+	IGR	INS	-	T	T	rs150550565	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122763185_122763186insT								WDR11 (94150 upstream) : FGFR2 (474659 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	123438953	123438953	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123438953delG								FGFR2 (80981 upstream) : ATE1 (63673 downstream)																																			---	---	---	---
PLEKHA1	59338	broad.mit.edu	37	10	124186890	124186890	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124186890delA	uc001lge.1	+						PLEKHA1_uc001lgf.1_Intron|PLEKHA1_uc001lgg.1_Intron|PLEKHA1_uc001lgh.2_Intron	NM_001001974	NP_001001974			pleckstrin homology domain containing, family A						B cell receptor signaling pathway|cellular response to hydrogen peroxide|establishment of protein localization|negative regulation of protein kinase B signaling cascade|phosphatidylinositol 3-kinase cascade|ruffle organization	cytoplasm|nucleus|ruffle membrane	PDZ domain binding|phosphatidylinositol-3,4-bisphosphate binding			kidney(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	129936485	129936485	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129936485delT								MKI67 (12017 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	130301343	130301344	+	IGR	INS	-	AC	AC	rs138841331	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130301343_130301344insAC								MKI67 (376875 upstream) : MGMT (964110 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	130399990	130399991	+	IGR	INS	-	T	T	rs145443223	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130399990_130399991insT								MKI67 (475522 upstream) : MGMT (865463 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132173378	132173378	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132173378delA								GLRX3 (190594 upstream) : TCERG1L (717278 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132789210	132789211	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132789210_132789211insA								GLRX3 (806426 upstream) : TCERG1L (101445 downstream)																																			---	---	---	---
TCERG1L	256536	broad.mit.edu	37	10	132974689	132974690	+	Intron	DEL	AT	-	-	rs76829431		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132974689_132974690delAT	uc001lkp.2	-						TCERG1L_uc009yax.1_Intron	NM_174937	NP_777597			transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	133578411	133578412	+	IGR	INS	-	ACACACAC	ACACACAC	rs142791678	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133578411_133578412insACACACAC								TCERG1L (468427 upstream) : PPP2R2D (169548 downstream)																																			---	---	---	---
C10orf93	255352	broad.mit.edu	37	10	134759029	134759029	+	5'Flank	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134759029delC	uc001llt.1	-						C10orf93_uc001llu.2_5'Flank	NM_173572	NP_775843			hypothetical protein LOC255352								binding			pancreas(1)	1		all_cancers(35;1.8e-07)|all_epithelial(44;6.22e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Colorectal(31;0.119)|Glioma(114;0.172)|Melanoma(40;0.175)		Epithelial(32;4.28e-05)|OV - Ovarian serous cystadenocarcinoma(35;4.31e-05)|all cancers(32;5.02e-05)														---	---	---	---
SIRT3	23410	broad.mit.edu	37	11	226084	226084	+	Intron	DEL	A	-	-	rs143575075		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:226084delA	uc001lok.3	-						SIRT3_uc001loj.3_Intron|SIRT3_uc010qvm.1_Intron|SIRT3_uc010qvn.1_Intron|SIRT3_uc010qvo.1_Intron|SIRT3_uc010qvp.1_Intron|SIRT3_uc010qvq.1_Intron|SIRT3_uc009ybt.1_Intron	NM_012239	NP_036371			sirtuin 3 isoform a						chromatin silencing|protein ADP-ribosylation|protein deacetylation	mitochondrial matrix	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides|NAD+ ADP-ribosyltransferase activity|NAD+ binding|protein binding|zinc ion binding			urinary_tract(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)														---	---	---	---
AP2A2	161	broad.mit.edu	37	11	953619	953628	+	Intron	DEL	CTCCGTCTGC	-	-	rs67263403		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:953619_953628delCTCCGTCTGC	uc001lss.2	+						AP2A2_uc001lst.1_Intron|AP2A2_uc009yco.1_Intron	NM_012305	NP_036437			adaptor-related protein complex 2, alpha 2						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|cytosol	lipid binding|protein transporter activity				0		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)														---	---	---	---
MUC5B	727897	broad.mit.edu	37	11	1141252	1141253	+	5'Flank	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1141252_1141253delGT	uc009ycr.1	+							NM_017511	NP_059981			SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	1753244	1753245	+	IGR	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1753244_1753245delCA								KRTAP5-6 (34260 upstream) : CTSD (20740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	2455951	2455952	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2455951_2455952delTG								TRPM5 (11676 upstream) : KCNQ1 (10269 downstream)																																			---	---	---	---
KCNQ1	3784	broad.mit.edu	37	11	2522477	2522478	+	Intron	INS	-	T	T	rs137864691	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2522477_2522478insT	uc001lwn.2	+						KCNQ1_uc009ydo.1_Intron|KCNQ1_uc009ydp.1_Intron|KCNQ1_uc001lwo.2_Intron	NM_000218	NP_000209			potassium voltage-gated channel, KQT-like						blood circulation|membrane depolarization|muscle contraction|sensory perception of sound		delayed rectifier potassium channel activity|protein binding			ovary(1)	1		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)													---	---	---	---
OSBPL5	114879	broad.mit.edu	37	11	3118384	3118384	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3118384delA	uc001lxk.2	-						OSBPL5_uc010qxq.1_Intron|OSBPL5_uc009ydw.2_Intron|OSBPL5_uc001lxl.2_Intron|OSBPL5_uc009ydx.2_Intron|OSBPL5_uc001lxj.2_5'Flank	NM_020896	NP_065947			oxysterol-binding protein-like protein 5 isoform						cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)														---	---	---	---
RRM1	6240	broad.mit.edu	37	11	4121173	4121174	+	Intron	INS	-	C	C	rs139324393	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4121173_4121174insC	uc001lyw.3	+						RRM1_uc009yeh.1_Intron|RRM1_uc009yei.2_Intron|RRM1_uc010qyc.1_Intron	NM_001033	NP_001024			ribonucleoside-diphosphate reductase M1 chain						deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleoplasm|ribonucleoside-diphosphate reductase complex	ATP binding|ribonucleoside-diphosphate reductase activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	4575874	4575874	+	IGR	DEL	G	-	-	rs147216211		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4575874delG								OR52M1 (8501 upstream) : C11orf40 (16780 downstream)																																			---	---	---	---
OR51B5	282763	broad.mit.edu	37	11	5423110	5423111	+	Intron	INS	-	TCTC	TCTC	rs148071208	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5423110_5423111insTCTC	uc001maq.1	-						HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_001005567	NP_001005567			olfactory receptor, family 51, subfamily B,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	6512135	6512135	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6512135delA								FXC1 (6225 upstream) : DNHD1 (6391 downstream)																																			---	---	---	---
ZNF215	7762	broad.mit.edu	37	11	6969701	6969701	+	Intron	DEL	T	-	-	rs10707253		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6969701delT	uc001mey.2	+						ZNF215_uc010raw.1_Intron|ZNF215_uc010rax.1_Intron|ZNF215_uc001mez.1_Intron	NM_013250	NP_037382			zinc finger protein 215						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	9397435	9397435	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9397435delT								TMEM41B (61139 upstream) : IPO7 (8734 downstream)																																			---	---	---	---
ZNF143	7702	broad.mit.edu	37	11	9524155	9524155	+	Intron	DEL	A	-	-	rs111516318		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9524155delA	uc001mhr.2	+						ZNF143_uc009yfu.2_Intron|ZNF143_uc010rby.1_Intron	NM_003442	NP_003433			zinc finger protein 143						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)														---	---	---	---
GALNTL4	374378	broad.mit.edu	37	11	11312863	11312864	+	Intron	DEL	AG	-	-	rs78462885		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11312863_11312864delAG	uc001mjo.2	-							NM_198516	NP_940918			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)														---	---	---	---
GALNTL4	374378	broad.mit.edu	37	11	11327783	11327784	+	Intron	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11327783_11327784delTG	uc001mjo.2	-							NM_198516	NP_940918			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	11772119	11772119	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11772119delT								GALNTL4 (128558 upstream) : USP47 (90851 downstream)																																			---	---	---	---
MICALCL	84953	broad.mit.edu	37	11	12340691	12340692	+	Intron	INS	-	T	T	rs145543352	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12340691_12340692insT	uc001mkg.1	+							NM_032867	NP_116256			MICAL C-terminal like						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm	mitogen-activated protein kinase binding			skin(1)	1				Epithelial(150;0.00177)														---	---	---	---
PARVA	55742	broad.mit.edu	37	11	12445886	12445889	+	Intron	DEL	TATT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12445886_12445889delTATT	uc001mki.2	+						PARVA_uc001mkh.2_Intron|PARVA_uc010rck.1_Intron	NM_018222	NP_060692			parvin, alpha						cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	13099665	13099665	+	IGR	DEL	A	-	-	rs11285688		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13099665delA								RASSF10 (67018 upstream) : ARNTL (199660 downstream)																																			---	---	---	---
FAR1	84188	broad.mit.edu	37	11	13729994	13729995	+	Intron	INS	-	CGCA	CGCA	rs139902063	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13729994_13729995insCGCA	uc001mld.2	+						FAR1_uc009ygp.2_Intron	NM_032228	NP_115604			fatty acyl CoA reductase 1						ether lipid biosynthetic process	integral to membrane|peroxisomal matrix|peroxisomal membrane	protein binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	15659501	15659502	+	IGR	DEL	CA	-	-	rs145338777		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15659501_15659502delCA								INSC (390749 upstream) : SOX6 (328494 downstream)																																			---	---	---	---
ABCC8	6833	broad.mit.edu	37	11	17479662	17479663	+	Intron	INS	-	AGA	AGA			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17479662_17479663insAGA	uc001mnc.2	-						ABCC8_uc010rcy.1_Intron	NM_000352	NP_000343			ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)													---	---	---	---
KCNC1	3746	broad.mit.edu	37	11	17761221	17761222	+	Intron	DEL	TG	-	-	rs144535999		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17761221_17761222delTG	uc001mnk.3	+						KCNC1_uc009yhc.1_Intron	NM_004976	NP_004967			Shaw-related voltage-gated potassium channel							voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
GTF2H1	2965	broad.mit.edu	37	11	18387652	18387653	+	3'UTR	DEL	AT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18387652_18387653delAT	uc001moi.2	+	16					GTF2H1_uc001moh.2_3'UTR|GTF2H1_uc009yhm.2_3'UTR|GTF2H1_uc001moj.2_3'UTR	NM_001142307	NP_001135779			general transcription factor IIH, polypeptide 1,						mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding				0													NER					---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19373523	19373524	+	Intron	INS	-	GT	GT	rs138899723	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19373523_19373524insGT	uc001mpp.2	+							NM_001111018	NP_001104488			neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19532303	19532307	+	Intron	DEL	ACTGG	-	-	rs143600012		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19532303_19532307delACTGG	uc001mpp.2	+							NM_001111018	NP_001104488			neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19549484	19549485	+	Intron	INS	-	AC	AC	rs145304049	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19549484_19549485insAC	uc001mpp.2	+							NM_001111018	NP_001104488			neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19573287	19573288	+	Intron	INS	-	A	A	rs141213061	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19573287_19573288insA	uc001mpp.2	+							NM_001111018	NP_001104488			neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19575056	19575057	+	Intron	INS	-	CACACA	CACACA	rs145806450	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19575056_19575057insCACACA	uc001mpp.2	+							NM_001111018	NP_001104488			neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																OREG0020833	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	11	20678275	20678275	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20678275delC								SLC6A5 (1667 upstream) : NELL1 (12842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	24207295	24207303	+	IGR	DEL	GGAAGGAAG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24207295_24207303delGGAAGGAAG								None (None upstream) : LUZP2 (311253 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	25645701	25645702	+	IGR	INS	-	T	T	rs138594174	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25645701_25645702insT								LUZP2 (541519 upstream) : ANO3 (565127 downstream)																																			---	---	---	---
ANO3	63982	broad.mit.edu	37	11	26584943	26584952	+	Intron	DEL	TGTGTGTGTG	-	-	rs61877025		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26584943_26584952delTGTGTGTGTG	uc001mqt.3	+						ANO3_uc010rdr.1_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron|MUC15_uc001mqw.2_Intron|MUC15_uc001mqx.2_Intron|MUC15_uc001mqy.2_Intron	NM_031418	NP_113606			transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
ANO3	63982	broad.mit.edu	37	11	26630872	26630883	+	Intron	DEL	TCACATGCAGGA	-	-	rs72225637		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26630872_26630883delTCACATGCAGGA	uc001mqt.3	+						ANO3_uc010rdr.1_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron	NM_031418	NP_113606			transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
CCDC34	91057	broad.mit.edu	37	11	27373929	27373930	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27373929_27373930insA	uc001mrh.1	-						CCDC34_uc001mri.1_Intron	NM_030771	NP_110398			coiled-coil domain containing 34 isoform 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	27766501	27766502	+	IGR	INS	-	T	T	rs149490193		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27766501_27766502insT								BDNF (22896 upstream) : KIF18A (275661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29232273	29232273	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29232273delC								METT5D1 (877219 upstream) : KCNA4 (799493 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	30627839	30627839	+	IGR	DEL	A	-	-	rs76102461		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30627839delA								MPPED2 (19909 upstream) : DCDC1 (336910 downstream)																																			---	---	---	---
DCDC1	341019	broad.mit.edu	37	11	31305519	31305520	+	Intron	DEL	CT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31305519_31305520delCT	uc001msv.2	-						DCDC1_uc001msu.1_Intron	NM_181807	NP_861523			doublecortin domain containing 1						intracellular signal transduction					skin(1)	1	Lung SC(675;0.225)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	32204664	32204664	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32204664delT								RCN1 (77393 upstream) : WT1 (204661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	32504417	32504418	+	IGR	INS	-	TGTG	TGTG	rs145521568	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32504417_32504418insTGTG								WIT1 (36156 upstream) : EIF3M (100973 downstream)																																			---	---	---	---
LMO2	4005	broad.mit.edu	37	11	33897125	33897125	+	Intron	DEL	A	-	-	rs111802861		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33897125delA	uc010rem.1	-							NM_005574	NP_005565			LIM domain only 2 isoform 1						multicellular organismal development	nucleus	protein binding|zinc ion binding			lung(1)	1								T	TRD@	T-ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	11	37445261	37445261	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37445261delC								C11orf74 (748871 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	38579337	38579338	+	IGR	DEL	AC	-	-	rs67388080		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38579337_38579338delAC								None (None upstream) : None (None downstream)																																			---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40639818	40639819	+	Intron	INS	-	A	A	rs150403810	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40639818_40639819insA	uc001mxc.1	-						LRRC4C_uc001mxd.1_Intron	NM_020929	NP_065980			netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	41616827	41616827	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:41616827delT								LRRC4C (135504 upstream) : None (None downstream)																																			---	---	---	---
CD82	3732	broad.mit.edu	37	11	44635394	44635394	+	Intron	DEL	A	-	-	rs10709853		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44635394delA	uc001myc.2	+						CD82_uc001myd.2_Intron	NM_002231	NP_002222			CD82 antigen isoform 1							integral to plasma membrane	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	44701030	44701030	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44701030delT								CD82 (59717 upstream) : TSPAN18 (180849 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	46263808	46263808	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46263808delT								PHF21A (120823 upstream) : CREB3L1 (35420 downstream)																																			---	---	---	---
DGKZ	8525	broad.mit.edu	37	11	46370104	46370105	+	Intron	INS	-	TC	TC	rs144194979	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46370104_46370105insTC	uc001nch.1	+						DGKZ_uc010rgq.1_Intron|DGKZ_uc001ncj.1_Intron|DGKZ_uc010rgr.1_Intron|DGKZ_uc001nck.1_Intron|DGKZ_uc001ncl.2_Intron|DGKZ_uc001ncm.2_Intron|DGKZ_uc009yky.1_Intron|DGKZ_uc010rgs.1_Intron|DGKZ_uc001nci.1_Intron	NM_201532	NP_963290			diacylglycerol kinase zeta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)														---	---	---	---
ARFGAP2	84364	broad.mit.edu	37	11	47189416	47189417	+	Intron	INS	-	A	A	rs34204386		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47189416_47189417insA	uc001ndt.2	-						ARFGAP2_uc010rha.1_Intron|ARFGAP2_uc010rhb.1_Intron|ARFGAP2_uc001ndu.2_Intron|ARFGAP2_uc010rhc.1_Intron	NM_032389	NP_115765			ADP-ribosylation factor GTPase activating						protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding			ovary(1)	1																		---	---	---	---
FNBP4	23360	broad.mit.edu	37	11	47765831	47765831	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47765831delT	uc009ylv.2	-						FNBP4_uc001ngj.2_Intron|FNBP4_uc001ngl.2_Intron	NM_015308	NP_056123			formin binding protein 4											ovary(1)	1																		---	---	---	---
PTPRJ	5795	broad.mit.edu	37	11	48082560	48082561	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48082560_48082561insT	uc001ngp.3	+						PTPRJ_uc001ngo.3_Intron	NM_002843	NP_002834			protein tyrosine phosphatase, receptor type, J						contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	48384473	48384473	+	IGR	DEL	A	-	-	rs66860975		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48384473delA								OR4C45 (10474 upstream) : OR4A47 (125872 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48385440	48385440	+	IGR	DEL	A	-	-	rs67779764		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48385440delA								OR4C45 (11441 upstream) : OR4A47 (124905 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50620122	50620122	+	IGR	DEL	T	-	-	rs150358541		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50620122delT								LOC646813 (240319 upstream) : OR4A5 (791326 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	55468838	55468838	+	IGR	DEL	C	-	-	rs36073481		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55468838delC								OR4C6 (34680 upstream) : OR5D13 (72076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	59848046	59848046	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59848046delA								MS4A3 (9459 upstream) : MS4A2 (8091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	62052002	62052002	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62052002delT								SCGB2A2 (11375 upstream) : SCGB1D4 (11752 downstream)																																			---	---	---	---
CHRM1	1128	broad.mit.edu	37	11	62681323	62681323	+	Intron	DEL	T	-	-	rs36126486		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62681323delT	uc001nwi.2	-							NM_000738	NP_000729			cholinergic receptor, muscarinic 1						activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell proliferation|nervous system development|positive regulation of cell proliferation|protein modification process	cell junction|integral to plasma membrane|membrane fraction|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity|protein binding				0					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Benztropine(DB00245)|Bethanechol(DB01019)|Biperiden(DB00810)|Buclizine(DB00354)|Carbachol(DB00411)|Carbinoxamine(DB00748)|Cevimeline(DB00185)|Clidinium(DB00771)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Doxylamine(DB00366)|Ethopropazine(DB00392)|Flavoxate(DB01148)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quinacrine(DB01103)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trospium(DB00209)													---	---	---	---
PLCB3	5331	broad.mit.edu	37	11	64035101	64035101	+	3'UTR	DEL	T	-	-	rs71789407		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64035101delT	uc009ypg.1	+	31					PLCB3_uc009yph.1_3'UTR|PLCB3_uc009ypi.2_Intron|GPR137_uc009ypj.1_5'Flank	NM_000932	NP_000923			phospholipase C beta 3						intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2																		---	---	---	---
NRXN2	9379	broad.mit.edu	37	11	64474425	64474425	+	Intron	DEL	T	-	-	rs35829576		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64474425delT	uc001oar.2	-						NRXN2_uc001oas.2_Intron	NM_015080	NP_055895			neurexin 2 isoform alpha-1 precursor						cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10																		---	---	---	---
SNX15	29907	broad.mit.edu	37	11	64803743	64803743	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64803743delG	uc001oci.3	+						SNX15_uc009ypy.2_Intron|SNX15_uc001ocj.2_Intron|SNX15_uc001ock.2_Intron	NM_013306	NP_037438			sorting nexin 15 isoform A						cell communication|intracellular protein transport	cytoplasmic vesicle membrane|cytosol	phosphatidylinositol binding|protein transporter activity			ovary(1)	1																		---	---	---	---
SLC22A20	440044	broad.mit.edu	37	11	64994715	64994715	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64994715delA	uc010roc.1	+							NM_001004326	NP_001004326			solute carrier family 22, member 20						ion transport	integral to membrane	transmembrane transporter activity			central_nervous_system(1)	1																		---	---	---	---
TIGD3	220359	broad.mit.edu	37	11	65120529	65120529	+	5'Flank	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65120529delT	uc001odo.3	+							NM_145719	NP_663771			tigger transposable element derived 3						regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0																OREG0021076	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
LRP5	4041	broad.mit.edu	37	11	68085816	68085816	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68085816delT	uc001ont.2	+						LRP5_uc009ysg.2_Intron	NM_002335	NP_002326			low density lipoprotein receptor-related protein						adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	68222717	68222718	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68222717_68222718insT								LRP5 (5978 upstream) : SAPS3 (5468 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	68395224	68395225	+	IGR	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68395224_68395225delAC								SAPS3 (12425 upstream) : GAL (56758 downstream)																																			---	---	---	---
GAL	51083	broad.mit.edu	37	11	68458593	68458593	+	3'UTR	DEL	T	-	-	rs75147512		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68458593delT	uc001oob.2	+	6						NM_015973	NP_057057			galanin preproprotein						growth hormone secretion|insulin secretion|neuropeptide signaling pathway|smooth muscle contraction	extracellular region	neuropeptide hormone activity				0	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)														---	---	---	---
IGHMBP2	3508	broad.mit.edu	37	11	68676311	68676311	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68676311delT	uc001ook.1	+						IGHMBP2_uc001ooj.1_Intron	NM_002180	NP_002171			immunoglobulin mu binding protein 2						cell death|DNA recombination|DNA repair|DNA replication|protein homooligomerization|transcription, DNA-dependent|translation	axon|growth cone|nucleus|ribonucleoprotein complex	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' RNA helicase activity|ribosome binding|single-stranded DNA binding|transcription factor binding|tRNA binding|zinc ion binding				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	69663292	69663293	+	IGR	INS	-	TTTCT	TTTCT	rs146449202	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69663292_69663293insTTTCT								FGF3 (29100 upstream) : ANO1 (261115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	69665231	69665232	+	IGR	INS	-	A	A	rs145173465	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69665231_69665232insA								FGF3 (31039 upstream) : ANO1 (259176 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	69860107	69860108	+	IGR	INS	-	AG	AG	rs149719890	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69860107_69860108insAG								FGF3 (225915 upstream) : ANO1 (64300 downstream)																																			---	---	---	---
ANO1	55107	broad.mit.edu	37	11	70017495	70017496	+	Intron	INS	-	A	A	rs72519689		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70017495_70017496insA	uc001opj.2	+						ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron|ANO1_uc010rql.1_Intron	NM_018043	NP_060513			anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2																		---	---	---	---
DEFB108B	245911	broad.mit.edu	37	11	71547507	71547508	+	Intron	INS	-	G	G			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71547507_71547508insG	uc010rqr.1	+							NM_001002035	NP_001002035			beta-defensin 108B precursor						defense response to bacterium	extracellular region					0																		---	---	---	---
PDE2A	5138	broad.mit.edu	37	11	72347906	72347906	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72347906delC	uc010rrc.1	-						PDE2A_uc001oso.2_Intron|PDE2A_uc010rra.1_Intron|PDE2A_uc001osn.2_Intron|PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron|PDE2A_uc001osq.2_Intron	NM_002599	NP_002590			phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)													---	---	---	---
FAM168A	23201	broad.mit.edu	37	11	73184864	73184865	+	Intron	DEL	TT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73184864_73184865delTT	uc001otz.1	-						FAM168A_uc001oty.1_Intron|FAM168A_uc009ytp.1_Intron	NM_015159	NP_055974			hypothetical protein LOC23201												0																		---	---	---	---
MRPL48	51642	broad.mit.edu	37	11	73502300	73502300	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73502300delG	uc001ouh.3	+						MRPL48_uc009ytt.2_Intron|MRPL48_uc010rri.1_Intron|MRPL48_uc009ytu.2_Intron	NM_016055	NP_057139			mitochondrial ribosomal protein L48 precursor						translation	mitochondrial ribosome	protein binding|structural constituent of ribosome				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	74275835	74275836	+	IGR	INS	-	AAA	AAA	rs148497416	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74275835_74275836insAAA								LIPT2 (71080 upstream) : POLD3 (27793 downstream)																																			---	---	---	---
ACER3	55331	broad.mit.edu	37	11	76709467	76709468	+	Intron	INS	-	AGCTAAAGAGAAGAGAGG	AGCTAAAGAGAAGAGAGG	rs149593943	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76709467_76709468insAGCTAAAGAGAAGAGAGG	uc009yum.1	+						ACER3_uc010rsg.1_Intron|ACER3_uc009yul.1_Intron|ACER3_uc001oxu.2_Intron|ACER3_uc009yun.1_Intron|ACER3_uc009yuo.1_Intron|ACER3_uc010rsh.1_Intron|ACER3_uc010rsi.1_Intron|ACER3_uc010rsj.1_Intron	NM_018367	NP_060837			phytoceramidase, alkaline						ceramide metabolic process|phytosphingosine biosynthetic process|positive regulation of cell proliferation|sphingosine biosynthetic process	integral to endoplasmic reticulum membrane|integral to Golgi membrane	phytoceramidase activity				0																		---	---	---	---
MYO7A	4647	broad.mit.edu	37	11	76892815	76892816	+	Intron	INS	-	TTG	TTG			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76892815_76892816insTTG	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251			myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4																		---	---	---	---
MYO7A	4647	broad.mit.edu	37	11	76904299	76904301	+	Intron	DEL	TGG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76904299_76904301delTGG	uc001oyb.2	+						MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251			myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	79610238	79610238	+	IGR	DEL	A	-	-	rs34401494		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79610238delA								ODZ4 (458543 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	80437776	80437776	+	IGR	DEL	A	-	-	rs35872504		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80437776delA								None (None upstream) : None (None downstream)																																			---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83507952	83507953	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83507952_83507953insA	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
DLG2	1740	broad.mit.edu	37	11	84141481	84141481	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84141481delA	uc001paj.2	-						DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc001pal.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	86723126	86723127	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86723126_86723127insA								FZD4 (56693 upstream) : TMEM135 (25938 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	87242978	87242981	+	IGR	DEL	TCAA	-	-	rs138506900		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87242978_87242981delTCAA								TMEM135 (208410 upstream) : RAB38 (603450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	87968218	87968219	+	IGR	INS	-	T	T	rs145826627		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87968218_87968219insT								RAB38 (59619 upstream) : CTSC (58542 downstream)																																			---	---	---	---
GRM5	2915	broad.mit.edu	37	11	88690157	88690157	+	Intron	DEL	T	-	-	rs67296072		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88690157delT	uc001pcq.2	-						GRM5_uc009yvm.2_Intron	NM_001143831	NP_001137303			glutamate receptor, metabotropic 5 isoform a						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	90383530	90383531	+	IGR	INS	-	G	G	rs139358340	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90383530_90383531insG								CHORDC1 (426998 upstream) : MIR1261 (218758 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	90674235	90674236	+	IGR	INS	-	T	T	rs141386774	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90674235_90674236insT								MIR1261 (71865 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	91211386	91211386	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91211386delA								MIR1261 (609016 upstream) : FAT3 (873876 downstream)																																			---	---	---	---
C11orf54	28970	broad.mit.edu	37	11	93481362	93481362	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93481362delT	uc009ywi.2	+						C11orf54_uc001pee.1_Intron|C11orf54_uc001pef.2_Intron|C11orf54_uc001peg.2_Intron|C11orf54_uc001peh.2_Intron|C11orf54_uc001pei.2_Intron|C11orf54_uc001pej.2_5'Flank	NM_014039	NP_054758			hypothetical protein LOC28970							nucleus	hydrolase activity, acting on ester bonds|protein binding|zinc ion binding				0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	94000981	94000984	+	IGR	DEL	ACAC	-	-	rs147881676		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94000981_94000984delACAC								PANX1 (85846 upstream) : FOLR4 (37819 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	94818905	94818906	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94818905_94818906insA								SFRS2B (14518 upstream) : ENDOD1 (4111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	95052082	95052085	+	IGR	DEL	AAAG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95052082_95052085delAAAG								SESN3 (86377 upstream) : FAM76B (450021 downstream)																																			---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	99622793	99622794	+	Intron	INS	-	A	A	rs35666631		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99622793_99622794insA	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176			contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
ARHGAP42	143872	broad.mit.edu	37	11	100660263	100660274	+	Intron	DEL	GGCATGAGTCTT	-	-	rs72312746		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100660263_100660274delGGCATGAGTCTT	uc001pge.2	+							NM_152432	NP_689645			Rho-type GTPase-activating protein FLJ32810						filopodium assembly|signal transduction	intracellular	cytoskeletal adaptor activity|GTPase activator activity|SH3 domain binding				0																		---	---	---	---
ARHGAP42	143872	broad.mit.edu	37	11	100808785	100808786	+	Intron	INS	-	T	T	rs144745074		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100808785_100808786insT	uc001pge.2	+							NM_152432	NP_689645			Rho-type GTPase-activating protein FLJ32810						filopodium assembly|signal transduction	intracellular	cytoskeletal adaptor activity|GTPase activator activity|SH3 domain binding				0																		---	---	---	---
PGR	5241	broad.mit.edu	37	11	100971337	100971338	+	Intron	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100971337_100971338delCA	uc001pgh.2	-						PGR_uc001pgi.2_Intron|PGR_uc009yww.1_Intron|PGR_uc001pgj.2_Intron|PGR_uc009ywx.1_Intron	NM_000926	NP_000917			progesterone receptor						cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)													---	---	---	---
KIAA1377	57562	broad.mit.edu	37	11	101835369	101835369	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101835369delA	uc001pgm.2	+						KIAA1377_uc001pgn.2_Intron|KIAA1377_uc010run.1_Intron	NM_020802	NP_065853			hypothetical protein LOC57562								protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	104242586	104242587	+	IGR	INS	-	A	A	rs5794310		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104242586_104242587insA								PDGFD (207559 upstream) : CASP12 (513855 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	104380043	104380043	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104380043delA								PDGFD (345016 upstream) : CASP12 (376399 downstream)																																			---	---	---	---
AASDHPPT	60496	broad.mit.edu	37	11	105961622	105961625	+	Intron	DEL	TACT	-	-	rs138293505		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105961622_105961625delTACT	uc001pjc.1	+						AASDHPPT_uc010rvn.1_Intron|AASDHPPT_uc001pjd.1_Intron	NM_015423	NP_056238			aminoadipate-semialdehyde						macromolecule biosynthetic process|pantothenate metabolic process	cytosol	holo-[acyl-carrier-protein] synthase activity|magnesium ion binding|protein binding				0		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	106039223	106039223	+	IGR	DEL	T	-	-	rs140166260		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106039223delT								AASDHPPT (69804 upstream) : GUCY1A2 (518687 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	106292068	106292068	+	IGR	DEL	A	-	-	rs35186625		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106292068delA								AASDHPPT (322649 upstream) : GUCY1A2 (265842 downstream)																																			---	---	---	---
CWF19L2	143884	broad.mit.edu	37	11	107299327	107299328	+	Intron	INS	-	A	A	rs11377816		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107299327_107299328insA	uc010rvp.1	-						CWF19L2_uc001pjh.3_Intron|CWF19L2_uc009yxo.2_Intron	NM_152434	NP_689647			CWF19-like 2, cell cycle control								catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	111455932	111455933	+	IGR	DEL	AA	-	-	rs35436172		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111455932_111455933delAA								LAYN (24144 upstream) : SIK2 (17237 downstream)																																			---	---	---	---
SIK2	23235	broad.mit.edu	37	11	111522468	111522471	+	Intron	DEL	ATTT	-	-	rs112977830		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111522468_111522471delATTT	uc001plt.2	+							NM_015191	NP_056006			SNF1-like kinase 2						intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|skin(1)	3																		---	---	---	---
ALG9	79796	broad.mit.edu	37	11	111730221	111730221	+	Intron	DEL	T	-	-	rs11354045		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111730221delT	uc001pmb.2	-						ALG9_uc001ply.2_Intron|ALG9_uc001plz.2_Intron|ALG9_uc010rwm.1_Intron|ALG9_uc010rwn.1_Intron|ALG9_uc010rwo.1_Intron|ALG9_uc009yyh.1_Intron	NM_001077690	NP_001071158			asparagine-linked glycosylation 9 protein						dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			large_intestine(1)|ovary(1)	2		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)														---	---	---	---
NCAM1	4684	broad.mit.edu	37	11	112989863	112989864	+	Intron	INS	-	AGAC	AGAC	rs148348731	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112989863_112989864insAGAC	uc009yyq.1	+						NCAM1_uc001pno.2_Intron	NM_001076682	NP_001070150			neural cell adhesion molecule 1 isoform 3						axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)														---	---	---	---
NCAM1	4684	broad.mit.edu	37	11	113128658	113128658	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113128658delC	uc001pns.2	+											SubName: Full=cDNA FLJ52974, highly similar to Neural cell adhesion molecule 1, 140 kDa isoform;						axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	113514574	113514577	+	IGR	DEL	CATG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113514574_113514577delCATG								DRD2 (168161 upstream) : TMPRSS5 (43692 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	113592522	113592522	+	IGR	DEL	C	-	-	rs34402340		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113592522delC								TMPRSS5 (15454 upstream) : ZW10 (11389 downstream)																																			---	---	---	---
ZBTB16	7704	broad.mit.edu	37	11	113951168	113951169	+	Intron	DEL	CT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113951168_113951169delCT	uc001pop.2	+						ZBTB16_uc001poo.1_Intron|ZBTB16_uc001poq.2_Intron	NM_006006	NP_005997			promyelocytic leukemia zinc finger protein						apoptosis|central nervous system development|mesonephros development|myeloid cell differentiation|negative regulation of myeloid cell differentiation|negative regulation of transcription, DNA-dependent	nuclear speck|PML body|transcriptional repressor complex	protein homodimerization activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)														---	---	---	---
ZBTB16	7704	broad.mit.edu	37	11	113957850	113957850	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113957850delC	uc001pop.2	+						ZBTB16_uc001poo.1_Intron|ZBTB16_uc001poq.2_Intron	NM_006006	NP_005997			promyelocytic leukemia zinc finger protein						apoptosis|central nervous system development|mesonephros development|myeloid cell differentiation|negative regulation of myeloid cell differentiation|negative regulation of transcription, DNA-dependent	nuclear speck|PML body|transcriptional repressor complex	protein homodimerization activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)														---	---	---	---
ZBTB16	7704	broad.mit.edu	37	11	114061450	114061451	+	Intron	INS	-	ATAT	ATAT			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114061450_114061451insATAT	uc001pop.2	+						ZBTB16_uc001poq.2_Intron	NM_006006	NP_005997			promyelocytic leukemia zinc finger protein						apoptosis|central nervous system development|mesonephros development|myeloid cell differentiation|negative regulation of myeloid cell differentiation|negative regulation of transcription, DNA-dependent	nuclear speck|PML body|transcriptional repressor complex	protein homodimerization activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)														---	---	---	---
NNMT	4837	broad.mit.edu	37	11	114147226	114147226	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114147226delT	uc001por.1	+							NM_006169	NP_006160			nicotinamide N-methyltransferase						xenobiotic metabolic process	cytosol	nicotinamide N-methyltransferase activity|pyridine N-methyltransferase activity			ovary(1)	1		all_cancers(61;4.83e-16)|all_epithelial(67;7.28e-09)|all_hematologic(158;0.000135)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.79e-06)|Epithelial(105;1.32e-05)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.128)	Niacin(DB00627)													---	---	---	---
CADM1	23705	broad.mit.edu	37	11	115051348	115051348	+	Intron	DEL	T	-	-	rs112512887		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115051348delT	uc001ppi.3	-						CADM1_uc001ppf.3_Intron|CADM1_uc001ppk.3_Intron|CADM1_uc001ppj.3_Intron|CADM1_uc001pph.3_Intron	NM_014333	NP_055148			immunoglobulin superfamily, member 4D isoform 1						adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	115494773	115494773	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115494773delA								CADM1 (119532 upstream) : None (None downstream)																																			---	---	---	---
TAGLN	6876	broad.mit.edu	37	11	117075477	117075477	+	3'UTR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117075477delA	uc001pqm.2	+	5					uc001pqk.1_5'Flank|TAGLN_uc001pql.1_RNA|TAGLN_uc001pqn.2_3'UTR|TAGLN_uc001pqo.2_3'UTR|TAGLN_uc001pqp.2_3'UTR|uc001pqq.1_5'Flank	NM_003186	NP_003177			transgelin						muscle organ development	cytoplasm	actin binding				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|Epithelial(105;5.49e-05)|all cancers(92;0.000435)														---	---	---	---
CEP164	22897	broad.mit.edu	37	11	117224739	117224739	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117224739delT	uc001prc.2	+						CEP164_uc001prb.2_Intron|CEP164_uc010rxj.1_Intron|CEP164_uc010rxk.1_Intron	NM_014956	NP_055771			centrosomal protein 164kDa						cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	118736761	118736761	+	IGR	DEL	T	-	-	rs67977490		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118736761delT								DDX6 (74789 upstream) : CXCR5 (17780 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	119440471	119440471	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119440471delT								THY1 (146225 upstream) : PVRL1 (68337 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	123120481	123120481	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123120481delA								ASAM (54474 upstream) : GRAMD1B (276047 downstream)																																			---	---	---	---
PKNOX2	63876	broad.mit.edu	37	11	125032850	125032850	+	5'Flank	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125032850delG	uc001qbu.2	+						PKNOX2_uc010saz.1_5'Flank|PKNOX2_uc010sba.1_5'Flank|PKNOX2_uc010sbb.1_5'Flank	NM_022062	NP_071345			PBX/knotted 1 homeobox 2							nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)														---	---	---	---
KIRREL3	84623	broad.mit.edu	37	11	126418356	126418356	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126418356delA	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920			kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	126974298	126974305	+	IGR	DEL	TTCATTCA	-	-	rs10531297		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126974298_126974305delTTCATTCA								KIRREL3 (100943 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	127078672	127078675	+	IGR	DEL	AAAC	-	-	rs111940137		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127078672_127078675delAAAC								KIRREL3 (205317 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	127719982	127719982	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127719982delA								KIRREL3 (846627 upstream) : ETS1 (608674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	127818452	127818453	+	IGR	DEL	TG	-	-	rs72129598		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127818452_127818453delTG								KIRREL3 (945097 upstream) : ETS1 (510203 downstream)																																			---	---	---	---
TMEM45B	120224	broad.mit.edu	37	11	129715233	129715234	+	Intron	DEL	TG	-	-	rs138680788	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129715233_129715234delTG	uc001qfe.1	+							NM_138788	NP_620143			transmembrane protein 45B							integral to membrane					0	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	130867760	130867760	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130867760delT								SNX19 (81378 upstream) : NTM (372611 downstream)																																			---	---	---	---
NTM	50863	broad.mit.edu	37	11	132102103	132102103	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132102103delG	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron|NTM_uc001qgr.2_Intron	NM_016522	NP_057606			neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	133448817	133448818	+	IGR	INS	-	GG	GG	rs149101666	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133448817_133448818insGG								OPCML (46414 upstream) : SPATA19 (261699 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	165787	165787	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:165787delG								FAM138D (16375 upstream) : IQSEC3 (10416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	167333	167333	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:167333delA								FAM138D (17921 upstream) : IQSEC3 (8870 downstream)																																			---	---	---	---
CCDC77	84318	broad.mit.edu	37	12	518377	518377	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:518377delA	uc001qig.2	+						CCDC77_uc009zdk.2_Intron|CCDC77_uc010sdp.1_Intron|CCDC77_uc010sdq.1_Intron	NM_032358	NP_115734			coiled-coil domain containing 77 isoform a							centrosome				ovary(1)	1	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)															---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1147211	1147211	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1147211delA	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron	NM_178040	NP_829884			RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1429861	1429861	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1429861delT	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron|ERC1_uc010sdv.1_Intron|ERC1_uc001qje.2_Intron	NM_178040	NP_829884			RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1453016	1453016	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1453016delT	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron|ERC1_uc010sdv.1_Intron|ERC1_uc001qje.2_Intron	NM_178040	NP_829884			RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2656822	2656823	+	Intron	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2656822_2656823delTG	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc009zdy.1_Intron|CACNA1C_uc001qkv.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
TSPAN9	10867	broad.mit.edu	37	12	3383713	3383716	+	Intron	DEL	GTCA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3383713_3383716delGTCA	uc001qlp.2	+							NM_006675	NP_006666			tetraspanin 9							integral to plasma membrane|membrane fraction				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)															---	---	---	---
VWF	7450	broad.mit.edu	37	12	6212712	6212713	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6212712_6212713delAC	uc001qnn.1	-						VWF_uc010set.1_Intron|VWF_uc001qno.1_Intron	NM_000552	NP_000543			von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)													---	---	---	---
TPI1	7167	broad.mit.edu	37	12	6980075	6980076	+	3'UTR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6980075_6980076insA	uc001qrk.2	+	7					TPI1_uc010sfo.1_3'UTR|LRRC23_uc001qrn.1_5'Flank	NM_000365	NP_000356			triosephosphate isomerase 1 isoform 1						fatty acid biosynthetic process|gluconeogenesis|glycolysis|pentose-phosphate shunt	cytosol	triose-phosphate isomerase activity				0																		---	---	---	---
CD163L1	283316	broad.mit.edu	37	12	7554966	7554967	+	Intron	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7554966_7554967delTG	uc001qsy.2	-						CD163L1_uc010sge.1_Intron	NM_174941	NP_777601			scavenger receptor cysteine-rich type 1							extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11																		---	---	---	---
SLC2A3	6515	broad.mit.edu	37	12	8080155	8080157	+	Intron	DEL	ATC	-	-	rs142448943		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8080155_8080157delATC	uc001qtr.2	-							NM_006931	NP_008862			solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)														---	---	---	---
KLRG1	10219	broad.mit.edu	37	12	9148758	9148759	+	Intron	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9148758_9148759delTG	uc001qvh.2	+						KLRG1_uc001qvg.2_Intron	NM_005810	NP_005801			killer cell lectin-like receptor subfamily G,						cell surface receptor linked signaling pathway|cellular defense response|inflammatory response|regulation of immune response	integral to membrane	receptor activity|sugar binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	9374671	9374672	+	IGR	INS	-	T	T	rs11428799		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9374671_9374672insT								PZP (13705 upstream) : MIR1244 (17391 downstream)																																			---	---	---	---
KLRB1	3820	broad.mit.edu	37	12	9753831	9753831	+	Intron	DEL	C	-	-	rs35181877	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9753831delC	uc010sgt.1	-							NM_002258	NP_002249			killer cell lectin-like receptor subfamily B,						cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	sugar binding|transmembrane receptor activity				0																		---	---	---	---
PRB4	5545	broad.mit.edu	37	12	11218796	11218796	+	Intron	DEL	G	-	-	rs11291284		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11218796delG	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qzj.2_Intron	NM_002723	NP_002714			proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1															HNSCC(22;0.051)			---	---	---	---
Unknown	0	broad.mit.edu	37	12	17621182	17621183	+	IGR	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17621182_17621183delAC								LMO3 (858424 upstream) : RERGL (612621 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	19548953	19548956	+	IGR	DEL	AAAC	-	-	rs10565475		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19548953_19548956delAAAC								PLEKHA5 (19622 upstream) : AEBP2 (43652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	19938501	19938501	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19938501delT								AEBP2 (263328 upstream) : PDE3A (583696 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	20413110	20413110	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20413110delA								AEBP2 (737937 upstream) : PDE3A (109087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	22993726	22993727	+	IGR	DEL	GT	-	-	rs28638200	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22993726_22993727delGT								ETNK1 (150119 upstream) : SOX5 (691505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	23607200	23607200	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23607200delA								ETNK1 (763593 upstream) : SOX5 (78032 downstream)																																			---	---	---	---
C12orf11	55726	broad.mit.edu	37	12	27082714	27082717	+	Intron	DEL	AAGA	-	-	rs28835300		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27082714_27082717delAAGA	uc001rhk.3	-						C12orf11_uc010sjk.1_Intron	NM_018164	NP_060634			hypothetical protein LOC55726						cell division|mitosis|regulation of mitotic cell cycle		protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	Colorectal(261;0.0847)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	27614476	27614476	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27614476delA								ARNTL2 (41010 upstream) : C12orf70 (5267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	28871230	28871231	+	IGR	INS	-	A	A	rs77421708		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28871230_28871231insA								CCDC91 (168132 upstream) : FAR2 (431001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	29229596	29229597	+	IGR	DEL	AA	-	-	rs1390539	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29229596_29229597delAA								CCDC91 (526498 upstream) : FAR2 (72635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	32216874	32216875	+	IGR	INS	-	AC	AC	rs141291665	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32216874_32216875insAC								C12orf35 (70843 upstream) : BICD1 (43310 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	33636530	33636530	+	IGR	DEL	C	-	-	rs78957310		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33636530delC								SYT10 (43776 upstream) : ALG10 (538686 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	34850967	34850967	+	IGR	DEL	A	-	-	rs144752075	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34850967delA								ALG10 (669733 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38062871	38062871	+	IGR	DEL	A	-	-	rs138842064	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38062871delA								None (None upstream) : ALG10B (647686 downstream)																																			---	---	---	---
CNTN1	1272	broad.mit.edu	37	12	41119715	41119715	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41119715delA	uc001rmm.1	+						CNTN1_uc009zjy.1_Intron|CNTN1_uc001rmn.1_Intron	NM_001843	NP_001834			contactin 1 isoform 1 precursor						axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	43546071	43546072	+	IGR	INS	-	TGT	TGT	rs142506650	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43546071_43546072insTGT								PRICKLE1 (562499 upstream) : ADAMTS20 (201941 downstream)																																			---	---	---	---
DBX2	440097	broad.mit.edu	37	12	45427911	45427912	+	Intron	INS	-	CA	CA	rs141193526	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45427911_45427912insCA	uc001rok.1	-							NM_001004329	NP_001004329			developing brain homeobox 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	46409492	46409493	+	IGR	DEL	TT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46409492_46409493delTT								SFRS2IP (23589 upstream) : SLC38A1 (167350 downstream)																																			---	---	---	---
SLC38A1	81539	broad.mit.edu	37	12	46655005	46655005	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46655005delC	uc001rpa.2	-						SLC38A1_uc001rpb.2_Intron|SLC38A1_uc001rpc.2_Intron|SLC38A1_uc001rpd.2_Intron|SLC38A1_uc001rpe.2_Intron|SLC38A1_uc010slh.1_Intron|SLC38A1_uc009zkj.1_Intron	NM_030674	NP_109599			amino acid transporter system A1						cellular nitrogen compound metabolic process|neurotransmitter uptake	integral to membrane|plasma membrane	sodium:amino acid symporter activity			ovary(2)|skin(2)|central_nervous_system(1)	5	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)															---	---	---	---
RAPGEF3	10411	broad.mit.edu	37	12	48130953	48130954	+	3'UTR	DEL	CT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48130953_48130954delCT	uc009zkp.2	-	27					uc001rpv.2_Intron|RAPGEF3_uc001rpw.2_3'UTR|RAPGEF3_uc001rpx.2_3'UTR|RAPGEF3_uc010sln.1_3'UTR|RAPGEF3_uc001rpy.2_RNA|RAPGEF3_uc009zkq.2_3'UTR|RAPGEF3_uc001rpz.3_3'UTR	NM_001098532	NP_001092002			Rap guanine nucleotide exchange factor 3 isoform						regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex	cAMP-dependent protein kinase regulator activity|guanyl-nucleotide exchange factor activity			lung(2)|skin(1)|pancreas(1)	4	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	48641344	48641345	+	IGR	INS	-	ACACACA	ACACACA	rs141028244	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48641344_48641345insACACACA								OR10AD1 (44269 upstream) : H1FNT (81418 downstream)																																			---	---	---	---
LASS5	91012	broad.mit.edu	37	12	50528687	50528687	+	Intron	DEL	A	-	-	rs3830643		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50528687delA	uc001rwd.3	-						LASS5_uc001rwc.2_Intron|LASS5_uc001rwe.3_Intron|LASS5_uc001rwf.3_Intron|LASS5_uc010smq.1_Intron	NM_147190	NP_671723			LAG1 homolog, ceramide synthase 5						ceramide biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0																		---	---	---	---
LETMD1	25875	broad.mit.edu	37	12	51447933	51447934	+	Intron	INS	-	GA	GA	rs141010792	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51447933_51447934insGA	uc001rxm.2	+						LETMD1_uc010smz.1_Intron|LETMD1_uc010sna.1_Intron|LETMD1_uc001rxl.2_Intron|LETMD1_uc009zlv.2_Intron|LETMD1_uc001rxs.2_Intron|LETMD1_uc009zlw.2_Intron|LETMD1_uc001rxn.2_Intron|LETMD1_uc001rxo.2_Intron|LETMD1_uc001rxp.2_Intron|LETMD1_uc001rxq.2_Intron|LETMD1_uc001rxr.2_Intron|LETMD1_uc001rxt.2_Intron	NM_015416	NP_056231			LETM1 domain containing 1 isoform 1							integral to membrane|mitochondrial outer membrane	protein binding			central_nervous_system(2)	2																		---	---	---	---
KRT82	3888	broad.mit.edu	37	12	52801630	52801630	+	5'Flank	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52801630delG	uc001sai.1	-							NM_033033	NP_149022			keratin 82							keratin filament	protein binding|structural constituent of epidermis			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	53269721	53269722	+	IGR	DEL	AA	-	-	rs144376574		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53269721_53269722delAA								KRT78 (26943 upstream) : KRT8 (21249 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	55516185	55516186	+	IGR	DEL	TG	-	-	rs113396453		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55516185_55516186delTG								NEUROD4 (92385 upstream) : OR9K2 (7367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	56012840	56012840	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56012840delA								OR6C4 (66902 upstream) : OR10P1 (17836 downstream)																																			---	---	---	---
STAT6	6778	broad.mit.edu	37	12	57505073	57505074	+	5'Flank	DEL	AC	-	-	rs143689240		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57505073_57505074delAC	uc009zpe.2	-						STAT6_uc009zpf.2_5'UTR|STAT6_uc001sna.2_5'UTR|STAT6_uc010srb.1_5'UTR|STAT6_uc010src.1_5'UTR|STAT6_uc010srd.1_5'UTR|STAT6_uc009zpg.2_Intron	NM_003153	NP_003144			signal transducer and activator of transcription						regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
SHMT2	6472	broad.mit.edu	37	12	57625004	57625007	+	Intron	DEL	CCTT	-	-	rs72159442		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57625004_57625007delCCTT	uc001snf.1	+						SHMT2_uc001sng.1_Intron|SHMT2_uc001snh.1_Intron|SHMT2_uc009zpk.1_Intron|SHMT2_uc001sni.1_Intron|SHMT2_uc010srg.1_Intron|SHMT2_uc001snj.1_Intron|SHMT2_uc010srh.1_Intron|SHMT2_uc001snk.1_Intron|SHMT2_uc010sri.1_Intron|SHMT2_uc001snl.2_Intron|SHMT2_uc010srj.1_5'Flank	NM_005412	NP_005403			serine hydroxymethyltransferase 2							microtubule cytoskeleton|mitochondrial nucleoid	glycine hydroxymethyltransferase activity|methyltransferase activity			ovary(1)|central_nervous_system(1)	2					Glycine(DB00145)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	59008058	59008059	+	Intron	INS	-	AGTC	AGTC	rs141220558	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59008058_59008059insAGTC	uc001sqq.1	-											Homo sapiens cDNA FLJ35805 fis, clone TESTI2005982.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	61021799	61021799	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61021799delT								SLC16A7 (846392 upstream) : None (None downstream)																																			---	---	---	---
PPM1H	57460	broad.mit.edu	37	12	63051097	63051097	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63051097delA	uc001srk.3	-							NM_020700	NP_065751			protein phosphatase 1H (PP2C domain containing)								phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	63777113	63777114	+	IGR	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63777113_63777114delTC								AVPR1A (230523 upstream) : DPY19L2 (175579 downstream)																																			---	---	---	---
XPOT	11260	broad.mit.edu	37	12	64840403	64840404	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64840403_64840404insT	uc001ssb.2	+							NM_007235	NP_009166			tRNA exportin						intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)														---	---	---	---
RAP1B	5908	broad.mit.edu	37	12	69014386	69014387	+	Intron	INS	-	T	T	rs72361454		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69014386_69014387insT	uc001sub.2	+						RAP1B_uc010ste.1_Intron|RAP1B_uc001suc.2_Intron|RAP1B_uc010stf.1_Intron|RAP1B_uc010stg.1_Intron|RAP1B_uc010sth.1_Intron|RAP1B_uc010sti.1_Intron	NM_001089704	NP_001083173			SubName: Full=Ras-related protein Rap-1A; SubName: Full=cDNA FLJ75985, highly similar to Homo sapiens RAP1A, member of RAS oncogene family (RAP1A), transcript variant 2, mRNA; SubName: Full=RAP1A, member of RAS oncogene family;						blood coagulation|energy reserve metabolic process|regulation of establishment of cell polarity|regulation of insulin secretion	cell-cell junction|cytosol	GDP binding|GTP binding|GTPase activity|protein binding				0	Breast(13;1.24e-05)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)	GBM - Glioblastoma multiforme(7;0.000306)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	69363850	69363850	+	IGR	DEL	T	-	-	rs34946062		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69363850delT								CPM (6830 upstream) : CPSF6 (269467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	69554079	69554080	+	IGR	INS	-	A	A	rs113208291		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69554079_69554080insA								CPM (197059 upstream) : CPSF6 (79237 downstream)																																			---	---	---	---
CPSF6	11052	broad.mit.edu	37	12	69665936	69665936	+	3'UTR	DEL	T	-	-	rs144880272		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69665936delT	uc001sut.3	+	10					CPSF6_uc001suu.3_3'UTR|CPSF6_uc010stk.1_3'UTR	NM_007007	NP_008938			cleavage and polyadenylation specific factor 6,						mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	70752412	70752412	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70752412delT								CNOT2 (3640 upstream) : KCNMB4 (7650 downstream)																																			---	---	---	---
KCNMB4	27345	broad.mit.edu	37	12	70769932	70769932	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70769932delA	uc001svx.2	+							NM_014505	NP_055320			calcium-activated potassium channel beta 4						detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of neurotransmitter secretion|regulation of vasoconstriction|synaptic transmission	voltage-gated potassium channel complex	calcium-activated potassium channel activity|protein binding				0	Renal(347;0.236)		Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	70831187	70831188	+	IGR	INS	-	A	A	rs141259395	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70831187_70831188insA								KCNMB4 (6210 upstream) : PTPRB (79446 downstream)																																			---	---	---	---
ZFC3H1	196441	broad.mit.edu	37	12	72037193	72037193	+	Intron	DEL	A	-	-	rs77322213		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72037193delA	uc001swo.2	-							NM_144982	NP_659419			proline/serine-rich coiled-coil 2						RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	80549118	80549119	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80549118_80549119insA								PPP1R12A (219883 upstream) : PTPRQ (289007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	80722099	80722100	+	IGR	INS	-	AACAAC	AACAAC	rs143936880	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80722099_80722100insAACAAC								PPP1R12A (392864 upstream) : PTPRQ (116026 downstream)																																			---	---	---	---
PTPRQ	374462	broad.mit.edu	37	12	81019120	81019121	+	Intron	INS	-	AG	AG	rs143046098	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81019120_81019121insAG	uc001sze.2	+							NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	83728689	83728690	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83728689_83728690delTG								TMTC2 (200626 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	85333200	85333201	+	IGR	INS	-	TT	TT	rs63012060		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85333200_85333201insTT								SLC6A15 (26594 upstream) : TSPAN19 (74894 downstream)																																			---	---	---	---
MGAT4C	25834	broad.mit.edu	37	12	87106879	87106880	+	Intron	DEL	AC	-	-	rs35824830		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:87106879_87106880delAC	uc001tal.3	-						MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron	NM_013244	NP_037376			alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3																		---	---	---	---
MGAT4C	25834	broad.mit.edu	37	12	87136893	87136894	+	Intron	INS	-	TGTG	TGTG	rs141517571	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:87136893_87136894insTGTG	uc001tal.3	-						MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron	NM_013244	NP_037376			alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	87765045	87765046	+	IGR	INS	-	T	T	rs68043823		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:87765045_87765046insT								MGAT4C (532364 upstream) : C12orf50 (608770 downstream)																																			---	---	---	---
CEP290	80184	broad.mit.edu	37	12	88514121	88514121	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88514121delT	uc001tar.2	-						CEP290_uc001tat.2_Intron|CEP290_uc009zsl.1_Intron	NM_025114	NP_079390			centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	89141381	89141382	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89141381_89141382insT								KITLG (167143 upstream) : DUSP6 (600457 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	91181225	91181225	+	IGR	DEL	A	-	-	rs35384308		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91181225delA								None (None upstream) : C12orf12 (164768 downstream)																																			---	---	---	---
BTG1	694	broad.mit.edu	37	12	92502491	92502491	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92502491delT	uc001tbv.1	-						BTG1_uc001tbw.1_Intron|BTG1_uc001tbx.1_Intron|BTG1_uc009zss.1_Intron					Homo sapiens full length insert cDNA clone YW25A12.						cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)						T	MYC	BCLL								---	---	---	---
PLXNC1	10154	broad.mit.edu	37	12	94638231	94638232	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94638231_94638232insA	uc001tdc.2	+							NM_005761	NP_005752			plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	95359607	95359607	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95359607delA								MIR492 (131318 upstream) : NDUFA12 (5505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	97370845	97370845	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97370845delT								NEDD1 (23384 upstream) : RMST (487954 downstream)																																			---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	99817432	99817433	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99817432_99817433insA	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	99984038	99984039	+	Intron	INS	-	CC	CC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99984038_99984039insCC	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	100053443	100053446	+	Intron	DEL	TGTG	-	-	rs145360834		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100053443_100053446delTGTG	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
ACTR6	64431	broad.mit.edu	37	12	100595710	100595710	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100595710delT	uc001thb.1	+						ACTR6_uc010svh.1_Intron|ACTR6_uc001thc.1_Intron|ACTR6_uc001thd.1_Intron|ACTR6_uc009ztu.1_Intron|ACTR6_uc001the.1_Intron|ACTR6_uc001thf.1_Intron	NM_022496	NP_071941			ARP6 actin-related protein 6 homolog							cytoplasm|cytoskeleton				ovary(1)	1																		---	---	---	---
GAS2L3	283431	broad.mit.edu	37	12	100983118	100983118	+	Intron	DEL	A	-	-	rs112590509		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100983118delA	uc001thu.2	+						GAS2L3_uc009zty.2_Intron	NM_174942	NP_777602			growth arrest-specific 2 like 3						cell cycle arrest					skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	103354476	103354477	+	IGR	INS	-	TG	TG	rs141356138	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103354476_103354477insTG								ASCL1 (189 upstream) : C12orf42 (276893 downstream)																																			---	---	---	---
STAB2	55576	broad.mit.edu	37	12	104041107	104041107	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104041107delA	uc001tjw.2	+							NM_017564	NP_060034			stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14																		---	---	---	---
CHST11	50515	broad.mit.edu	37	12	104985271	104985272	+	Intron	INS	-	TCT	TCT	rs140549380	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104985271_104985272insTCT	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883			carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0																		---	---	---	---
RFX4	5992	broad.mit.edu	37	12	107001541	107001544	+	Intron	DEL	ATGA	-	-	rs111793077		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107001541_107001544delATGA	uc001tlr.2	+						RFX4_uc010swv.1_Intron|RFX4_uc001tls.2_Intron|RFX4_uc001tlt.2_Intron	NM_213594	NP_998759			regulatory factor X4 isoform c						transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
RFX4	5992	broad.mit.edu	37	12	107106552	107106552	+	Intron	DEL	T	-	-	rs59951084		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107106552delT	uc001tlr.2	+						RFX4_uc010swv.1_Intron|RFX4_uc001tls.2_Intron|RFX4_uc001tlt.2_Intron|RFX4_uc001tlv.2_Intron	NM_213594	NP_998759			regulatory factor X4 isoform c						transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
RIC8B	55188	broad.mit.edu	37	12	107178679	107178679	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107178679delC	uc001tlx.2	+						RIC8B_uc001tlw.2_Intron|RIC8B_uc001tly.2_Intron|RIC8B_uc001tlz.2_Intron	NM_018157	NP_060627			resistance to inhibitors of cholinesterase 8						regulation of G-protein coupled receptor protein signaling pathway	cell cortex|cytosol|plasma membrane	G-protein alpha-subunit binding|guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
CRY1	1407	broad.mit.edu	37	12	107450359	107450359	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107450359delT	uc001tmi.3	-							NM_004075	NP_004066			cryptochrome 1 (photolyase-like)						DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	blue light photoreceptor activity|DNA photolyase activity|double-stranded DNA binding|nucleotide binding|protein binding			ovary(3)	3																		---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	107783624	107783631	+	Intron	DEL	TGTGTGTG	-	-	rs67656571		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107783624_107783631delTGTGTGTG	uc001tmk.1	+						BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Intron	NM_001018072	NP_001018082			BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3																		---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	107950789	107950789	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107950789delA	uc001tmk.1	+						BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Intron	NM_001018072	NP_001018082			BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3																		---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	108015224	108015225	+	Intron	INS	-	T	T	rs148150168	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108015224_108015225insT	uc001tmk.1	+						BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Intron|BTBD11_uc001tml.1_Intron	NM_001018072	NP_001018082			BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	108187116	108187118	+	IGR	DEL	TTG	-	-	rs112771302	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108187116_108187118delTTG								ASCL4 (16696 upstream) : WSCD2 (336393 downstream)																																			---	---	---	---
KCTD10	83892	broad.mit.edu	37	12	109888894	109888895	+	3'UTR	DEL	AC	-	-	rs71683895		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109888894_109888895delAC	uc001toi.1	-	7					KCTD10_uc001toh.1_RNA|KCTD10_uc009zvi.1_3'UTR|KCTD10_uc001toj.1_3'UTR|KCTD10_uc001tok.1_3'UTR	NM_031954	NP_114160			potassium channel tetramerisation domain						proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	Cul3-RING ubiquitin ligase complex|cytoplasm|nucleus|voltage-gated potassium channel complex	voltage-gated potassium channel activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	111135455	111135455	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111135455delT								HVCN1 (7838 upstream) : PPP1CC (22160 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	112777846	112777847	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112777846_112777847insA								C12orf51 (33808 upstream) : RPL6 (65148 downstream)																																			---	---	---	---
OAS1	4938	broad.mit.edu	37	12	113352779	113352779	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113352779delT	uc001tud.2	+						OAS1_uc010syn.1_Intron|OAS1_uc010syo.1_Intron|OAS1_uc001tub.2_Intron|OAS1_uc001tuc.2_Intron|OAS1_uc009zwf.2_Intron	NM_016816	NP_058132			2',5'-oligoadenylate synthetase 1 isoform 1						interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	114222070	114222071	+	IGR	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114222070_114222071delCA								LHX5 (312193 upstream) : RBM19 (32472 downstream)																																			---	---	---	---
TBX5	6910	broad.mit.edu	37	12	114822550	114822550	+	Intron	DEL	A	-	-	rs139927741	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114822550delA	uc001tvo.2	-						TBX5_uc001tvp.2_Intron|TBX5_uc001tvq.2_Intron|TBX5_uc010syv.1_Intron	NM_181486	NP_852259			T-box 5 isoform 1						cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)														---	---	---	---
TBX5	6910	broad.mit.edu	37	12	114844656	114844656	+	5'Flank	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114844656delT	uc001tvo.2	-						TBX5_uc001tvp.2_Intron|TBX5_uc001tvq.2_Intron|TBX5_uc010syv.1_5'Flank|uc001tvs.1_5'Flank	NM_181486	NP_852259			T-box 5 isoform 1						cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	115059122	115059122	+	IGR	DEL	A	-	-	rs138895027		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115059122delA								TBX5 (212875 upstream) : TBX3 (48937 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	115177971	115177971	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115177971delA	uc001tvv.1	+											full-length cDNA clone CS0DI031YB14 of Placenta Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	116890938	116890939	+	IGR	DEL	TT	-	-	rs142252605		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116890938_116890939delTT								MED13L (175947 upstream) : NCRNA00173 (80288 downstream)																																			---	---	---	---
PEBP1	5037	broad.mit.edu	37	12	118572903	118572904	+	5'Flank	INS	-	TG	TG			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118572903_118572904insTG	uc001twu.1	+						PEBP1_uc010szc.1_5'Flank	NM_002567	NP_002558			prostatic binding protein								ATP binding|phosphatidylethanolamine binding|serine-type endopeptidase inhibitor activity			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)												Direct_reversal_of_damage					---	---	---	---
TAOK3	51347	broad.mit.edu	37	12	118708475	118708477	+	Intron	DEL	TTT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118708475_118708477delTTT	uc001twx.2	-						TAOK3_uc001twy.3_Intron	NM_016281	NP_057365			TAO kinase 3						MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	119691836	119691837	+	IGR	INS	-	G	G	rs143596280		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119691836_119691837insG								HSPB8 (59286 upstream) : LOC144742 (29793 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	120327159	120327160	+	IGR	INS	-	T	T	rs150399060	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120327159_120327160insT								CIT (12067 upstream) : CCDC64 (100488 downstream)																																			---	---	---	---
CCDC64	92558	broad.mit.edu	37	12	120479204	120479204	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120479204delA	uc001txl.1	+						CCDC64_uc001txk.2_Intron|CCDC64_uc009zwv.1_Intron	NM_207311	NP_997194			coiled-coil domain containing 64						Golgi to secretory granule transport|neuron projection development	centrosome	dynactin binding|Rab GTPase binding			ovary(2)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
RAB35	11021	broad.mit.edu	37	12	120549485	120549485	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120549485delA	uc001txm.1	-						RAB35_uc009zww.1_Intron|RAB35_uc010szh.1_Intron	NM_006861	NP_006852			RAB35, member RAS oncogene family						cytokinesis|endosome transport|protein transport|small GTPase mediated signal transduction	cell projection membrane|clathrin-coated endocytic vesicle|coated pit|endosome|intercellular bridge|melanosome	GTP binding|GTPase activity|phosphatidylinositol-4,5-bisphosphate binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	122644034	122644036	+	IGR	DEL	AAA	-	-	rs150418643		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122644034_122644036delAAA								MLXIP (15069 upstream) : LRRC43 (8230 downstream)																																			---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	124818500	124818501	+	Intron	DEL	GT	-	-	rs72350510		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124818500_124818501delGT	uc010tay.1	-						NCOR2_uc010taz.1_Intron|NCOR2_uc010tax.1_Intron	NM_006312	NP_006303			nuclear receptor co-repressor 2 isoform 1						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	127981308	127981309	+	IGR	INS	-	TG	TG			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127981308_127981309insTG								None (None upstream) : TMEM132C (917982 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	129529678	129529678	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129529678delA								GLT1D1 (60169 upstream) : TMEM132D (26593 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	131729055	131729055	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131729055delT								LOC116437 (31580 upstream) : SFRS8 (466580 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	131962092	131962093	+	IGR	INS	-	ATA	ATA			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131962092_131962093insATA								LOC116437 (264617 upstream) : SFRS8 (233542 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	132141694	132141696	+	IGR	DEL	ATG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132141694_132141696delATG								LOC116437 (444219 upstream) : SFRS8 (53939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	132643053	132643054	+	IGR	INS	-	AC	AC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132643053_132643054insAC								NOC4L (6067 upstream) : GALNT9 (37864 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	132964917	132964918	+	IGR	DEL	AG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132964917_132964918delAG								GALNT9 (59012 upstream) : FBRSL1 (102239 downstream)																																			---	---	---	---
POLE	5426	broad.mit.edu	37	12	133258000	133258004	+	Intron	DEL	GCTCA	-	-	rs5744732		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133258000_133258004delGCTCA	uc001uks.1	-						POLE_uc010tbq.1_Intron|POLE_uc009zyu.1_Intron	NM_006231	NP_006222			DNA-directed DNA polymerase epsilon						base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)									DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
PXMP2	5827	broad.mit.edu	37	12	133267638	133267638	+	Intron	DEL	T	-	-	rs66475637		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133267638delT	uc001ukt.2	+						PGAM5_uc010tbr.1_Intron	NM_018663	NP_061133			peroxisomal membrane protein 2, 22kDa							integral to membrane|peroxisomal membrane	protein binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.86e-08)|Epithelial(86;2.47e-07)|all cancers(50;6.85e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	20829951	20829951	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20829951delT								GJB6 (23417 upstream) : CRYL1 (147858 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22213244	22213245	+	IGR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22213244_22213245delGT								EFHA1 (34937 upstream) : FGF9 (31970 downstream)																																	OREG0022288	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	13	22309381	22309381	+	IGR	DEL	T	-	-	rs111487380		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22309381delT								FGF9 (30741 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22997245	22997246	+	IGR	INS	-	TT	TT	rs139611024	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22997245_22997246insTT								FGF9 (718605 upstream) : SGCG (757814 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	23398689	23398689	+	IGR	DEL	A	-	-	rs78432058		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23398689delA								None (None upstream) : SGCG (356371 downstream)																																			---	---	---	---
MIPEP	4285	broad.mit.edu	37	13	24389461	24389463	+	Intron	DEL	TTG	-	-	rs111483148		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24389461_24389463delTTG	uc001uox.3	-							NM_005932	NP_005923			mitochondrial intermediate peptidase precursor						protein processing involved in protein targeting to mitochondrion|proteolysis	mitochondrial matrix	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)														---	---	---	---
TPTE2P1	646405	broad.mit.edu	37	13	25503155	25503157	+	3'UTR	DEL	AAC	-	-	rs145989568		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25503155_25503157delAAC	uc010tdh.1	-	5					uc010tdg.1_5'Flank|TPTE2P1_uc001upw.2_RNA|TPTE2P1_uc001upx.3_RNA	NR_026730				RecName: Full=C2 tensin-type domain-containing protein ENSP00000371290;												0																		---	---	---	---
ATP8A2	51761	broad.mit.edu	37	13	26264527	26264528	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26264527_26264528insT	uc001uqk.2	+						ATP8A2_uc010tdi.1_Intron|ATP8A2_uc010tdj.1_Intron|ATP8A2_uc010aaj.1_Intron	NM_016529	NP_057613			ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	27546168	27546170	+	IGR	DEL	AAA	-	-	rs35944544		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27546168_27546170delAAA								GPR12 (211246 upstream) : USP12 (96268 downstream)																																			---	---	---	---
FLT3	2322	broad.mit.edu	37	13	28607290	28607290	+	Intron	DEL	A	-	-	rs67976075		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28607290delA	uc001urw.2	-						FLT3_uc010aao.2_Intron|FLT3_uc010tdn.1_Intron	NM_004119	NP_004110			fms-related tyrosine kinase 3 precursor						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)			Mis|O		AML|ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	13	29507256	29507265	+	IGR	DEL	ACACACACAC	-	-	rs71757587		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29507256_29507265delACACACACAC								SLC46A3 (214106 upstream) : MTUS2 (91483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	30316047	30316056	+	IGR	DEL	TGTGTGTGTG	-	-	rs72423220		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30316047_30316056delTGTGTGTGTG								SLC7A1 (146222 upstream) : UBL3 (22490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	30585642	30585643	+	IGR	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30585642_30585643delCA								UBL3 (160822 upstream) : KATNAL1 (191125 downstream)																																			---	---	---	---
PDS5B	23047	broad.mit.edu	37	13	33202916	33202916	+	Intron	DEL	T	-	-	rs66517336		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33202916delT	uc010abf.2	+						PDS5B_uc001uun.2_Intron|PDS5B_uc001uuo.2_Intron|PDS5B_uc010abg.2_Intron	NM_015032	NP_055847			PDS5, regulator of cohesion maintenance, homolog						cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)														---	---	---	---
KL	9365	broad.mit.edu	37	13	33593937	33593938	+	Intron	INS	-	AG	AG	rs141796177	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33593937_33593938insAG	uc001uus.2	+						KL_uc001uur.1_Intron	NM_004795	NP_004786			klotho precursor						aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)|skin(1)	3	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	34803652	34803653	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34803652_34803653delTG								RFC3 (262958 upstream) : NBEA (712803 downstream)																																			---	---	---	---
NBEA	26960	broad.mit.edu	37	13	35601521	35601521	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35601521delT	uc001uvb.2	+							NM_015678	NP_056493			neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
FAM48A	55578	broad.mit.edu	37	13	37596556	37596557	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37596556_37596557insT	uc001uwg.2	-						FAM48A_uc010abt.2_Intron|FAM48A_uc001uwh.2_Intron|FAM48A_uc001uwi.2_Intron|FAM48A_uc001uwj.2_Intron|FAM48A_uc001uwk.2_Intron|FAM48A_uc001uwd.2_5'UTR|FAM48A_uc001uwe.2_Intron|FAM48A_uc001uwf.2_Intron	NM_001014286	NP_001014308			family with sequence similarity 48, member A						autophagy|gastrulation	SAGA-type complex	protein binding				0		Lung NSC(96;2.09e-06)|Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.0959)		all cancers(112;6.06e-07)|Epithelial(112;1.87e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00794)|BRCA - Breast invasive adenocarcinoma(63;0.0128)|GBM - Glioblastoma multiforme(144;0.0477)														---	---	---	---
POSTN	10631	broad.mit.edu	37	13	38150736	38150737	+	Intron	DEL	TA	-	-	rs71904206		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38150736_38150737delTA	uc001uwo.3	-						POSTN_uc010tet.1_Intron|POSTN_uc001uwp.3_Intron|POSTN_uc001uwr.2_Intron|POSTN_uc001uwq.2_Intron|POSTN_uc010teu.1_Intron|POSTN_uc010tev.1_Intron|POSTN_uc010tew.1_Intron	NM_006475	NP_006466			periostin, osteoblast specific factor isoform 1						cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding			ovary(2)	2		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	38554345	38554348	+	IGR	DEL	TTTG	-	-	rs71850600		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38554345_38554348delTTTG								TRPC4 (110406 upstream) : UFM1 (369594 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	38812137	38812137	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38812137delT								TRPC4 (368198 upstream) : UFM1 (111805 downstream)																																			---	---	---	---
FREM2	341640	broad.mit.edu	37	13	39259965	39259965	+	5'Flank	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39259965delG	uc001uwv.2	+							NM_207361	NP_997244			FRAS1-related extracellular matrix protein 2						cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)														---	---	---	---
LHFP	10186	broad.mit.edu	37	13	40036107	40036107	+	Intron	DEL	A	-	-	rs113190970		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40036107delA	uc001uxf.2	-							NM_005780	NP_005771			lipoma HMGIC fusion partner precursor							integral to membrane	DNA binding		HMGA2/LHFP(2)	soft_tissue(2)|lung(1)|breast(1)	4		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)				T	HMGA2	lipoma								---	---	---	---
ENOX1	55068	broad.mit.edu	37	13	43979753	43979754	+	Intron	INS	-	CAC	CAC	rs143862932	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43979753_43979754insCAC	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron	NM_001127615	NP_001121087			ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)														---	---	---	---
SLC25A30	253512	broad.mit.edu	37	13	45989509	45989509	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45989509delG	uc001vag.2	-						SLC25A30_uc010tfs.1_Intron|SLC25A30_uc001vah.2_Intron|SLC25A30_uc010tft.1_Intron	NM_001010875	NP_001010875			solute carrier family 25, member 30						mitochondrial transport	integral to membrane|mitochondrial inner membrane	binding			breast(1)	1		Lung NSC(96;0.00227)|Prostate(109;0.00578)|Breast(56;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.95e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	48103917	48103918	+	IGR	INS	-	A	A	rs35753654		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48103917_48103918insA								HTR2A (632867 upstream) : SUCLA2 (412874 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	48273675	48273675	+	IGR	DEL	C	-	-	rs147689163		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48273675delC								HTR2A (802625 upstream) : SUCLA2 (243117 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	48363265	48363265	+	IGR	DEL	A	-	-	rs151248705		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48363265delA								HTR2A (892215 upstream) : SUCLA2 (153527 downstream)																																			---	---	---	---
DLEU1	10301	broad.mit.edu	37	13	50937504	50937504	+	Intron	DEL	T	-	-	rs34079374		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50937504delT	uc010adl.1	+						DLEU1_uc001vee.1_Intron|DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron|uc001vek.1_Intron|uc001vel.1_Intron|uc001vem.1_Intron|uc001ven.1_Intron|uc001veo.1_Intron|uc001vep.1_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	51178868	51178868	+	Intron	DEL	T	-	-	rs34940382		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51178868delT	uc001vet.1	+											Homo sapiens mRNA for B-cell neoplasia associated transcript, (BCMS gene), splice variant D, non coding transcript.																														---	---	---	---
GUCY1B2	2974	broad.mit.edu	37	13	51617407	51617407	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51617407delT	uc001vfd.3	-						GUCY1B2_uc010tgo.1_Intron|GUCY1B2_uc001vfc.3_Intron					SubName: Full=Guanylate cyclase 1, soluble, beta 2;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	52051805	52051806	+	IGR	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52051805_52051806delAC								INTS6 (24530 upstream) : WDFY2 (106678 downstream)																																			---	---	---	---
THSD1P1	374500	broad.mit.edu	37	13	52783345	52783346	+	Intron	DEL	TG	-	-	rs35720986		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52783345_52783346delTG	uc001vgm.1	-											Homo sapiens cDNA FLJ14630 fis, clone NT2RP2000459.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	54852081	54852083	+	IGR	DEL	AGT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54852081_54852083delAGT								None (None upstream) : MIR1297 (34024 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	55007454	55007455	+	IGR	DEL	CT	-	-	rs34109413		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55007454_55007455delCT								MIR1297 (121271 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57657031	57657031	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57657031delT								None (None upstream) : PRR20C (58021 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57853481	57853482	+	IGR	INS	-	AA	AA	rs140734824	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57853481_57853482insAA								PRR20B (109129 upstream) : PCDH17 (352307 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	58572423	58572423	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58572423delT								PCDH17 (269358 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59961421	59961422	+	IGR	INS	-	T	T	rs76772158	byFrequency;by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59961421_59961422insT								None (None upstream) : DIAPH3 (278303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	60035437	60035437	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60035437delA								None (None upstream) : DIAPH3 (204288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	61244206	61244206	+	IGR	DEL	T	-	-	rs71092692		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61244206delT								TDRD3 (96194 upstream) : PCDH20 (739615 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62771703	62771706	+	IGR	DEL	GGAA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62771703_62771706delGGAA								PCDH20 (769624 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62779593	62779594	+	IGR	DEL	TA	-	-	rs34400656		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62779593_62779594delTA								PCDH20 (777514 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63631658	63631659	+	IGR	INS	-	T	T	rs140816937		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63631658_63631659insT								None (None upstream) : OR7E156P (679909 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	68730788	68730788	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:68730788delC								PCDH9 (926320 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	71070900	71070900	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:71070900delC								ATXN8OS (357015 upstream) : DACH1 (941198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	73770914	73770915	+	IGR	INS	-	T	T	rs142312998	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73770914_73770915insT								KLF5 (119239 upstream) : KLF12 (489235 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	74067146	74067146	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74067146delT								KLF5 (415471 upstream) : KLF12 (193004 downstream)																																			---	---	---	---
KLF12	11278	broad.mit.edu	37	13	74519194	74519195	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74519194_74519195insA	uc001vjf.2	-						KLF12_uc010aeq.2_Intron|KLF12_uc001vjg.3_Intron	NM_007249	NP_009180			Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	79066552	79066554	+	Intron	DEL	AAT	-	-	rs10543814		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79066552_79066554delAAT	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	79162513	79162516	+	Intron	DEL	TGTG	-	-	rs71658008		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79162513_79162516delTGTG	uc001vku.1	+											Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	79454567	79454568	+	IGR	DEL	GT	-	-	rs35196276		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79454567_79454568delGT								RNF219 (219867 upstream) : RBM26 (439532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	80244774	80244775	+	IGR	INS	-	C	C			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80244774_80244775insC								NDFIP2 (114569 upstream) : SPRY2 (665339 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	82249681	82249681	+	IGR	DEL	T	-	-	rs147656489		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82249681delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	86161997	86161998	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86161997_86161998insA								None (None upstream) : SLITRK6 (204924 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	86472792	86472793	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86472792_86472793insA								SLITRK6 (99309 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	87355109	87355109	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87355109delT								SLITRK6 (981626 upstream) : SLITRK5 (969761 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	90541456	90541456	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90541456delT								None (None upstream) : MIR622 (341980 downstream)																																			---	---	---	---
GPC5	2262	broad.mit.edu	37	13	93213110	93213111	+	Intron	INS	-	TG	TG	rs34114433		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93213110_93213111insTG	uc010tif.1	+							NM_004466	NP_004457			glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
ABCC4	10257	broad.mit.edu	37	13	95684590	95684592	+	Intron	DEL	ATC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95684590_95684592delATC	uc001vmd.3	-						ABCC4_uc010afj.2_Intron|ABCC4_uc010afk.2_Intron	NM_005845	NP_005836			ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)													---	---	---	---
UGGT2	55757	broad.mit.edu	37	13	96519386	96519386	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96519386delA	uc001vmt.2	-							NM_020121	NP_064506			UDP-glucose ceramide glucosyltransferase-like 2						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
HS6ST3	266722	broad.mit.edu	37	13	97015545	97015545	+	Intron	DEL	T	-	-	rs140814436		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97015545delT	uc001vmw.2	+							NM_153456	NP_703157			heparan sulfate 6-O-sulfotransferase 3							integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)																	---	---	---	---
HS6ST3	266722	broad.mit.edu	37	13	97376233	97376233	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97376233delT	uc001vmw.2	+							NM_153456	NP_703157			heparan sulfate 6-O-sulfotransferase 3							integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)																	---	---	---	---
MBNL2	10150	broad.mit.edu	37	13	97962673	97962673	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97962673delT	uc010aft.2	+						MBNL2_uc001vmz.2_Intron|MBNL2_uc001vna.2_Intron|MBNL2_uc001vnb.2_Intron|MBNL2_uc010tij.1_Intron	NM_144778	NP_659002			muscleblind-like 2 isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	cytoplasm|nucleus	RNA binding|zinc ion binding				0	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)															---	---	---	---
MBNL2	10150	broad.mit.edu	37	13	98019914	98019914	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98019914delA	uc010aft.2	+						MBNL2_uc001vmz.2_Intron|MBNL2_uc001vna.2_Intron|MBNL2_uc001vnb.2_Intron|MBNL2_uc010tij.1_Intron	NM_144778	NP_659002			muscleblind-like 2 isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	cytoplasm|nucleus	RNA binding|zinc ion binding				0	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	98393864	98393864	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98393864delA								RAP2A (273613 upstream) : IPO5 (212065 downstream)																																			---	---	---	---
FARP1	10160	broad.mit.edu	37	13	99083716	99083717	+	Intron	DEL	TT	-	-	rs67688201		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99083716_99083717delTT	uc001vnj.2	+						FARP1_uc001vnh.2_Intron	NM_005766	NP_005757			FERM, RhoGEF, and pleckstrin domain protein 1						regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	99435423	99435423	+	IGR	DEL	T	-	-	rs11311515		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99435423delT								SLC15A1 (30494 upstream) : DOCK9 (10318 downstream)																																			---	---	---	---
UBAC2	337867	broad.mit.edu	37	13	99883301	99883302	+	Intron	INS	-	A	A	rs149090712	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99883301_99883302insA	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_001144072	NP_001137544			UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
CLYBL	171425	broad.mit.edu	37	13	100422341	100422342	+	Intron	INS	-	TC	TC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100422341_100422342insTC	uc001vok.2	+						CLYBL_uc010tix.1_Intron|CLYBL_uc010tiy.1_Intron	NM_206808	NP_996531			citrate lyase beta like precursor						cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	103335919	103335920	+	IGR	DEL	GT	-	-	rs112371798		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103335919_103335920delGT								TPP2 (4398 upstream) : C13orf39 (2179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	103742231	103742236	+	IGR	DEL	ACACAC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103742231_103742236delACACAC								SLC10A2 (23035 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	104065714	104065714	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104065714delG								SLC10A2 (346518 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	106585854	106585854	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106585854delT								DAOA (442472 upstream) : EFNB2 (556244 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	107055028	107055031	+	IGR	DEL	TGTG	-	-	rs111967256		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107055028_107055031delTGTG								DAOA (911646 upstream) : EFNB2 (87067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	107558453	107558454	+	IGR	INS	-	CA	CA			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107558453_107558454insCA								ARGLU1 (337939 upstream) : FAM155A (262426 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	107617243	107617244	+	IGR	INS	-	A	A	rs77002689		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107617243_107617244insA								ARGLU1 (396729 upstream) : FAM155A (203636 downstream)																																			---	---	---	---
FAM155A	728215	broad.mit.edu	37	13	107821768	107821771	+	3'UTR	DEL	TTTG	-	-	rs67025345		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107821768_107821771delTTTG	uc001vql.2	-	3						NM_001080396	NP_001073865			family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	110127026	110127027	+	IGR	INS	-	T	T	rs116619241	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110127026_110127027insT								MYO16 (266671 upstream) : IRS2 (279159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	110211823	110211823	+	IGR	DEL	G	-	-	rs34058471		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110211823delG								MYO16 (351468 upstream) : IRS2 (194363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	110503108	110503109	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110503108_110503109delTG								IRS2 (64194 upstream) : COL4A1 (298202 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	111508339	111508340	+	IGR	INS	-	GCCAGGTATTAGG	GCCAGGTATTAGG	rs143898288	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111508339_111508340insGCCAGGTATTAGG								ING1 (134919 upstream) : C13orf29 (7994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	112037214	112037215	+	IGR	INS	-	G	G	rs147230819	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112037214_112037215insG								C13orf16 (40621 upstream) : SOX1 (684698 downstream)																																			---	---	---	---
RASA3	22821	broad.mit.edu	37	13	114760044	114760044	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114760044delA	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron	NM_007368	NP_031394			RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)															---	---	---	---
RASA3	22821	broad.mit.edu	37	13	114882384	114882385	+	Intron	DEL	GT	-	-	rs34996989		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114882384_114882385delGT	uc001vui.2	-						RASA3_uc001vuj.2_Intron|RASA3_uc010tkl.1_Intron	NM_007368	NP_031394			RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)															---	---	---	---
TEP1	7011	broad.mit.edu	37	14	20844825	20844826	+	Intron	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20844825_20844826delTC	uc001vxe.2	-						TEP1_uc010ahk.2_Intron|TEP1_uc010tlf.1_Intron|TEP1_uc010tlg.1_Intron|TEP1_uc010tlh.1_Intron	NM_007110	NP_009041			telomerase-associated protein 1						telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)														---	---	---	---
RAB2B	84932	broad.mit.edu	37	14	21935070	21935071	+	Intron	INS	-	T	T	rs113373209		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21935070_21935071insT	uc010tlt.1	-						RAB2B_uc010tls.1_Intron|RAB2B_uc001wax.2_Intron|RAB2B_uc010ain.2_Intron	NM_032846	NP_116235			RAB2B protein isoform 1						protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane|plasma membrane	GTP binding			ovary(1)	1	all_cancers(95;0.000858)		Epithelial(56;1.53e-06)|all cancers(55;1.44e-05)	GBM - Glioblastoma multiforme(265;0.00391)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	22443706	22443706	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22443706delT	uc001wbw.2	+						uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
NYNRIN	57523	broad.mit.edu	37	14	24883721	24883733	+	Intron	DEL	GGGTTTCCACAGA	-	-	rs67039398		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24883721_24883733delGGGTTTCCACAGA	uc001wpf.3	+							NM_025081	NP_079357			hypothetical protein LOC57523						DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	26503352	26503352	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26503352delT								STXBP6 (984181 upstream) : NOVA1 (411738 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	28169732	28169735	+	IGR	DEL	CACA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28169732_28169735delCACA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	28945317	28945319	+	IGR	DEL	TTG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28945317_28945319delTTG								None (None upstream) : FOXG1 (290968 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	28980963	28980963	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28980963delC								None (None upstream) : FOXG1 (255324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	32351555	32351556	+	IGR	DEL	CT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32351555_32351556delCT								NUBPL (21138 upstream) : C14orf128 (193070 downstream)																																			---	---	---	---
SNX6	58533	broad.mit.edu	37	14	35073916	35073917	+	Intron	INS	-	T	T	rs147978719	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35073916_35073917insT	uc001wsf.1	-						SNX6_uc001wse.1_Intron|SNX6_uc010tpm.1_Intron|SNX6_uc010amm.1_Intron	NM_152233	NP_689419			sorting nexin 6 isoform b						cell communication|intracellular protein transport|negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent|negative regulation of transforming growth factor beta receptor signaling pathway|retrograde transport, endosome to Golgi	cytoplasmic vesicle membrane|early endosome membrane|nucleus	phosphatidylinositol binding|protein homodimerization activity				0	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	40026278	40026278	+	IGR	DEL	A	-	-	rs5808030		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40026278delA								FBXO33 (124574 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	43343195	43343195	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43343195delT								LRFN5 (969445 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	43419772	43419775	+	IGR	DEL	TGAA	-	-	rs111731004		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43419772_43419775delTGAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44374979	44374980	+	IGR	INS	-	T	T	rs137977268	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44374979_44374980insT								None (None upstream) : FSCB (598375 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44403651	44403651	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44403651delT								None (None upstream) : FSCB (569704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44528272	44528272	+	IGR	DEL	A	-	-	rs5808256		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44528272delA								None (None upstream) : FSCB (445083 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	46554427	46554436	+	IGR	DEL	ATATAGTGGT	-	-	rs142474873		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46554427_46554436delATATAGTGGT								C14orf106 (831822 upstream) : RPL10L (565786 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	47003400	47003400	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47003400delT								None (None upstream) : RPL10L (116822 downstream)																																			---	---	---	---
TMX1	81542	broad.mit.edu	37	14	51708547	51708547	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51708547delT	uc001wza.3	+						TMX1_uc010tqr.1_Intron|TMX1_uc010aoa.2_Intron	NM_030755	NP_110382			thioredoxin domain containing 1 precursor						anti-apoptosis|cell proliferation|cell redox homeostasis|DNA replication|electron transport chain|ER to Golgi vesicle-mediated transport|leukocyte activation|positive regulation of growth|positive regulation of transcription, DNA-dependent|response to stress|signal transduction	endoplasmic reticulum membrane|integral to membrane|membrane fraction	arsenate reductase (thioredoxin) activity|disulfide oxidoreductase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	52291858	52291858	+	IGR	DEL	T	-	-	rs72181980		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52291858delT								FRMD6 (94416 upstream) : GNG2 (22094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	54162945	54162945	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54162945delT								DDHD1 (542899 upstream) : BMP4 (253512 downstream)																																			---	---	---	---
C14orf34	645687	broad.mit.edu	37	14	56259940	56259941	+	Intron	INS	-	A	A	rs143239473	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56259940_56259941insA	uc010trd.1	-						C14orf34_uc010tre.1_Intron	NR_026796				Homo sapiens chromosome 14 open reading frame 34 (C14orf34), transcript variant 1, non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	56308649	56308649	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56308649delA								C14orf34 (45257 upstream) : PELI2 (276444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	56351851	56351852	+	IGR	INS	-	T	T	rs143801879	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56351851_56351852insT								C14orf34 (88459 upstream) : PELI2 (233241 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	57405869	57405870	+	IGR	DEL	AC	-	-	rs71450312		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57405869_57405870delAC								OTX2 (128685 upstream) : EXOC5 (263326 downstream)																																			---	---	---	---
GPR135	64582	broad.mit.edu	37	14	59907789	59907790	+	Intron	INS	-	A	A	rs34075525		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59907789_59907790insA	uc001xed.2	-							NM_022571				G protein-coupled receptor 135							integral to membrane|plasma membrane	G-protein coupled receptor activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.134)														---	---	---	---
RTN1	6252	broad.mit.edu	37	14	60206897	60206899	+	Intron	DEL	ATC	-	-	rs61042105		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60206897_60206899delATC	uc001xen.1	-							NM_021136	NP_066959			reticulon 1 isoform A						neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)														---	---	---	---
RTN1	6252	broad.mit.edu	37	14	60259078	60259079	+	Intron	DEL	CA	-	-	rs34358761		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60259078_60259079delCA	uc001xen.1	-							NM_021136	NP_066959			reticulon 1 isoform A						neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)														---	---	---	---
MNAT1	4331	broad.mit.edu	37	14	61281199	61281200	+	Intron	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61281199_61281200delTG	uc001xfd.2	+						MNAT1_uc001xfe.2_Intron	NM_002431	NP_002422			menage a trois 1 (CAK assembly factor)						cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein complex assembly|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	cytoplasm|holo TFIIH complex	protein N-terminus binding|zinc ion binding			ovary(1)|lung(1)	2				OV - Ovarian serous cystadenocarcinoma(108;0.0174)									Direct_reversal_of_damage|NER					---	---	---	---
KCNH5	27133	broad.mit.edu	37	14	63222758	63222759	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63222758_63222759insA	uc001xfx.2	-						KCNH5_uc001xfy.2_Intron|KCNH5_uc001xfz.1_Intron	NM_139318	NP_647479			potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)														---	---	---	---
SPTB	6710	broad.mit.edu	37	14	65293478	65293479	+	Intron	INS	-	CCAT	CCAT			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65293478_65293479insCCAT	uc001xhs.2	-						SPTB_uc001xhu.2_Intron	NM_001024858	NP_001020029			spectrin beta isoform a						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	65653692	65653694	+	IGR	DEL	AAC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65653692_65653694delAAC								MAX (84465 upstream) : LOC645431 (223619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	66531894	66531894	+	IGR	DEL	C	-	-	rs1273864		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66531894delC								FUT8 (321933 upstream) : C14orf53 (421215 downstream)																																			---	---	---	---
RAD51L1	5890	broad.mit.edu	37	14	68435998	68435998	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68435998delG	uc001xkf.1	+						RAD51L1_uc001xkd.2_Intron|RAD51L1_uc010aqr.2_Intron|RAD51L1_uc001xke.2_Intron|RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193			RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)				T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
SNORD56B	319139	broad.mit.edu	37	14	71863122	71863122	+	5'Flank	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71863122delT	uc001xmq.2	+							NR_001276				Homo sapiens small nucleolar RNA, C/D box 56B (SNORD56B), non-coding RNA.												0																		---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72767755	72767755	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72767755delG	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
DPF3	8110	broad.mit.edu	37	14	73348003	73348005	+	Intron	DEL	TGT	-	-	rs10545910		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73348003_73348005delTGT	uc001xnc.2	-						DPF3_uc001xnf.2_Intron|DPF3_uc010ari.1_Intron|DPF3_uc010ttq.1_Intron	NM_012074	NP_036206			D4, zinc and double PHD fingers, family 3						chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)														---	---	---	---
ZFYVE1	53349	broad.mit.edu	37	14	73477309	73477309	+	Intron	DEL	A	-	-	rs34902764		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73477309delA	uc001xnm.2	-						ZFYVE1_uc010arj.2_Intron	NM_021260	NP_067083			zinc finger, FYVE domain containing 1 isoform 1							endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	74091329	74091329	+	IGR	DEL	C	-	-	rs6574132	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74091329delC								ACOT6 (4739 upstream) : DNAL1 (20249 downstream)																																			---	---	---	---
C14orf45	80127	broad.mit.edu	37	14	74487209	74487209	+	Intron	DEL	T	-	-	rs33959730		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74487209delT	uc010tup.1	+						ENTPD5_uc010tuo.1_5'Flank	NM_025057	NP_079333			hypothetical protein LOC80127												0				BRCA - Breast invasive adenocarcinoma(234;0.00351)														---	---	---	---
NEK9	91754	broad.mit.edu	37	14	75558606	75558606	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75558606delA	uc001xrl.2	-						NEK9_uc001xrj.2_5'Flank|NEK9_uc001xrk.2_Intron	NM_033116	NP_149107			NIMA-related kinase 9						cell division|mitosis	mitochondrion|nucleus	ATP binding|metal ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(2)|stomach(2)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00718)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	77044758	77044758	+	IGR	DEL	T	-	-	rs78766609		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77044758delT								ESRRB (76580 upstream) : VASH1 (183477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	78249437	78249438	+	IGR	INS	-	G	G	rs79625378		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78249437_78249438insG								C14orf178 (13352 upstream) : ADCK1 (16988 downstream)																																			---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	80208144	80208145	+	Intron	INS	-	AC	AC	rs146519362	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80208144_80208145insAC	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc001xup.2_Intron|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	84774073	84774073	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84774073delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85266882	85266882	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85266882delA								None (None upstream) : FLRT2 (729606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85617416	85617417	+	IGR	DEL	AA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85617416_85617417delAA								None (None upstream) : FLRT2 (379071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85637240	85637240	+	IGR	DEL	A	-	-	rs36111356		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85637240delA								None (None upstream) : FLRT2 (359248 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	87332620	87332623	+	IGR	DEL	TGTG	-	-	rs112372706		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87332620_87332623delTGTG								None (None upstream) : GALC (971541 downstream)																																			---	---	---	---
PTPN21	11099	broad.mit.edu	37	14	88971026	88971026	+	Intron	DEL	A	-	-	rs138863875		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88971026delA	uc001xwv.3	-						PTPN21_uc010twc.1_Intron|PTPN21_uc010atf.1_Intron	NM_007039	NP_008970			protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4																		---	---	---	---
C14orf143	90141	broad.mit.edu	37	14	90303708	90303708	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90303708delG	uc001xxt.2	-						C14orf143_uc001xxs.2_Intron|C14orf143_uc001xxv.1_Intron|uc001xxu.2_5'Flank	NM_145231	NP_660274			hypothetical protein LOC90141								calcium ion binding				0		all_cancers(154;0.136)		Epithelial(152;0.194)														---	---	---	---
RPS6KA5	9252	broad.mit.edu	37	14	91442547	91442550	+	Intron	DEL	AAAA	-	-	rs150202668		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91442547_91442550delAAAA	uc001xys.2	-						RPS6KA5_uc010twi.1_Intron|RPS6KA5_uc001xyt.2_Intron|RPS6KA5_uc010att.1_Intron	NM_004755	NP_004746			ribosomal protein S6 kinase, polypeptide 5						axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	92011797	92011800	+	IGR	DEL	TTTC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92011797_92011800delTTTC								SMEK1 (34984 upstream) : C14orf184 (26988 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	92728340	92728341	+	IGR	INS	-	ACAC	ACAC	rs146511442	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92728340_92728341insACAC								CPSF2 (97797 upstream) : SLC24A4 (60584 downstream)																																			---	---	---	---
KIAA1409	57578	broad.mit.edu	37	14	93910634	93910634	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93910634delT	uc001ybs.1	+							NM_020818	NP_065869			hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)														---	---	---	---
KIAA1409	57578	broad.mit.edu	37	14	94132412	94132413	+	Intron	DEL	TG	-	-	rs34190212		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94132412_94132413delTG	uc001ybv.1	+						KIAA1409_uc001ybs.1_Intron	NM_020818	NP_065869			hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)														---	---	---	---
TCL6	27004	broad.mit.edu	37	14	96120990	96120990	+	Intron	DEL	A	-	-	rs34140444		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96120990delA	uc001yeq.2	+						TCL6_uc001yep.1_Intron	NM_020554	NP_065579			SubName: Full=T-cell leukemia/lymphoma 6 ORF163;												0		all_cancers(154;0.103)		Epithelial(152;0.0655)|all cancers(159;0.149)|BRCA - Breast invasive adenocarcinoma(234;0.206)|COAD - Colon adenocarcinoma(157;0.207)				T	TRA@	T-ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	14	97185123	97185124	+	IGR	INS	-	GT	GT	rs148572415	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97185123_97185124insGT								PAPOLA (151677 upstream) : VRK1 (78560 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	97235205	97235205	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97235205delT								PAPOLA (201759 upstream) : VRK1 (28479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99010584	99010585	+	IGR	INS	-	T	T	rs112580765		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99010584_99010585insT								C14orf64 (566123 upstream) : C14orf177 (167365 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99259807	99259807	+	IGR	DEL	C	-	-	rs1950465	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99259807delC								C14orf177 (75710 upstream) : BCL11B (375820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99272660	99272661	+	IGR	INS	-	CA	CA	rs140300117	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99272660_99272661insCA								C14orf177 (88563 upstream) : BCL11B (362966 downstream)																																			---	---	---	---
EVL	51466	broad.mit.edu	37	14	100521534	100521535	+	Intron	DEL	AA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100521534_100521535delAA	uc001ygt.2	+						EVL_uc001ygv.2_Intron	NM_016337	NP_057421			Enah/Vasp-like						actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)																---	---	---	---
RTL1	388015	broad.mit.edu	37	14	101351861	101351862	+	5'Flank	DEL	TT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101351861_101351862delTT	uc010txj.1	-							NM_001134888	NP_001128360			retrotransposon-like 1											pancreas(1)	1																		---	---	---	---
PPP2R5C	5527	broad.mit.edu	37	14	102326252	102326252	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102326252delT	uc001yko.2	+						PPP2R5C_uc010txr.1_Intron|PPP2R5C_uc001ykk.2_Intron|PPP2R5C_uc010txt.1_Intron|PPP2R5C_uc001ykn.2_Intron|PPP2R5C_uc001ykp.2_Intron|PPP2R5C_uc010txs.1_Intron	NM_002719	NP_002710			gamma isoform of regulatory subunit B56, protein						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of cell proliferation|proteasomal ubiquitin-dependent protein catabolic process|signal transduction	chromosome, centromeric region|nucleus|protein phosphatase type 2A complex	protein binding|protein binding|protein phosphatase type 2A regulator activity|protein phosphatase type 2A regulator activity			ovary(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	102519479	102519479	+	IGR	DEL	T	-	-	rs34327327		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102519479delT								DYNC1H1 (2344 upstream) : HSP90AA1 (27597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	104721005	104721006	+	IGR	INS	-	TGTG	TGTG			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104721005_104721006insTGTG								KIF26A (73771 upstream) : C14orf180 (325050 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	105095635	105095635	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105095635delG								TMEM179 (24538 upstream) : INF2 (60308 downstream)																																			---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106770438	106770439	+	Splice_Site	INS	-	CT	CT			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106770438_106770439insCT	uc010tyt.1	-	442		c.15776_splice	c.e442-1							Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	107093170	107093171	+	Intron	INS	-	G	G	rs149623573	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107093170_107093171insG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20036288	20036288	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20036288delG								None (None upstream) : GOLGA6L6 (700806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20038342	20038342	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20038342delA								None (None upstream) : GOLGA6L6 (698752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	21931004	21931004	+	IGR	DEL	A	-	-	rs113406709		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21931004delA								NF1P1 (796379 upstream) : LOC646214 (1510 downstream)																																			---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22318825	22318825	+	Intron	DEL	C	-	-	rs35131467		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22318825delC	uc001yuc.1	+						LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22334928	22334929	+	Intron	INS	-	AGAGAC	AGAGAC	rs139309913	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22334928_22334929insAGAGAC	uc001yuc.1	+						LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	22416887	22416888	+	IGR	INS	-	TTTTTA	TTTTTA	rs78995995		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22416887_22416888insTTTTTA								OR4N3P (2502 upstream) : MIR1268 (96341 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22565225	22565225	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22565225delC								MIR1268 (51945 upstream) : GOLGA8DP (137060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	24649154	24649155	+	IGR	INS	-	AT	AT	rs151155456	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24649154_24649155insAT								PWRN2 (234059 upstream) : PWRN1 (129684 downstream)																																			---	---	---	---
UBE3A	7337	broad.mit.edu	37	15	25606274	25606276	+	Intron	DEL	TTT	-	-	rs36024661		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25606274_25606276delTTT	uc001zaq.2	-						uc001zae.2_Intron|UBE3A_uc001zar.2_Intron|UBE3A_uc001zas.2_Intron|UBE3A_uc001zat.2_Intron	NM_000462	NP_000453			ubiquitin protein ligase E3A isoform 2						brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)														---	---	---	---
ATP10A	57194	broad.mit.edu	37	15	26034738	26034739	+	Intron	INS	-	GTGTGTGTGTGA	GTGTGTGTGTGA	rs147843643	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26034738_26034739insGTGTGTGTGTGA	uc010ayu.2	-							NM_024490	NP_077816			ATPase, class V, type 10A						ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	26144586	26144586	+	IGR	DEL	T	-	-	rs141426701		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26144586delT								ATP10A (34269 upstream) : GABRB3 (644109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	26731651	26731651	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26731651delA								ATP10A (621334 upstream) : GABRB3 (57044 downstream)																																			---	---	---	---
OTUD7A	161725	broad.mit.edu	37	15	31822376	31822376	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31822376delC	uc001zfq.2	-						OTUD7A_uc001zfr.2_Intron	NM_130901	NP_570971			OTU domain containing 7A							cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)														---	---	---	---
FMN1	342184	broad.mit.edu	37	15	33111422	33111422	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33111422delC	uc001zhf.3	-							NM_001103184	NP_001096654			formin 1						actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	34425684	34425684	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34425684delA								PGBD4 (29094 upstream) : C15orf29 (7192 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	35042860	35042860	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35042860delA								GOLGA8B (214638 upstream) : GJD2 (1819 downstream)																																			---	---	---	---
EXD1	161829	broad.mit.edu	37	15	41487861	41487862	+	Intron	INS	-	A	A	rs33987701		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41487861_41487862insA	uc001znk.2	-						EXD1_uc010ucv.1_Intron	NM_152596	NP_689809			exonuclease 3'-5' domain containing 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding			ovary(1)	1																		---	---	---	---
EHD4	30844	broad.mit.edu	37	15	42250086	42250086	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42250086delA	uc001zot.2	-						EHD4_uc001zou.2_Intron	NM_139265	NP_644670			EH-domain containing 4						endocytic recycling|protein homooligomerization	early endosome membrane|endoplasmic reticulum|nucleus|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			ovary(2)	2		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)														---	---	---	---
ZFP106	64397	broad.mit.edu	37	15	42758359	42758359	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42758359delA	uc001zpx.2	-						ZFP106_uc001zpy.1_Intron	NM_022473	NP_071918			zinc finger protein 106 homolog							nucleolus	zinc ion binding			central_nervous_system(2)|ovary(1)	3		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.6e-07)														---	---	---	---
CTDSPL2	51496	broad.mit.edu	37	15	44745604	44745604	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44745604delT	uc001ztr.2	+						CTDSPL2_uc001zts.2_Intron|CTDSPL2_uc001ztt.2_Intron	NM_016396	NP_057480			CTD (carboxy-terminal domain, RNA polymerase II,								phosphoprotein phosphatase activity				0		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	46593502	46593502	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46593502delA								SQRDL (610024 upstream) : SEMA6D (882901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	48401592	48401592	+	IGR	DEL	T	-	-	rs111228032		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48401592delT								SEMA6D (335173 upstream) : SLC24A5 (11577 downstream)																																			---	---	---	---
SHC4	399694	broad.mit.edu	37	15	49197138	49197139	+	Intron	DEL	AC	-	-	rs71650107		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49197138_49197139delAC	uc001zxb.1	-							NM_203349	NP_976224			rai-like protein						intracellular signal transduction	cell junction|postsynaptic membrane				ovary(3)|pancreas(2)	5		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)														---	---	---	---
SHC4	399694	broad.mit.edu	37	15	49213529	49213529	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49213529delT	uc001zxb.1	-							NM_203349	NP_976224			rai-like protein						intracellular signal transduction	cell junction|postsynaptic membrane				ovary(3)|pancreas(2)	5		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)														---	---	---	---
MAPK6	5597	broad.mit.edu	37	15	52312654	52312655	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52312654_52312655insT	uc002abp.2	+							NM_002748	NP_002739			mitogen-activated protein kinase 6						cell cycle		ATP binding|MAP kinase activity			lung(3)|ovary(1)	4				all cancers(107;0.0028)														---	---	---	---
MYO5A	4644	broad.mit.edu	37	15	52818386	52818386	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52818386delT	uc002aby.2	-						MYO5A_uc002abx.3_Intron|MYO5A_uc010uge.1_Intron	NM_000259	NP_000250			myosin VA isoform 1						actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	54159096	54159097	+	IGR	DEL	AA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54159096_54159097delAA								WDR72 (107237 upstream) : UNC13C (146004 downstream)																																			---	---	---	---
CCPG1	9236	broad.mit.edu	37	15	55769678	55769678	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55769678delG	uc002acy.2	-						DYX1C1_uc010ugh.1_Intron|DYX1C1_uc010ugi.1_Intron|DYX1C1_uc002adb.2_Intron|DYX1C1_uc002adc.2_Intron|DYX1C1_uc002add.2_Intron	NM_020739	NP_065790			cell cycle progression 1 isoform 2						cell cycle	integral to membrane				ovary(1)	1				all cancers(107;0.0354)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	56300225	56300225	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56300225delA								NEDD4 (14390 upstream) : RFX7 (79254 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	58093939	58093939	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58093939delT								GCOM1 (84187 upstream) : ALDH1A2 (151689 downstream)																																			---	---	---	---
ALDH1A2	8854	broad.mit.edu	37	15	58558169	58558169	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58558169delA	uc010ugw.1	-							NM_170697	NP_733798			aldehyde dehydrogenase 1A2 isoform 3						negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)													---	---	---	---
GTF2A2	2958	broad.mit.edu	37	15	59930640	59930642	+	3'UTR	DEL	ATG	-	-	rs3053076		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59930640_59930642delATG	uc002agg.2	-	5						NM_004492	NP_004483			general transcription factor IIA, 2, 12kDa						interspecies interaction between organisms|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	transcription factor TFIIA complex	protein heterodimerization activity|protein homodimerization activity|TBP-class protein binding|transcription coactivator activity			central_nervous_system(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	62475749	62475749	+	IGR	DEL	A	-	-	rs150215896		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62475749delA								C2CD4B (18267 upstream) : MGC15885 (453622 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	62895484	62895485	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62895484_62895485insT								C2CD4B (438002 upstream) : MGC15885 (33886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	63320780	63320783	+	IGR	DEL	ACAC	-	-	rs146009293		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63320780_63320783delACAC								TLN2 (183953 upstream) : TPM1 (14055 downstream)																																			---	---	---	---
TRIP4	9325	broad.mit.edu	37	15	64696389	64696390	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64696389_64696390insA	uc002anm.2	+							NM_016213	NP_057297			thyroid hormone receptor interactor 4						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ligand-dependent nuclear receptor binding|transcription coactivator activity|zinc ion binding			ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
MAP2K5	5607	broad.mit.edu	37	15	68029897	68029897	+	Intron	DEL	A	-	-	rs112444290		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68029897delA	uc002aqu.2	+						MAP2K5_uc002aqv.2_Intron|MAP2K5_uc002aqw.2_Intron|MAP2K5_uc002aqx.2_Intron	NM_145160	NP_660143			mitogen-activated protein kinase kinase 5						nerve growth factor receptor signaling pathway		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	68157026	68157027	+	IGR	INS	-	TTG	TTG	rs139985910	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68157026_68157027insTTG								LBXCOR1 (30852 upstream) : PIAS1 (189545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	68208815	68208818	+	IGR	DEL	AATC	-	-	rs77197478		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68208815_68208818delAATC								LBXCOR1 (82641 upstream) : PIAS1 (137754 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	70582473	70582475	+	IGR	DEL	GAG	-	-	rs79535788		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70582473_70582475delGAG								TLE3 (192217 upstream) : UACA (364420 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	70624809	70624810	+	IGR	INS	-	AC	AC	rs139744943	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70624809_70624810insAC								TLE3 (234553 upstream) : UACA (322085 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	70748125	70748126	+	IGR	INS	-	C	C	rs146282388	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70748125_70748126insC								TLE3 (357869 upstream) : UACA (198769 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	70812280	70812281	+	IGR	DEL	CA	-	-	rs35791382		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70812280_70812281delCA								TLE3 (422024 upstream) : UACA (134614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	73230402	73230403	+	IGR	INS	-	T	T	rs35514594		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73230402_73230403insT								ADPGK (153735 upstream) : NEO1 (114472 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	74272971	74272971	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74272971delT								LOXL1 (28493 upstream) : STOML1 (2590 downstream)																																			---	---	---	---
GOLGA6A	342096	broad.mit.edu	37	15	74377791	74377791	+	5'Flank	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74377791delA	uc002axa.1	-							NM_001038640	NP_001033729			golgi autoantigen, golgin subfamily a, 6												0																		---	---	---	---
LMAN1L	79748	broad.mit.edu	37	15	75104569	75104569	+	5'Flank	DEL	T	-	-	rs113438960		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75104569delT	uc002ayt.1	+						LMAN1L_uc010bkd.2_5'Flank|LMAN1L_uc010ulo.1_5'Flank|LMAN1L_uc010bke.1_5'Flank	NM_021819	NP_068591			lectin, mannose-binding, 1 like precursor							ER-Golgi intermediate compartment membrane|integral to membrane	sugar binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	75204581	75204581	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75204581delT								C15orf17 (5119 upstream) : COX5A (8038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	77202616	77202617	+	IGR	INS	-	ACAC	ACAC	rs139361993	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77202616_77202617insACAC								SCAPER (4872 upstream) : RCN2 (21345 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	78706567	78706568	+	IGR	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78706567_78706568delCA								CRABP1 (65995 upstream) : IREB2 (23950 downstream)																																			---	---	---	---
ADAMTS7	11173	broad.mit.edu	37	15	79063347	79063356	+	Intron	DEL	GCAATCGCTA	-	-	rs112014538		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79063347_79063356delGCAATCGCTA	uc002bej.3	-						ADAMTS7_uc010und.1_Intron|ADAMTS7_uc002bek.1_3'UTR	NM_014272	NP_055087			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0																		---	---	---	---
C15orf26	161502	broad.mit.edu	37	15	81409884	81409885	+	Intron	INS	-	T	T	rs143700340		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81409884_81409885insT	uc010blp.1	+							NM_173528	NP_775799			hypothetical protein LOC161502												0																		---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	86050257	86050260	+	Intron	DEL	TGGG	-	-	rs71813519		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86050257_86050260delTGGG	uc002blv.1	+						AKAP13_uc002bls.2_Intron|AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron	NM_007200	NP_009131			A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	86120560	86120564	+	Intron	DEL	GAATG	-	-	rs56040828		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86120560_86120564delGAATG	uc002blv.1	+						AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron	NM_007200	NP_009131			A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
CRTC3	64784	broad.mit.edu	37	15	91131491	91131492	+	Intron	INS	-	A	A	rs149536942		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91131491_91131492insA	uc002bpp.2	+						CRTC3_uc002bpn.2_Intron|CRTC3_uc002bpo.2_Intron	NM_022769	NP_073606			transducer of regulated CREB protein 3 isoform						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)					T	MAML2	salivary gland mucoepidermoid								---	---	---	---
SLCO3A1	28232	broad.mit.edu	37	15	92660123	92660124	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92660123_92660124insA	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404			solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	93334264	93334264	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93334264delA								FAM174B (56960 upstream) : CHD2 (95169 downstream)																																			---	---	---	---
CHD2	1106	broad.mit.edu	37	15	93442987	93442987	+	5'Flank	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93442987delT	uc002bsp.2	+						CHD2_uc002bsm.1_Intron|CHD2_uc002bsn.2_5'Flank|CHD2_uc002bso.1_5'Flank	NM_001271	NP_001262			chromodomain helicase DNA binding protein 2						regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	93791214	93791215	+	IGR	INS	-	T	T	rs148358191	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93791214_93791215insT								RGMA (158781 upstream) : MCTP2 (983586 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	93950944	93950947	+	Intron	DEL	TTTG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93950944_93950947delTTTG	uc002bsu.1	+											Homo sapiens cDNA FLJ37033 fis, clone BRACE2011389.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	94423583	94423584	+	Intron	DEL	AC	-	-	rs35288531		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94423583_94423584delAC	uc002bte.1	-											Homo sapiens cDNA clone IMAGE:5266107.																														---	---	---	---
MCTP2	55784	broad.mit.edu	37	15	94927494	94927494	+	Intron	DEL	T	-	-	rs3217405		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94927494delT	uc002btj.2	+						MCTP2_uc002bti.2_Intron|MCTP2_uc010boj.2_Intron|MCTP2_uc010bok.2_Intron|MCTP2_uc002btk.3_Intron|MCTP2_uc002btl.2_Intron	NM_018349	NP_060819			multiple C2 domains, transmembrane 2 isoform 1						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	95091904	95091905	+	IGR	DEL	GA	-	-	rs72135581		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95091904_95091905delGA								MCTP2 (64724 upstream) : LOC145820 (884417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96067843	96067845	+	IGR	DEL	CTT	-	-	rs112950682		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96067843_96067845delCTT								LOC145820 (16769 upstream) : NR2F2 (801312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96735162	96735162	+	IGR	DEL	T	-	-	rs34814926		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96735162delT								LOC145820 (684088 upstream) : NR2F2 (133995 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96920196	96920196	+	IGR	DEL	T	-	-	rs150701073	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96920196delT								NR2F2 (36706 upstream) : SPATA8 (406483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97059893	97059894	+	IGR	DEL	TT	-	-	rs72096380		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97059893_97059894delTT								NR2F2 (176403 upstream) : SPATA8 (266785 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	98113961	98113961	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98113961delG								SPATA8 (785117 upstream) : LOC91948 (171885 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	101802851	101802852	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101802851_101802852insT								CHSY1 (10725 upstream) : SELS (8362 downstream)																																			---	---	---	---
NPRL3	8131	broad.mit.edu	37	16	174348	174348	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:174348delT	uc002cfr.2	-						NPRL3_uc010uua.1_Intron|NPRL3_uc002cfp.1_Intron|NPRL3_uc002cfq.2_Intron|NPRL3_uc010uub.1_Intron|NPRL3_uc010uuc.1_Intron|NPRL3_uc002cfs.1_Intron	NM_001077350	NP_001070818			conserved gene telomeric to alpha globin cluster								protein binding			ovary(1)	1																		---	---	---	---
RAB40C	57799	broad.mit.edu	37	16	667850	667850	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:667850delA	uc002chr.2	+						RAB40C_uc002chq.2_Intron	NM_021168	NP_066991			RAB40C, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding				0		Hepatocellular(780;0.0218)																---	---	---	---
ABCA17P	650655	broad.mit.edu	37	16	2467842	2467842	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2467842delA	uc002cqc.1	+							NR_003574				Homo sapiens cDNA FLJ37881 fis, clone BRSTN2000367.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	4669645	4669646	+	IGR	DEL	TT	-	-	rs71402554		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4669645_4669646delTT								FAM100A (4718 upstream) : MGRN1 (5180 downstream)																																			---	---	---	---
ZNF500	26048	broad.mit.edu	37	16	4808912	4808912	+	Intron	DEL	A	-	-	rs74654106		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4808912delA	uc002cxp.1	-						ZNF500_uc002cxo.1_Intron|ZNF500_uc010uxt.1_Intron	NM_021646	NP_067678			zinc finger protein 500						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	6011488	6011488	+	IGR	DEL	C	-	-	rs917534		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6011488delC								FAM86A (863699 upstream) : A2BP1 (57644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	6033833	6033836	+	IGR	DEL	TCCC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6033833_6033836delTCCC								FAM86A (886044 upstream) : A2BP1 (35296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	6040982	6040982	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6040982delA								FAM86A (893193 upstream) : A2BP1 (28150 downstream)																																			---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	6662716	6662716	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6662716delG	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	6870676	6870677	+	Intron	INS	-	AAAC	AAAC	rs140758304	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6870676_6870677insAAAC	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7096239	7096240	+	Intron	DEL	GT	-	-	rs111756547		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7096239_7096240delGT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	7942973	7942974	+	IGR	DEL	GA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7942973_7942974delGA								A2BP1 (179633 upstream) : TMEM114 (676529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	8021124	8021124	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8021124delA								A2BP1 (257784 upstream) : TMEM114 (598379 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	8070293	8070294	+	IGR	INS	-	CT	CT	rs149898557	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8070293_8070294insCT								A2BP1 (306953 upstream) : TMEM114 (549209 downstream)																																			---	---	---	---
PMM2	5373	broad.mit.edu	37	16	8917163	8917164	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8917163_8917164insA	uc002czf.3	+						PMM2_uc010uyf.1_Intron|PMM2_uc010uyg.1_Intron|PMM2_uc010uyh.1_Intron|PMM2_uc010buj.2_Intron|PMM2_uc010uyi.1_Intron	NM_000303	NP_000294			phosphomannomutase 2						dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	phosphomannomutase activity			ovary(1)	1																		---	---	---	---
FAM18A	780776	broad.mit.edu	37	16	10874306	10874306	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10874306delC	uc010buo.1	-						FAM18A_uc010uyr.1_Intron|FAM18A_uc010uys.1_Intron|FAM18A_uc010uyt.1_Intron|FAM18A_uc010bun.2_Intron|FAM18A_uc010uyu.1_Intron|FAM18A_uc002dad.3_Intron|FAM18A_uc002daf.1_Intron	NM_001079512	NP_001072980			hypothetical protein LOC780776							integral to membrane					0																		---	---	---	---
SNX29	92017	broad.mit.edu	37	16	12421593	12421594	+	Intron	DEL	AG	-	-	rs3975335		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12421593_12421594delAG	uc002dby.3	+							NM_001080530	NP_001073999			sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	12965916	12965917	+	IGR	INS	-	TCT	TCT	rs150940185	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12965916_12965917insTCT								CPPED1 (68172 upstream) : SHISA9 (29560 downstream)																																			---	---	---	---
PARN	5073	broad.mit.edu	37	16	14593911	14593911	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14593911delT	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron	NM_002582	NP_002573			poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2																		---	---	---	---
BFAR	51283	broad.mit.edu	37	16	14753415	14753416	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14753415_14753416insT	uc002dco.2	+						BFAR_uc002dcp.2_Intron|BFAR_uc010uzh.1_Intron	NM_016561	NP_057645			bifunctional apoptosis regulator						anti-apoptosis|apoptosis	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	structural molecule activity|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
PDXDC1	23042	broad.mit.edu	37	16	15192058	15192058	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15192058delT	uc002ddc.2	+						uc010bve.1_Intron	NM_015027	NP_055842			pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	16918926	16918927	+	IGR	INS	-	TCA	TCA	rs139568374	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16918926_16918927insTCA								LOC339047 (474489 upstream) : XYLT1 (277256 downstream)																																			---	---	---	---
XYLT1	64131	broad.mit.edu	37	16	17397856	17397857	+	Intron	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17397856_17397857delGT	uc002dfa.2	-							NM_022166	NP_071449			xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	17574952	17574955	+	IGR	DEL	ACAC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17574952_17574955delACAC								XYLT1 (10214 upstream) : NOMO2 (936228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	17617775	17617775	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17617775delA								XYLT1 (53037 upstream) : NOMO2 (893408 downstream)																																			---	---	---	---
SMG1	23049	broad.mit.edu	37	16	18865325	18865331	+	Intron	DEL	TAGGAGG	-	-	rs59703706		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18865325_18865331delTAGGAGG	uc002dfm.2	-						SMG1_uc010bwb.2_Intron|SMG1_uc010bwa.2_Intron	NM_015092	NP_055907			PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	19290366	19290366	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19290366delC								SYT17 (11813 upstream) : LOC728276 (6739 downstream)																																			---	---	---	---
C16orf62	57020	broad.mit.edu	37	16	19630244	19630244	+	Intron	DEL	T	-	-	rs112519752		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19630244delT	uc002dgn.1	+						C16orf62_uc002dgo.1_Intron|C16orf62_uc002dgp.1_Intron	NM_020314	NP_064710			hypothetical protein LOC57020							integral to membrane				ovary(1)	1																		---	---	---	---
ACSM1	116285	broad.mit.edu	37	16	20661989	20661990	+	Intron	INS	-	A	A	rs78279863		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20661989_20661990insA	uc002dhm.1	-						ACSM1_uc002dhn.1_Intron|ACSM1_uc010bwg.1_Intron	NM_052956	NP_443188			acyl-CoA synthetase medium-chain family member						benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
EEF2K	29904	broad.mit.edu	37	16	22278917	22278917	+	Intron	DEL	A	-	-	rs77912160		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22278917delA	uc002dki.2	+						EEF2K_uc002dkh.2_Intron	NM_013302	NP_037434			elongation factor-2 kinase						insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	22928550	22928550	+	IGR	DEL	C	-	-	rs78430875		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22928550delC								HS3ST2 (893 upstream) : USP31 (144179 downstream)																																			---	---	---	---
PRKCB	5579	broad.mit.edu	37	16	23886359	23886360	+	Intron	DEL	TT	-	-	rs67490416		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23886359_23886360delTT	uc002dmd.2	+						PRKCB_uc002dme.2_Intron	NM_212535	NP_997700			protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)													---	---	---	---
PRKCB	5579	broad.mit.edu	37	16	23930156	23930156	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23930156delA	uc002dmd.2	+						PRKCB_uc002dme.2_Intron	NM_212535	NP_997700			protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	24593966	24593966	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24593966delA								RBBP6 (9785 upstream) : TNRC6A (147083 downstream)																																			---	---	---	---
TNRC6A	27327	broad.mit.edu	37	16	24830838	24830839	+	Intron	DEL	TG	-	-	rs111316847		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24830838_24830839delTG	uc002dmm.2	+						TNRC6A_uc010bxs.2_Intron|TNRC6A_uc002dmn.2_Intron|TNRC6A_uc002dmo.2_Intron|TNRC6A_uc002dmr.2_5'Flank	NM_014494	NP_055309			trinucleotide repeat containing 6A						negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	25096040	25096040	+	IGR	DEL	A	-	-	rs112621773		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25096040delA								ARHGAP17 (69365 upstream) : LCMT1 (27007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26422754	26422754	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26422754delA								HS3ST4 (273746 upstream) : C16orf82 (655465 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26461371	26461371	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26461371delA								HS3ST4 (312363 upstream) : C16orf82 (616848 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26845559	26845567	+	IGR	DEL	GGAGGAAGA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26845559_26845567delGGAGGAAGA								HS3ST4 (696551 upstream) : C16orf82 (232652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26925945	26925946	+	IGR	INS	-	C	C			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26925945_26925946insC								HS3ST4 (776937 upstream) : C16orf82 (152273 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	27130819	27130820	+	IGR	INS	-	T	T	rs147498644	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27130819_27130820insT								C16orf82 (50333 upstream) : JMJD5 (83987 downstream)																																			---	---	---	---
XPO6	23214	broad.mit.edu	37	16	28116316	28116316	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28116316delT	uc002dpa.1	-						XPO6_uc002dpb.1_Intron|XPO6_uc010vcp.1_Intron	NM_015171	NP_055986			exportin 6						protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
XPO6	23214	broad.mit.edu	37	16	28173882	28173883	+	Intron	DEL	TT	-	-	rs113189417		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28173882_28173883delTT	uc002dpa.1	-						XPO6_uc002dpb.1_Intron|XPO6_uc010vcp.1_Intron	NM_015171	NP_055986			exportin 6						protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	28298770	28298770	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28298770delA	uc002dpc.1	-											Homo sapiens cDNA FLJ34137 fis, clone FCBBF3010733.																														---	---	---	---
ATP2A1	487	broad.mit.edu	37	16	28907019	28907019	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28907019delA	uc002dro.1	+						uc010vct.1_Intron|ATP2A1_uc002drn.1_Intron|ATP2A1_uc002drp.1_Intron	NM_173201	NP_775293			ATPase, Ca++ transporting, fast twitch 1 isoform						apoptosis in response to endoplasmic reticulum stress|apoptotic mitochondrial changes|ATP biosynthetic process|calcium ion import|elevation of endoplasmic reticulum calcium ion concentration|elevation of mitochondrial calcium ion concentration|maintenance of mitochondrion location|negative regulation of striated muscle contraction|platelet activation|positive regulation of fast-twitch skeletal muscle fiber contraction|reduction of endoplasmic reticulum calcium ion concentration|relaxation of skeletal muscle|response to endoplasmic reticulum stress	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|H zone|I band|microsome|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum|sarcoplasmic reticulum membrane	ATP binding|ATP binding|calcium ion binding|calcium ion binding|calcium-transporting ATPase activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	29349607	29349608	+	Intron	DEL	AA	-	-	rs76472264		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29349607_29349608delAA	uc010vct.1	-						RUNDC2C_uc010bys.1_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
BOLA2	552900	broad.mit.edu	37	16	29557043	29557043	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29557043delT	uc010bzb.1	-						LOC440354_uc002dsp.3_Intron|uc002dtf.2_Intron|LOC440354_uc010bza.1_Intron|LOC440354_uc002dtj.2_Intron					SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	30479788	30479788	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30479788delT								SEPHS2 (22564 upstream) : ITGAL (4195 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	31176147	31176147	+	IGR	DEL	T	-	-	rs77254152		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31176147delT								PRSS36 (14732 upstream) : FUS (15306 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32422964	32422965	+	IGR	DEL	TT	-	-	rs35238106		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32422964_32422965delTT								HERC2P4 (259090 upstream) : TP53TG3B (261876 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32460828	32460831	+	IGR	DEL	TGAG	-	-	rs112878812		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32460828_32460831delTGAG								HERC2P4 (296954 upstream) : TP53TG3B (224010 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32466258	32466258	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32466258delT								HERC2P4 (302384 upstream) : TP53TG3B (218583 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32523006	32523007	+	IGR	INS	-	T	T	rs147367342		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32523006_32523007insT								HERC2P4 (359132 upstream) : TP53TG3B (161834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32539797	32539798	+	IGR	INS	-	A	A	rs138179239		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32539797_32539798insA								HERC2P4 (375923 upstream) : TP53TG3B (145043 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32544622	32544622	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32544622delT								HERC2P4 (380748 upstream) : TP53TG3B (140219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32548384	32548384	+	IGR	DEL	G	-	-	rs112617757		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32548384delG								HERC2P4 (384510 upstream) : TP53TG3B (136457 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32844771	32844774	+	IGR	DEL	CTAT	-	-	rs74380329	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32844771_32844774delCTAT								TP53TG3B (155893 upstream) : SLC6A10P (44023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33041000	33041001	+	IGR	DEL	AT	-	-	rs79665710		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33041000_33041001delAT								SLC6A10P (144537 upstream) : MIR1826 (924507 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33382685	33382688	+	IGR	DEL	CATG	-	-	rs138261645		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33382685_33382688delCATG								SLC6A10P (486222 upstream) : MIR1826 (582820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33391860	33391861	+	IGR	INS	-	GAGA	GAGA	rs55750210		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33391860_33391861insGAGA								SLC6A10P (495397 upstream) : MIR1826 (573647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33429160	33429161	+	IGR	INS	-	T	T	rs139686188	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33429160_33429161insT								SLC6A10P (532697 upstream) : MIR1826 (536347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33435738	33435739	+	IGR	INS	-	A	A	rs150378535	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33435738_33435739insA								SLC6A10P (539275 upstream) : MIR1826 (529769 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33474923	33474924	+	IGR	INS	-	A	A	rs149129291	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33474923_33474924insA								SLC6A10P (578460 upstream) : MIR1826 (490584 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33495413	33495414	+	IGR	INS	-	A	A	rs144028075	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33495413_33495414insA								SLC6A10P (598950 upstream) : MIR1826 (470094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33521131	33521133	+	IGR	DEL	AAT	-	-	rs35351557		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33521131_33521133delAAT								SLC6A10P (624668 upstream) : MIR1826 (444375 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33532378	33532380	+	IGR	DEL	AAC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33532378_33532380delAAC								SLC6A10P (635915 upstream) : MIR1826 (433128 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33857196	33857197	+	IGR	INS	-	GTGAA	GTGAA			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33857196_33857197insGTGAA								SLC6A10P (960733 upstream) : MIR1826 (108311 downstream)																																			---	---	---	---
MIR1826	100302162	broad.mit.edu	37	16	33963717	33963717	+	5'Flank	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33963717delC	hsa-mir-1826|MI0008194	+																							0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	33980480	33980480	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33980480delC								MIR1826 (14888 upstream) : UBE2MP1 (423322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46461022	46461023	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46461022_46461023insA								None (None upstream) : ANKRD26P1 (42226 downstream)																																			---	---	---	---
ITFG1	81533	broad.mit.edu	37	16	47345499	47345500	+	Intron	DEL	AA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47345499_47345500delAA	uc002eet.2	-						ITFG1_uc010vgg.1_Intron|ITFG1_uc010vgh.1_Intron	NM_030790	NP_110417			integrin alpha FG-GAP repeat containing 1							extracellular region|integral to membrane				ovary(1)|central_nervous_system(1)	2		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)																---	---	---	---
PAPD5	64282	broad.mit.edu	37	16	50249123	50249125	+	Intron	DEL	TTA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50249123_50249125delTTA	uc010vgo.1	+						PAPD5_uc010cbi.2_Intron|PAPD5_uc002efz.2_Intron|PAPD5_uc002ega.2_Intron	NM_001040284	NP_001035374			PAP associated domain containing 5 isoform a						cell division|DNA replication|histone mRNA catabolic process|mitosis	cytoplasm|nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding				0		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)														---	---	---	---
ADCY7	113	broad.mit.edu	37	16	50336060	50336062	+	Intron	DEL	CTC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50336060_50336062delCTC	uc002egd.1	+						ADCY7_uc002egb.1_Intron|ADCY7_uc002egc.1_Intron	NM_001114	NP_001105			adenylate cyclase 7						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	50433763	50433764	+	IGR	INS	-	T	T	rs68089497		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50433763_50433764insT								BRD7 (30934 upstream) : NKD1 (148477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	50899166	50899166	+	IGR	DEL	T	-	-	rs67714038		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50899166delT								CYLD (63320 upstream) : SALL1 (270720 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51205958	51205959	+	IGR	INS	-	T	T	rs112570229		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51205958_51205959insT								SALL1 (20775 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51231565	51231566	+	IGR	INS	-	AGA	AGA	rs142918190	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51231565_51231566insAGA								SALL1 (46382 upstream) : None (None downstream)																																	OREG0002655	type=REGULATORY REGION|Gene=SALL1-CHD9|Dataset=Vista Enhancers|EvidenceSubtype=In-vivo LacZ Expression Assay	---	---	---	---
Unknown	0	broad.mit.edu	37	16	51260766	51260767	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51260766_51260767insA								SALL1 (75583 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51901979	51901980	+	IGR	INS	-	G	G	rs149207371	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51901979_51901980insG								SALL1 (716796 upstream) : TOX3 (569938 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52102392	52102393	+	IGR	DEL	TG	-	-	rs72181005		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52102392_52102393delTG								SALL1 (917209 upstream) : TOX3 (369525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52412384	52412385	+	IGR	DEL	GT	-	-	rs72239113		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52412384_52412385delGT								None (None upstream) : TOX3 (59533 downstream)																																			---	---	---	---
TOX3	27324	broad.mit.edu	37	16	52559607	52559608	+	Intron	DEL	AC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52559607_52559608delAC	uc002egw.2	-						TOX3_uc010vgt.1_Intron|TOX3_uc010vgu.1_Intron	NM_001080430	NP_001073899			TOX high mobility group box family member 3						apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	55149275	55149279	+	IGR	DEL	GGAAG	-	-	rs71377162		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55149275_55149279delGGAAG								IRX5 (180882 upstream) : IRX6 (209192 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	55191551	55191557	+	IGR	DEL	AAAAGAA	-	-	rs71389044		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55191551_55191557delAAAAGAA								IRX5 (223158 upstream) : IRX6 (166914 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	58259378	58259378	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58259378delA								CSNK2A2 (27596 upstream) : CCDC113 (24462 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	58271393	58271393	+	IGR	DEL	T	-	-	rs71385156		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58271393delT								CSNK2A2 (39611 upstream) : CCDC113 (12447 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	58782493	58782493	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58782493delT								GOT2 (14247 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59474770	59474771	+	IGR	INS	-	C	C			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59474770_59474771insC								GOT2 (706524 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	60076683	60076683	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60076683delA								None (None upstream) : None (None downstream)																																			---	---	---	---
CDH8	1006	broad.mit.edu	37	16	61883226	61883226	+	Intron	DEL	A	-	-	rs66664910		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61883226delA	uc002eog.1	-						CDH8_uc002eoh.2_Intron	NM_001796	NP_001787			cadherin 8, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	62110118	62110119	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62110118_62110119insT								CDH8 (40082 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63056613	63056613	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63056613delA								CDH8 (986577 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63173184	63173185	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63173184_63173185insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63196292	63196299	+	IGR	DEL	CTTCTTTC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63196292_63196299delCTTCTTTC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63218503	63218503	+	IGR	DEL	T	-	-	rs71968408		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63218503delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63568947	63568947	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63568947delA								None (None upstream) : None (None downstream)																																			---	---	---	---
CDH11	1009	broad.mit.edu	37	16	65053800	65053800	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65053800delA	uc002eoi.2	-						CDH11_uc002eoj.2_Intron|CDH11_uc010vin.1_Intron|CDH11_uc010vio.1_Intron	NM_001797	NP_001788			cadherin 11, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)				T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			---	---	---	---
Unknown	0	broad.mit.edu	37	16	65839776	65839777	+	IGR	INS	-	TCT	TCT			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65839776_65839777insTCT								LOC283867 (229573 upstream) : CDH5 (560748 downstream)																																			---	---	---	---
CDH5	1003	broad.mit.edu	37	16	66418865	66418866	+	Intron	INS	-	AAAC	AAAC	rs139178542	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66418865_66418866insAAAC	uc002eom.3	+						CDH5_uc002eon.1_Intron	NM_001795	NP_001786			cadherin 5, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)														---	---	---	---
RANBP10	57610	broad.mit.edu	37	16	67771663	67771663	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67771663delC	uc002eud.2	-						RANBP10_uc010ceo.2_Intron|RANBP10_uc010vju.1_Intron|RANBP10_uc010vjv.1_Intron|RANBP10_uc010vjx.1_Intron|RANBP10_uc010vjy.1_Intron	NM_020850	NP_065901			RAN binding protein 10											ovary(1)	1		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)														---	---	---	---
DPEP3	64180	broad.mit.edu	37	16	68013233	68013233	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68013233delA	uc002evc.3	-						DPEP3_uc010cex.2_Intron	NM_022357	NP_071752			dipeptidase 3 isoform a						meiosis	anchored to membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity			breast(3)	3		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)														---	---	---	---
NFATC3	4775	broad.mit.edu	37	16	68176147	68176148	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68176147_68176148insT	uc002evo.1	+						NFATC3_uc010vkl.1_Intron|NFATC3_uc010vkm.1_Intron|NFATC3_uc010vkn.1_Intron|NFATC3_uc010vko.1_Intron|NFATC3_uc010vkp.1_Intron|NFATC3_uc010vkq.1_Intron|NFATC3_uc002evl.2_Intron|NFATC3_uc002evk.2_Intron|NFATC3_uc002evm.1_Intron|NFATC3_uc002evn.1_Intron|NFATC3_uc010vkr.1_Intron|NFATC3_uc010vks.1_Intron|NFATC3_uc010vkt.1_Intron|NFATC3_uc010vku.1_Intron|NFATC3_uc010vkv.1_Intron|NFATC3_uc010vkw.1_Intron|NFATC3_uc010vkx.1_Intron|NFATC3_uc010vky.1_Intron|NFATC3_uc010vkz.1_Intron|NFATC3_uc010vla.1_Intron|NFATC3_uc010vlb.1_Intron|NFATC3_uc010vlc.1_Intron	NM_173165	NP_775188			nuclear factor of activated T-cells,						inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)														---	---	---	---
TMCO7	79613	broad.mit.edu	37	16	69059906	69059906	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69059906delT	uc002ewi.3	+							NM_024562	NP_078838			transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)														---	---	---	---
HYDIN	54768	broad.mit.edu	37	16	71040988	71040988	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71040988delT	uc002ezr.2	-							NM_032821	NP_116210			hydrocephalus inducing isoform a											ovary(1)|skin(1)	2		Ovarian(137;0.0654)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	71370826	71370827	+	IGR	INS	-	T	T	rs138039609	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71370826_71370827insT								FTSJD1 (47313 upstream) : CALB2 (21799 downstream)																																			---	---	---	---
PHLPP2	23035	broad.mit.edu	37	16	71716122	71716122	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71716122delT	uc002fax.2	-						PHLPP2_uc002fav.2_5'Flank|PHLPP2_uc010cgf.2_Intron|PHLPP2_uc002fay.1_Intron	NM_015020	NP_055835			PH domain and leucine rich repeat protein							cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	72792498	72792499	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72792498_72792499insT	uc002fcj.1	+											Homo sapiens cDNA FLJ11501 fis, clone HEMBA1002100.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	73622606	73622606	+	IGR	DEL	C	-	-	rs12925130		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73622606delC								HTA (494936 upstream) : PSMD7 (708075 downstream)																																			---	---	---	---
LOC283922	283922	broad.mit.edu	37	16	74392303	74392303	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74392303delA	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	74419886	74419887	+	Intron	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74419886_74419887delTC	uc010vmt.1	+											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	74460227	74460228	+	IGR	DEL	AT	-	-	rs113968392		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74460227_74460228delAT								CLEC18B (4578 upstream) : GLG1 (21100 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	75246585	75246586	+	IGR	INS	-	GTG	GTG	rs78746547		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75246585_75246586insGTG								CTRB2 (5513 upstream) : CTRB1 (6298 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	76003231	76003236	+	IGR	DEL	TCCTCC	-	-	rs71134737	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76003231_76003236delTCCTCC								TERF2IP (311903 upstream) : CNTNAP4 (307940 downstream)																																			---	---	---	---
CNTNAP4	85445	broad.mit.edu	37	16	76351605	76351606	+	Intron	INS	-	GTGT	GTGT	rs146648270	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76351605_76351606insGTGT	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837			cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	77781962	77781962	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77781962delT								NUDT7 (5809 upstream) : VAT1L (40521 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	79284974	79284975	+	IGR	INS	-	C	C	rs144229458	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79284974_79284975insC								WWOX (38411 upstream) : MAF (342771 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	79713433	79713433	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79713433delT								MAF (78811 upstream) : DYNLRB2 (861421 downstream)																																			---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83594890	83594890	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83594890delA	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	86276067	86276068	+	IGR	DEL	CT	-	-	rs67086666		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86276067_86276068delCT								IRF8 (319858 upstream) : LOC732275 (89388 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	87050312	87050313	+	IGR	INS	-	T	T	rs148845324	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87050312_87050313insT								FOXL1 (435009 upstream) : FBXO31 (312631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	87843487	87843488	+	IGR	INS	-	AG	AG	rs143291422	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87843487_87843488insAG								KLHDC4 (43945 upstream) : SLC7A5 (20142 downstream)																																			---	---	---	---
CA5A	763	broad.mit.edu	37	16	87934007	87934007	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87934007delA	uc002fkn.1	-							NM_001739	NP_001730			carbonic anhydrase VA, mitochondrial precursor						one-carbon metabolic process	mitochondrial matrix	carbonate dehydratase activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0513)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	88197219	88197222	+	IGR	DEL	GATG	-	-	rs111997484		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88197219_88197222delGATG								BANP (86296 upstream) : ZNF469 (296657 downstream)																																			---	---	---	---
NXN	64359	broad.mit.edu	37	17	809975	809976	+	Intron	DEL	TT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:809975_809976delTT	uc002fsa.2	-							NM_022463	NP_071908			nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)														---	---	---	---
SLC43A2	124935	broad.mit.edu	37	17	1516266	1516266	+	Intron	DEL	A	-	-	rs113654174		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1516266delA	uc002fsv.2	-						SLC43A2_uc002fsu.2_Intron|SLC43A2_uc002fsw.2_Intron|SLC43A2_uc002fsx.2_Intron	NM_152346	NP_689559			solute carrier family 43, member 2						cellular nitrogen compound metabolic process|ion transport	integral to membrane|plasma membrane					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0883)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	5676547	5676548	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5676547_5676548insA	uc002gcm.2	+											Homo sapiens hypothetical protein LOC339166, mRNA (cDNA clone IMAGE:5163423), partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	7032940	7032941	+	IGR	INS	-	TG	TG	rs149033773	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7032940_7032941insTG								ASGR2 (14648 upstream) : ASGR1 (43811 downstream)																																			---	---	---	---
TP53	7157	broad.mit.edu	37	17	7582240	7582241	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7582240_7582241insT	uc002gim.2	-						TP53_uc002gig.1_5'Flank|TP53_uc002gih.2_5'Flank|TP53_uc010cnh.1_Intron|TP53_uc010cni.1_Intron|TP53_uc002gij.2_Intron|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Intron|TP53_uc010cnk.1_Intron	NM_001126112	NP_001119584			tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(2)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
CCDC42	146849	broad.mit.edu	37	17	8643213	8643214	+	Intron	INS	-	C	C	rs149149374	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8643213_8643214insC	uc002gln.2	-						CCDC42_uc002glo.2_Intron	NM_144681	NP_653282			coiled-coil domain containing 42 isoform 1											ovary(1)	1																		---	---	---	---
GAS7	8522	broad.mit.edu	37	17	10058336	10058336	+	Intron	DEL	T	-	-	rs112469999		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10058336delT	uc002gmg.1	-							NM_201433	NP_958839			growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2								T	MLL	AML*								---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11590583	11590583	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11590583delA	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	12973926	12973926	+	IGR	DEL	A	-	-	rs76199030		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12973926delA								ELAC2 (52567 upstream) : HS3ST3A1 (425080 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	13013192	13013195	+	IGR	DEL	TGGC	-	-	rs140141491		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13013192_13013195delTGGC								ELAC2 (91833 upstream) : HS3ST3A1 (385811 downstream)																																			---	---	---	---
COX10	1352	broad.mit.edu	37	17	14063000	14063002	+	Intron	DEL	ATT	-	-	rs149677552		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14063000_14063002delATT	uc002gof.3	+						COX10_uc010vvs.1_Intron|COX10_uc010vvt.1_Intron	NM_001303	NP_001294			heme A:farnesyltransferase precursor						heme a biosynthetic process|heme O biosynthetic process|respiratory chain complex IV assembly	integral to membrane|mitochondrial membrane	protoheme IX farnesyltransferase activity				0		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	14623755	14623758	+	IGR	DEL	TGTG	-	-	rs151075550		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14623755_14623758delTGTG								HS3ST3B1 (374263 upstream) : PMP22 (509339 downstream)																																			---	---	---	---
FAM18B2	201158	broad.mit.edu	37	17	15428995	15428996	+	Intron	DEL	CA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15428995_15428996delCA	uc002goq.2	-						CDRT4_uc010vvw.1_Intron|FAM18B2_uc010vvx.1_Intron	NM_145301	NP_660344			hypothetical protein LOC201158 isoform 1							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0872)|BRCA - Breast invasive adenocarcinoma(8;0.0581)|READ - Rectum adenocarcinoma(1115;0.0967)														---	---	---	---
MPRIP	23164	broad.mit.edu	37	17	16959931	16959931	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16959931delT	uc002gqu.1	+						MPRIP_uc002gqv.1_Intron	NM_201274	NP_958431			myosin phosphatase-Rho interacting protein							cytoplasm|cytoskeleton	actin binding				0																		---	---	---	---
RAI1	10743	broad.mit.edu	37	17	17703495	17703500	+	Intron	DEL	TCTCTC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17703495_17703500delTCTCTC	uc002grm.2	+							NM_030665	NP_109590			retinoic acid induced 1							cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)														---	---	---	---
SLC5A10	125206	broad.mit.edu	37	17	18864154	18864154	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18864154delG	uc002guu.1	+						SLC5A10_uc002gur.1_Intron|SLC5A10_uc002gut.1_Intron|SLC5A10_uc002guv.1_Intron|SLC5A10_uc010vyl.1_Intron	NM_001042450	NP_001035915			solute carrier family 5 (sodium/glucose						sodium ion transport|transmembrane transport	integral to membrane	transporter activity			ovary(1)	1																OREG0024231	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
RNF112	7732	broad.mit.edu	37	17	19314918	19314918	+	Intron	DEL	T	-	-	rs35694276		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19314918delT	uc010vyw.1	+						RNF112_uc010vyu.1_Intron|RNF112_uc010vyv.1_Intron|RNF112_uc010vyx.1_5'Flank	NM_007148	NP_009079			ring finger protein 112								GTP binding|GTPase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
ALDH3A2	224	broad.mit.edu	37	17	19576700	19576700	+	Intron	DEL	T	-	-	rs66737570		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19576700delT	uc002gwb.1	+						ALDH3A2_uc002gwa.1_Intron|ALDH3A2_uc010cqr.1_Intron|ALDH3A2_uc002gwc.1_Intron|ALDH3A2_uc002gwd.1_Intron	NM_000382	NP_000373			aldehyde dehydrogenase 3A2 isoform 2						cellular aldehyde metabolic process|central nervous system development|epidermis development|lipid metabolic process|peripheral nervous system development	endoplasmic reticulum membrane|integral to membrane	3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase			ovary(2)	2	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)				NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	21236300	21236300	+	IGR	DEL	T	-	-	rs66882987		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21236300delT								MAP2K3 (17751 upstream) : KCNJ12 (43399 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21246683	21246683	+	IGR	DEL	A	-	-	rs66832039		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21246683delA								MAP2K3 (28134 upstream) : KCNJ12 (33016 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21248150	21248151	+	IGR	INS	-	C	C	rs142379650		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21248150_21248151insC								MAP2K3 (29601 upstream) : KCNJ12 (31548 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21335417	21335419	+	IGR	DEL	ACA	-	-	rs112205373		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21335417_21335419delACA								KCNJ12 (12238 upstream) : C17orf51 (96153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21488070	21488071	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21488070_21488071insT								C17orf51 (10339 upstream) : FAM27L (337299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21506391	21506392	+	IGR	INS	-	TTTG	TTTG			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21506391_21506392insTTTG								C17orf51 (28660 upstream) : FAM27L (318978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21535170	21535170	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21535170delC								C17orf51 (57439 upstream) : FAM27L (290200 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21540907	21540910	+	IGR	DEL	TTGT	-	-	rs112854575		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21540907_21540910delTTGT								C17orf51 (63176 upstream) : FAM27L (284460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21546701	21546702	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21546701_21546702insT								C17orf51 (68970 upstream) : FAM27L (278668 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21565641	21565642	+	IGR	DEL	TT	-	-	rs74643846		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21565641_21565642delTT								C17orf51 (87910 upstream) : FAM27L (259728 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	22085311	22085311	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22085311delA								FLJ36000 (172241 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	22253548	22253549	+	IGR	INS	-	C	C	rs138638530		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22253548_22253549insC								FLJ36000 (340478 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25293189	25293190	+	IGR	INS	-	ATG	ATG			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25293189_25293190insATG								None (None upstream) : WSB1 (327916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25310849	25310849	+	IGR	DEL	A	-	-	rs33937773		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25310849delA								None (None upstream) : WSB1 (310257 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25407207	25407208	+	IGR	INS	-	T	T	rs146648363	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25407207_25407208insT								None (None upstream) : WSB1 (213898 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25615556	25615557	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25615556_25615557insT								None (None upstream) : WSB1 (5549 downstream)																																			---	---	---	---
NOS2	4843	broad.mit.edu	37	17	26137165	26137166	+	Intron	INS	-	GGAT	GGAT	rs143417660	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26137165_26137166insGGAT	uc010crh.1	-							NM_000625	NP_000616			nitric oxide synthase 2A						arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)													---	---	---	---
TAOK1	57551	broad.mit.edu	37	17	27762152	27762152	+	Intron	DEL	G	-	-	rs57516771		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27762152delG	uc002hdz.1	+						TAOK1_uc010wbe.1_Intron|TAOK1_uc010wbf.1_Intron	NM_020791	NP_065842			TAO kinase 1						mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)															---	---	---	---
NF1	4763	broad.mit.edu	37	17	29473428	29473431	+	Intron	DEL	TCCA	-	-	rs112178514		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29473428_29473431delTCCA	uc002hgg.2	+						NF1_uc002hge.1_Intron|NF1_uc002hgf.1_Intron|NF1_uc002hgh.2_Intron	NM_001042492	NP_001035957			neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.0?(5)|p.?(3)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)				D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			---	---	---	---
LRRC37B	114659	broad.mit.edu	37	17	30354395	30354396	+	Intron	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30354395_30354396delTG	uc002hgu.2	+						LRRC37B_uc010wbx.1_Intron|LRRC37B_uc010csu.2_Intron	NM_052888	NP_443120			leucine rich repeat containing 37B precursor							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	30724837	30724837	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30724837delT								ZNF207 (16862 upstream) : PSMD11 (46665 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	31235010	31235018	+	IGR	DEL	CTTAGCCCA	-	-	rs60172242	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31235010_31235018delCTTAGCCCA								MYO1D (31108 upstream) : TMEM98 (19910 downstream)																																			---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31570058	31570059	+	Intron	DEL	AT	-	-	rs2346690		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31570058_31570059delAT	uc002hhu.2	-						ACCN1_uc002hht.2_Intron	NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31715114	31715115	+	Intron	INS	-	CAAAA	CAAAA	rs147651143	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31715114_31715115insCAAAA	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
ACCN1	40	broad.mit.edu	37	17	32253952	32253952	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32253952delT	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
ACCN1	40	broad.mit.edu	37	17	32486415	32486416	+	5'Flank	INS	-	C	C	rs139581882	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32486415_32486416insC	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	32664937	32664937	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32664937delT								CCL8 (16518 upstream) : CCL13 (18534 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	33110525	33110526	+	IGR	INS	-	A	A	rs112960476		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33110525_33110526insA								TMEM132E (144189 upstream) : CCT6B (144414 downstream)																																			---	---	---	---
RASL10B	91608	broad.mit.edu	37	17	34069118	34069118	+	3'UTR	DEL	T	-	-	rs11306545		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34069118delT	uc002hju.2	+	4						NM_033315	NP_201572			RAS-like, family 10, member B precursor						small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			lung(2)|breast(2)	4				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)														---	---	---	---
TAF15	8148	broad.mit.edu	37	17	34141474	34141475	+	Intron	DEL	TT	-	-	rs75100616		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34141474_34141475delTT	uc002hkd.2	+						TAF15_uc010ctw.1_Intron|TAF15_uc002hkc.2_Intron	NM_139215	NP_631961			TBP-associated factor 15 isoform 1						positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		TAF15/NR4A3(33)	bone(33)|lung(1)|skin(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)				T	TEC|CHN1|ZNF384	extraskeletal myxoid chondrosarcomas|ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	17	35052823	35052825	+	IGR	DEL	GCA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35052823_35052825delGCA								MRM1 (87417 upstream) : LHX1 (241674 downstream)																																			---	---	---	---
TADA2A	6871	broad.mit.edu	37	17	35829006	35829007	+	Intron	INS	-	TT	TT			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35829006_35829007insTT	uc002hnt.2	+						TADA2A_uc002hnv.2_Intron|TADA2A_uc002hnw.2_Intron|TADA2A_uc010cvb.2_Intron	NM_001488	NP_001479			transcriptional adaptor 2A isoform a						histone H3 acetylation|transcription from RNA polymerase II promoter	chromosome|PCAF complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|zinc ion binding			breast(3)|skin(1)	4																		---	---	---	---
SYNRG	11276	broad.mit.edu	37	17	35939985	35939985	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35939985delT	uc002hoa.2	-						SYNRG_uc010wde.1_Intron|SYNRG_uc010wdf.1_Intron|SYNRG_uc002hoc.2_Intron|SYNRG_uc002hoe.2_Intron|SYNRG_uc002hod.2_Intron|SYNRG_uc010wdg.1_Intron|SYNRG_uc002hob.2_Intron|SYNRG_uc010cvd.1_5'Flank|SYNRG_uc002hog.1_Intron|SYNRG_uc010wdh.1_Intron	NM_007247	NP_009178			synergin, gamma isoform 1						endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	38684407	38684407	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38684407delT								TNS4 (26553 upstream) : CCR7 (25616 downstream)																																			---	---	---	---
RPL27	6155	broad.mit.edu	37	17	41154523	41154524	+	Intron	INS	-	A	A	rs75432195		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41154523_41154524insA	uc002icj.2	+						RPL27_uc002ick.2_Intron	NM_000988	NP_000979			ribosomal protein L27						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	structural constituent of ribosome				0		Breast(137;0.000717)|Ovarian(249;0.0776)		BRCA - Breast invasive adenocarcinoma(366;0.157)														---	---	---	---
BRCA1	672	broad.mit.edu	37	17	41260063	41260063	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41260063delA	uc002icq.2	-						BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Intron|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Intron|BRCA1_uc002ict.2_Intron|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Intron|BRCA1_uc010cyy.1_Intron|BRCA1_uc010whs.1_Intron|BRCA1_uc010cyz.2_Intron|BRCA1_uc010cza.2_Intron|BRCA1_uc010wht.1_Intron	NM_007294	NP_009225			breast cancer 1, early onset isoform 1						androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)				D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	41435886	41435886	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41435886delG								TMEM106A (64297 upstream) : LOC100130581 (11327 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	41824475	41824475	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41824475delA								MEOX1 (85213 upstream) : SOST (6624 downstream)																																			---	---	---	---
FAM171A2	284069	broad.mit.edu	37	17	42438712	42438712	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42438712delG	uc002igs.2	-							NM_198475	NP_940877			family with sequence similarity 171, member A2							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	45530614	45530615	+	Intron	INS	-	A	A	rs3065209		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45530614_45530615insA	uc002ilp.1	-											Homo sapiens cDNA clone IMAGE:5266250, containing frame-shift errors.																														---	---	---	---
SKAP1	8631	broad.mit.edu	37	17	46282376	46282377	+	Intron	DEL	TT	-	-	rs35138934		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46282376_46282377delTT	uc002ini.1	-						SKAP1_uc002inj.1_Intron|SKAP1_uc010dbd.1_Intron|SKAP1_uc010dbe.1_Intron	NM_003726	NP_003717			src kinase associated phosphoprotein 1 isoform						positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	46768187	46768188	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46768187_46768188insT								MIR196A1 (58266 upstream) : PRAC (30904 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	47056747	47056747	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47056747delA								GIP (10792 upstream) : IGF2BP1 (18027 downstream)																																			---	---	---	---
TAC4	255061	broad.mit.edu	37	17	47925054	47925055	+	Intron	INS	-	AC	AC	rs150685532	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47925054_47925055insAC	uc002ipo.1	-						TAC4_uc002ipp.1_Intron|TAC4_uc002ipq.1_Intron|TAC4_uc002ipr.1_Intron|TAC4_uc002ips.1_Intron|TAC4_uc002ipt.2_Intron|TAC4_uc002ipu.2_Intron	NM_170685	NP_733786			tachykinin 4 isoform alpha						regulation of blood pressure	extracellular region				breast(1)	1																		---	---	---	---
MYCBPAP	84073	broad.mit.edu	37	17	48589415	48589415	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48589415delT	uc010wmr.1	+						MYCBPAP_uc002iqx.2_Intron|MYCBPAP_uc002iqz.2_Intron	NM_032133	NP_115509			Myc-binding protein-associated protein						cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	55269250	55269250	+	IGR	DEL	A	-	-	rs71365805		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55269250delA								AKAP1 (70541 upstream) : MSI2 (63962 downstream)																																			---	---	---	---
CUEDC1	404093	broad.mit.edu	37	17	56014187	56014188	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56014187_56014188insT	uc002ive.1	-							NM_017949	NP_060419			CUE domain-containing 1											skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	56223809	56223809	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56223809delG								DYNLL2 (56191 upstream) : OR4D1 (8706 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	56363425	56363426	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56363425_56363426insA								MPO (5129 upstream) : BZRAP1 (15170 downstream)																																			---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	59362592	59362593	+	Intron	INS	-	TG	TG			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59362592_59362593insTG	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron|BCAS3_uc002izb.3_Intron|BCAS3_uc002izc.3_Intron	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)															---	---	---	---
TBC1D3P2	440452	broad.mit.edu	37	17	60355073	60355074	+	5'Flank	INS	-	T	T	rs71867731		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60355073_60355074insT	uc002izq.2	-						TBC1D3P2_uc010woz.1_5'Flank					SubName: Full=Putative uncharacterized protein TBC1D3E;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	60900794	60900794	+	IGR	DEL	A	-	-	rs113839785		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60900794delA								MARCH10 (15089 upstream) : MIR633 (120782 downstream)																																			---	---	---	---
LRRC37A3	374819	broad.mit.edu	37	17	62917127	62917128	+	5'Flank	INS	-	AGGG	AGGG	rs140057763		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62917127_62917128insAGGG	uc002jey.2	-						LRRC37A3_uc010wqg.1_5'Flank	NM_199340	NP_955372			leucine rich repeat containing 37, member A3							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	62981592	62981593	+	IGR	INS	-	GT	GT	rs67256711		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62981592_62981593insGT								AMZ2P1 (9889 upstream) : GNA13 (23816 downstream)																																			---	---	---	---
CCDC46	201134	broad.mit.edu	37	17	63912832	63912833	+	Intron	DEL	TT	-	-	rs145561440		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63912832_63912833delTT	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473			coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)															---	---	---	---
CCDC46	201134	broad.mit.edu	37	17	63966582	63966583	+	Intron	INS	-	CAT	CAT	rs139925922	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63966582_63966583insCAT	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473			coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)															---	---	---	---
CACNG1	786	broad.mit.edu	37	17	65044440	65044442	+	Intron	DEL	AAC	-	-	rs3043080		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65044440_65044442delAAC	uc002jfu.2	+							NM_000727	NP_000718			voltage-dependent calcium channel gamma-1						muscle contraction	voltage-gated calcium channel complex	voltage-gated calcium channel activity				0	all_cancers(12;1.04e-10)|Breast(2;1.45e-16)|all_epithelial(3;4.81e-12)				Amlodipine(DB00381)|Diltiazem(DB00343)|Ibutilide(DB00308)|Lercanidipine(DB00528)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Nitrendipine(DB01054)|Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	66788560	66788561	+	IGR	INS	-	A	A	rs35116333		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66788560_66788561insA								FAM20A (191465 upstream) : ABCA8 (74872 downstream)																																			---	---	---	---
ABCA8	10351	broad.mit.edu	37	17	66901752	66901752	+	Intron	DEL	A	-	-	rs4148024		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66901752delA	uc002jhp.2	-						ABCA8_uc002jhq.2_Intron|ABCA8_uc010wqq.1_Intron|ABCA8_uc010wqr.1_Intron|ABCA8_uc002jhr.2_Intron	NM_007168	NP_009099			ATP-binding cassette, sub-family A member 8							integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)																	---	---	---	---
ABCA5	23461	broad.mit.edu	37	17	67289305	67289306	+	Intron	INS	-	ACACAC	ACACAC	rs141471808	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67289305_67289306insACACAC	uc002jif.2	-						ABCA5_uc002jie.2_Intron|ABCA5_uc002jig.2_Intron|ABCA5_uc002jih.2_Intron|ABCA5_uc010dfe.2_Intron	NM_018672	NP_061142			ATP-binding cassette, sub-family A , member 5						cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	67329304	67329307	+	IGR	DEL	TGTT	-	-	rs34458793		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67329304_67329307delTGTT								ABCA5 (5981 upstream) : MAP2K6 (81531 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	67761591	67761593	+	IGR	DEL	CTC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67761591_67761593delCTC								MAP2K6 (223129 upstream) : KCNJ16 (309833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	67785381	67785382	+	IGR	DEL	GA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67785381_67785382delGA								MAP2K6 (246919 upstream) : KCNJ16 (286044 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68158522	68158522	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68158522delA								KCNJ16 (26778 upstream) : KCNJ2 (6292 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68300086	68300086	+	IGR	DEL	T	-	-	rs34453257		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68300086delT								KCNJ2 (123905 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68938009	68938009	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68938009delT								KCNJ2 (761828 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70185057	70185059	+	IGR	DEL	TGA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70185057_70185059delTGA								SOX9 (62505 upstream) : SLC39A11 (457027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70299059	70299059	+	IGR	DEL	T	-	-	rs67593895		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70299059delT								SOX9 (176507 upstream) : SLC39A11 (343027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70560795	70560796	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70560795_70560796insT	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																														---	---	---	---
SLC39A11	201266	broad.mit.edu	37	17	70817487	70817488	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70817487_70817488insA	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron	NM_001159770	NP_001153242			solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1																		---	---	---	---
TTYH2	94015	broad.mit.edu	37	17	72253240	72253240	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72253240delT	uc002jkc.2	+						TTYH2_uc010wqw.1_Intron|TTYH2_uc002jkd.2_Intron	NM_032646	NP_116035			tweety 2 isoform 1							chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4																		---	---	---	---
LLGL2	3993	broad.mit.edu	37	17	73525284	73525284	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73525284delT	uc002joh.2	+						LLGL2_uc002jog.1_Intron|LLGL2_uc010dgf.1_Intron|LLGL2_uc002joi.2_Intron	NM_001031803	NP_001026973			lethal giant larvae homolog 2 isoform c						cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding			ovary(2)	2	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)															---	---	---	---
UNC13D	201294	broad.mit.edu	37	17	73834303	73834303	+	Intron	DEL	T	-	-	rs77246839		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73834303delT	uc002jpp.2	-						UNC13D_uc010wsk.1_Intron|UNC13D_uc002jpq.1_Intron|UNC13D_uc010dgq.1_Intron	NM_199242	NP_954712			unc-13 homolog D						positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding			upper_aerodigestive_tract(1)|skin(1)	2			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)											Familial_Hemophagocytic_Lymphohistiocytosis				---	---	---	---
QRICH2	84074	broad.mit.edu	37	17	74301247	74301247	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74301247delT	uc002jrd.1	-						QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510			glutamine rich 2								protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
HRNBP3	146713	broad.mit.edu	37	17	77166223	77166226	+	Intron	DEL	GGAA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77166223_77166226delGGAA	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044			hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	77667503	77667504	+	IGR	INS	-	GTGTGC	GTGTGC	rs151081253	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77667503_77667504insGTGTGC								HRNBP3 (188823 upstream) : ENPP7 (37378 downstream)																																			---	---	---	---
CCDC40	55036	broad.mit.edu	37	17	78059466	78059468	+	Intron	DEL	TTT	-	-	rs3071279		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78059466_78059468delTTT	uc010dht.2	+						CCDC40_uc002jxm.3_Intron|CCDC40_uc002jxn.3_Intron	NM_017950	NP_060420			coiled-coil domain containing 40						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)															---	---	---	---
RNF213	57674	broad.mit.edu	37	17	78330146	78330147	+	Intron	DEL	CT	-	-	rs146120897		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78330146_78330147delCT	uc002jyh.1	+						uc002jyi.1_Intron|RNF213_uc010dhw.1_Intron	NM_020914	NP_065965			ring finger protein 213											ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)															---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78797442	78797447	+	Intron	DEL	CACACA	-	-	rs3042670		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78797442_78797447delCACACA	uc002jyt.1	+						RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
NPLOC4	55666	broad.mit.edu	37	17	79562978	79562980	+	Intron	DEL	GTT	-	-	rs145761561		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79562978_79562980delGTT	uc002kat.3	-						NPLOC4_uc002kau.3_Intron|NPLOC4_uc010wur.1_Intron	NM_017921	NP_060391			nuclear protein localization 4						cellular membrane fusion|ER-associated protein catabolic process|Golgi organization	cytosol|endoplasmic reticulum|nuclear outer membrane-endoplasmic reticulum membrane network|nucleus	zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	80267306	80267306	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80267306delT								CSNK1D (35733 upstream) : CD7 (5440 downstream)																																			---	---	---	---
RAB40B	10966	broad.mit.edu	37	17	80629394	80629394	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80629394delT	uc002kft.2	-						RAB40B_uc002kfs.2_Intron	NM_006822	NP_006813			RAB40B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			central_nervous_system(1)	1	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	13080	13082	+	IGR	DEL	CCT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13080_13082delCCT								None (None upstream) : USP14 (145401 downstream)																																			---	---	---	---
COLEC12	81035	broad.mit.edu	37	18	355084	355085	+	Intron	INS	-	ATCA	ATCA			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:355084_355085insATCA	uc002kkm.2	-							NM_130386	NP_569057			collectin sub-family member 12						carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)																---	---	---	---
CLUL1	27098	broad.mit.edu	37	18	625519	625528	+	Intron	DEL	ACACACACAC	-	-	rs71654198		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:625519_625528delACACACACAC	uc002kkp.2	+						CLUL1_uc010wys.1_Intron|CLUL1_uc002kkq.2_Intron	NM_014410	NP_055225			clusterin-like 1 (retinal) precursor						cell death	extracellular region				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	3232330	3232331	+	IGR	DEL	AA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3232330_3232331delAA								MYOM1 (12224 upstream) : MYL12A (15197 downstream)																																			---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	3679850	3679852	+	Intron	DEL	TTC	-	-	rs140355789		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3679850_3679852delTTC	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron	NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	4300653	4300653	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4300653delT	uc010wyz.1	-							NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	4718763	4718763	+	IGR	DEL	T	-	-	rs34704027		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4718763delT								DLGAP1 (263497 upstream) : LOC642597 (424909 downstream)																																			---	---	---	---
LOC339290	339290	broad.mit.edu	37	18	5245411	5245412	+	RNA	INS	-	AGAG	AGAG	rs142268956	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5245411_5245412insAGAG	uc002kmo.2	+	3		c.2883_2884insAGAG			LOC339290_uc010dko.2_RNA|LOC339290_uc002kmp.2_RNA	NR_015389				Homo sapiens cDNA FLJ32367 fis, clone PUAEN1000239.												0																		---	---	---	---
LAMA1	284217	broad.mit.edu	37	18	7052430	7052430	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7052430delA	uc002knm.2	-						LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550			laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	8372720	8372720	+	Intron	DEL	A	-	-	rs35938570		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8372720delA	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836			protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
KIAA0802	23255	broad.mit.edu	37	18	8785010	8785011	+	Intron	INS	-	T	T	rs142102394	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8785010_8785011insT	uc002knr.2	+						KIAA0802_uc002knq.2_Intron|KIAA0802_uc010dkw.1_Intron	NM_015210	NP_056025			hypothetical protein LOC23255												0																		---	---	---	---
FAM38B	63895	broad.mit.edu	37	18	10797197	10797201	+	5'Flank	DEL	ATCAT	-	-	rs145542001		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10797197_10797201delATCAT	uc002kov.1	-											Homo sapiens cDNA FLJ34907 fis, clone NT2RI2003392.							integral to membrane	ion channel activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	11341460	11341460	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11341460delA								FAM38B (639481 upstream) : GNAL (347676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	12130673	12130673	+	IGR	DEL	T	-	-	rs111720198		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12130673delT								IMPA2 (99797 upstream) : CIDEA (123645 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	13974393	13974394	+	IGR	DEL	AG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13974393_13974394delAG								MC2R (58858 upstream) : ZNF519 (101595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15404526	15404526	+	IGR	DEL	A	-	-	rs138925969		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15404526delA								LOC644669 (78608 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	21080367	21080368	+	IGR	INS	-	G	G	rs145198315	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21080367_21080368insG								RIOK3 (17270 upstream) : C18orf8 (3094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	21546671	21546671	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21546671delA								LAMA3 (11644 upstream) : TTC39C (26066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	23451948	23451950	+	IGR	DEL	TTG	-	-	rs5823493		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23451948_23451950delTTG								ZNF521 (519734 upstream) : SS18 (144269 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	23580766	23580767	+	IGR	DEL	TG	-	-	rs57673113		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23580766_23580767delTG								ZNF521 (648552 upstream) : SS18 (15452 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	27135636	27135637	+	IGR	INS	-	A	A	rs147456684	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27135636_27135637insA								None (None upstream) : MIR302F (743239 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	27766826	27766827	+	IGR	INS	-	A	A	rs147307506	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27766826_27766827insA								None (None upstream) : MIR302F (112049 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	27971400	27971401	+	IGR	INS	-	C	C	rs150997934	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27971400_27971401insC								MIR302F (92474 upstream) : DSC3 (598652 downstream)																																			---	---	---	---
FAM59A	64762	broad.mit.edu	37	18	30044733	30044734	+	Intron	INS	-	TC	TC	rs143229356	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30044733_30044734insTC	uc002kxl.2	-						FAM59A_uc002kxk.1_Intron	NM_022751	NP_073588			family with sequence similarity 59, member A											ovary(1)|skin(1)	2																		---	---	---	---
DTNA	1837	broad.mit.edu	37	18	32122634	32122635	+	Intron	INS	-	A	A	rs112077559		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32122634_32122635insA	uc002kxw.2	+						DTNA_uc002kxu.2_Intron|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Intron	NM_032975	NP_116757			dystrobrevin alpha isoform 2						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0																		---	---	---	---
DTNA	1837	broad.mit.edu	37	18	32302571	32302572	+	Intron	DEL	AC	-	-	rs67088527		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32302571_32302572delAC	uc010dmj.2	+						DTNA_uc002kxu.2_Intron|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Intron|DTNA_uc002kxw.2_Intron|DTNA_uc002kxx.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010dmk.1_Intron|DTNA_uc010dml.2_Intron|DTNA_uc002kyb.3_Intron	NM_032975	NP_116757			dystrobrevin alpha isoform 2						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0																		---	---	---	---
DTNA	1837	broad.mit.edu	37	18	32307530	32307531	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32307530_32307531insT	uc010dmj.2	+						DTNA_uc002kxu.2_Intron|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Intron|DTNA_uc002kxw.2_Intron|DTNA_uc002kxx.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010dmk.1_Intron|DTNA_uc010dml.2_Intron|DTNA_uc002kyb.3_Intron	NM_032975	NP_116757			dystrobrevin alpha isoform 2						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0																		---	---	---	---
MAPRE2	10982	broad.mit.edu	37	18	32655718	32655719	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32655718_32655719insA	uc002kyg.2	+						MAPRE2_uc010xcb.1_Intron|MAPRE2_uc010xcc.1_Intron|MAPRE2_uc002kyf.2_Intron|MAPRE2_uc002kyh.2_Intron|MAPRE2_uc010xcd.1_Intron	NM_014268	NP_055083			microtubule-associated protein, RP/EB family,						cell division|cell proliferation|mitosis|signal transduction	cytoplasm|microtubule	microtubule binding			ovary(1)	1																		---	---	---	---
GALNT1	2589	broad.mit.edu	37	18	33182518	33182519	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33182518_33182519insT	uc010dmu.2	+						GALNT1_uc002kyz.3_Intron	NM_020474	NP_065207			polypeptide N-acetylgalactosaminyltransferase 1						protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	33376565	33376565	+	IGR	DEL	T	-	-	rs59217460		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33376565delT								GALNT1 (84768 upstream) : MIR187 (108216 downstream)																																			---	---	---	---
CELF4	56853	broad.mit.edu	37	18	34828914	34828915	+	Intron	INS	-	AGGG	AGGG	rs142255643	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34828914_34828915insAGGG	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron	NM_020180	NP_064565			bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	35914261	35914261	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35914261delC								CELF4 (768261 upstream) : LOC647946 (872627 downstream)																																			---	---	---	---
SLC14A1	6563	broad.mit.edu	37	18	43323370	43323370	+	Intron	DEL	T	-	-	rs11363137		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43323370delT	uc010xcn.1	+						SLC14A1_uc010dnk.2_Intron|SLC14A1_uc002lbf.3_Intron|SLC14A1_uc002lbg.3_Intron|SLC14A1_uc010xco.1_Intron|SLC14A1_uc002lbh.3_Intron|SLC14A1_uc002lbi.3_Intron|SLC14A1_uc002lbj.3_Intron|SLC14A1_uc002lbk.3_Intron	NM_001146036	NP_001139508			solute carrier family 14 (urea transporter),							integral to plasma membrane	urea transmembrane transporter activity			central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
SMAD2	4087	broad.mit.edu	37	18	45422401	45422401	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45422401delT	uc002lcy.2	-						SMAD2_uc002lcz.2_Intron|SMAD2_uc010xdc.1_Intron|SMAD2_uc010xdd.1_Intron	NM_005901	NP_005892			Sma- and Mad-related protein 2 isoform 1						anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding			large_intestine(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	47041948	47041948	+	IGR	DEL	G	-	-	rs34780696		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47041948delG								RPL17 (23042 upstream) : LIPG (46479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	48065292	48065292	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48065292delC								SKA1 (144758 upstream) : MAPK4 (21192 downstream)																																			---	---	---	---
MAPK4	5596	broad.mit.edu	37	18	48243179	48243180	+	Intron	INS	-	A	A	rs143259134	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48243179_48243180insA	uc002lev.2	+						MAPK4_uc010xdm.1_Intron|MAPK4_uc010doz.2_Intron	NM_002747	NP_002738			mitogen-activated protein kinase 4						cell cycle		ATP binding|MAP kinase activity			lung(4)|skin(2)	6		Colorectal(6;0.0297)		Colorectal(21;0.156)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	48315968	48315969	+	IGR	DEL	CA	-	-	rs35330215		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48315968_48315969delCA								MAPK4 (57773 upstream) : MRO (5522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	49214104	49214104	+	IGR	DEL	A	-	-	rs138965300		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49214104delA								MEX3C (490414 upstream) : DCC (652467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	49779026	49779027	+	IGR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49779026_49779027delGT								None (None upstream) : DCC (87544 downstream)																																			---	---	---	---
DCC	1630	broad.mit.edu	37	18	50410760	50410760	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50410760delT	uc002lfe.1	+						DCC_uc010xdr.1_Intron	NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	51373869	51373869	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51373869delA								DCC (316087 upstream) : MBD2 (306706 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	51568579	51568579	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51568579delG								DCC (510797 upstream) : MBD2 (111996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	53324047	53324047	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53324047delT								TCF4 (20862 upstream) : TXNL1 (946008 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	53994786	53994787	+	IGR	DEL	GT	-	-	rs112736322		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53994786_53994787delGT								TCF4 (691601 upstream) : TXNL1 (275268 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	55096366	55096366	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55096366delC								ST8SIA3 (60207 upstream) : ONECUT2 (6551 downstream)																																			---	---	---	---
NEDD4L	23327	broad.mit.edu	37	18	55907407	55907408	+	Intron	INS	-	T	T	rs144906242	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55907407_55907408insT	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lhc.2_Intron|NEDD4L_uc002lhd.2_Intron|NEDD4L_uc002lhb.2_Intron|NEDD4L_uc002lhe.2_Intron|NEDD4L_uc002lhf.2_Intron|NEDD4L_uc010dpl.1_Intron|NEDD4L_uc002lhg.2_Intron	NM_001144967	NP_001138439			neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	58389306	58389307	+	IGR	DEL	TG	-	-	rs141035912		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58389306_58389307delTG								MC4R (349305 upstream) : CDH20 (611681 downstream)																																			---	---	---	---
CDH20	28316	broad.mit.edu	37	18	59150779	59150781	+	Intron	DEL	TGC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59150779_59150781delTGC	uc002lif.2	+							NM_031891	NP_114097			cadherin 20, type 2 preproprotein						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	59977995	59977997	+	IGR	DEL	ACC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59977995_59977997delACC								KIAA1468 (3641 upstream) : TNFRSF11A (14551 downstream)																																			---	---	---	---
SERPINB5	5268	broad.mit.edu	37	18	61161095	61161098	+	Intron	DEL	AAAC	-	-	rs79098750		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61161095_61161098delAAAC	uc002liz.3	+							NM_002639	NP_002630			serine (or cysteine) proteinase inhibitor, clade						cellular component movement|regulation of proteolysis	cytoplasm|extracellular space	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	62256895	62256896	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62256895_62256896delTG								C18orf20 (440635 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	63755738	63755739	+	IGR	INS	-	TA	TA			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63755738_63755739insTA								CDH7 (207564 upstream) : CDH19 (415582 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	63916682	63916682	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63916682delG								CDH7 (368508 upstream) : CDH19 (254639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	64026169	64026169	+	IGR	DEL	C	-	-	rs78573488		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64026169delC								CDH7 (477995 upstream) : CDH19 (145152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	64766001	64766002	+	IGR	INS	-	T	T	rs140022467	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64766001_64766002insT								CDH19 (494785 upstream) : DSEL (407817 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	68773500	68773501	+	IGR	INS	-	A	A	rs4891897	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68773500_68773501insA								SOCS6 (776066 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	70885102	70885102	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70885102delC	uc002lla.1	-						uc002llb.2_Intron					Homo sapiens cDNA clone IMAGE:3842655.																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	74449549	74449549	+	IGR	DEL	T	-	-	rs11284897		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74449549delT								LOC284276 (177766 upstream) : ZNF236 (86567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	74496289	74496290	+	IGR	DEL	GT	-	-	rs143560228		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74496289_74496290delGT								LOC284276 (224506 upstream) : ZNF236 (39826 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	76311364	76311366	+	IGR	DEL	TGT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76311364_76311366delTGT								None (None upstream) : SALL3 (428909 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	76569930	76569941	+	IGR	DEL	TGCACACATACG	-	-	rs80001572		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76569930_76569941delTGCACACATACG								None (None upstream) : SALL3 (170334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	3332754	3332764	+	IGR	DEL	CCCTCCGTCCC	-	-	rs145775505		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3332754_3332764delCCCTCCGTCCC								CELF5 (35683 upstream) : NFIC (26852 downstream)																																			---	---	---	---
ZFR2	23217	broad.mit.edu	37	19	3853497	3853497	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3853497delA	uc002lyw.2	-						ZFR2_uc010xhx.1_Intron|ZFR2_uc002lyx.3_Intron|ZFR2_uc010xhy.1_Intron	NM_015174	NP_055989			zinc finger RNA binding protein 2 isoform 1							intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)														---	---	---	---
ACSBG2	81616	broad.mit.edu	37	19	6143847	6143849	+	Intron	DEL	TTG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6143847_6143849delTTG	uc002mef.1	+						ACSBG2_uc002mee.1_Intron|ACSBG2_uc002meg.1_Intron|ACSBG2_uc002meh.1_Intron|ACSBG2_uc002mei.1_Intron|ACSBG2_uc010xiz.1_Intron	NM_030924	NP_112186			bubblegum-related acyl-CoA synthetase 2						cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1																		---	---	---	---
VAV1	7409	broad.mit.edu	37	19	6790190	6790194	+	Intron	DEL	AAAAT	-	-	rs113831501		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6790190_6790194delAAAAT	uc002mfu.1	+						VAV1_uc010xjh.1_Intron|VAV1_uc010dva.1_Intron|VAV1_uc002mfv.1_Intron	NM_005428	NP_005419			vav 1 guanine nucleotide exchange factor						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	7092167	7092168	+	IGR	INS	-	GTG	GTG	rs138504672	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7092167_7092168insGTG								ZNF557 (4191 upstream) : INSR (20098 downstream)																																			---	---	---	---
INSR	3643	broad.mit.edu	37	19	7151194	7151195	+	Intron	INS	-	C	C	rs149167794		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7151194_7151195insC	uc002mgd.1	-						INSR_uc002mge.1_Intron	NM_000208	NP_000199			insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
C19orf45	374877	broad.mit.edu	37	19	7569592	7569593	+	Intron	DEL	AA	-	-	rs112442039		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7569592_7569593delAA	uc002mgm.2	+						C19orf45_uc010xjo.1_5'Flank	NM_198534	NP_940936			hypothetical protein LOC374877												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	8011706	8011706	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8011706delA								TIMM44 (3168 upstream) : ELAVL1 (11752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	8770106	8770107	+	IGR	INS	-	TCCT	TCCT	rs148951480	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8770106_8770107insTCCT								ADAMTS10 (94518 upstream) : ACTL9 (37644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	8788093	8788100	+	IGR	DEL	TCCATCCA	-	-	rs149810235	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8788093_8788100delTCCATCCA								ADAMTS10 (112505 upstream) : ACTL9 (19651 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	9108988	9108989	+	IGR	INS	-	AG	AG			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9108988_9108989insAG								MUC16 (16970 upstream) : OR1M1 (94932 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	9127578	9127578	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9127578delT								MUC16 (35560 upstream) : OR1M1 (76343 downstream)																																			---	---	---	---
ZNF846	162993	broad.mit.edu	37	19	9877377	9877377	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9877377delC	uc002mmb.1	-						ZNF846_uc010xky.1_Intron|ZNF846_uc010xkz.1_Intron|ZNF846_uc010dww.2_Intron|ZNF846_uc002mmc.1_Intron	NM_001077624	NP_001071092			zinc finger protein 846						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	10055883	10055895	+	IGR	DEL	GGGAGGGAGGGAG	-	-	rs111802762		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10055883_10055895delGGGAGGGAGGGAG								OLFM2 (8813 upstream) : COL5A3 (14342 downstream)																																			---	---	---	---
DNMT1	1786	broad.mit.edu	37	19	10307093	10307093	+	5'Flank	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10307093delT	uc002mng.2	-						DNMT1_uc010xlc.1_5'Flank|DNMT1_uc002mnh.2_5'Flank|DNMT1_uc010xld.1_5'Flank	NM_001379	NP_001370			DNA (cytosine-5-)-methyltransferase 1 isoform b						chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)													---	---	---	---
LDLR	3949	broad.mit.edu	37	19	11233654	11233654	+	Intron	DEL	T	-	-	rs35951147		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11233654delT	uc002mqk.3	+						LDLR_uc010xlk.1_Intron|LDLR_uc010xll.1_Intron|LDLR_uc010xlm.1_Intron|LDLR_uc010xln.1_Intron|LDLR_uc010xlo.1_Intron	NM_000527	NP_000518			low density lipoprotein receptor precursor						cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)													---	---	---	---
ZNF44	51710	broad.mit.edu	37	19	12389544	12389544	+	Intron	DEL	A	-	-	rs150865732		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12389544delA	uc010xmj.1	-						ZNF44_uc002mtl.2_Intron|ZNF44_uc010dyr.1_Intron|ZNF44_uc010xmi.1_Intron|ZNF44_uc002mtn.3_Intron|ZNF44_uc010dys.2_Intron	NM_001164276	NP_001157748			zinc finger protein 44 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)														---	---	---	---
ZNF799	90576	broad.mit.edu	37	19	12507622	12507622	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12507622delA	uc010dyt.2	-						ZNF799_uc002mts.3_Intron	NM_001080821	NP_001074290			zinc finger protein 799						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|ovary(2)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	13709239	13709246	+	IGR	DEL	AAAAAAGA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13709239_13709246delAAAAAAGA								CACNA1A (91965 upstream) : CCDC130 (133328 downstream)																																	OREG0025297	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	19	13821617	13821617	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13821617delT								CACNA1A (204343 upstream) : CCDC130 (20957 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	14620646	14620646	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14620646delT								GIPC1 (13702 upstream) : DNAJB1 (4936 downstream)																																			---	---	---	---
TECR	9524	broad.mit.edu	37	19	14655389	14655389	+	Intron	DEL	G	-	-	rs35751479		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14655389delG	uc002mza.2	+						TECR_uc002mzb.2_Intron|TECR_uc010xns.1_Intron|TECR_uc002mzc.2_Intron|TECR_uc002mzd.2_Intron	NM_138501	NP_612510			glycoprotein, synaptic 2						fatty acid elongation|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	trans-2-enoyl-CoA reductase (NADPH) activity|very long-chain-acyl-CoA dehydrogenase activity				0																		---	---	---	---
WIZ	58525	broad.mit.edu	37	19	15545396	15545397	+	Intron	INS	-	A	A	rs34814226		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15545396_15545397insA	uc002nbb.3	-						WIZ_uc002nba.3_5'Flank	NM_021241	NP_067064			widely-interspaced zinc finger motifs							nucleus	zinc ion binding				0																		---	---	---	---
CYP4F2	8529	broad.mit.edu	37	19	15991138	15991138	+	Intron	DEL	A	-	-	rs76756803		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15991138delA	uc002nbs.1	-						CYP4F2_uc010xot.1_Intron	NM_001082	NP_001073			cytochrome P450, family 4, subfamily F,						leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	16373033	16373033	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16373033delA								AP1M1 (26877 upstream) : KLF2 (62618 downstream)																																			---	---	---	---
MED26	9441	broad.mit.edu	37	19	16654446	16654446	+	Intron	DEL	T	-	-	rs78991709		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16654446delT	uc002nee.2	-						CHERP_uc002nei.1_5'Flank|CHERP_uc002nej.2_5'Flank	NM_004831				mediator complex subunit 26						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|RNA polymerase II transcription cofactor activity|transcription coactivator activity			ovary(2)	2																		---	---	---	---
USHBP1	83878	broad.mit.edu	37	19	17374674	17374674	+	Intron	DEL	A	-	-	rs77430153		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17374674delA	uc002nfs.1	-						USHBP1_uc002nft.1_Intron|USHBP1_uc010xpk.1_Intron|USHBP1_uc010eam.1_5'UTR	NM_031941	NP_114147			Usher syndrome 1C binding protein 1								PDZ domain binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	19065552	19065555	+	IGR	DEL	CCAT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19065552_19065555delCCAT								HOMER3 (13511 upstream) : SFRS14 (36142 downstream)																																			---	---	---	---
SFRS14	10147	broad.mit.edu	37	19	19121949	19121949	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19121949delA	uc002nkx.2	-						SFRS14_uc002nkz.1_Intron|SFRS14_uc002nla.1_Intron|SFRS14_uc002nlb.2_Intron|SFRS14_uc010xqk.1_Intron	NM_014884	NP_055699			splicing factor, arginine/serine-rich 14						mRNA processing|RNA splicing	nucleus	RNA binding				0			OV - Ovarian serous cystadenocarcinoma(5;3.05e-05)|Epithelial(12;0.00161)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	21750328	21750329	+	IGR	INS	-	A	A	rs35412290		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21750328_21750329insA								ZNF429 (11260 upstream) : ZNF100 (156515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	22062272	22062272	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22062272delA								ZNF43 (27442 upstream) : ZNF208 (53488 downstream)																																			---	---	---	---
ZNF98	148198	broad.mit.edu	37	19	22586060	22586061	+	Intron	INS	-	AA	AA			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22586060_22586061insAA	uc002nqt.2	-							NM_001098626	NP_001092096			zinc finger protein 98						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	22777722	22777723	+	5'Flank	INS	-	A	A	rs137950236	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22777722_22777723insA	uc002nqu.3	+											Homo sapiens cDNA FLJ60031 complete cds, moderately similar to Golgin subfamily A member 2.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	23105528	23105529	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23105528_23105529insT								ZNF99 (152744 upstream) : ZNF91 (415890 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27837617	27837617	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27837617delT								None (None upstream) : LOC148189 (443785 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27863934	27863934	+	IGR	DEL	T	-	-	rs113354153		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27863934delT								None (None upstream) : LOC148189 (417468 downstream)																																			---	---	---	---
ZNF536	9745	broad.mit.edu	37	19	30950261	30950262	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30950261_30950262insT	uc002nsu.1	+						ZNF536_uc010edd.1_Intron	NM_014717	NP_055532			zinc finger protein 536						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	31273643	31273643	+	IGR	DEL	T	-	-	rs76430949		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31273643delT								ZNF536 (224678 upstream) : DKFZp566F0947 (367140 downstream)																																			---	---	---	---
TSHZ3	57616	broad.mit.edu	37	19	31793798	31793799	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31793798_31793799insT	uc002nsy.3	-							NM_020856	NP_065907			zinc finger protein 537						negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	32037571	32037571	+	IGR	DEL	T	-	-	rs68110747		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32037571delT								TSHZ3 (197381 upstream) : ZNF507 (798943 downstream)																																			---	---	---	---
ANKRD27	84079	broad.mit.edu	37	19	33156196	33156196	+	Intron	DEL	T	-	-	rs138813390		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33156196delT	uc002ntn.1	-						ANKRD27_uc002nto.1_Intron	NM_032139	NP_115515			ankyrin repeat domain 27 (VPS9 domain)						early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	34542848	34542848	+	IGR	DEL	A	-	-	rs80313460		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34542848delA								KCTD15 (236183 upstream) : LSM14A (120504 downstream)																																			---	---	---	---
ZNF565	147929	broad.mit.edu	37	19	36691394	36691395	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36691394_36691395insT	uc002odn.2	-						ZNF565_uc010ees.2_Intron|ZNF565_uc002odo.2_Intron|ZNF565_uc002odp.1_Intron	NM_152477	NP_689690			zinc finger protein 565						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)															---	---	---	---
FCGBP	8857	broad.mit.edu	37	19	40406396	40406396	+	Intron	DEL	A	-	-	rs36093773		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40406396delA	uc002omp.3	-							NM_003890	NP_003881			Fc fragment of IgG binding protein precursor							extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)															---	---	---	---
ATP1A3	478	broad.mit.edu	37	19	42495978	42495979	+	Intron	INS	-	GGA	GGA			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42495978_42495979insGGA	uc002osg.2	-						ATP1A3_uc010xwf.1_Intron|ATP1A3_uc010xwg.1_Intron|ATP1A3_uc010xwh.1_Intron|ATP1A3_uc002osh.2_Intron	NM_152296	NP_689509			Na+/K+ -ATPase alpha 3 subunit						ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2																		---	---	---	---
POU2F2	5452	broad.mit.edu	37	19	42595247	42595247	+	3'UTR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42595247delT	uc002osp.2	-	14					POU2F2_uc002osn.2_3'UTR|POU2F2_uc002oso.2_3'UTR|POU2F2_uc002osq.2_3'UTR	NM_002698	NP_002689			POU domain, class 2, transcription factor 2						humoral immune response|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2		Prostate(69;0.059)																---	---	---	---
PSG6	5675	broad.mit.edu	37	19	43460948	43460948	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43460948delA	uc002ovh.1	-						PSG11_uc002ouw.2_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron					SubName: Full=Putative uncharacterized protein PSG6;						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)																---	---	---	---
PSG9	5678	broad.mit.edu	37	19	43773916	43773938	+	5'Flank	DEL	ACACACACACACACACAGAAGAG	-	-	rs144147659	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43773916_43773938delACACACACACACACACAGAAGAG	uc002owd.3	-						PSG9_uc002owe.3_5'Flank|PSG9_uc010xwm.1_5'Flank|PSG9_uc002owf.3_5'Flank|PSG9_uc002owg.2_5'Flank|PSG9_uc002owh.2_5'Flank	NM_002784	NP_002775			pregnancy specific beta-1-glycoprotein 9						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	43962086	43962086	+	IGR	DEL	G	-	-	rs34398539		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43962086delG								TEX101 (39320 upstream) : LYPD3 (2860 downstream)																																			---	---	---	---
PHLDB3	653583	broad.mit.edu	37	19	44006626	44006626	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44006626delC	uc002own.3	-						PHLDB3_uc002owo.2_Intron	NM_198850	NP_942147			pleckstrin homology-like domain, family B,												0		Prostate(69;0.0153)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	44262458	44262459	+	IGR	INS	-	C	C	rs147150460	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44262458_44262459insC								C19orf61 (3316 upstream) : KCNN4 (8228 downstream)																																			---	---	---	---
ZNF233	353355	broad.mit.edu	37	19	44775666	44775666	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44775666delT	uc002oyz.1	+						ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF233_uc002oyy.1_Intron	NM_181756	NP_861421			zinc finger protein 233						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2		Prostate(69;0.0435)|all_neural(266;0.226)																---	---	---	---
IGFL2	147920	broad.mit.edu	37	19	46651810	46651810	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46651810delA	uc010xxv.1	+						IGFL2_uc002peb.2_Intron	NM_001135113	NP_001128585			IGF-like family member 2 isoform b							extracellular region	protein binding				0		Ovarian(192;0.0908)|all_neural(266;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	46846766	46846773	+	IGR	DEL	TTCCTTCC	-	-	rs71814107		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46846766_46846773delTTCCTTCC								HIF3A (77 upstream) : PPP5C (3521 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	47075921	47075924	+	Intron	DEL	AGAA	-	-	rs67738072		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47075921_47075924delAGAA	uc002pev.1	-											SubName: Full=cDNA FLJ37185 fis, clone BRALZ2001743, moderately similar to Serine/threonine-protein phosphatase 5;          EC=3.1.3.16;																														---	---	---	---
PRKD2	25865	broad.mit.edu	37	19	47212240	47212241	+	Intron	INS	-	G	G	rs149133512		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47212240_47212241insG	uc002pfh.2	-						PRKD2_uc002pfg.2_Intron|PRKD2_uc002pfi.2_Intron|PRKD2_uc002pfj.2_Intron|PRKD2_uc010xye.1_Intron|PRKD2_uc002pfk.2_Intron	NM_001079881	NP_001073350			protein kinase D2 isoform A						cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	47808181	47808181	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47808181delT								PRR24 (29202 upstream) : C5AR1 (4923 downstream)																																			---	---	---	---
NAPA	8775	broad.mit.edu	37	19	47991875	47991875	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47991875delA	uc002pha.1	-						uc002pgz.1_Intron|NAPA_uc002phb.1_Intron|NAPA_uc002phc.1_Intron|NAPA_uc002phd.1_Intron	NM_003827	NP_003818			N-ethylmaleimide-sensitive factor attachment						cellular membrane fusion|intra-Golgi vesicle-mediated transport|post-Golgi vesicle-mediated transport	cytosol					0		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000466)|all cancers(93;0.000739)|Epithelial(262;0.0168)|GBM - Glioblastoma multiforme(486;0.049)														---	---	---	---
CPT1C	126129	broad.mit.edu	37	19	50206328	50206331	+	Intron	DEL	ACAC	-	-	rs111846507		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50206328_50206331delACAC	uc002ppj.2	+						CPT1C_uc002ppl.3_Intron|CPT1C_uc002ppi.2_Intron|CPT1C_uc002ppk.2_Intron|CPT1C_uc010eng.2_Intron|CPT1C_uc010enh.2_Intron|CPT1C_uc010ybc.1_Intron|CPT1C_uc010eni.1_5'Flank	NM_152359	NP_689572			carnitine palmitoyltransferase 1C isoform 2						fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)														---	---	---	---
KLK5	25818	broad.mit.edu	37	19	51456168	51456168	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51456168delC	uc002pue.2	-						KLK5_uc002puf.2_Intron|KLK5_uc002pug.2_5'UTR	NM_001077491	NP_001070959			kallikrein-related peptidase 5 preproprotein						epidermis development|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)														---	---	---	---
ZNF836	162962	broad.mit.edu	37	19	52667684	52667685	+	Intron	DEL	GA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52667684_52667685delGA	uc010ydi.1	-						ZNF836_uc010ydj.1_Intron	NM_001102657	NP_001096127			zinc finger protein 836						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	54520771	54520771	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54520771delC								CACNG6 (4853 upstream) : VSTM1 (23314 downstream)																																			---	---	---	---
PTPRH	5794	broad.mit.edu	37	19	55711116	55711117	+	Intron	INS	-	GAAA	GAAA	rs143270418	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55711116_55711117insGAAA	uc002qjq.2	-						PTPRH_uc010esv.2_Intron|PTPRH_uc002qjs.2_Intron	NM_002842	NP_002833			protein tyrosine phosphatase, receptor type, H						apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)														---	---	---	---
NLRP9	338321	broad.mit.edu	37	19	56249127	56249129	+	Intron	DEL	GAT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56249127_56249129delGAT	uc002qly.2	-							NM_176820	NP_789790			NLR family, pyrin domain containing 9							cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	57842701	57842701	+	IGR	DEL	T	-	-	rs11306357		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57842701delT								ZNF543 (557 upstream) : ZNF304 (19944 downstream)																																			---	---	---	---
ZNF587	84914	broad.mit.edu	37	19	58282669	58282669	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58282669delA	uc002qqb.2	+						ZNF586_uc002qqd.2_Intron|ZNF586_uc002qqe.2_Intron|ZNF586_uc010euh.2_Intron|ZNF586_uc002qqf.1_Intron	NM_032828	NP_116217			zinc finger protein 587						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	58941959	58941960	+	IGR	DEL	TT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58941959_58941960delTT								ZNF584 (12269 upstream) : ZNF132 (2222 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	180244	180245	+	IGR	INS	-	C	C			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:180244_180245insC								DEFB128 (9980 upstream) : DEFB129 (27680 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	1769272	1769273	+	IGR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1769272_1769273delGT								SIRPG (130847 upstream) : SIRPA (105540 downstream)																																			---	---	---	---
PRNP	5621	broad.mit.edu	37	20	4680935	4680935	+	3'UTR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4680935delA	uc002wku.2	+	2					PRNP_uc002wkv.2_3'UTR|PRNP_uc002wkw.2_3'UTR|PRNP_uc002wkx.2_3'UTR|PRNP_uc002wkt.1_3'UTR|PRNP_uc002wky.2_3'UTR|PRNP_uc010gbe.1_3'UTR	NM_001080122	NP_001073591			prion protein preproprotein						axon guidance|cell cycle arrest|cellular copper ion homeostasis|metabolic process|negative regulation of activated T cell proliferation|negative regulation of calcineurin-NFAT signaling pathway|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-2 production|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell receptor signaling pathway|protein homooligomerization|response to oxidative stress	anchored to membrane|endoplasmic reticulum|extrinsic to membrane|Golgi apparatus|membrane raft|nucleus|plasma membrane	copper ion binding|identical protein binding|microtubule binding			central_nervous_system(1)	1					Tetracycline(DB00759)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	5514441	5514441	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5514441delA								LOC149837 (29199 upstream) : GPCPD1 (10640 downstream)																																			---	---	---	---
GPCPD1	56261	broad.mit.edu	37	20	5549069	5549069	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5549069delT	uc002wme.3	-						GPCPD1_uc002wmd.3_Intron	NM_019593	NP_062539			hypothetical protein LOC56261						glycerol metabolic process|lipid metabolic process		carbohydrate binding|glycerophosphodiester phosphodiesterase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	12862374	12862375	+	IGR	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12862374_12862375insA								BTBD3 (955132 upstream) : SPTLC3 (127252 downstream)																																			---	---	---	---
ESF1	51575	broad.mit.edu	37	20	13720369	13720370	+	Intron	DEL	AA	-	-	rs112560154		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13720369_13720370delAA	uc002woj.2	-							NM_016649	NP_057733			ABT1-associated protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	13828920	13828924	+	IGR	DEL	AGAAG	-	-	rs10608755		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13828920_13828924delAGAAG								C20orf7 (31048 upstream) : SEL1L2 (1128 downstream)																																			---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	14331255	14331255	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14331255delT	uc002wou.2	+						MACROD2_uc002wot.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	14638620	14638620	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14638620delA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002wox.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	16196119	16196122	+	IGR	DEL	AAGA	-	-	rs74175671		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16196119_16196122delAAGA								MACROD2 (162280 upstream) : KIF16B (56627 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	16794483	16794483	+	IGR	DEL	T	-	-	rs138741333		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16794483delT								OTOR (61675 upstream) : PCSK2 (412269 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	17004390	17004391	+	IGR	DEL	CA	-	-	rs5840745		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17004390_17004391delCA								OTOR (271582 upstream) : PCSK2 (202361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	18946052	18946052	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18946052delT								C20orf79 (151019 upstream) : SLC24A3 (247238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	19154997	19154997	+	IGR	DEL	T	-	-	rs28719714	byFrequency;by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19154997delT								C20orf79 (359964 upstream) : SLC24A3 (38293 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	19990001	19990001	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19990001delT								RIN2 (6901 upstream) : NAA20 (7936 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	20773508	20773509	+	IGR	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20773508_20773509delTC								RALGAPA2 (80242 upstream) : PLK1S1 (333115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	21704403	21704403	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21704403delT								PAX1 (7783 upstream) : LOC284788 (676568 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25863491	25863491	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25863491delT								FAM182B (14705 upstream) : LOC100134868 (126944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25889977	25889977	+	IGR	DEL	A	-	-	rs141336957		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25889977delA								FAM182B (41191 upstream) : LOC100134868 (100458 downstream)																																			---	---	---	---
C20orf191	149934	broad.mit.edu	37	20	26088971	26088971	+	Intron	DEL	A	-	-	rs76867961	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26088971delA	uc002wvj.3	-							NR_003678				SubName: Full=Putative uncharacterized protein ENSP00000323172;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	26101643	26101645	+	IGR	DEL	CAA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26101643_26101645delCAA								C20orf191 (6966 upstream) : MIR663 (87177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26142245	26142250	+	IGR	DEL	TTTTCT	-	-	rs75244022		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26142245_26142250delTTTTCT								C20orf191 (47568 upstream) : MIR663 (46572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26315295	26315296	+	IGR	INS	-	A	A	rs140252412		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26315295_26315296insA								MIR663 (126381 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29465993	29465994	+	IGR	INS	-	G	G	rs141861763	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29465993_29465994insG								None (None upstream) : FRG1B (145885 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29600592	29600596	+	IGR	DEL	AAAAG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29600592_29600596delAAAAG								None (None upstream) : FRG1B (11283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29606707	29606707	+	IGR	DEL	C	-	-	rs62196963	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29606707delC								None (None upstream) : FRG1B (5172 downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29612970	29612973	+	Intron	DEL	GAAA	-	-	rs113379318		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29612970_29612973delGAAA	uc002wvm.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_5'Flank	NR_003579				Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29616709	29616710	+	Intron	INS	-	T	T	rs145794920	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29616709_29616710insT	uc010ztk.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron					RecName: Full=Protein FRG1B;												0																		---	---	---	---
REM1	28954	broad.mit.edu	37	20	30062439	30062439	+	5'Flank	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30062439delT	uc002wwa.2	+						DEFB124_uc002wvz.1_5'Flank	NM_014012	NP_054731			RAS-like GTP-binding protein REM						small GTPase mediated signal transduction	membrane	calmodulin binding|GTP binding|GTPase activity			lung(2)|pancreas(2)	4	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)															---	---	---	---
RALY	22913	broad.mit.edu	37	20	32609901	32609901	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32609901delT	uc002xab.2	+						RALY_uc010zui.1_Intron|RALY_uc002xac.2_Intron|RALY_uc002xad.2_Intron|RALY_uc002xae.1_Intron	NM_016732	NP_057951			RNA binding protein (autoantigenic,							catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	32716398	32716398	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32716398delA								EIF2S2 (16313 upstream) : ASIP (131773 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	32931110	32931110	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32931110delT								AHCY (31502 upstream) : ITCH (19952 downstream)																																			---	---	---	---
ITCH	83737	broad.mit.edu	37	20	32994342	32994342	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32994342delT	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671			itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
EPB41L1	2036	broad.mit.edu	37	20	34807070	34807070	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34807070delG	uc002xfb.2	+						EPB41L1_uc002xeu.2_Intron|EPB41L1_uc002xev.2_Intron|EPB41L1_uc002xew.2_Intron|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Intron|EPB41L1_uc002xez.2_Intron|EPB41L1_uc010gfq.2_Intron	NM_012156	NP_036288			erythrocyte membrane protein band 4.1-like 1						cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity			ovary(2)|pancreas(1)	3	Breast(12;0.0239)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	36118152	36118156	+	IGR	DEL	TTTTA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36118152_36118156delTTTTA								SRC (84333 upstream) : BLCAP (27664 downstream)																																			---	---	---	---
KIAA0406	9675	broad.mit.edu	37	20	36645807	36645808	+	Intron	DEL	TG	-	-	rs112205846		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36645807_36645808delTG	uc002xhl.2	-						KIAA0406_uc002xhm.2_Intron	NM_014657	NP_055472			hypothetical protein LOC9675								binding				0		Myeloproliferative disorder(115;0.00874)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	38937293	38937294	+	IGR	DEL	GT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38937293_38937294delGT								None (None upstream) : MAFB (377225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	39618467	39618467	+	Intron	DEL	A	-	-	rs71332478		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39618467delA	uc002xjj.2	+						uc002xjk.2_Intron					Homo sapiens cDNA FLJ10978 fis, clone PLACE1001484.																														---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41182655	41182655	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41182655delA	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41570631	41570632	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41570631_41570632insA	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
IFT52	51098	broad.mit.edu	37	20	42254905	42254905	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42254905delT	uc002xkw.2	+						IFT52_uc002xky.2_Intron|IFT52_uc002xkx.2_Intron|IFT52_uc010ggn.2_Intron|IFT52_uc002xkz.2_Intron	NM_016004	NP_057088			intraflagellar transport 52 homolog							intraflagellar transport particle B|microtubule-based flagellum	protein C-terminus binding			ovary(2)	2		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	43888175	43888175	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43888175delG								SLPI (4969 upstream) : MATN4 (33912 downstream)																																			---	---	---	---
ELMO2	63916	broad.mit.edu	37	20	45053236	45053237	+	Intron	INS	-	TG	TG	rs147908598	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45053236_45053237insTG	uc010zxs.1	-						uc002xry.2_Intron					SubName: Full=ELMO2 protein; SubName: Full=Engulfment and cell motility 2;						apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
ZNF334	55713	broad.mit.edu	37	20	45139744	45139744	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45139744delT	uc002xsc.2	-						ZNF334_uc002xsd.2_Intron|ZNF334_uc010ghl.2_Intron	NM_018102	NP_060572			zinc finger protein 334 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45599719	45599720	+	Intron	INS	-	AC	AC	rs148380754	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45599719_45599720insAC	uc002xsm.2	+						EYA2_uc010ghp.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	47056521	47056521	+	IGR	DEL	T	-	-	rs11474935		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47056521delT								LOC284749 (57140 upstream) : PREX1 (184272 downstream)																																			---	---	---	---
SLC9A8	23315	broad.mit.edu	37	20	48447940	48447941	+	Intron	DEL	CT	-	-	rs11469884	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48447940_48447941delCT	uc002xuv.1	+						SLC9A8_uc010zym.1_Intron|SLC9A8_uc010zyj.1_Intron|SLC9A8_uc010zyk.1_Intron|SLC9A8_uc010zyl.1_Intron|SLC9A8_uc010gib.1_Intron	NM_015266	NP_056081			sodium/hydrogen exchanger 8							Golgi membrane|integral to membrane	sodium:hydrogen antiporter activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)															---	---	---	---
RNF114	55905	broad.mit.edu	37	20	48569241	48569241	+	3'UTR	DEL	G	-	-	rs11475779		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48569241delG	uc002xux.2	+	6					RNF114_uc010zyo.1_3'UTR|RNF114_uc002xuy.2_RNA	NM_018683	NP_061153			zinc finger protein 313						cell differentiation|multicellular organismal development|spermatogenesis	intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
TMEM189-UBE2V1	387522	broad.mit.edu	37	20	48771931	48771931	+	5'Flank	DEL	A	-	-	rs112945410		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48771931delA	uc002xvf.2	-						TMEM189_uc010zyq.1_5'Flank|TMEM189_uc002xvg.2_5'Flank|TMEM189_uc010gif.2_5'Flank	NM_199203	NP_954673			TMEM189-UBE2V1 readthrough transcript						cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein K63-linked ubiquitination|regulation of DNA repair|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus|UBC13-UEV1A complex|ubiquitin ligase complex	acid-amino acid ligase activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	49383238	49383239	+	IGR	INS	-	TT	TT	rs146157408	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49383238_49383239insTT								PARD6B (12961 upstream) : BCAS4 (28228 downstream)																																			---	---	---	---
NFATC2	4773	broad.mit.edu	37	20	50052861	50052862	+	Intron	DEL	AG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50052861_50052862delAG	uc002xwd.2	-						NFATC2_uc002xwc.2_Intron|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Intron|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Intron	NM_173091	NP_775114			nuclear factor of activated T-cells,						B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	50982842	50982843	+	IGR	INS	-	GT	GT			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50982842_50982843insGT								ZFP64 (174318 upstream) : TSHZ2 (606034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	51234739	51234739	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51234739delT								ZFP64 (426215 upstream) : TSHZ2 (354138 downstream)																																			---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51773821	51773822	+	Intron	INS	-	A	A	rs142656910	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51773821_51773822insA	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	52086310	52086313	+	Intron	DEL	AGGG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52086310_52086313delAGGG	uc002xwo.2	+						uc002xwp.1_Intron	NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52479435	52479436	+	IGR	INS	-	AC	AC	rs140935933	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52479435_52479436insAC								ZNF217 (268634 upstream) : SUMO1P1 (11606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	53385959	53385960	+	IGR	DEL	AC	-	-	rs112866324		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53385959_53385960delAC								DOK5 (118250 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	54557385	54557385	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54557385delT								None (None upstream) : CBLN4 (15112 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55285975	55285986	+	IGR	DEL	TCCTCTCCCTCC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55285975_55285986delTCCTCTCCCTCC								TFAP2C (71639 upstream) : BMP7 (457823 downstream)																																			---	---	---	---
RAB22A	57403	broad.mit.edu	37	20	56934552	56934553	+	Intron	DEL	TT	-	-	rs33925119		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56934552_56934553delTT	uc002xyz.2	+							NM_020673	NP_065724			RAS-related protein RAB-22A						endocytosis|endosome organization|protein transport|small GTPase mediated signal transduction	early endosome|endosome membrane|plasma membrane	GTP binding|GTPase activity|protein binding				0	all_epithelial(3;5.09e-14)|Lung NSC(12;0.000122)|all_lung(29;0.00042)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;4.73e-08)|all cancers(14;4.83e-07)															---	---	---	---
CDH4	1002	broad.mit.edu	37	20	59912411	59912412	+	Intron	INS	-	TGA	TGA	rs115954388		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59912411_59912412insTGA	uc002ybn.1	+							NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60222578	60222579	+	Intron	DEL	AT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60222578_60222579delAT	uc002ybn.1	+						CDH4_uc002ybo.1_Intron|CDH4_uc002ybp.1_Intron	NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
TAF4	6874	broad.mit.edu	37	20	60604531	60604532	+	Intron	INS	-	GC	GC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60604531_60604532insGC	uc002ybs.2	-							NM_003185	NP_003176			TBP-associated factor 4						interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	62019434	62019435	+	IGR	DEL	AT	-	-	rs28483310		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62019434_62019435delAT								CHRNA4 (9945 upstream) : KCNQ2 (18107 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9443367	9443369	+	IGR	DEL	ATG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9443367_9443369delATG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9887074	9887074	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9887074delA								None (None upstream) : None (None downstream)																																			---	---	---	---
LOC100132288	100132288	broad.mit.edu	37	21	9924708	9924710	+	Intron	DEL	TAT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9924708_9924710delTAT	uc002zka.1	-							NM_001033515	NP_001028687			hypothetical protein LOC100132288												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	10580033	10580034	+	Intron	INS	-	C	C			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10580033_10580034insC	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10598427	10598427	+	5'Flank	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10598427delG	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10900502	10900503	+	IGR	INS	-	T	T	rs142551773		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10900502_10900503insT								None (None upstream) : TPTE (6240 downstream)																																			---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11059001	11059003	+	Intron	DEL	AAG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11059001_11059003delAAG	uc002yit.1	-						BAGE_uc002yiw.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11099173	11099173	+	5'Flank	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11099173delA	uc002yit.1	-						BAGE_uc002yix.2_5'Flank	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	11105381	11105381	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11105381delG								BAGE (6444 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14343426	14343427	+	IGR	INS	-	A	A	rs150026790		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14343426_14343427insA								None (None upstream) : C21orf99 (67060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14360464	14360467	+	IGR	DEL	ACAG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14360464_14360467delACAG								None (None upstream) : C21orf99 (50020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	16924484	16924485	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16924484_16924485insT								NRIP1 (487358 upstream) : USP25 (178011 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	16954419	16954419	+	IGR	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16954419delA								NRIP1 (517293 upstream) : USP25 (148077 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	21238571	21238571	+	IGR	DEL	C	-	-	rs79825333	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21238571delC								None (None upstream) : C21orf131 (876343 downstream)																																			---	---	---	---
NCAM2	4685	broad.mit.edu	37	21	22665961	22665961	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22665961delT	uc002yld.1	+						NCAM2_uc011acb.1_Intron|NCAM2_uc011acc.1_Intron	NM_004540	NP_004531			neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)														---	---	---	---
NCAM2	4685	broad.mit.edu	37	21	22829963	22829964	+	Intron	DEL	AA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22829963_22829964delAA	uc002yld.1	+						NCAM2_uc011acb.1_Intron	NM_004540	NP_004531			neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	23461652	23461652	+	Intron	DEL	A	-	-	rs35519157		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23461652delA	uc002ylf.2	-											Homo sapiens cDNA clone IMAGE:5271510.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	24441767	24441767	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24441767delT								None (None upstream) : None (None downstream)																																			---	---	---	---
ADAMTS5	11096	broad.mit.edu	37	21	28292894	28292894	+	3'UTR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28292894delC	uc002ymg.2	-	8						NM_007038	NP_008969			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	28797454	28797455	+	Intron	INS	-	C	C	rs148233703	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28797454_28797455insC	uc002ymh.2	-											Homo sapiens, clone IMAGE:5227164, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	28866274	28866274	+	IGR	DEL	T	-	-	rs111495476		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28866274delT								ADAMTS5 (526835 upstream) : NCRNA00113 (228424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29837169	29837169	+	IGR	DEL	T	-	-	rs72359631		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29837169delT								C21orf94 (441641 upstream) : NCRNA00161 (74471 downstream)																																			---	---	---	---
TIAM1	7074	broad.mit.edu	37	21	32873900	32873903	+	Intron	DEL	TTTG	-	-	rs67820524		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32873900_32873903delTTTG	uc002yow.1	-						TIAM1_uc002yox.1_Intron	NM_003253	NP_003244			T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	33545390	33545391	+	IGR	INS	-	A	A	rs145150153	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33545390_33545391insA								NCRNA00159 (16574 upstream) : C21orf45 (95141 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	33776735	33776736	+	IGR	INS	-	TG	TG	rs151154619	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33776735_33776736insTG								C21orf119 (10471 upstream) : C21orf63 (8016 downstream)																																			---	---	---	---
DONSON	29980	broad.mit.edu	37	21	34964785	34964785	+	Intron	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34964785delG	uc002ysm.2	-						DONSON_uc002ysn.1_Intron|CRYZL1_uc011adw.1_Intron	NM_017613	NP_060083			downstream neighbor of SON						multicellular organismal development	nucleus				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
RUNX1	861	broad.mit.edu	37	21	36435824	36435827	+	Intron	DEL	ACAT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36435824_36435827delACAT	uc002yut.1	-											Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
DOPEY2	9980	broad.mit.edu	37	21	37599842	37599843	+	Intron	INS	-	A	A	rs141141432	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37599842_37599843insA	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119			pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
DOPEY2	9980	broad.mit.edu	37	21	37606851	37606851	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37606851delT	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119			pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
DOPEY2	9980	broad.mit.edu	37	21	37644234	37644235	+	Intron	INS	-	T	T	rs71326666		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37644234_37644235insT	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119			pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
KCNJ6	3763	broad.mit.edu	37	21	39099761	39099762	+	Intron	INS	-	GT	GT	rs147533871	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39099761_39099762insGT	uc011aej.1	-						KCNJ6_uc002ywo.2_Intron	NM_002240	NP_002231			potassium inwardly-rectifying channel J6						synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1					Halothane(DB01159)													---	---	---	---
KCNJ15	3772	broad.mit.edu	37	21	39642965	39642965	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39642965delC	uc002ywv.2	+						KCNJ15_uc002yww.2_Intron|KCNJ15_uc002ywx.2_5'Flank|uc002ywy.2_5'Flank	NM_002243	NP_002234			potassium inwardly-rectifying channel J15						synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity			ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	40082875	40082875	+	IGR	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40082875delC								ERG (49171 upstream) : NCRNA00114 (28004 downstream)																																			---	---	---	---
NCRNA00114	400866	broad.mit.edu	37	21	40115112	40115113	+	Intron	DEL	TC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40115112_40115113delTC	uc010goa.2	-						NCRNA00114_uc011aen.1_Intron|NCRNA00114_uc002yxd.3_Intron	NR_027067				Homo sapiens chromosome 21 open reading frame 24 isoform 1 (C21orf24) mRNA, complete sequence.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	40165440	40165440	+	IGR	DEL	T	-	-	rs72307692		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40165440delT								NCRNA00114 (20039 upstream) : ETS2 (11791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	40742347	40742348	+	IGR	INS	-	AC	AC	rs71872089		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40742347_40742348insAC								HMGN1 (21077 upstream) : WRB (9865 downstream)																																			---	---	---	---
B3GALT5	10317	broad.mit.edu	37	21	40944769	40944770	+	Intron	INS	-	T	T	rs143218117	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40944769_40944770insT	uc002yyb.1	+							NM_033173	NP_149363			UDP-Gal:betaGlcNAc beta						protein glycosylation	endoplasmic reticulum|Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			skin(1)	1		Prostate(19;2.55e-06)																---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	41442322	41442326	+	Intron	DEL	GAAAA	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41442322_41442326delGAAAA	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
ZNF295	49854	broad.mit.edu	37	21	43418302	43418302	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43418302delT	uc002zab.3	-						ZNF295_uc002yzz.3_Intron|ZNF295_uc002yzy.3_Intron|ZNF295_uc002zaa.3_Intron|ZNF295_uc010gov.1_Intron|ZNF295_uc002zac.2_Intron	NM_001098402	NP_001091872			zinc finger protein 295 isoform L						negative regulation of transcription, DNA-dependent|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|nucleus	methyl-CpG binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
ABCG1	9619	broad.mit.edu	37	21	43712724	43712725	+	Intron	INS	-	CA	CA			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43712724_43712725insCA	uc002zaq.2	+						ABCG1_uc002zan.2_Intron|ABCG1_uc002zam.2_Intron|ABCG1_uc002zao.2_Intron|ABCG1_uc002zap.2_Intron|ABCG1_uc002zar.2_Intron|ABCG1_uc011aev.1_Intron|ABCG1_uc010gpb.1_Intron	NM_004915	NP_004906			ATP-binding cassette sub-family G member 1						amyloid precursor protein catabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|detection of hormone stimulus|high-density lipoprotein particle remodeling|intracellular cholesterol transport|lipoprotein metabolic process|low-density lipoprotein particle remodeling|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|positive regulation of cholesterol biosynthetic process|regulation of cholesterol esterification|regulation of transcription, DNA-dependent|response to lipid|reverse cholesterol transport	endoplasmic reticulum membrane|external side of plasma membrane|Golgi membrane|recycling endosome	ADP binding|ATP binding|cholesterol transporter activity|glycoprotein transporter activity|phospholipid transporter activity|protein heterodimerization activity|protein homodimerization activity|sterol-transporting ATPase activity|toxin transporter activity			ovary(2)|central_nervous_system(1)	3					Adenosine triphosphate(DB00171)													---	---	---	---
Unknown	0	broad.mit.edu	37	21	44233264	44233264	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44233264delT								PDE9A (37648 upstream) : WDR4 (29942 downstream)																																			---	---	---	---
AGPAT3	56894	broad.mit.edu	37	21	45308280	45308281	+	Intron	DEL	AT	-	-	rs72233443		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45308280_45308281delAT	uc002zdv.2	+							NM_020132	NP_064517			1-acylglycerol-3-phosphate O-acyltransferase 3						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)														---	---	---	---
PFKL	5211	broad.mit.edu	37	21	45724503	45724503	+	Intron	DEL	C	-	-	rs112154128		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45724503delC	uc002zel.2	+						PFKL_uc002zek.2_Intron|PFKL_uc011afd.1_Intron	NM_002626	NP_002617			liver phosphofructokinase						fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding				0				Colorectal(79;0.0811)														---	---	---	---
TRPM2	7226	broad.mit.edu	37	21	45806297	45806298	+	Intron	INS	-	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45806297_45806298insA	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron	NM_003307	NP_003298			transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	47474758	47474758	+	IGR	DEL	A	-	-	rs68075636		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47474758delA								COL6A1 (49795 upstream) : COL6A2 (43275 downstream)																																			---	---	---	---
POTEH	23784	broad.mit.edu	37	22	16264718	16264718	+	Intron	DEL	A	-	-	rs141034850		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16264718delA	uc010gqp.2	-						POTEH_uc002zlg.1_Intron|POTEH_uc002zlh.1_Intron	NM_001136213	NP_001129685			ANKRD26-like family C, member 3											skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	16956559	16956560	+	IGR	DEL	CT	-	-	rs148056720	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16956559_16956560delCT								OR11H1 (506755 upstream) : CCT8L2 (115088 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	17237876	17237877	+	IGR	INS	-	TTTG	TTTG	rs149509176	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17237876_17237877insTTTG								psiTPTE22 (58355 upstream) : XKR3 (26436 downstream)																																			---	---	---	---
CECR5	27440	broad.mit.edu	37	22	17620417	17620417	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17620417delA	uc002zmf.2	-						CECR5_uc002zmd.2_Intron|CECR5_uc002zme.2_Intron|CECR5_uc002zmg.2_Intron|CECR5_uc002zmh.2_Intron	NM_033070	NP_149061			cat eye syndrome chromosome region, candidate 5								hydrolase activity				0		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)																---	---	---	---
SLC25A18	83733	broad.mit.edu	37	22	18067212	18067213	+	Intron	DEL	GG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18067212_18067213delGG	uc002zmp.1	+						SLC25A18_uc010gqx.2_Intron|SLC25A18_uc002zmq.1_Intron	NM_031481	NP_113669			solute carrier							integral to membrane|mitochondrial inner membrane	binding|symporter activity				0				Lung(27;0.124)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	22	18880305	18880306	+	IGR	INS	-	A	A	rs112911268	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18880305_18880306insA								GGT3P (87313 upstream) : DGCR6 (13235 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	19146820	19146820	+	IGR	DEL	T	-	-	rs5844376		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19146820delT								GSC2 (9024 upstream) : SLC25A1 (16275 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	20151957	20151959	+	IGR	DEL	GTT	-	-	rs146872094	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151957_20151959delGTT								ZDHHC8 (16428 upstream) : LOC150197 (41896 downstream)																																			---	---	---	---
KLHL22	84861	broad.mit.edu	37	22	20828222	20828222	+	Intron	DEL	C	-	-	rs78498710		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20828222delC	uc002zsl.1	-						KLHL22_uc011ahr.1_Intron|KLHL22_uc002zsm.1_Intron	NM_032775	NP_116164			kelch-like						cell division	Cul3-RING ubiquitin ligase complex				lung(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)															---	---	---	---
MED15	51586	broad.mit.edu	37	22	20873725	20873725	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20873725delT	uc002zsp.2	+						MED15_uc002zsn.1_Intron|MED15_uc002zso.2_Intron|MED15_uc002zsq.2_Intron|MED15_uc010gso.2_Intron|MED15_uc002zsr.2_Intron|MED15_uc011ahs.1_Intron	NM_001003891	NP_001003891			mediator complex subunit 15 isoform a						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)															---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22669421	22669421	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22669421delA	uc011aim.1	+						LOC96610_uc011aiq.1_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	23866237	23866238	+	IGR	INS	-	A	A	rs35682703		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23866237_23866238insA								ZDHHC8P1 (121438 upstream) : IGLL1 (49077 downstream)																																			---	---	---	---
LOC91316	91316	broad.mit.edu	37	22	23988519	23988519	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23988519delA	uc002zxh.3	-						LOC91316_uc002zxi.3_Intron|LOC91316_uc002zxk.3_Intron|LOC91316_uc010gua.2_Intron|LOC91316_uc002zxl.3_Intron|LOC91316_uc011aiz.1_Intron					Homo sapiens cDNA FLJ32313 fis, clone PROST2003232, weakly similar to BETA-GLUCURONIDASE PRECURSOR (EC 3.2.1.31).												0																		---	---	---	---
KIAA1671	85379	broad.mit.edu	37	22	25498755	25498756	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25498755_25498756insT	uc003abn.2	+						KIAA1671_uc003abl.2_Intron|uc010guv.1_RNA	NM_001145206	NP_001138678			hypothetical protein LOC85379											lung(1)	1																		---	---	---	---
SEZ6L	23544	broad.mit.edu	37	22	26720031	26720032	+	Intron	DEL	CA	-	-	rs68053762		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26720031_26720032delCA	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938			seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	26919949	26919950	+	IGR	INS	-	T	T	rs79967564		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26919949_26919950insT								TFIP11 (11512 upstream) : TPST2 (1766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27538642	27538642	+	IGR	DEL	T	-	-	rs71686820		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27538642delT								MIAT (423693 upstream) : MN1 (605624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27646122	27646123	+	IGR	INS	-	AAA	AAA	rs34717720		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27646122_27646123insAAA								MIAT (531173 upstream) : MN1 (498143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27993262	27993263	+	IGR	INS	-	CA	CA	rs151162975	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27993262_27993263insCA								MIAT (878313 upstream) : MN1 (151003 downstream)																																			---	---	---	---
ZNRF3	84133	broad.mit.edu	37	22	29438754	29438755	+	Intron	INS	-	G	G	rs144703972	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29438754_29438755insG	uc003aeg.2	+						ZNRF3_uc003aeh.1_Intron	NM_032173	NP_115549			zinc and ring finger 3							integral to membrane	zinc ion binding			ovary(1)	1																		---	---	---	---
DRG1	4733	broad.mit.edu	37	22	31800235	31800235	+	Intron	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31800235delT	uc003aku.2	+							NM_004147	NP_004138			developmentally regulated GTP binding protein 1						multicellular organismal development|transcription, DNA-dependent	cytoplasm|intermediate filament cytoskeleton|nucleus	GTP binding|transcription factor binding			central_nervous_system(1)	1																		---	---	---	---
SYN3	8224	broad.mit.edu	37	22	32990479	32990480	+	Intron	INS	-	T	T	rs146770698		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32990479_32990480insT	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481			synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	33587267	33587267	+	IGR	DEL	A	-	-	rs66736476		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33587267delA								SYN3 (132890 upstream) : LARGE (81796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	34577544	34577547	+	IGR	DEL	TGTG	-	-	rs68178847		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34577544_34577547delTGTG								LARGE (258960 upstream) : ISX (884582 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	34588347	34588348	+	IGR	INS	-	G	G	rs150023141	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34588347_34588348insG								LARGE (269763 upstream) : ISX (873781 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	34811161	34811162	+	IGR	DEL	TG	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34811161_34811162delTG								LARGE (492577 upstream) : ISX (650967 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	34984733	34984733	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34984733delT								LARGE (666149 upstream) : ISX (477396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	35396473	35396473	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35396473delG								None (None upstream) : ISX (65656 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	35457930	35457931	+	IGR	INS	-	A	A	rs148551069	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35457930_35457931insA								None (None upstream) : ISX (4198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	35500457	35500457	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35500457delG								ISX (17079 upstream) : HMGXB4 (152988 downstream)																																			---	---	---	---
TXN2	25828	broad.mit.edu	37	22	36865457	36865458	+	Intron	DEL	CT	-	-	rs151011703		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36865457_36865458delCT	uc003apk.1	-						TXN2_uc003apl.1_Intron	NM_012473	NP_036605			thioredoxin 2 precursor						cell redox homeostasis|electron transport chain|glycerol ether metabolic process|transport	mitochondrion|nucleolus	electron carrier activity				0																		---	---	---	---
TMPRSS6	164656	broad.mit.edu	37	22	37475456	37475459	+	Intron	DEL	ATGG	-	-	rs10537993		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37475456_37475459delATGG	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron	NM_153609	NP_705837			transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6																		---	---	---	---
CSNK1E	1454	broad.mit.edu	37	22	38720078	38720083	+	Intron	DEL	TTTGTG	-	-	rs67980518		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38720078_38720083delTTTGTG	uc003avm.1	-						CSNK1E_uc003avo.2_Intron|LOC400927_uc010gxm.2_Intron	NM_152221	NP_689407			casein kinase 1 epsilon						DNA repair|G2/M transition of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|signal transduction	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Melanoma(58;0.045)																	---	---	---	---
Unknown	0	broad.mit.edu	37	22	38906900	38906900	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38906900delT								DDX17 (3235 upstream) : DMC1 (8054 downstream)																																			---	---	---	---
SERHL	94009	broad.mit.edu	37	22	42896006	42896017	+	5'Flank	DEL	CGGGCTCACCAC	-	-	rs111234719		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42896006_42896017delCGGGCTCACCAC	uc011apm.1	+						SERHL_uc011apl.1_5'Flank					RecName: Full=Serine hydrolase-like protein;          EC=3.1.-.-;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	44609833	44609834	+	IGR	INS	-	CAT	CAT	rs140426927	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44609833_44609834insCAT								PARVG (6799 upstream) : KIAA1644 (29723 downstream)																																			---	---	---	---
PRR5	55615	broad.mit.edu	37	22	45081473	45081474	+	Intron	INS	-	C	C			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45081473_45081474insC	uc010gzt.1	+						PRR5_uc003bew.1_Intron|PRR5_uc003bex.1_Intron|PRR5_uc010gzu.1_Intron|PRR5_uc003bey.1_Intron|PRR5_uc003bez.1_Intron	NM_001017530	NP_001017530			proline rich 5 (renal) isoform 3						cell cycle					skin(1)	1		all_neural(38;0.00409)|Ovarian(80;0.024)|Glioma(61;0.0647)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)												OREG0026630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	22	45262993	45262994	+	IGR	INS	-	A	A	rs143320246		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45262993_45262994insA								PRR5-ARHGAP8 (4331 upstream) : PHF21B (14051 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	45887108	45887109	+	IGR	INS	-	T	T	rs113471843		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45887108_45887109insT								RIBC2 (58815 upstream) : FBLN1 (11610 downstream)																																			---	---	---	---
GRAMD4	23151	broad.mit.edu	37	22	47020141	47020141	+	5'Flank	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47020141delT	uc003bhx.2	+							NM_015124	NP_055939			death-inducing-protein						apoptosis	integral to membrane|mitochondrial membrane				ovary(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)														---	---	---	---
TBC1D22A	25771	broad.mit.edu	37	22	47407914	47407914	+	Intron	DEL	C	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47407914delC	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161			TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	47655125	47655126	+	IGR	INS	-	CA	CA	rs141777561	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47655125_47655126insCA								TBC1D22A (85403 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	48694538	48694538	+	IGR	DEL	A	-	-	rs113076071		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48694538delA								None (None upstream) : FAM19A5 (190750 downstream)																																			---	---	---	---
FAM19A5	25817	broad.mit.edu	37	22	49131686	49131686	+	Intron	DEL	G	-	-	rs10716843		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49131686delG	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436			family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)														---	---	---	---
BRD1	23774	broad.mit.edu	37	22	50185826	50185826	+	Intron	DEL	A	-	-	rs11290240		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50185826delA	uc003biv.2	-						BRD1_uc011arf.1_Intron|BRD1_uc011arg.1_Intron|BRD1_uc011arh.1_Intron|BRD1_uc003biu.3_Intron	NM_014577	NP_055392			bromodomain containing protein 1						histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	50346054	50346054	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50346054delG								CRELD2 (24868 upstream) : PIM3 (8089 downstream)																																			---	---	---	---
SAPS2	9701	broad.mit.edu	37	22	50852099	50852100	+	Intron	INS	-	CCCCCTCCT	CCCCCTCCT	rs138644041	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50852099_50852100insCCCCCTCCT	uc003blb.1	+						SAPS2_uc003bky.1_Intron|SAPS2_uc003bkz.1_Intron|SAPS2_uc003blc.2_Intron|SAPS2_uc003bla.1_Intron	NM_014678	NP_055493			SAPS domain family, member 2							cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	810161	810170	+	IGR	DEL	TTTCTTTTCT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:810161_810170delTTTCTTTTCT								SHOX (190016 upstream) : CRLF2 (504717 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	977550	977550	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:977550delT								SHOX (357405 upstream) : CRLF2 (337337 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	1451433	1451433	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1451433delT								CSF2RA (22605 upstream) : IL3RA (4076 downstream)																																			---	---	---	---
DHRSX	207063	broad.mit.edu	37	X	2243892	2243893	+	Intron	INS	-	TTCTC	TTCTC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2243892_2243893insTTCTC	uc004cqf.3	-							NM_145177	NP_660160			dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	23210484	23210487	+	IGR	DEL	ACAC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23210484_23210487delACAC								DDX53 (190280 upstream) : PTCHD1 (142498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	26180110	26180111	+	IGR	INS	-	TC	TC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26180110_26180111insTC								MAGEB18 (21258 upstream) : MAGEB6 (30446 downstream)																																			---	---	---	---
CXorf22	170063	broad.mit.edu	37	X	35966918	35966919	+	Intron	DEL	GT	-	-	rs112676215	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35966918_35966919delGT	uc004ddj.2	+						CXorf22_uc010ngv.2_Intron	NM_152632	NP_689845			hypothetical protein LOC170063											large_intestine(1)|lung(1)|ovary(1)	3																		---	---	---	---
RPGR	6103	broad.mit.edu	37	X	38145532	38145534	+	In_Frame_Del	DEL	TCC	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38145532_38145534delTCC	uc004ded.1	-	15	2886_2888	c.2718_2720delGGA	c.(2716-2721)GAGGAA>GAA	p.906_907EE>E	RPGR_uc004deb.2_Intron|RPGR_uc004dea.2_Intron|RPGR_uc004dec.2_Intron	NM_001034853	NP_001030025	Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator isoform C	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1																		---	---	---	---
USP9X	8239	broad.mit.edu	37	X	41064887	41064888	+	Intron	DEL	TT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41064887_41064888delTT	uc004dfb.2	+						USP9X_uc004dfc.2_Intron	NM_001039590	NP_001034679			ubiquitin specific protease 9, X-linked isoform						BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6																		---	---	---	---
SSX7	280658	broad.mit.edu	37	X	52681173	52681174	+	Intron	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52681173_52681174insT	uc004dqx.1	-							NM_173358	NP_775494			synovial sarcoma, X breakpoint 7						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding			skin(1)	1	Ovarian(276;0.236)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	53063289	53063289	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53063289delG								FAM156A (125706 upstream) : GPR173 (15217 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	61793091	61793091	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61793091delT								None (None upstream) : SPIN4 (774017 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	66338204	66338205	+	IGR	DEL	TG	-	-	rs35615257		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66338204_66338205delTG								EDA2R (479096 upstream) : AR (425669 downstream)																																			---	---	---	---
SLC16A2	6567	broad.mit.edu	37	X	73735211	73735211	+	Intron	DEL	A	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73735211delA	uc004ebt.2	+							NM_006517	NP_006508			solute carrier family 16, member 2							integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity			breast(2)|ovary(1)	3					Pyruvic acid(DB00119)													---	---	---	---
Unknown	0	broad.mit.edu	37	X	105845181	105845182	+	IGR	INS	-	AC	AC			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105845181_105845182insAC								MUM1L1 (392233 upstream) : CXorf57 (9978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	128741659	128741659	+	IGR	DEL	T	-	-	rs67828960		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128741659delT								OCRL (15131 upstream) : APLN (37667 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	144474223	144474224	+	IGR	INS	-	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144474223_144474224insT								SPANXN1 (136495 upstream) : SLITRK2 (425123 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9978056	9978056	+	IGR	DEL	G	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9978056delG								TTTY22 (327202 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9980382	9980384	+	IGR	DEL	ACA	-	-	rs141681160		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9980382_9980384delACA								TTTY22 (329528 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10016115	10016116	+	IGR	INS	-	T	T	rs141302004		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10016115_10016116insT								TTTY22 (365261 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10042329	10042330	+	IGR	DEL	CT	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10042329_10042330delCT								TTTY22 (391475 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13138210	13138214	+	IGR	DEL	CCATT	-	-	rs113102175		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13138210_13138214delCCATT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13271205	13271205	+	IGR	DEL	A	-	-	rs141186848		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13271205delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13445284	13445285	+	IGR	INS	-	G	G			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13445284_13445285insG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	22280239	22280239	+	IGR	DEL	T	-	-			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:22280239delT								KDM5D (373414 upstream) : TTTY10 (347315 downstream)																																			---	---	---	---
KIF1B	23095	broad.mit.edu	37	1	10394612	10394612	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10394612G>A	uc001aqx.3	+	28	3161	c.2959G>A	c.(2959-2961)GTG>ATG	p.V987M	KIF1B_uc001aqw.3_Missense_Mutation_p.V941M|KIF1B_uc001aqy.2_Missense_Mutation_p.V961M|KIF1B_uc001aqz.2_Missense_Mutation_p.V987M|KIF1B_uc001ara.2_Missense_Mutation_p.V947M|KIF1B_uc001arb.2_Missense_Mutation_p.V973M	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	987					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)														---	---	---	---
EFCAB7	84455	broad.mit.edu	37	1	64021086	64021086	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64021086A>G	uc001dbf.2	+	9	1408	c.1114A>G	c.(1114-1116)ACT>GCT	p.T372A		NM_032437	NP_115813	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7	372							calcium ion binding				0																		---	---	---	---
C1orf173	127254	broad.mit.edu	37	1	75037527	75037527	+	Silent	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75037527C>A	uc001dgg.2	-	14	4086	c.3867G>T	c.(3865-3867)GCG>GCT	p.A1289A		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	1289	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5																		---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103352525	103352525	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103352525C>A	uc001dul.2	-	63	5014	c.4696G>T	c.(4696-4698)GAT>TAT	p.D1566Y	COL11A1_uc001duk.2_Missense_Mutation_p.D762Y|COL11A1_uc001dum.2_Missense_Mutation_p.D1578Y|COL11A1_uc001dun.2_Missense_Mutation_p.D1527Y|COL11A1_uc009weh.2_Missense_Mutation_p.D1450Y	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1566					collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)														---	---	---	---
AMY2B	280	broad.mit.edu	37	1	104120221	104120221	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104120221G>A	uc001duq.2	+	10	1827	c.1211G>A	c.(1210-1212)CGC>CAC	p.R404H	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Missense_Mutation_p.R404H|AMY2B_uc001dus.1_RNA	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	404					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)														---	---	---	---
COPA	1314	broad.mit.edu	37	1	160261727	160261727	+	Intron	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160261727G>T	uc009wti.2	-						COPA_uc001fvv.3_Intron	NM_004371	NP_004362			coatomer protein complex, subunit alpha isoform						COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)													OREG0013929	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TNN	63923	broad.mit.edu	37	1	175046731	175046731	+	Silent	SNP	C	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175046731C>T	uc001gkl.1	+	2	290	c.177C>T	c.(175-177)GAC>GAT	p.D59D	TNN_uc010pmx.1_Silent_p.D59D	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	59					cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)														---	---	---	---
ASTN1	460	broad.mit.edu	37	1	176999973	176999973	+	Silent	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176999973G>A	uc001glc.2	-	4	1193	c.981C>T	c.(979-981)AGC>AGT	p.S327S	ASTN1_uc001glb.1_Silent_p.S327S|ASTN1_uc001gld.1_Silent_p.S327S|ASTN1_uc009wwx.1_Silent_p.S327S|ASTN1_uc001gle.3_RNA|MIR488_hsa-mir-488|MI0003123_5'Flank	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	327					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15																		---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216073486	216073486	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216073486G>A	uc001hku.1	-	40	7912	c.7525C>T	c.(7525-7527)CGG>TGG	p.R2509W		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2509	Extracellular (Potential).|Fibronectin type-III 11.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
OR2M2	391194	broad.mit.edu	37	1	248343916	248343916	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248343916C>A	uc010pzf.1	+	1	629	c.629C>A	c.(628-630)CCT>CAT	p.P210H		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	210	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)															---	---	---	---
PLB1	151056	broad.mit.edu	37	2	28785965	28785965	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28785965C>T	uc002rmb.1	+	18	1205	c.1205C>T	c.(1204-1206)ACG>ATG	p.T402M	PLB1_uc010ezj.1_Missense_Mutation_p.T413M|PLB1_uc002rmc.2_Missense_Mutation_p.T90M	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor	402	4 X 308-326 AA approximate repeats.|2.|Extracellular (Potential).				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
DHX57	90957	broad.mit.edu	37	2	39089287	39089287	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39089287C>A	uc002rrf.2	-	4	671	c.572G>T	c.(571-573)AGG>ATG	p.R191M	DHX57_uc002rre.2_Translation_Start_Site|DHX57_uc002rrg.2_Missense_Mutation_p.R191M	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	191	UBA.						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)																---	---	---	---
PPM1B	5495	broad.mit.edu	37	2	44428714	44428714	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44428714G>T	uc002rtt.2	+	2	804	c.376G>T	c.(376-378)GGG>TGG	p.G126W	PPM1B_uc002rts.2_Missense_Mutation_p.G126W|PPM1B_uc002rtu.2_Missense_Mutation_p.G126W|PPM1B_uc002rtv.2_Intron|PPM1B_uc002rtw.2_Missense_Mutation_p.G126W|PPM1B_uc002rtx.2_Missense_Mutation_p.G126W	NM_002706	NP_002697	O75688	PPM1B_HUMAN	protein phosphatase 1B isoform 1	126					protein dephosphorylation	protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity			kidney(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)																---	---	---	---
ZNF638	27332	broad.mit.edu	37	2	71576909	71576909	+	Silent	SNP	C	A	A	rs148484922		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71576909C>A	uc002shx.2	+	2	1144	c.825C>A	c.(823-825)CCC>CCA	p.P275P	ZNF638_uc010fec.2_Silent_p.P381P|ZNF638_uc010yqw.1_Intron|ZNF638_uc002shw.2_Silent_p.P275P|ZNF638_uc002shy.2_Silent_p.P275P|ZNF638_uc002shz.2_Silent_p.P275P|ZNF638_uc002sia.2_Silent_p.P275P|ZNF638_uc002sib.1_Silent_p.P275P	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638	275					RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4																		---	---	---	---
FAHD2A	51011	broad.mit.edu	37	2	96078462	96078462	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96078462G>T	uc002sur.2	+	7	1011	c.832G>T	c.(832-834)GGG>TGG	p.G278W	FAHD2A_uc002sus.2_Missense_Mutation_p.G278W|uc002sut.1_5'Flank	NM_016044	NP_057128	Q96GK7	FAH2A_HUMAN	fumarylacetoacetate hydrolase domain containing	278							hydrolase activity|metal ion binding			ovary(1)	1																		---	---	---	---
ITGA6	3655	broad.mit.edu	37	2	173355777	173355777	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173355777G>T	uc002uhp.1	+	21	2908	c.2705G>T	c.(2704-2706)CGG>CTG	p.R902L	ITGA6_uc010zdy.1_Missense_Mutation_p.R783L|ITGA6_uc002uho.1_Missense_Mutation_p.R902L|ITGA6_uc010fqm.1_Missense_Mutation_p.R533L	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	941	Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)															---	---	---	---
UBA7	7318	broad.mit.edu	37	3	49850900	49850900	+	Intron	SNP	C	A	A	rs34487991		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49850900C>A	uc003cxr.2	-							NM_003335	NP_003326			ubiquitin-like modifier activating enzyme 7						ISG15-protein conjugation|negative regulation of type I interferon production	cytosol	ATP binding|ISG15 activating enzyme activity|ligase activity			ovary(1)|pancreas(1)	2				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)														---	---	---	---
MCM2	4171	broad.mit.edu	37	3	127340016	127340016	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127340016G>A	uc003ejp.2	+	15	2606	c.2549G>A	c.(2548-2550)CGC>CAC	p.R850H	MCM2_uc011bkm.1_Missense_Mutation_p.R720H|MCM2_uc010hsl.2_RNA|MCM2_uc011bkn.1_Missense_Mutation_p.R803H	NM_004526	NP_004517	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	850					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding			ovary(3)|skin(1)	4																		---	---	---	---
POLR2H	5437	broad.mit.edu	37	3	184081350	184081350	+	Silent	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184081350C>A	uc003fok.1	+	1	157	c.70C>A	c.(70-72)CGA>AGA	p.R24R	CLCN2_uc003foi.2_5'Flank|CLCN2_uc010hya.1_5'Flank|CLCN2_uc011brl.1_5'Flank|CLCN2_uc011brm.1_5'Flank|CLCN2_uc011brn.1_5'Flank|POLR2H_uc003foj.1_RNA	NM_006232	NP_006223	P52434	RPAB3_HUMAN	RNA polymerase II, polypeptide H	24					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase I transcription|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex|nucleolus	DNA-directed RNA polymerase activity|protein binding|zinc ion binding				0	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)													OREG0015950	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SH3TC1	54436	broad.mit.edu	37	4	8235216	8235216	+	Silent	SNP	C	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8235216C>T	uc003gkv.3	+	14	3359	c.3258C>T	c.(3256-3258)AGC>AGT	p.S1086S	SH3TC1_uc003gkw.3_Silent_p.S1010S|SH3TC1_uc003gkx.3_RNA|SH3TC1_uc003gky.2_RNA	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	1086							binding			large_intestine(2)|pancreas(1)	3																		---	---	---	---
TTC23L	153657	broad.mit.edu	37	5	34845620	34845620	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34845620C>A	uc003jiu.2	+	3	200	c.97C>A	c.(97-99)CAG>AAG	p.Q33K		NM_144725	NP_653326	Q6PF05	TT23L_HUMAN	tetratricopeptide repeat domain 23-like	33							binding			central_nervous_system(1)	1																		---	---	---	---
RAD1	5810	broad.mit.edu	37	5	34914967	34914967	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34914967C>A	uc003jix.2	-	2	360	c.31G>T	c.(31-33)GAG>TAG	p.E11*	RAD1_uc003jiw.2_5'UTR|RAD1_uc003jiy.2_Nonsense_Mutation_p.E11*|BRIX1_uc003jiz.2_5'Flank|BRIX1_uc011col.1_5'Flank|BRIX1_uc003jja.2_5'Flank	NM_002853	NP_002844	O60671	RAD1_HUMAN	RAD1 homolog	11					DNA damage checkpoint|DNA repair|DNA replication|meiotic prophase I	nucleoplasm	3'-5' exonuclease activity|damaged DNA binding|exodeoxyribonuclease III activity|protein binding				0	all_lung(31;0.000107)	Lung NSC(810;5.19e-05)|Ovarian(839;0.0448)|Breast(839;0.198)	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)										Other_conserved_DNA_damage_response_genes					---	---	---	---
PCDHA13	56136	broad.mit.edu	37	5	140263466	140263466	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140263466G>A	uc003lif.2	+	1	1613	c.1613G>A	c.(1612-1614)CGC>CAC	p.R538H	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.R538H|PCDHA13_uc003lid.2_Missense_Mutation_p.R538H	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	538	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PRPF4B	8899	broad.mit.edu	37	6	4032255	4032255	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4032255G>T	uc003mvv.2	+	2	595	c.504G>T	c.(502-504)AAG>AAT	p.K168N	PRPF4B_uc011dhv.1_RNA	NM_003913	NP_003904	Q13523	PRP4B_HUMAN	serine/threonine-protein kinase PRP4K	168	Arg/Lys-rich (basic).					catalytic step 2 spliceosome	ATP binding|protein binding|protein serine/threonine kinase activity			breast(5)	5	Ovarian(93;0.0925)	all_hematologic(90;0.0895)																---	---	---	---
DSP	1832	broad.mit.edu	37	6	7574904	7574904	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7574904G>T	uc003mxp.1	+	17	2591	c.2312G>T	c.(2311-2313)AGG>ATG	p.R771M	DSP_uc003mxq.1_Missense_Mutation_p.R771M	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	771	Globular 1.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)														---	---	---	---
OR2J3	442186	broad.mit.edu	37	6	29079853	29079853	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29079853G>A	uc011dll.1	+	1	186	c.186G>A	c.(184-186)ATG>ATA	p.M62I		NM_001005216	NP_001005216	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J,	62	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---
PPT2	9374	broad.mit.edu	37	6	32123534	32123534	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32123534C>T	uc003nzx.2	+	4	975	c.407C>T	c.(406-408)TCC>TTC	p.S136F	PRRT1_uc003nzu.2_5'Flank|uc003nzv.3_5'Flank|PPT2_uc003nzw.2_Missense_Mutation_p.S142F|PPT2_uc011dpi.1_RNA|PPT2_uc003nzy.1_RNA|PPT2_uc003nzz.2_Missense_Mutation_p.S136F|PPT2_uc003oaa.2_Missense_Mutation_p.S136F|PPT2_uc010jtu.1_Missense_Mutation_p.S136F	NM_005155	NP_005146	Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2 isoform a	136					protein modification process	lysosome	palmitoyl-(protein) hydrolase activity				0																		---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75857407	75857407	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75857407C>A	uc003phs.2	-	23	4567	c.4401G>T	c.(4399-4401)AAG>AAT	p.K1467N	COL12A1_uc003pht.2_Missense_Mutation_p.K303N	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1467	Fibronectin type-III 9.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
SOBP	55084	broad.mit.edu	37	6	107955224	107955224	+	Silent	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107955224G>T	uc003prx.2	+	6	1680	c.1176G>T	c.(1174-1176)CCG>CCT	p.P392P		NM_018013	NP_060483	A7XYQ1	SOBP_HUMAN	sine oculis binding protein homolog	392	Pro-rich.						metal ion binding			ovary(1)	1		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)														---	---	---	---
RPS6KA2	6196	broad.mit.edu	37	6	166844008	166844008	+	Missense_Mutation	SNP	G	A	A	rs145694057		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166844008G>A	uc003qvb.1	-	16	1733	c.1514C>T	c.(1513-1515)TCG>TTG	p.S505L	RPS6KA2_uc011ego.1_Missense_Mutation_p.S416L|RPS6KA2_uc010kkl.1_Missense_Mutation_p.S416L|RPS6KA2_uc003qvc.1_Missense_Mutation_p.S513L|RPS6KA2_uc003qvd.1_Missense_Mutation_p.S530L	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	505	Protein kinase 2.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)														---	---	---	---
LMTK2	22853	broad.mit.edu	37	7	97766742	97766742	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97766742A>C	uc003upd.1	+	2	512	c.219A>C	c.(217-219)GAA>GAC	p.E73D		NM_014916	NP_055731	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2 precursor	73					early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)																	---	---	---	---
ZKSCAN5	23660	broad.mit.edu	37	7	99123521	99123521	+	Silent	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99123521C>A	uc003uqv.2	+	6	982	c.858C>A	c.(856-858)ACC>ACA	p.T286T	ZKSCAN5_uc010lfx.2_Silent_p.T286T|ZKSCAN5_uc003uqw.2_Silent_p.T286T|ZKSCAN5_uc003uqx.2_Silent_p.T213T|ZKSCAN5_uc003uqy.2_Silent_p.T22T	NM_145102	NP_659570	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	286	KRAB.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)																	---	---	---	---
CPA5	93979	broad.mit.edu	37	7	129987658	129987658	+	Silent	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129987658C>A	uc010lmd.1	+	5	788	c.168C>A	c.(166-168)CTC>CTA	p.L56L	CPA5_uc003vps.2_Silent_p.L56L|CPA5_uc003vpt.2_Silent_p.L56L|CPA5_uc010lme.1_Silent_p.L56L|CPA5_uc003vpu.1_Silent_p.L56L	NM_001127441	NP_001120913	Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5 isoform 1	56					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2	Melanoma(18;0.0435)																	---	---	---	---
NUP205	23165	broad.mit.edu	37	7	135307616	135307616	+	Silent	SNP	C	T	T	rs144174512		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135307616C>T	uc003vsw.2	+	31	4453	c.4422C>T	c.(4420-4422)GGC>GGT	p.G1474G	NUP205_uc003vsx.2_RNA	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1474					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
TRPV6	55503	broad.mit.edu	37	7	142583185	142583185	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142583185C>A	uc003wbx.1	-	1	293	c.77G>T	c.(76-78)CGG>CTG	p.R26L		NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	26	Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)																	---	---	---	---
SMARCD3	6604	broad.mit.edu	37	7	150936587	150936587	+	Intron	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150936587G>T	uc003wjs.2	-						SMARCD3_uc003wjt.2_Intron|SMARCD3_uc003wju.2_Intron	NM_001003801	NP_001003801			SWI/SNF related, matrix associated, actin						cellular lipid metabolic process|chromatin modification|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	nuclear hormone receptor binding|protein binding|transcription coactivator activity|transcription factor binding			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
MLL3	58508	broad.mit.edu	37	7	151945044	151945044	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151945044C>A	uc003wla.2	-	14	2694	c.2475G>T	c.(2473-2475)ATG>ATT	p.M825I		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	825					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
AMAC1L2	83650	broad.mit.edu	37	8	11189042	11189042	+	Missense_Mutation	SNP	G	A	A	rs142654795	byFrequency	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11189042G>A	uc003wtp.1	+	1	548	c.427G>A	c.(427-429)GCT>ACT	p.A143T		NM_054028	NP_473369	Q96KT7	AMCL2_HUMAN	acyl-malonyl condensing enzyme	143	DUF6 1.					integral to membrane					0			STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)														---	---	---	---
TAF1L	138474	broad.mit.edu	37	9	32630718	32630718	+	Silent	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32630718G>A	uc003zrg.1	-	1	4950	c.4860C>T	c.(4858-4860)TAC>TAT	p.Y1620Y	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1620					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)														---	---	---	---
FRMPD1	22844	broad.mit.edu	37	9	37711391	37711391	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37711391C>T	uc004aag.1	+	5	451	c.407C>T	c.(406-408)TCG>TTG	p.S136L	FRMPD1_uc004aah.1_Missense_Mutation_p.S136L	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	136						cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)														---	---	---	---
TNC	3371	broad.mit.edu	37	9	117808747	117808747	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117808747T>G	uc004bjj.3	-	17	5429	c.5067A>C	c.(5065-5067)GAA>GAC	p.E1689D	TNC_uc010mvf.2_Intron	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1689	Fibronectin type-III 12.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7																		---	---	---	---
KIAA1274	27143	broad.mit.edu	37	10	72307091	72307091	+	Silent	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72307091C>A	uc001jrd.3	+	18	2432	c.2151C>A	c.(2149-2151)CCC>CCA	p.P717P	KIAA1274_uc001jre.3_Silent_p.P8P	NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274	717										ovary(2)|central_nervous_system(1)	3																		---	---	---	---
MUC2	4583	broad.mit.edu	37	11	1093349	1093349	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1093349C>T	uc001lsx.1	+	31	12281	c.12254C>T	c.(12253-12255)CCC>CTC	p.P4085L		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4085						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)													---	---	---	---
SOX6	55553	broad.mit.edu	37	11	15994601	15994601	+	Silent	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15994601G>A	uc001mme.2	-	16	2313	c.2280C>T	c.(2278-2280)ATC>ATT	p.I760I	SOX6_uc001mmd.2_Silent_p.I723I|SOX6_uc001mmf.2_Silent_p.I720I|SOX6_uc001mmg.2_Silent_p.I727I	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	747					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3																		---	---	---	---
TRAF6	7189	broad.mit.edu	37	11	36511396	36511396	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36511396C>A	uc001mwr.1	-	8	1901	c.1561G>T	c.(1561-1563)GGG>TGG	p.G521W	uc001mwq.1_5'Flank|TRAF6_uc001mws.1_Missense_Mutation_p.G521W	NM_145803	NP_665802	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6	521					activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|ossification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell cytokine production|protein autoubiquitination|protein K63-linked ubiquitination|response to interleukin-1|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cell cortex|cytosol|endosome membrane|internal side of plasma membrane|nuclear membrane	histone deacetylase binding|mitogen-activated protein kinase kinase kinase binding|protein kinase B binding|protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1	all_lung(20;0.211)	all_hematologic(20;0.107)																---	---	---	---
OR5D13	390142	broad.mit.edu	37	11	55541040	55541040	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55541040G>T	uc010ril.1	+	1	127	c.127G>T	c.(127-129)GGG>TGG	p.G43W		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	43	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)																---	---	---	---
RARG	5916	broad.mit.edu	37	12	53607425	53607425	+	Silent	SNP	C	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53607425C>T	uc001sce.2	-	8	1358	c.873G>A	c.(871-873)GGG>GGA	p.G291G	RARG_uc001scd.2_Silent_p.G280G|RARG_uc010sob.1_Silent_p.G269G|RARG_uc001scf.2_Silent_p.G291G|RARG_uc001scg.2_Silent_p.G219G|RARG_uc010soc.1_Silent_p.G170G|RARG_uc010sod.1_Silent_p.G328G	NM_000966	NP_000957	P13631	RARG_HUMAN	retinoic acid receptor, gamma isoform 1	291	Ligand-binding.				canonical Wnt receptor signaling pathway|embryonic eye morphogenesis|embryonic hindlimb morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|regulation of cell size|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid	integral to membrane|transcription factor complex	retinoic acid receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			breast(2)|ovary(1)|lung(1)	4					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)											OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ZFC3H1	196441	broad.mit.edu	37	12	72023392	72023392	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72023392G>T	uc001swo.2	-	19	4182	c.3823C>A	c.(3823-3825)CAT>AAT	p.H1275N		NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	1275					RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
LTA4H	4048	broad.mit.edu	37	12	96408713	96408713	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96408713G>T	uc001ten.1	-	12	1192	c.1124C>A	c.(1123-1125)CCT>CAT	p.P375H	LTA4H_uc010suy.1_Missense_Mutation_p.P337H|LTA4H_uc010suz.1_Missense_Mutation_p.P337H|LTA4H_uc010sva.1_RNA|LTA4H_uc009ztj.2_RNA	NM_000895	NP_000886	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase	375					hormone biosynthetic process|inflammatory response|leukotriene biosynthetic process|peptide catabolic process|prostanoid metabolic process|proteolysis	cytosol|nucleus	aminopeptidase activity|epoxide hydrolase activity|leukotriene-A4 hydrolase activity|metallopeptidase activity|protein binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(1)	1																		---	---	---	---
WSCD2	9671	broad.mit.edu	37	12	108589947	108589947	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108589947G>A	uc001tms.2	+	2	1082	c.338G>A	c.(337-339)CGA>CAA	p.R113Q	WSCD2_uc001tmt.2_Missense_Mutation_p.R113Q	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	113						integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3																		---	---	---	---
CIT	11113	broad.mit.edu	37	12	120150099	120150099	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120150099C>A	uc001txi.1	-	36	4665	c.4612G>T	c.(4612-4614)GGG>TGG	p.G1538W	CIT_uc001txh.1_Missense_Mutation_p.G1057W|CIT_uc001txj.1_Missense_Mutation_p.G1580W	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	1538	PH.				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)														---	---	---	---
POLE	5426	broad.mit.edu	37	12	133237686	133237686	+	Missense_Mutation	SNP	C	A	A	rs142563997		TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133237686C>A	uc001uks.1	-	25	2973	c.2929G>T	c.(2929-2931)GGG>TGG	p.G977W	POLE_uc001ukr.1_5'Flank|POLE_uc010tbq.1_RNA|POLE_uc009zyu.1_Missense_Mutation_p.G950W	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	977					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)									DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
LCP1	3936	broad.mit.edu	37	13	46733037	46733037	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46733037C>A	uc001vaz.3	-	3	278	c.152G>T	c.(151-153)CGA>CTA	p.R51L	LCP1_uc001vba.3_Missense_Mutation_p.R51L	NM_002298	NP_002289	P13796	PLSL_HUMAN	L-plastin	51	EF-hand 2.				regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding			lung(4)|ovary(3)	7		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)				T	BCL6	NHL 								---	---	---	---
FNDC3A	22862	broad.mit.edu	37	13	49776088	49776088	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49776088C>A	uc001vcm.2	+	24	3445	c.3140C>A	c.(3139-3141)CCA>CAA	p.P1047Q	FNDC3A_uc001vcn.2_Missense_Mutation_p.P1047Q|FNDC3A_uc001vco.2_RNA|FNDC3A_uc001vcq.2_Missense_Mutation_p.P991Q	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	1047	Fibronectin type-III 9.					Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)														---	---	---	---
CUL4A	8451	broad.mit.edu	37	13	113893752	113893752	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113893752G>A	uc010tjy.1	+	11	933	c.922G>A	c.(922-924)GAC>AAC	p.D308N	CUL4A_uc010tjx.1_Missense_Mutation_p.D208N|CUL4A_uc010agu.2_Missense_Mutation_p.D169N|CUL4A_uc010tjz.1_5'UTR	NM_001008895	NP_001008895	Q13619	CUL4A_HUMAN	cullin 4A isoform 1	308					cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	ubiquitin protein ligase binding			central_nervous_system(2)|skin(1)	3	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)															---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64679700	64679700	+	Silent	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64679700C>A	uc001xgm.2	+	105	19263	c.19033C>A	c.(19033-19035)CGG>AGG	p.R6345R	SYNE2_uc001xgl.2_Silent_p.R6345R|SYNE2_uc010apy.2_Silent_p.R2730R|SYNE2_uc001xgn.2_Silent_p.R1307R|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_Silent_p.R315R|SYNE2_uc001xgq.2_Silent_p.R710R|SYNE2_uc001xgr.2_Silent_p.R128R|SYNE2_uc010tsi.1_5'Flank|SYNE2_uc001xgs.2_5'Flank|SYNE2_uc001xgt.2_5'Flank	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6345	Spectrin 8.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64691769	64691769	+	Intron	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64691769G>T	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc001xgn.2_Intron|SYNE2_uc001xgo.2_Intron|SYNE2_uc010aqa.2_Intron|SYNE2_uc001xgq.2_Intron|SYNE2_uc001xgr.2_Intron|SYNE2_uc010tsi.1_Intron|SYNE2_uc001xgs.2_Intron|SYNE2_uc001xgt.2_Intron	NM_015180	NP_055995			spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
HDC	3067	broad.mit.edu	37	15	50540522	50540522	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50540522T>C	uc001zxz.2	-	10	1166	c.1060A>G	c.(1060-1062)AGC>GGC	p.S354G	HDC_uc001zxy.2_Missense_Mutation_p.S97G|HDC_uc010uff.1_Intron	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	354					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)													---	---	---	---
RGS11	8786	broad.mit.edu	37	16	321028	321028	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:321028C>T	uc002cgj.1	-	13	937	c.934G>A	c.(934-936)GTG>ATG	p.V312M	RGS11_uc002cgi.1_Missense_Mutation_p.V291M|RGS11_uc010bqs.1_Missense_Mutation_p.V301M|RGS11_uc002cgk.1_Missense_Mutation_p.V128M	NM_183337	NP_899180	O94810	RGS11_HUMAN	regulator of G-protein signalling 11 isoform 1	312	RGS.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			lung(1)|pancreas(1)	2		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)																---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7383034	7383034	+	Intron	SNP	C	A	A	rs145351963	by1000genomes	TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7383034C>A	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Missense_Mutation_p.P11H|A2BP1_uc002cyy.2_Missense_Mutation_p.P11H|A2BP1_uc002cyx.2_Missense_Mutation_p.P11H|A2BP1_uc010uyc.1_Missense_Mutation_p.P11H	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
GRIN2A	2903	broad.mit.edu	37	16	9862888	9862888	+	Silent	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9862888G>A	uc002czo.3	-	12	2963	c.2415C>T	c.(2413-2415)AAC>AAT	p.N805N	GRIN2A_uc010uym.1_Silent_p.N805N|GRIN2A_uc010uyn.1_Silent_p.N648N|GRIN2A_uc002czr.3_Silent_p.N805N	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	805	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
OTOA	146183	broad.mit.edu	37	16	21726384	21726384	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21726384C>T	uc002djh.2	+	13	1400	c.1399C>T	c.(1399-1401)CGC>TGC	p.R467C	uc002diq.3_Intron|OTOA_uc010vbj.1_Missense_Mutation_p.R388C|OTOA_uc002dji.2_Missense_Mutation_p.R143C|OTOA_uc010vbk.1_Missense_Mutation_p.R115C	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1	481					sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)														---	---	---	---
SPNS1	83985	broad.mit.edu	37	16	28993708	28993708	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28993708G>A	uc010vdi.1	+	9	1137	c.997G>A	c.(997-999)GGA>AGA	p.G333R	uc010vct.1_Intron|SPNS1_uc002drx.2_Missense_Mutation_p.G260R|SPNS1_uc002dsa.2_Missense_Mutation_p.G333R|SPNS1_uc002drz.2_Missense_Mutation_p.G281R|SPNS1_uc010byp.2_Missense_Mutation_p.G259R|SPNS1_uc010byq.1_Missense_Mutation_p.G265R|LAT_uc010vdj.1_5'Flank|LAT_uc002dsb.2_5'Flank|LAT_uc002dsd.2_5'Flank|LAT_uc002dsc.2_5'Flank|LAT_uc010vdk.1_5'Flank|LAT_uc010vdl.1_5'Flank	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 isoform 1	333	Helical; (Potential).				lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding				0																		---	---	---	---
BCKDK	10295	broad.mit.edu	37	16	31122413	31122413	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31122413C>T	uc002eaw.3	+	9	1034	c.718C>T	c.(718-720)CGC>TGC	p.R240C	BCKDK_uc002eav.3_Missense_Mutation_p.R240C|BCKDK_uc010cah.2_RNA|BCKDK_uc010cai.2_Missense_Mutation_p.R240C	NM_005881	NP_005872	O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	240	Histidine kinase.				branched chain family amino acid catabolic process|peptidyl-histidine phosphorylation	mitochondrial alpha-ketoglutarate dehydrogenase complex	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity|ATP binding|protein binding|protein serine/threonine kinase activity|two-component sensor activity			stomach(1)|breast(1)	2																		---	---	---	---
GPT2	84706	broad.mit.edu	37	16	46934666	46934666	+	Silent	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46934666C>A	uc002eel.2	+	4	500	c.406C>A	c.(406-408)CGG>AGG	p.R136R	GPT2_uc002eem.2_Silent_p.R36R	NM_133443	NP_597700	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase 2 isoform 1	136					2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)													---	---	---	---
SHBG	6462	broad.mit.edu	37	17	7529937	7529937	+	Intron	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7529937G>T	uc010cmt.2	+						SHBG_uc010cmo.2_Intron|SHBG_uc010cmp.2_Intron|SHBG_uc010cmq.2_Intron|SHBG_uc010cmr.2_Intron|SHBG_uc010cms.2_Intron|SHBG_uc010cmu.2_Intron|SAT2_uc002gib.1_Intron|SAT2_uc002gic.2_Intron|SHBG_uc010cmz.2_5'Flank|SHBG_uc010cmv.2_5'Flank|SHBG_uc010cmw.2_5'Flank|SHBG_uc010cmx.2_5'Flank|SHBG_uc010cmy.2_5'Flank|SHBG_uc002gid.3_5'Flank	NM_001040	NP_001031			sex hormone-binding globulin isoform 1						hormone transport	extracellular region	androgen binding|protein homodimerization activity	p.?(1)			0		all_cancers(10;0.0867)		READ - Rectum adenocarcinoma(115;0.168)	Danazol(DB01406)|Dromostanolone(DB00858)|Estradiol(DB00783)|Estrone(DB00655)|Fluoxymesterone(DB01185)|Hydrocortisone(DB00741)|Mitotane(DB00648)|Norethindrone(DB00717)|Testosterone(DB00624)													---	---	---	---
MFAP4	4239	broad.mit.edu	37	17	19288417	19288417	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19288417C>A	uc002gvt.2	-	5	540	c.515G>T	c.(514-516)GGG>GTG	p.G172V	MFAP4_uc002gvr.2_RNA|MFAP4_uc002gvs.2_Missense_Mutation_p.G196V	NM_002404	NP_002395	P55083	MFAP4_HUMAN	microfibrillar-associated protein 4 precursor	172	Fibrinogen C-terminal.				cell adhesion|signal transduction	microfibril	receptor binding				0	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)																	---	---	---	---
KRT37	8688	broad.mit.edu	37	17	39580071	39580071	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39580071G>A	uc002hwp.1	-	2	565	c.518C>T	c.(517-519)GCC>GTC	p.A173V	uc002hwo.1_RNA	NM_003770	NP_003761	O76014	KRT37_HUMAN	keratin 37	173	Rod.|Coil 1B.					intermediate filament	structural molecule activity			skin(1)	1		Breast(137;0.000496)																---	---	---	---
KRT15	3866	broad.mit.edu	37	17	39672455	39672455	+	Silent	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39672455C>A	uc002hwy.2	-	4	992	c.801G>T	c.(799-801)CCG>CCT	p.P267P	KRT15_uc002hwz.2_Silent_p.P169P|KRT15_uc002hxa.2_Silent_p.P102P|KRT15_uc002hxb.1_Silent_p.P102P	NM_002275	NP_002266	P19012	K1C15_HUMAN	keratin 15	267	Rod.|Linker 12.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000286)																---	---	---	---
ZNF519	162655	broad.mit.edu	37	18	14124359	14124359	+	Silent	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14124359G>T	uc002kst.1	-	2	273	c.120C>A	c.(118-120)CTC>CTA	p.L40L	ZNF519_uc002ksq.1_RNA|ZNF519_uc002ksr.1_Intron|ZNF519_uc010dlm.1_RNA	NM_145287	NP_660330	Q8TB69	ZN519_HUMAN	zinc finger protein 519	40	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
FBN3	84467	broad.mit.edu	37	19	8183870	8183870	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8183870C>A	uc002mjf.2	-	25	3269	c.3248G>T	c.(3247-3249)CGG>CTG	p.R1083L		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1083	EGF-like 14; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11																		---	---	---	---
ZNF30	90075	broad.mit.edu	37	19	35435170	35435170	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35435170G>T	uc010edp.1	+	5	1678	c.1300G>T	c.(1300-1302)GGC>TGC	p.G434C	ZNF30_uc002nxf.2_Missense_Mutation_p.G353C|ZNF30_uc010edq.1_Missense_Mutation_p.G435C|ZNF30_uc010edr.1_Missense_Mutation_p.G435C	NM_194325	NP_919306	P17039	ZNF30_HUMAN	zinc finger protein 30 isoform b	434	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)														---	---	---	---
NLRP5	126206	broad.mit.edu	37	19	56539525	56539525	+	Silent	SNP	C	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56539525C>T	uc002qmj.2	+	7	1926	c.1926C>T	c.(1924-1926)AGC>AGT	p.S642S	NLRP5_uc002qmi.2_Silent_p.S623S	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	642						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)														---	---	---	---
RPN2	6185	broad.mit.edu	37	20	35835851	35835851	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35835851G>T	uc002xgp.2	+	7	1170	c.866G>T	c.(865-867)CGG>CTG	p.R289L	RPN2_uc002xgo.3_Missense_Mutation_p.R289L|RPN2_uc010gfw.2_Missense_Mutation_p.R132L|RPN2_uc002xgq.2_Missense_Mutation_p.R257L	NM_002951	NP_002942	P04844	RPN2_HUMAN	ribophorin II isoform 1 precursor	289	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|nucleus|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(115;0.00878)																---	---	---	---
SLC32A1	140679	broad.mit.edu	37	20	37356405	37356405	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37356405C>A	uc002xjc.2	+	2	964	c.701C>A	c.(700-702)CCG>CAG	p.P234Q		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	234	Cytoplasmic (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)													---	---	---	---
ZNFX1	57169	broad.mit.edu	37	20	47865495	47865495	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47865495C>A	uc002xui.2	-	14	4313	c.4066G>T	c.(4066-4068)GGC>TGC	p.G1356C		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1356							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)															---	---	---	---
RSPH1	89765	broad.mit.edu	37	21	43913160	43913160	+	Silent	SNP	G	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43913160G>A	uc002zbg.2	-	2	189	c.84C>T	c.(82-84)GGC>GGT	p.G28G	SLC37A1_uc002zbh.1_5'Flank	NM_080860	NP_543136	Q8WYR4	RSPH1_HUMAN	testis-specific gene A2	28	MORN 1.				meiosis	cytosol|nucleus				ovary(1)	1																		---	---	---	---
KRTAP10-10	353333	broad.mit.edu	37	21	46057679	46057679	+	Silent	SNP	C	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46057679C>T	uc002zfq.2	+	1	407	c.345C>T	c.(343-345)TTC>TTT	p.F115F	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_181688	NP_859016	P60014	KR10A_HUMAN	keratin associated protein 10-10	115	15 X 5 AA repeats of C-C-X(3).					keratin filament					0																		---	---	---	---
ZNF74	7625	broad.mit.edu	37	22	20760923	20760923	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20760923G>T	uc010gsm.2	+	6	1812	c.1600G>T	c.(1600-1602)GGC>TGC	p.G534C	ZNF74_uc002zsg.2_Missense_Mutation_p.G463C|ZNF74_uc002zsh.2_Missense_Mutation_p.G534C|ZNF74_uc002zsi.2_Missense_Mutation_p.G463C|ZNF74_uc010gsn.2_Missense_Mutation_p.G463C	NM_003426	NP_003417	Q16587	ZNF74_HUMAN	zinc finger protein 74	534	C2H2-type 11.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)															---	---	---	---
NIPSNAP1	8508	broad.mit.edu	37	22	29957610	29957610	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29957610C>A	uc003afx.3	-	6	537	c.464G>T	c.(463-465)CGG>CTG	p.R155L	NIPSNAP1_uc011akp.1_Missense_Mutation_p.R135L	NM_003634	NP_003625	Q9BPW8	NIPS1_HUMAN	nipsnap homolog 1	155								p.?(1)		skin(1)	1																		---	---	---	---
IGSF1	3547	broad.mit.edu	37	X	130408698	130408698	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130408698C>A	uc004ewd.2	-	18	3864	c.3626G>T	c.(3625-3627)GGA>GTA	p.G1209V	IGSF1_uc004ewe.3_Missense_Mutation_p.G1203V|IGSF1_uc004ewf.2_Missense_Mutation_p.G1189V	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	1209	Extracellular (Potential).|Ig-like C2-type 12.				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
SLC9A6	10479	broad.mit.edu	37	X	135084305	135084305	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135084305G>T	uc004ezj.2	+	6	812	c.736G>T	c.(736-738)GTT>TTT	p.V246F	SLC9A6_uc004ezk.2_Missense_Mutation_p.V278F|SLC9A6_uc011mvx.1_Missense_Mutation_p.V226F	NM_006359	NP_006350	Q92581	SL9A6_HUMAN	solute carrier family 9 (sodium/hydrogen	246	Helical; (Potential).				regulation of pH	early endosome membrane|endoplasmic reticulum membrane|integral to membrane|microsome|plasma membrane|recycling endosome membrane	sodium:hydrogen antiporter activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
HAUS7	55559	broad.mit.edu	37	X	152722680	152722680	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4187-01A-01D-1126-08	TCGA-BR-4187-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152722680C>A	uc004fho.1	-	5	949	c.391G>T	c.(391-393)GCC>TCC	p.A131S	HAUS7_uc004fhl.2_RNA|HAUS7_uc004fhm.2_RNA|HAUS7_uc004fhn.1_Missense_Mutation_p.A131S|HAUS7_uc004fhp.1_RNA|HAUS7_uc011myq.1_RNA	NM_017518	NP_059988	Q99871	HAUS7_HUMAN	HAUS augmin-like complex subunit 7	131					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleolus|plasma membrane|spindle	thioesterase binding				0																		---	---	---	---
