Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
Unknown	0	broad.mit.edu	37	1	1186218	1186219	+	IGR	INS	-	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1186218_1186219insC								FAM132A (4116 upstream) : UBE2J2 (3075 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	1301702	1301713	+	IGR	DEL	GTGTGTAAATGG	-	-	rs140417427	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1301702_1301713delGTGTGTAAATGG								MXRA8 (4545 upstream) : AURKAIP1 (7397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	2776092	2776093	+	IGR	INS	-	G	G	rs146034990	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2776092_2776093insG								MMEL1 (211611 upstream) : ACTRT2 (161953 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	3837151	3837152	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3837151_3837152insT								LOC100133612 (3274 upstream) : LOC284661 (634959 downstream)																																			---	---	---	---
KCNAB2	8514	broad.mit.edu	37	1	6106164	6106164	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6106164delC	uc009vlv.1	+						KCNAB2_uc001alv.1_Intron|KCNAB2_uc001alw.1_Intron|KCNAB2_uc001alx.1_Intron|KCNAB2_uc001aly.1_5'UTR|KCNAB2_uc009vlw.1_5'UTR|KCNAB2_uc001alu.2_Intron	NM_003636	NP_003627			potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane|juxtaparanode region of axon	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity				0	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
ACOT7	11332	broad.mit.edu	37	1	6345829	6345838	+	Intron	DEL	TGCTTCAGGG	-	-	rs59054940		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6345829_6345838delTGCTTCAGGG	uc001ams.2	-						ACOT7_uc010nzq.1_Intron|ACOT7_uc001amt.2_Intron|ACOT7_uc001amu.2_Intron|ACOT7_uc001amv.2_Intron|ACOT7_uc001amq.2_Intron|ACOT7_uc001amr.2_Intron	NM_181864	NP_863654			acyl-CoA thioesterase 7 isoform hBACHb							mitochondrion|nucleus	carboxylesterase activity|fatty-acyl-CoA binding|palmitoyl-CoA hydrolase activity				0	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	6784516	6784516	+	IGR	DEL	T	-	-	rs34515137		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6784516delT								DNAJC11 (22550 upstream) : CAMTA1 (60868 downstream)																																			---	---	---	---
SLC2A7	155184	broad.mit.edu	37	1	9078906	9078907	+	Intron	INS	-	GT	GT	rs141131875	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9078906_9078907insGT	uc009vmo.1	-							NM_207420	NP_997303			intestinal facilitative glucose transporter 7							integral to membrane|plasma membrane	sugar transmembrane transporter activity				0	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)														---	---	---	---
PGD	5226	broad.mit.edu	37	1	10479232	10479232	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10479232delT	uc001arc.2	+						PGD_uc001ard.2_Intron|PGD_uc010oak.1_Intron|PGD_uc010oal.1_Intron	NM_002631	NP_002622			phosphogluconate dehydrogenase						pentose-phosphate shunt, oxidative branch	cytosol	NADP binding|phosphogluconate dehydrogenase (decarboxylating) activity|protein binding			ovary(1)	1	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)														---	---	---	---
MTOR	2475	broad.mit.edu	37	1	11306661	11306662	+	Intron	INS	-	G	G	rs146618543	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11306661_11306662insG	uc001asd.2	-							NM_004958	NP_004949			FK506 binding protein 12-rapamycin associated						cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29																		---	---	---	---
C1orf187	374946	broad.mit.edu	37	1	11762477	11762478	+	Intron	DEL	CA	-	-	rs151236280		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11762477_11762478delCA	uc001asr.1	+							NM_198545	NP_940947			chromosome 1 open reading frame 187 precursor						axon guidance|commissural neuron differentiation in spinal cord|dorsal spinal cord development|forebrain development|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular region					0	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.48e-06)|COAD - Colon adenocarcinoma(227;0.000283)|BRCA - Breast invasive adenocarcinoma(304;0.000316)|Kidney(185;0.000841)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|STAD - Stomach adenocarcinoma(313;0.00754)|READ - Rectum adenocarcinoma(331;0.0651)														---	---	---	---
PDPN	10630	broad.mit.edu	37	1	13910742	13910744	+	Intron	DEL	GGA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13910742_13910744delGGA	uc001avd.2	+						PDPN_uc001avc.2_Intron|PDPN_uc009vob.2_5'Flank|PDPN_uc009voc.2_5'Flank|PDPN_uc001ave.2_5'Flank|PDPN_uc001avf.2_5'Flank	NM_006474	NP_006465			lung type-I cell membrane-associated						cell morphogenesis|lymphangiogenesis|regulation of cell shape	filopodium membrane|integral to plasma membrane|lamellipodium membrane|microvillus membrane|ruffle membrane				ovary(2)	2	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)														---	---	---	---
KAZ	23254	broad.mit.edu	37	1	15002919	15002920	+	Intron	INS	-	CGT	CGT	rs139089206	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15002919_15002920insCGT	uc001avm.3	+						KAZ_uc009vog.1_Intron|KAZ_uc010obj.1_Intron	NM_201628	NP_963922			kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0																		---	---	---	---
KAZ	23254	broad.mit.edu	37	1	15017081	15017082	+	Intron	INS	-	AG	AG	rs144532100	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15017081_15017082insAG	uc001avm.3	+						KAZ_uc009vog.1_Intron|KAZ_uc010obj.1_Intron	NM_201628	NP_963922			kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0																		---	---	---	---
CLCNKB	1188	broad.mit.edu	37	1	16363393	16363412	+	Intron	DEL	TCAGTGCACCATGATCTCCA	-	-	rs71003234		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16363393_16363412delTCAGTGCACCATGATCTCCA	uc001axw.3	+						FAM131C_uc010obz.1_Intron	NM_000085	NP_000076			chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	16833209	16833210	+	IGR	INS	-	AAACTGTCA	AAACTGTCA	rs146119741	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16833209_16833210insAAACTGTCA								CROCCL2 (14013 upstream) : NBPF1 (57202 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	16858585	16858586	+	IGR	DEL	TC	-	-	rs113365884		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16858585_16858586delTC								CROCCL2 (39389 upstream) : NBPF1 (31826 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	16869617	16869617	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16869617delA								CROCCL2 (50421 upstream) : NBPF1 (20795 downstream)																																			---	---	---	---
NBPF1	55672	broad.mit.edu	37	1	16938209	16938212	+	Intron	DEL	ACTC	-	-	rs147138514		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16938209_16938212delACTC	uc009vos.1	-						NBPF1_uc001aza.3_Intron|NBPF1_uc001azb.1_Intron|NBPF1_uc001azc.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	16977615	16977617	+	IGR	DEL	TAA	-	-	rs113577623		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16977615_16977617delTAA								MST1P2 (701 upstream) : ESPNP (40096 downstream)																																			---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17200409	17200412	+	Intron	DEL	CTTC	-	-	rs144786506		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17200409_17200412delCTTC	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
IGSF21	84966	broad.mit.edu	37	1	18455622	18455622	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18455622delA	uc001bau.1	+							NM_032880	NP_116269			immunoglobin superfamily, member 21 precursor							extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)														---	---	---	---
EXTL1	2134	broad.mit.edu	37	1	26357179	26357179	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26357179delC	uc001blf.2	+							NM_004455	NP_004446			exostoses-like 1						skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
GPATCH3	63906	broad.mit.edu	37	1	27218357	27218357	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27218357delC	uc001bne.2	-						GPN2_uc001bnd.1_5'Flank|GPATCH3_uc009vsp.1_Intron	NM_022078	NP_071361			G patch domain containing 3							intracellular	nucleic acid binding				0		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	30268574	30268574	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30268574delA								PTPRU (615259 upstream) : MATN1 (915552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	31128790	31128791	+	IGR	INS	-	T	T	rs144223262	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128790_31128791insT								None (None upstream) : MATN1 (55335 downstream)																																			---	---	---	---
MATN1	4146	broad.mit.edu	37	1	31187311	31187311	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31187311delA	uc001brz.2	-						MATN1_uc001bsa.1_Intron	NM_002379	NP_002370			matrilin 1, cartilage matrix protein precursor						protein complex assembly	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			central_nervous_system(1)	1		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34239709	34239718	+	Intron	DEL	TGTGTGTGTG	-	-	rs71732038		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34239709_34239718delTGTGTGTGTG	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128			CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	34799326	34799326	+	IGR	DEL	A	-	-	rs146081801		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34799326delA								C1orf94 (114597 upstream) : MIR552 (335874 downstream)																																			---	---	---	---
DLGAP3	58512	broad.mit.edu	37	1	35372260	35372262	+	5'Flank	DEL	AAG	-	-	rs71990810		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35372260_35372262delAAG	uc001byc.2	-							NM_001080418	NP_001073887			discs, large (Drosophila) homolog-associated						cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	38109280	38109280	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38109280delC								RSPO1 (8789 upstream) : C1orf109 (37970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	39510197	39510199	+	IGR	DEL	AAA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39510197_39510199delAAA								NDUFS5 (9911 upstream) : MACF1 (36919 downstream)																																			---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39585091	39585096	+	Intron	DEL	TTGTTG	-	-	rs137864357		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39585091_39585096delTTGTTG	uc010ois.1	+						MACF1_uc001cda.1_5'Flank	NM_012090	NP_036222			microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
CTPS	1503	broad.mit.edu	37	1	41447704	41447704	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41447704delT	uc001cgk.3	+						CTPS_uc010ojo.1_Intron|CTPS_uc010ojp.1_Intron|CTPS_uc001cgl.3_5'Flank	NM_001905	NP_001896			CTP synthase						CTP biosynthetic process|glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|response to drug	cytosol	ATP binding|CTP synthase activity|protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)			L-Glutamine(DB00130)													---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	42019766	42019766	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42019766delC	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001cgy.2_Intron	NM_024503	NP_078779			human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
RIMKLA	284716	broad.mit.edu	37	1	42867121	42867121	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42867121delA	uc001chi.2	+							NM_173642	NP_775913			ribosomal modification protein rimK-like family						protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0																		---	---	---	---
IPP	3652	broad.mit.edu	37	1	46212701	46212701	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46212701delA	uc001cou.2	-						IPP_uc001cos.3_Intron	NM_005897	NP_005888			intracisternal A particle-promoted polypeptide							actin cytoskeleton|cytoplasm	actin binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	46909044	46909044	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46909044delT								FAAH (29524 upstream) : DMBX1 (63624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	46942226	46942226	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46942226delA								FAAH (62706 upstream) : DMBX1 (30442 downstream)																																			---	---	---	---
FAF1	11124	broad.mit.edu	37	1	51391135	51391135	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51391135delA	uc009vyx.1	-						FAF1_uc009vyw.1_Intron|FAF1_uc001cse.1_Intron	NM_007051	NP_008982			FAS-associated factor 1						apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)														---	---	---	---
ZCCHC11	23318	broad.mit.edu	37	1	52914757	52914758	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52914757_52914758delAC	uc001ctx.2	-						ZCCHC11_uc001cty.2_Intron|ZCCHC11_uc001ctz.2_Intron|ZCCHC11_uc009vze.1_Intron|ZCCHC11_uc009vzf.1_Intron|ZCCHC11_uc001cua.1_Intron	NM_015269	NP_056084			zinc finger, CCHC domain containing 11 isoform						miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	54443788	54443788	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54443788delA								LRRC42 (9949 upstream) : LDLRAD1 (30718 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	54959144	54959145	+	IGR	INS	-	A	A	rs71066931		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54959144_54959145insA								SSBP3 (87052 upstream) : ACOT11 (48785 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	56903194	56903195	+	IGR	INS	-	C	C	rs148705946	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56903194_56903195insC								None (None upstream) : PPAP2B (57238 downstream)																																			---	---	---	---
PPAP2B	8613	broad.mit.edu	37	1	57035890	57035890	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57035890delG	uc001cyj.1	-							NM_177414	NP_803133			phosphatidic acid phosphatase type 2B						canonical Wnt receptor signaling pathway involved in positive regulation of cell-cell adhesion|canonical Wnt receptor signaling pathway involved in positive regulation of endothelial cell migration|canonical Wnt receptor signaling pathway involved in positive regulation of wound healing|germ cell migration|homotypic cell-cell adhesion|negative regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|sphingolipid metabolic process	adherens junction|Golgi apparatus|integral to membrane	phosphatidate phosphatase activity|phosphoprotein phosphatase activity|protein binding|sphingosine-1-phosphate phosphatase activity				0																		---	---	---	---
FGGY	55277	broad.mit.edu	37	1	59963586	59963587	+	Intron	INS	-	T	T	rs145853106	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59963586_59963587insT	uc001czi.3	+						FGGY_uc001czg.2_Intron|FGGY_uc001czh.2_Intron|FGGY_uc009wac.2_Intron|FGGY_uc001czj.3_Intron|FGGY_uc001czk.3_Intron|FGGY_uc001czl.3_Intron	NM_018291	NP_060761			FGGY carbohydrate kinase domain containing						carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)																	---	---	---	---
INADL	10207	broad.mit.edu	37	1	62492157	62492160	+	Intron	DEL	TGTC	-	-	rs10561151		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62492157_62492160delTGTC	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352			InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	63644727	63644728	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63644727_63644728insA	uc001daw.1	-											Homo sapiens cDNA clone IMAGE:4838722.																														---	---	---	---
CACHD1	57685	broad.mit.edu	37	1	65106575	65106576	+	Intron	INS	-	T	T	rs143320589	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65106575_65106576insT	uc001dbo.1	+						CACHD1_uc001dbp.1_Intron|CACHD1_uc001dbq.1_Intron	NM_020925	NP_065976			cache domain containing 1						calcium ion transport	integral to membrane				ovary(2)	2																		---	---	---	---
DNAJC6	9829	broad.mit.edu	37	1	65800792	65800794	+	Intron	DEL	TTT	-	-	rs72333405		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65800792_65800794delTTT	uc001dcd.1	+						DNAJC6_uc001dcc.1_Intron|DNAJC6_uc010opc.1_Intron|DNAJC6_uc001dce.1_Intron	NM_014787	NP_055602			DnaJ (Hsp40) homolog, subfamily C, member 6						cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3																		---	---	---	---
LEPR	3953	broad.mit.edu	37	1	65984678	65984679	+	Intron	INS	-	TTCT	TTCT	rs145341691	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65984678_65984679insTTCT	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron	NM_002303	NP_002294			leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)														---	---	---	---
IL12RB2	3595	broad.mit.edu	37	1	67837759	67837760	+	Intron	INS	-	TGTGTC	TGTGTC	rs10674845		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67837759_67837760insTGTGTC	uc001ddu.2	+						IL12RB2_uc010oqi.1_Intron|IL12RB2_uc010oqj.1_Intron|IL12RB2_uc010oqk.1_Intron|IL12RB2_uc010oql.1_Intron|IL12RB2_uc010oqm.1_Intron|IL12RB2_uc010oqn.1_Intron	NM_001559	NP_001550			interleukin 12 receptor, beta 2 precursor						positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
GNG12	55970	broad.mit.edu	37	1	68235500	68235505	+	Intron	DEL	CACACT	-	-	rs113880063		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68235500_68235505delCACACT	uc001dea.1	-							NM_018841	NP_061329			G-protein gamma-12 subunit precursor						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	71134793	71134793	+	IGR	DEL	G	-	-	rs76916909		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71134793delG								CTH (229541 upstream) : PTGER3 (183243 downstream)																																			---	---	---	---
NEGR1	257194	broad.mit.edu	37	1	72318573	72318588	+	Intron	DEL	AAAGAATGGTAAAACT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72318573_72318588delAAAGAATGGTAAAACT	uc001dfw.2	-						NEGR1_uc001dfv.2_Intron|NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169			neuronal growth regulator 1 precursor						cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)														---	---	---	---
NEGR1	257194	broad.mit.edu	37	1	72325328	72325328	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72325328delG	uc001dfw.2	-						NEGR1_uc001dfv.2_Intron|NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169			neuronal growth regulator 1 precursor						cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)														---	---	---	---
SLC44A5	204962	broad.mit.edu	37	1	76064323	76064323	+	Intron	DEL	G	-	-	rs148069968		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76064323delG	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910			solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4																		---	---	---	---
ACADM	34	broad.mit.edu	37	1	76222109	76222110	+	Intron	INS	-	ACAT	ACAT	rs143854056		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76222109_76222110insACAT	uc001dgw.3	+						ACADM_uc010ord.1_Intron|ACADM_uc009wbp.2_Intron|ACADM_uc009wbr.2_Intron|ACADM_uc010ore.1_Intron|ACADM_uc010orf.1_Intron|ACADM_uc001dgx.3_Intron|ACADM_uc010org.1_Intron|ACADM_uc009wbs.1_Intron	NM_000016	NP_000007			medium-chain acyl-CoA dehydrogenase isoform a						carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity			breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	77224971	77224972	+	IGR	INS	-	T	T	rs138308280	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77224971_77224972insT								ST6GALNAC3 (128302 upstream) : ST6GALNAC5 (108214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	81429349	81429349	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81429349delA								None (None upstream) : LPHN2 (342496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	82685383	82685383	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82685383delT								LPHN2 (227277 upstream) : None (None downstream)																																			---	---	---	---
UOX	391051	broad.mit.edu	37	1	84852089	84852089	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84852089delA	uc009wcg.2	-							NR_003927				Homo sapiens urate oxidase (pseudogene) (UOX), non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	87776368	87776369	+	IGR	INS	-	GT	GT	rs139694055	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87776368_87776369insGT								LOC339524 (141484 upstream) : LMO4 (17782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	89789802	89789803	+	IGR	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89789802_89789803delGT								GBP5 (51258 upstream) : GBP6 (39633 downstream)																																			---	---	---	---
HFM1	164045	broad.mit.edu	37	1	91740542	91740543	+	Intron	INS	-	T	T	rs11369914		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91740542_91740543insT	uc001doa.3	-						HFM1_uc009wdb.2_Intron|HFM1_uc010osu.1_Intron|HFM1_uc001dob.3_Intron|HFM1_uc010osv.1_Intron	NM_001017975	NP_001017975			HFM1 protein								ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)														---	---	---	---
EVI5	7813	broad.mit.edu	37	1	93072480	93072481	+	Intron	DEL	CC	-	-	rs113229523	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93072480_93072481delCC	uc001dox.2	-						EVI5_uc010otf.1_Intron|EVI5_uc001doy.1_Intron	NM_005665	NP_005656			ecotropic viral integration site 5						cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)														---	---	---	---
DNTTIP2	30836	broad.mit.edu	37	1	94347048	94347048	+	5'Flank	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94347048delA	uc001dqf.2	-						DNTTIP2_uc010otm.1_5'Flank|DNTTIP2_uc009wdo.1_5'Flank	NM_014597	NP_055412			deoxynucleotidyltransferase, terminal,						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	95876171	95876171	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95876171delT								RWDD3 (163398 upstream) : None (None downstream)																																			---	---	---	---
DPYD	1806	broad.mit.edu	37	1	98302127	98302128	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98302127_98302128insA	uc001drv.2	-						DPYD_uc010oub.1_Intron|DPYD_uc001drw.2_Intron	NM_000110	NP_000101			dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	102611438	102611439	+	IGR	DEL	TT	-	-	rs140270205		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102611438_102611439delTT								OLFM3 (148648 upstream) : COL11A1 (730585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	104585658	104585659	+	IGR	INS	-	T	T	rs148905776		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104585658_104585659insT								AMY1A (378486 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	106301692	106301693	+	IGR	INS	-	A	A	rs141286732	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:106301692_106301693insA								None (None upstream) : None (None downstream)																																			---	---	---	---
STXBP3	6814	broad.mit.edu	37	1	109336516	109336517	+	Intron	DEL	AG	-	-	rs3830380		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109336516_109336517delAG	uc001dvy.2	+						STXBP3_uc001dvz.2_Intron	NM_007269	NP_009200			syntaxin binding protein 3						negative regulation of calcium ion-dependent exocytosis|neutrophil degranulation|platelet aggregation|protein transport|vesicle docking involved in exocytosis	cytosol|nucleus|platelet alpha granule|specific granule|tertiary granule	syntaxin-2 binding			ovary(3)|central_nervous_system(1)	4		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	110240543	110240544	+	IGR	INS	-	CAACAA	CAACAA	rs111314017		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110240543_110240544insCAACAA								GSTM1 (4177 upstream) : GSTM5 (14320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	110820822	110820822	+	IGR	DEL	A	-	-	rs71745333		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110820822delA								KCNC4 (44157 upstream) : RBM15 (61123 downstream)																																			---	---	---	---
MAGI3	260425	broad.mit.edu	37	1	114190544	114190544	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114190544delT	uc001edk.2	+						MAGI3_uc001edh.3_Intron|MAGI3_uc001edi.3_Intron|MAGI3_uc010owm.1_Intron|MAGI3_uc001edj.2_Intron	NM_001142782	NP_001136254			membrane-associated guanylate kinase-related  3						apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
MAGI3	260425	broad.mit.edu	37	1	114196198	114196199	+	Intron	DEL	AA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114196198_114196199delAA	uc001edk.2	+						MAGI3_uc001edh.3_Intron|MAGI3_uc001edi.3_Intron|MAGI3_uc010owm.1_Intron|MAGI3_uc001edj.2_Intron	NM_001142782	NP_001136254			membrane-associated guanylate kinase-related  3						apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
BCAS2	10286	broad.mit.edu	37	1	115115961	115115961	+	Intron	DEL	T	-	-	rs113020369		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115115961delT	uc001efa.2	-						DENND2C_uc001eez.2_Intron	NM_005872	NP_005863			breast carcinoma amplified sequence 2						mRNA processing|RNA splicing, via transesterification reactions	nucleolus|spliceosomal complex	protein binding			large_intestine(1)	1	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	117837826	117837827	+	IGR	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117837826_117837827delAC								VTCN1 (84277 upstream) : MAN1A2 (72258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	118174414	118174415	+	IGR	INS	-	G	G	rs148821851	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118174414_118174415insG								FAM46C (3404 upstream) : GDAP2 (231693 downstream)																																			---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120612224	120612226	+	5'UTR	DEL	GCC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612224_120612226delGCC	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719			notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	1	121402149	121402149	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121402149delC								LOC647121 (88463 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142584666	142584667	+	IGR	INS	-	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142584666_142584667insC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142647217	142647217	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142647217delA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142964527	142964527	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142964527delT	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143954491	143954491	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143954491delT	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	144011657	144011658	+	Intron	INS	-	G	G	rs139895110		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144011657_144011658insG	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																														---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144830526	144830527	+	Intron	DEL	TG	-	-	rs3979969		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144830526_144830527delTG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145454708	145454709	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145454708_145454709insA	uc001emp.3	+							NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145635486	145635487	+	Intron	INS	-	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145635486_145635487insG	uc001emp.3	+						RNF115_uc001eoj.2_Intron|RNF115_uc001eok.2_Intron|RNF115_uc009wiy.2_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	148848925	148848925	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148848925delT								NBPF16 (90614 upstream) : LOC645166 (79361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149030113	149030113	+	IGR	DEL	C	-	-	rs113427363		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149030113delC								LOC645166 (77059 upstream) : LOC388692 (249363 downstream)																																			---	---	---	---
GABPB2	126626	broad.mit.edu	37	1	151063510	151063510	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151063510delA	uc001ewr.2	+						GABPB2_uc010pcp.1_Intron|GABPB2_uc001ews.2_Intron|GABPB2_uc001ewt.2_5'Flank	NM_144618	NP_653219			GA repeat binding protein, beta 2						positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	protein heterodimerization activity|transcription regulatory region DNA binding				0				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)														---	---	---	---
SLC39A1	27173	broad.mit.edu	37	1	153940145	153940145	+	5'UTR	DEL	A	-	-	rs67765759		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153940145delA	uc001fdl.2	-	1					CREB3L4_uc001fdn.3_5'Flank|CREB3L4_uc010pef.1_5'Flank|CREB3L4_uc001fdo.3_5'Flank|CREB3L4_uc001fdm.1_5'Flank|CREB3L4_uc001fdp.1_5'Flank|CREB3L4_uc010peg.1_5'Flank|CREB3L4_uc001fdr.2_5'Flank|CREB3L4_uc001fdq.2_5'Flank	NM_014437	NP_055252			solute carrier family 39 (zinc transporter),							endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	zinc ion transmembrane transporter activity				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)	Colorectal(1306;0.019)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	157127801	157127801	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157127801delG								ETV3 (19418 upstream) : FCRL5 (355367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	158160082	158160083	+	IGR	DEL	TA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158160082_158160083delTA								CD1D (3868 upstream) : CD1A (63844 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	160366355	160366355	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160366355delG								NHLH1 (23717 upstream) : VANGL2 (3876 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	160964363	160964364	+	IGR	INS	-	A	A	rs79018692		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160964363_160964364insA								ITLN2 (39774 upstream) : F11R (638 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	163382898	163382899	+	IGR	INS	-	AAACAAAC	AAACAAAC	rs137874601	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163382898_163382899insAAACAAAC								NUF2 (57345 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	164454679	164454680	+	IGR	DEL	AA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164454679_164454680delAA								None (None upstream) : PBX1 (74122 downstream)																																			---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164795150	164795150	+	Intron	DEL	A	-	-	rs34668642		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164795150delA	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
LMX1A	4009	broad.mit.edu	37	1	165309072	165309072	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165309072delC	uc001gcy.1	-						LMX1A_uc001gcz.1_Intron	NM_177398	NP_796372			LIM homeobox transcription factor 1, alpha							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5	all_hematologic(923;0.248)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	166803835	166803836	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166803835_166803836insA								FMO9P (209364 upstream) : POGK (4888 downstream)																																			---	---	---	---
TBX19	9095	broad.mit.edu	37	1	168262523	168262524	+	Intron	INS	-	TGTT	TGTT	rs140890330	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168262523_168262524insTGTT	uc001gfl.2	+						TBX19_uc001gfj.3_Intron	NM_005149	NP_005140			T-box 19						anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)																	---	---	---	---
DPT	1805	broad.mit.edu	37	1	168680158	168680158	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168680158delC	uc001gfp.2	-							NM_001937	NP_001928			dermatopontin precursor						cell adhesion	extracellular space|proteinaceous extracellular matrix				ovary(1)	1	all_hematologic(923;0.208)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	171402592	171402593	+	IGR	DEL	AA	-	-	rs35222002		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171402592_171402593delAA								FMO4 (91370 upstream) : BAT2L2 (52073 downstream)																																			---	---	---	---
DNM3	26052	broad.mit.edu	37	1	171859758	171859759	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171859758_171859759insT	uc001gie.2	+						DNM3_uc001gid.3_Intron|DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384			dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1																		---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174290291	174290291	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174290291delT	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjy.2_Intron|RABGAP1L_uc001gjz.2_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	175032917	175032918	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175032917_175032918insT								MRPS14 (40356 upstream) : TNN (4076 downstream)																																			---	---	---	---
TNN	63923	broad.mit.edu	37	1	175094803	175094806	+	Intron	DEL	CTCC	-	-	rs71725590		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175094803_175094806delCTCC	uc001gkl.1	+							NM_022093	NP_071376			tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)														---	---	---	---
RFWD2	64326	broad.mit.edu	37	1	175921019	175921019	+	Intron	DEL	T	-	-	rs35483759		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175921019delT	uc001gku.1	-						RFWD2_uc001gkv.1_Intron|RFWD2_uc001gkw.1_Intron|RFWD2_uc009wwv.2_Intron|RFWD2_uc001gkt.1_Intron	NM_022457	NP_071902			ring finger and WD repeat domain 2 isoform a						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
ASTN1	460	broad.mit.edu	37	1	177131584	177131584	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177131584delT	uc001glc.2	-						ASTN1_uc001glb.1_Intron|ASTN1_uc001gld.1_Intron|ASTN1_uc009wwx.1_Intron	NM_004319	NP_004310			astrotactin isoform 1						cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	177891441	177891441	+	IGR	DEL	C	-	-	rs77380353		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177891441delC								FAM5B (639884 upstream) : SEC16B (6048 downstream)																																			---	---	---	---
RALGPS2	55103	broad.mit.edu	37	1	178739154	178739154	+	Intron	DEL	T	-	-	rs35638965		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178739154delT	uc001glz.2	+						RALGPS2_uc001gly.1_Intron|RALGPS2_uc010pnb.1_Intron	NM_152663	NP_689876			Ral GEF with PH domain and SH3 binding motif 2						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity|protein binding				0																		---	---	---	---
C1orf125	126859	broad.mit.edu	37	1	179337107	179337107	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179337107delT	uc001gmo.2	+						C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmn.1_Intron|C1orf125_uc010pnl.1_Intron|C1orf125_uc001gmp.2_Intron	NM_144696	NP_653297			hypothetical protein LOC126859 isoform 1												0																		---	---	---	---
FAM163A	148753	broad.mit.edu	37	1	179745626	179745626	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179745626delA	uc009wxj.2	+						FAM163A_uc001gnj.2_Intron|FAM163A_uc009wxk.2_Intron	NM_173509	NP_775780			hypothetical protein LOC148753							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	181963129	181963130	+	IGR	INS	-	T	T	rs35911109		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181963129_181963130insT								CACNA1E (192416 upstream) : ZNF648 (60577 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	184069653	184069654	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184069653_184069654delTC								TSEN15 (26312 upstream) : C1orf21 (286496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	186603988	186603988	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186603988delT								PDC (173749 upstream) : PTGS2 (36957 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	187115842	187115845	+	IGR	DEL	TCCC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187115842_187115845delTCCC								PLA2G4A (157737 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	187192317	187192317	+	IGR	DEL	T	-	-	rs77053328		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187192317delT								PLA2G4A (234212 upstream) : None (None downstream)																																			---	---	---	---
FAM5C	339479	broad.mit.edu	37	1	190215226	190215227	+	Intron	INS	-	ATA	ATA	rs10671872		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190215226_190215227insATA	uc001gse.1	-						FAM5C_uc010pot.1_Intron	NM_199051	NP_950252			family with sequence similarity 5, member C							extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)																	---	---	---	---
RGS13	6003	broad.mit.edu	37	1	192602629	192602630	+	5'Flank	DEL	TT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192602629_192602630delTT	uc001gsj.2	+						RGS13_uc001gsk.2_5'Flank	NM_002927	NP_002918			regulator of G-protein signalling 13							plasma membrane	GTPase activator activity|signal transducer activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	195547303	195547303	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195547303delC								None (None upstream) : KCNT2 (647610 downstream)																																			---	---	---	---
KCNT2	343450	broad.mit.edu	37	1	196277290	196277290	+	Intron	DEL	T	-	-	rs148249853		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196277290delT	uc001gtd.1	-						KCNT2_uc009wyt.1_Intron|KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Intron|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Intron|KCNT2_uc001gth.1_Intron	NM_198503	NP_940905			potassium channel, subfamily T, member 2							voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	199942716	199942716	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199942716delA								None (None upstream) : NR5A2 (54054 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200223965	200223965	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200223965delT								FAM58B (40322 upstream) : ZNF281 (151461 downstream)																																			---	---	---	---
CAMSAP1L1	23271	broad.mit.edu	37	1	200775872	200775873	+	Intron	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200775872_200775873delTG	uc001gvl.2	+						CAMSAP1L1_uc001gvk.2_Intron|CAMSAP1L1_uc001gvm.2_Intron	NM_203459	NP_982284			calmodulin regulated spectrin-associated protein							cytoplasm|microtubule	protein binding			ovary(2)|large_intestine(1)|pancreas(1)	4																		---	---	---	---
IPO9	55705	broad.mit.edu	37	1	201825258	201825258	+	Intron	DEL	T	-	-	rs144073830		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201825258delT	uc001gwz.2	+							NM_018085	NP_060555			importin 9						protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2																		---	---	---	---
PPP1R12B	4660	broad.mit.edu	37	1	202373200	202373200	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202373200delT	uc001gya.1	+						PPP1R12B_uc001gxy.2_Intron|PPP1R12B_uc009xad.1_Intron|PPP1R12B_uc009xae.1_Intron|PPP1R12B_uc001gxz.1_Intron	NM_002481	NP_002472			protein phosphatase 1, regulatory (inhibitor)						regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(75;0.166)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	203948567	203948567	+	IGR	DEL	T	-	-	rs113337558		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203948567delT								SNRPE (108289 upstream) : C1orf157 (53008 downstream)																																			---	---	---	---
PIK3C2B	5287	broad.mit.edu	37	1	204443117	204443118	+	Intron	INS	-	TT	TT	rs66464850		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204443117_204443118insTT	uc001haw.2	-						PIK3C2B_uc010pqv.1_Intron|PIK3C2B_uc001hax.1_Intron|PIK3C2B_uc009xbd.1_Intron	NM_002646	NP_002637			phosphoinositide-3-kinase, class 2 beta						cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)															---	---	---	---
LRRN2	10446	broad.mit.edu	37	1	204640520	204640527	+	Intron	DEL	TGTTTGTG	-	-	rs67797420		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204640520_204640527delTGTTTGTG	uc001hbe.1	-						MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Intron|LRRN2_uc009xbf.1_Intron	NM_006338	NP_006329			leucine rich repeat neuronal 2 precursor						cell adhesion	integral to membrane	receptor activity			central_nervous_system(2)	2	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	205517529	205517530	+	IGR	DEL	CC	-	-	rs10597485		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205517529_205517530delCC								CDK18 (15614 upstream) : LOC284578 (5871 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	208140044	208140045	+	IGR	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208140044_208140045delTG								CD34 (55361 upstream) : PLXNA2 (55545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	208431058	208431059	+	IGR	INS	-	TC	TC	rs149202515	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208431058_208431059insTC								PLXNA2 (13393 upstream) : None (None downstream)																																			---	---	---	---
KCNH1	3756	broad.mit.edu	37	1	211058839	211058839	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211058839delT	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872			potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)														---	---	---	---
KCNH1	3756	broad.mit.edu	37	1	211281734	211281735	+	Intron	INS	-	TG	TG	rs146852654	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211281734_211281735insTG	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872			potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	211686438	211686453	+	IGR	DEL	GACACAGTAAATATAT	-	-	rs138366360		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211686438_211686453delGACACAGTAAATATAT								RD3 (20179 upstream) : SLC30A1 (61928 downstream)																																			---	---	---	---
LPGAT1	9926	broad.mit.edu	37	1	211994656	211994656	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211994656delA	uc001hiu.2	-						LPGAT1_uc001hiv.2_Intron	NM_014873	NP_055688			lysophosphatidylglycerol acyltransferase 1						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	212026014	212026014	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212026014delT								LPGAT1 (21900 upstream) : INTS7 (88684 downstream)																																			---	---	---	---
CENPF	1063	broad.mit.edu	37	1	214825512	214825512	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214825512delG	uc001hkm.2	+							NM_016343	NP_057427			centromere protein F						cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)														---	---	---	---
TGFB2	7042	broad.mit.edu	37	1	218589635	218589635	+	Intron	DEL	T	-	-	rs67420524		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218589635delT	uc001hlm.2	+						TGFB2_uc001hln.2_Intron|TGFB2_uc010pue.1_Intron|TGFB2_uc001hlo.2_Intron	NM_003238	NP_003229			transforming growth factor, beta 2 isoform 2						activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding				0				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	219451254	219451255	+	IGR	INS	-	AGA	AGA	rs143528681	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219451254_219451255insAGA								LYPLAL1 (65048 upstream) : SLC30A10 (407514 downstream)																																			---	---	---	---
IARS2	55699	broad.mit.edu	37	1	220281408	220281408	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220281408delT	uc001hmc.2	+							NM_018060	NP_060530			mitochondrial isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)													---	---	---	---
DEGS1	8560	broad.mit.edu	37	1	224379894	224379894	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224379894delT	uc001hoj.2	+						DEGS1_uc001hoi.2_Intron	NM_144780	NP_659004			degenerative spermatocyte homolog 1, lipid						sphingolipid metabolic process|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	electron carrier activity|protein binding|sphingolipid delta-4 desaturase activity				0	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)														---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225207688	225207689	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225207688_225207689insA	uc001how.2	+						DNAH14_uc001hou.3_Intron|DNAH14_uc001hot.3_Intron	NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
PARP1	142	broad.mit.edu	37	1	226566107	226566108	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226566107_226566108insA	uc001hqd.3	-							NM_001618	NP_001609			poly (ADP-ribose) polymerase family, member 1						cellular response to insulin stimulus|protein ADP-ribosylation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nuclear envelope|nucleolus|transcription factor complex	DNA binding|identical protein binding|NAD+ ADP-ribosyltransferase activity|protein N-terminus binding|transcription factor binding|zinc ion binding			lung(3)|ovary(2)|breast(2)|skin(2)|upper_aerodigestive_tract(1)	10	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)									Direct_reversal_of_damage|PARP_enzymes_that_bind_to_DNA					---	---	---	---
Unknown	0	broad.mit.edu	37	1	230167176	230167177	+	IGR	INS	-	T	T	rs112907494		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230167176_230167177insT								URB2 (371230 upstream) : GALNT2 (26359 downstream)																																			---	---	---	---
TSNAX-DISC1	100303453	broad.mit.edu	37	1	231707010	231707010	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231707010delT	uc010pwg.1	+						TSNAX-DISC1_uc010pwe.1_Intron|TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron	NM_001012959	NP_001012977			disrupted in schizophrenia 1 isoform S												0																		---	---	---	---
DISC1	27185	broad.mit.edu	37	1	231957461	231957462	+	Intron	DEL	TT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231957461_231957462delTT	uc001huz.2	+						TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pwv.1_Intron|DISC1_uc010pww.1_Intron|DISC1_uc010pwx.1_Intron|DISC1_uc010pwy.1_Intron|DISC1_uc010pwz.1_Intron|DISC1_uc010pxa.1_Intron|DISC1_uc001huy.2_Intron|DISC1_uc010pxb.1_Intron|DISC1_uc010pxc.1_Intron|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron	NM_018662	NP_061132			disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)																---	---	---	---
DISC1	27185	broad.mit.edu	37	1	232167048	232167050	+	Intron	DEL	AGG	-	-	rs71797331		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232167048_232167050delAGG	uc001huz.2	+						DISC1_uc001hva.2_Intron	NM_018662	NP_061132			disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	232504924	232504925	+	IGR	INS	-	TC	TC			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232504924_232504925insTC								DISC1 (327908 upstream) : SIPA1L2 (28789 downstream)																																			---	---	---	---
PCNXL2	80003	broad.mit.edu	37	1	233431748	233431748	+	5'Flank	DEL	C	-	-	rs1294350		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233431748delC	uc001hvl.2	-							NM_014801	NP_055616			pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	235000730	235000731	+	IGR	INS	-	AC	AC	rs142023916	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235000730_235000731insAC								IRF2BP2 (255459 upstream) : TOMM20 (271929 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	236264749	236264750	+	IGR	INS	-	GT	GT	rs146938366	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236264749_236264750insGT								NID1 (36268 upstream) : GPR137B (41082 downstream)																																			---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237588934	237588934	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237588934delA	uc001hyl.1	+							NM_001035	NP_001026			cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237678972	237678973	+	Intron	INS	-	TTCC	TTCC			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237678972_237678973insTTCC	uc001hyl.1	+							NM_001035	NP_001026			cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
GREM2	64388	broad.mit.edu	37	1	240751599	240751599	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240751599delT	uc001hys.2	-							NM_022469	NP_071914			gremlin 2 precursor						BMP signaling pathway	extracellular space	cytokine activity				0		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	242150394	242150395	+	IGR	INS	-	T	T	rs150526034		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242150394_242150395insT								EXO1 (97347 upstream) : MAP1LC3C (8397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	244438456	244438474	+	IGR	DEL	AGCAGACGGGGAGAGAGAT	-	-	rs146401137		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244438456_244438474delAGCAGACGGGGAGAGAGAT								ZNF238 (217680 upstream) : C1orf100 (77463 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	244496045	244496048	+	IGR	DEL	AGAA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244496045_244496048delAGAA								ZNF238 (275269 upstream) : C1orf100 (19889 downstream)																																			---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245538591	245538592	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245538591_245538592insT	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
SMYD3	64754	broad.mit.edu	37	1	246448266	246448266	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246448266delT	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580			SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	248780355	248780356	+	IGR	INS	-	CA	CA			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248780355_248780356insCA								OR2T10 (23286 upstream) : OR2T11 (9123 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	209644	209653	+	IGR	DEL	CTGCCCCTCC	-	-	rs67552186		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209644_209653delCTGCCCCTCC								FAM110C (163259 upstream) : SH3YL1 (8485 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	410021	410023	+	IGR	DEL	CAC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:410021_410023delCAC								FAM150B (121713 upstream) : TMEM18 (257952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	3500829	3500830	+	IGR	INS	-	C	C	rs143070130	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3500829_3500830insC								TTC15 (11972 upstream) : ADI1 (861 downstream)																																			---	---	---	---
ALLC	55821	broad.mit.edu	37	2	3712474	3712475	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3712474_3712475insA	uc010ewt.2	+							NM_018436	NP_060906			allantoicase isoform a								allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)											HNSCC(21;0.051)			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5202144	5202145	+	IGR	INS	-	TGTG	TGTG	rs143533883	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5202144_5202145insTGTG								None (None upstream) : SOX11 (630654 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	6548289	6548290	+	IGR	INS	-	TCTT	TCTT	rs143507186	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6548289_6548290insTCTT								LOC400940 (419925 upstream) : CMPK2 (432213 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7272723	7272723	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7272723delC								RNF144A (88416 upstream) : LOC339788 (789835 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	8737410	8737411	+	IGR	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8737410_8737411delGT								LOC339788 (620433 upstream) : ID2 (81929 downstream)																																			---	---	---	---
HPCAL1	3241	broad.mit.edu	37	2	10481582	10481584	+	Intron	DEL	CAA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10481582_10481584delCAA	uc002raj.2	+						HPCAL1_uc002rak.2_Intron|HPCAL1_uc002ral.2_Intron|HPCAL1_uc010exe.2_Intron	NM_002149	NP_002140			hippocalcin-like 1								calcium ion binding			pancreas(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)														---	---	---	---
NOL10	79954	broad.mit.edu	37	2	10780153	10780154	+	Intron	INS	-	A	A	rs151330710	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10780153_10780154insA	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron|NOL10_uc002rar.2_Intron	NM_024894	NP_079170			nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	12031634	12031635	+	IGR	INS	-	TCTT	TCTT	rs150487795	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12031634_12031635insTCTT								LPIN1 (64103 upstream) : TRIB2 (825363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	13820379	13820379	+	IGR	DEL	A	-	-	rs112367934		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13820379delA								TRIB2 (937523 upstream) : FAM84A (952477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	14416067	14416068	+	Intron	INS	-	TA	TA	rs147889466	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14416067_14416068insTA	uc002rby.2	-											Homo sapiens cDNA clone IMAGE:5263003.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	17044080	17044081	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17044080_17044081insT								FAM49A (196984 upstream) : RAD51AP2 (647905 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19505011	19505012	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19505011_19505012insT								NT5C1B (734173 upstream) : OSR1 (46235 downstream)																																			---	---	---	---
C2orf18	54978	broad.mit.edu	37	2	26993585	26993586	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26993585_26993586insA	uc002rhp.1	+						C2orf18_uc002rhq.1_Intron|C2orf18_uc010eyo.1_Intron|C2orf18_uc010ylc.1_Intron	NM_017877	NP_060347			ANT2-binding protein precursor							integral to membrane|lysosomal membrane					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	27637009	27637009	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27637009delA								PPM1G (4513 upstream) : NRBP1 (13648 downstream)																																			---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33618239	33618241	+	Intron	DEL	TTA	-	-	rs111874012		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33618239_33618241delTTA	uc002ros.2	+						LTBP1_uc002rot.2_Intron|LTBP1_uc002rou.2_Intron|LTBP1_uc002rov.2_Intron|LTBP1_uc010ymz.1_Intron|LTBP1_uc010yna.1_Intron|LTBP1_uc010ynb.1_Intron	NM_206943	NP_996826			latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	33792667	33792668	+	IGR	INS	-	TCTT	TCTT			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33792667_33792668insTCTT								RASGRP3 (2870 upstream) : FAM98A (16061 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	37870454	37870454	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37870454delC								QPCT (269990 upstream) : CDC42EP3 (289 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	37976146	37976146	+	IGR	DEL	T	-	-	rs67724115		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37976146delT								CDC42EP3 (76820 upstream) : FAM82A1 (176316 downstream)																																			---	---	---	---
C2orf58	285154	broad.mit.edu	37	2	38371858	38371860	+	Intron	DEL	ATA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38371858_38371860delATA	uc010faj.1	+							NR_027252				Homo sapiens chromosome 2 open reading frame 58, mRNA (cDNA clone IMAGE:5197672).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	41345761	41345762	+	IGR	DEL	AG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41345761_41345762delAG								SLC8A1 (606186 upstream) : PKDCC (929399 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	45075801	45075802	+	IGR	DEL	GA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45075801_45075802delGA								C2orf34 (76072 upstream) : SIX3 (93235 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	49133047	49133048	+	IGR	INS	-	GCGT	GCGT	rs146669843	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49133047_49133048insGCGT								LHCGR (150167 upstream) : FSHR (56605 downstream)																																			---	---	---	---
FSHR	2492	broad.mit.edu	37	2	49355817	49355818	+	Intron	INS	-	T	T	rs78783854		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49355817_49355818insT	uc002rww.2	-						FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Intron|FSHR_uc010fbo.1_Intron	NM_000145	NP_000136			follicle stimulating hormone receptor isoform 1						female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)									Gonadal_Dysgenesis_46_XX				---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	51051439	51051440	+	Intron	INS	-	GT	GT	rs150396889	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51051439_51051440insGT	uc010fbq.2	-						NRXN1_uc002rxe.3_Intron	NM_001135659	NP_001129131			neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	51512919	51512919	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51512919delT								NRXN1 (253245 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	52279934	52279935	+	IGR	DEL	TG	-	-	rs5831200		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52279934_52279935delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53379410	53379414	+	IGR	DEL	TTCAC	-	-	rs74271831		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53379410_53379414delTTCAC								None (None upstream) : ASB3 (517704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53678023	53678024	+	IGR	INS	-	A	A	rs148372873	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53678023_53678024insA								None (None upstream) : ASB3 (219094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53759686	53759687	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53759686_53759687insA								None (None upstream) : ASB3 (137431 downstream)																																			---	---	---	---
SPTBN1	6711	broad.mit.edu	37	2	54868433	54868434	+	Intron	DEL	CT	-	-	rs72413665		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54868433_54868434delCT	uc002rxu.2	+						SPTBN1_uc002rxx.2_Intron	NM_003128	NP_003119			spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	57699585	57699590	+	IGR	DEL	ACACAC	-	-	rs10171888		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57699585_57699590delACACAC								None (None upstream) : VRK2 (435196 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	60789460	60789460	+	IGR	DEL	T	-	-	rs71753477		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60789460delT								BCL11A (8827 upstream) : PAPOLG (193923 downstream)																																			---	---	---	---
USP34	9736	broad.mit.edu	37	2	61646323	61646324	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61646323_61646324insT	uc002sbe.2	-						SNORA70B_uc010fck.1_5'Flank	NM_014709	NP_055524			ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
XPO1	7514	broad.mit.edu	37	2	61734709	61734709	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61734709delA	uc002sbj.2	-						XPO1_uc010fcl.2_Intron|XPO1_uc010ypn.1_Intron|XPO1_uc002sbk.2_Intron	NM_003400	NP_003391			exportin 1						intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)															---	---	---	---
C2orf86	51057	broad.mit.edu	37	2	63545667	63545667	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63545667delT	uc002sch.2	-						C2orf86_uc002sce.2_Intron|C2orf86_uc002scf.2_Intron|C2orf86_uc010ypu.1_Intron|C2orf86_uc002scg.2_Intron	NM_015910	NP_056994			hypothetical protein LOC51057 isoform 2						cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0																		---	---	---	---
C2orf86	51057	broad.mit.edu	37	2	63768741	63768741	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63768741delA	uc002sch.2	-						C2orf86_uc002sci.1_Intron	NM_015910	NP_056994			hypothetical protein LOC51057 isoform 2						cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	65096612	65096612	+	IGR	DEL	T	-	-	rs33997072		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65096612delT								SERTAD2 (215566 upstream) : SLC1A4 (118967 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	66113753	66113754	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66113753_66113754delAC	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	69908972	69908972	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69908972delT								AAK1 (37995 upstream) : ANXA4 (60155 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	71498804	71498804	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71498804delA								PAIP2B (44571 upstream) : ZNF638 (4919 downstream)																																			---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71864308	71864308	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71864308delG	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485			dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
EXOC6B	23233	broad.mit.edu	37	2	72483194	72483194	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72483194delA	uc010fep.2	-							NM_015189	NP_056004			SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	74186410	74186411	+	IGR	INS	-	A	A	rs145784577	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74186410_74186411insA								DGUOK (324 upstream) : TET3 (87039 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	75162384	75162385	+	IGR	DEL	TC	-	-	rs34623576		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75162384_75162385delTC								HK2 (41910 upstream) : POLE4 (23390 downstream)																																			---	---	---	---
C2orf3	6936	broad.mit.edu	37	2	75898891	75898894	+	Intron	DEL	ATTT	-	-	rs34342745		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75898891_75898894delATTT	uc002sno.2	-						C2orf3_uc010ffs.2_Intron|C2orf3_uc002snn.2_Intron|C2orf3_uc010fft.2_Intron	NM_003203	NP_003194			hypothetical protein LOC6936						negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	76125571	76125572	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76125571_76125572insT								C2orf3 (187460 upstream) : LRRTM4 (849286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	78019879	78019880	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78019879_78019880insT								LRRTM4 (270377 upstream) : SNAR-H (162153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	78724152	78724152	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78724152delG	uc002snv.3	-											Homo sapiens cytochrome c, somatic pseudogene 6, mRNA (cDNA clone IMAGE:4815768).																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	78980427	78980427	+	IGR	DEL	A	-	-	rs150139479		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78980427delA								SNAR-H (798275 upstream) : REG3G (272399 downstream)																																			---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80598182	80598183	+	Intron	INS	-	A	A	rs140584372	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80598182_80598183insA	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	82056162	82056163	+	IGR	INS	-	AAGTC	AAGTC	rs145862363	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82056162_82056163insAAGTC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	82868482	82868482	+	IGR	DEL	A	-	-	rs113288582		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82868482delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	84642806	84642807	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84642806_84642807insT								FUNDC2P2 (123482 upstream) : SUCLG1 (7847 downstream)																																			---	---	---	---
C2orf89	129293	broad.mit.edu	37	2	85051511	85051511	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85051511delT	uc010ysl.1	-						C2orf89_uc002sou.3_Intron	NM_001080824	NP_001074293			hypothetical protein LOC129293 precursor							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	85326471	85326471	+	IGR	DEL	A	-	-	rs111316197		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85326471delA								KCMF1 (39877 upstream) : TCF7L1 (34263 downstream)																																			---	---	---	---
REEP1	65055	broad.mit.edu	37	2	86565416	86565418	+	5'Flank	DEL	CTT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86565416_86565418delCTT	uc002srh.3	-						REEP1_uc010ytg.1_5'Flank|REEP1_uc010yth.1_5'Flank|REEP1_uc010yti.1_5'Flank	NM_022912	NP_075063			receptor accessory protein 1 isoform 2						cell death|protein insertion into membrane	integral to membrane|mitochondrial membrane	olfactory receptor binding				0																		---	---	---	---
KDM3A	55818	broad.mit.edu	37	2	86683539	86683540	+	Intron	INS	-	T	T	rs76250602		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86683539_86683540insT	uc002sri.3	+						KDM3A_uc010ytj.1_Intron|KDM3A_uc010ytk.1_Intron	NM_018433	NP_060903			jumonji domain containing 1A						androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
VPS24	51652	broad.mit.edu	37	2	86824656	86824656	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86824656delA	uc010ytl.1	-							NM_001005753	NP_001005753			vacuolar protein sorting 24 isoform 2						cell cycle|cell division|cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding			central_nervous_system(1)	1																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87377432	87377433	+	Intron	INS	-	T	T	rs68166409		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87377432_87377433insT	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
EIF2AK3	9451	broad.mit.edu	37	2	88883418	88883421	+	Intron	DEL	CAAA	-	-	rs71960349		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88883418_88883421delCAAA	uc002stc.3	-							NM_004836	NP_004827			eukaryotic translation initiation factor 2-alpha						activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	91662908	91662909	+	IGR	DEL	AG	-	-	rs113421649		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91662908_91662909delAG								None (None upstream) : LOC654342 (142283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92037050	92037051	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92037050_92037051insA								GGT8P (66897 upstream) : FKSG73 (92108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	96617539	96617541	+	Intron	DEL	ATG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96617539_96617541delATG	uc010yug.1	-											Homo sapiens cDNA FLJ54441 complete cds, highly similar to Homo sapiens ankyrin repeat domain 36 (ANKRD36), mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	97411698	97411698	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97411698delT								LMAN2L (5885 upstream) : CNNM4 (14941 downstream)																																			---	---	---	---
NMS	129521	broad.mit.edu	37	2	101093507	101093507	+	Intron	DEL	G	-	-	rs149906112	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101093507delG	uc002tan.1	+							NM_001011717	NP_001011717			neuromedin S precursor						neuropeptide signaling pathway|regulation of smooth muscle contraction	extracellular region				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	102561903	102561903	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102561903delT								MAP4K4 (50752 upstream) : IL1R2 (46403 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105488532	105488533	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105488532_105488533delAC	uc002tcm.1	-											Homo sapiens cDNA FLJ38179 fis, clone FCBBF1000118.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	105863134	105863134	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105863134delT								GPR45 (3210 upstream) : TGFBRAP1 (20408 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	109496680	109496681	+	IGR	INS	-	A	A	rs11449330		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109496680_109496681insA								CCDC138 (3833 upstream) : EDAR (14250 downstream)																																			---	---	---	---
SH3RF3	344558	broad.mit.edu	37	2	109760265	109760266	+	Intron	INS	-	AC	AC	rs140601333	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109760265_109760266insAC	uc010ywt.1	+						hsa-mir-4265|MI0015869_5'Flank	NM_001099289	NP_001092759			SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1																		---	---	---	---
SEPT10	151011	broad.mit.edu	37	2	110321688	110321689	+	Intron	DEL	AG	-	-	rs3835082		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110321688_110321689delAG	uc002tew.2	-						SEPT10_uc010ywu.1_Intron|SEPT10_uc002tex.2_Intron|SEPT10_uc002tey.2_Intron|SEPT10_uc010ywv.1_Intron|SEPT10_uc002tev.1_Intron|SEPT10_uc010fjo.2_Intron	NM_144710	NP_653311			septin 10 isoform 1						cell cycle|cell division	septin complex	GTP binding				0																		---	---	---	---
MERTK	10461	broad.mit.edu	37	2	112689467	112689467	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112689467delA	uc002thk.1	+						MERTK_uc002thl.1_Intron	NM_006343	NP_006334			MER receptor tyrosine kinase precursor						cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9																		---	---	---	---
SLC20A1	6574	broad.mit.edu	37	2	113418276	113418277	+	Intron	INS	-	GT	GT	rs145113210	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113418276_113418277insGT	uc002tib.2	+							NM_005415	NP_005406			solute carrier family 20 (phosphate						phosphate metabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to plasma membrane	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	114814798	114814801	+	IGR	DEL	TCCT	-	-	rs149609245		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114814798_114814801delTCCT								ACTR3 (98631 upstream) : DPP10 (385098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	114929439	114929440	+	IGR	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114929439_114929440delGT								ACTR3 (213272 upstream) : DPP10 (270459 downstream)																																			---	---	---	---
DPP10	57628	broad.mit.edu	37	2	116199940	116199941	+	Intron	DEL	TG	-	-	rs67734425		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116199940_116199941delTG	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	116591065	116591065	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116591065delT	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	118372206	118372207	+	IGR	DEL	CG	-	-	rs72147744		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118372206_118372207delCG								None (None upstream) : DDX18 (200048 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	121078688	121078690	+	IGR	DEL	CCT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121078688_121078690delCCT								RALB (26405 upstream) : INHBB (25029 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	121123088	121123089	+	IGR	INS	-	T	T	rs149379643	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121123088_121123089insT								INHBB (13705 upstream) : LOC84931 (98822 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	122636587	122636588	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122636587_122636588insT								TSN (111161 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	122699576	122699576	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122699576delT								TSN (174150 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	124566327	124566328	+	IGR	INS	-	A	A	rs145591294	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124566327_124566328insA								None (None upstream) : CNTNAP5 (216536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	127906419	127906419	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127906419delG								BIN1 (41555 upstream) : CYP27C1 (34993 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	128163933	128163933	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128163933delA								MAP3K2 (63128 upstream) : PROC (12084 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	130121904	130121904	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130121904delA								None (None upstream) : LOC389033 (558531 downstream)																																			---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	138287064	138287064	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138287064delC	uc002tva.1	+						THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	139227459	139227459	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139227459delA	uc002tvg.2	-											full-length cDNA clone CS0DL004YM17 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
ZEB2	9839	broad.mit.edu	37	2	145277028	145277028	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145277028delC	uc002tvu.2	-						ZEB2_uc002tvv.2_Intron|ZEB2_uc010zbm.1_Intron|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_5'Flank|ZEB2_uc002tvw.2_Intron|ZEB2_uc002tvx.1_5'Flank|ZEB2_uc002tvy.2_5'Flank|ZEB2_uc002tvz.2_Intron|ZEB2_uc002twa.2_Intron	NM_014795	NP_055610			zinc finger homeobox 1b							cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	148389605	148389605	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148389605delT								None (None upstream) : ACVR2A (212481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	150842124	150842124	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150842124delT								MMADHC (397794 upstream) : RND3 (482588 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	156085161	156085161	+	IGR	DEL	T	-	-	rs74633625		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156085161delT								KCNJ3 (372147 upstream) : None (None downstream)																																			---	---	---	---
CCDC148	130940	broad.mit.edu	37	2	159164987	159164987	+	Intron	DEL	A	-	-	rs66565216		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159164987delA	uc002tzq.2	-						CCDC148_uc002tzr.2_Intron|CCDC148_uc010foh.2_Intron|CCDC148_uc010foi.1_Intron|CCDC148_uc010foj.1_Intron|CCDC148_uc010fok.1_Intron	NM_138803	NP_620158			coiled-coil domain containing 148											ovary(2)	2																		---	---	---	---
WDSUB1	151525	broad.mit.edu	37	2	160100547	160100548	+	Intron	INS	-	A	A	rs73004947	byFrequency;by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160100547_160100548insA	uc002uaj.3	-						WDSUB1_uc002uak.3_Intron|WDSUB1_uc002ual.3_Intron|WDSUB1_uc002uam.3_Intron|WDSUB1_uc010foo.2_Intron	NM_152528	NP_689741			WD repeat, sterile alpha motif and U-box domain							ubiquitin ligase complex	ubiquitin-protein ligase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	162946185	162946186	+	IGR	INS	-	TGCCACA	TGCCACA	rs138328313	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162946185_162946186insTGCCACA								DPP4 (15133 upstream) : GCG (53203 downstream)																																			---	---	---	---
CSRNP3	80034	broad.mit.edu	37	2	166522681	166522682	+	Intron	DEL	AA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166522681_166522682delAA	uc002udf.2	+						CSRNP3_uc002udg.2_Intron	NM_024969	NP_079245			cysteine-serine-rich nuclear protein 3						apoptosis|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|large_intestine(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	168405196	168405197	+	IGR	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168405196_168405197delGT								XIRP2 (288937 upstream) : B3GALT1 (269985 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	168792177	168792178	+	IGR	INS	-	A	A	rs145134781	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168792177_168792178insA								B3GALT1 (64811 upstream) : STK39 (18353 downstream)																																			---	---	---	---
NOSTRIN	115677	broad.mit.edu	37	2	169691001	169691006	+	Intron	DEL	GCGCGC	-	-	rs72171187		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169691001_169691006delGCGCGC	uc002ueg.2	+						NOSTRIN_uc002uef.2_Intron|NOSTRIN_uc002uei.2_Intron|NOSTRIN_uc010fpu.2_Intron|NOSTRIN_uc002ueh.2_Intron|NOSTRIN_uc002uej.2_Intron	NM_001039724	NP_001034813			nitric oxide synthase trafficker isoform 2						endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	169779062	169779062	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169779062delC								G6PC2 (12553 upstream) : ABCB11 (387 downstream)																																			---	---	---	---
ABCB11	8647	broad.mit.edu	37	2	169873514	169873515	+	Intron	INS	-	TATC	TATC			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169873514_169873515insTATC	uc002ueo.1	-							NM_003742	NP_003733			ATP-binding cassette, sub-family B (MDR/TAP),						bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	171617943	171617943	+	Intron	DEL	A	-	-	rs113215415		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171617943delA	uc002ugf.1	-											Homo sapiens cDNA FLJ13453 fis, clone PLACE1003205.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	173060895	173060896	+	IGR	DEL	CA	-	-	rs10569214		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173060895_173060896delCA								DLX2 (93417 upstream) : ITGA6 (231186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	175904980	175904980	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175904980delA								CHN1 (34810 upstream) : ATF2 (34028 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	182230035	182230035	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182230035delT	uc002uns.1	+											Homo sapiens cDNA FLJ43011 fis, clone BRTHA2015853.																														---	---	---	---
TFPI	7035	broad.mit.edu	37	2	188407063	188407064	+	Intron	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188407063_188407064delTG	uc002upy.2	-						TFPI_uc002upz.2_Intron|TFPI_uc002uqa.2_Intron|TFPI_uc002uqb.2_Intron	NM_006287	NP_006278			tissue factor pathway inhibitor isoform a						blood coagulation, extrinsic pathway	extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0554)		Coagulation factor VIIa(DB00036)													---	---	---	---
GULP1	51454	broad.mit.edu	37	2	189302506	189302506	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189302506delG	uc010fru.2	+						GULP1_uc002uqc.3_Intron|GULP1_uc002uqd.2_Intron|GULP1_uc010zfw.1_Intron|GULP1_uc002uqe.2_Intron|GULP1_uc002uqf.2_Intron|GULP1_uc002uqg.2_Intron	NM_016315	NP_057399			GULP, engulfment adaptor PTB domain containing						apoptosis|lipid transport|phagocytosis, engulfment	cytoplasm|intracellular membrane-bounded organelle	signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	194833100	194833100	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:194833100delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	196473046	196473046	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196473046delG								None (None upstream) : SLC39A10 (48486 downstream)																																			---	---	---	---
DNAH7	56171	broad.mit.edu	37	2	196904513	196904513	+	Intron	DEL	A	-	-	rs34592815		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196904513delA	uc002utj.3	-							NM_018897	NP_061720			dynein, axonemal, heavy chain 7						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12																		---	---	---	---
HECW2	57520	broad.mit.edu	37	2	197080876	197080876	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197080876delA	uc002utm.1	-						HECW2_uc002utl.1_Intron	NM_020760	NP_065811			HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	197485684	197485684	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197485684delA								HECW2 (28349 upstream) : CCDC150 (18672 downstream)																																			---	---	---	---
ANKRD44	91526	broad.mit.edu	37	2	197879509	197879509	+	Intron	DEL	A	-	-	rs80147148		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197879509delA	uc002uua.1	-						ANKRD44_uc002utz.3_Intron	NM_153697	NP_710181			ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	198208085	198208085	+	IGR	DEL	T	-	-	rs80118575		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198208085delT								ANKRD44 (32590 upstream) : SF3B1 (48615 downstream)																																			---	---	---	---
PLCL1	5334	broad.mit.edu	37	2	198743368	198743369	+	Intron	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198743368_198743369delTG	uc010fsp.2	+						PLCL1_uc002uuv.3_Intron	NM_001114661	NP_001108133			RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	199301448	199301448	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:199301448delA								PLCL1 (286842 upstream) : SATB2 (832776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	199630953	199630953	+	IGR	DEL	G	-	-	rs34108658		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:199630953delG								PLCL1 (616347 upstream) : SATB2 (503271 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	201619758	201619761	+	IGR	DEL	TGTG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201619758_201619761delTGTG								AOX1 (83543 upstream) : AOX2P (15634 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	208356807	208356808	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208356807_208356808insA								MIR1302-4 (222659 upstream) : CREB1 (37808 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	209880697	209880697	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209880697delT								PTH2R (175879 upstream) : MAP2 (408074 downstream)																																			---	---	---	---
UNC80	285175	broad.mit.edu	37	2	210635710	210635721	+	5'Flank	DEL	GAAGGAGGAGGG	-	-	rs146937164	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210635710_210635721delGAAGGAGGAGGG	uc010zjc.1	+						UNC80_uc002vdj.1_5'Flank	NM_032504	NP_115893			chromosome 2 open reading frame 21 isoform 1							integral to membrane					0																		---	---	---	---
ERBB4	2066	broad.mit.edu	37	2	212893442	212893442	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212893442delA	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron|ERBB4_uc010fut.1_Intron	NM_005235	NP_005226			v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)											TSP Lung(8;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	2	215451205	215451205	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215451205delA								VWC2L (10552 upstream) : BARD1 (142070 downstream)																																			---	---	---	---
SMARCAL1	50485	broad.mit.edu	37	2	217278886	217278886	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217278886delT	uc002vgc.3	+						SMARCAL1_uc010fvf.2_Intron|SMARCAL1_uc002vgd.3_Intron|SMARCAL1_uc010fvg.2_5'Flank	NM_014140	NP_054859			SWI/SNF-related matrix-associated						chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)										Schimke_Immuno-Osseous_Dysplasia				---	---	---	---
Unknown	0	broad.mit.edu	37	2	217778930	217778931	+	IGR	INS	-	CA	CA	rs888170		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217778930_217778931insCA								TNP1 (54148 upstream) : DIRC3 (369817 downstream)																																			---	---	---	---
USP37	57695	broad.mit.edu	37	2	219328963	219328963	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219328963delT	uc002vie.2	-						USP37_uc010fvs.1_Intron|USP37_uc010zkf.1_Intron|USP37_uc002vif.2_Intron|USP37_uc002vig.2_Intron	NM_020935	NP_065986			ubiquitin specific peptidase 37						ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)														---	---	---	---
WNT10A	80326	broad.mit.edu	37	2	219750938	219750939	+	Intron	DEL	CA	-	-	rs112761948		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219750938_219750939delCA	uc002vjd.1	+							NM_025216	NP_079492			wingless-type MMTV integration site family,						anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|female gonad development|hair follicle morphogenesis|odontogenesis|regulation of odontogenesis of dentine-containing tooth|sebaceous gland development|skin development|tongue development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			lung(1)|skin(1)	2		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	220066060	220066060	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220066060delC								FAM134A (15870 upstream) : ZFAND2B (5469 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	220206347	220206348	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220206347_220206348insT								RESP18 (8448 upstream) : DNPEP (26725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	221349245	221349246	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221349245_221349246insT								SLC4A3 (842544 upstream) : EPHA4 (933503 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	221592583	221592583	+	IGR	DEL	T	-	-	rs77051457		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221592583delT								None (None upstream) : EPHA4 (690166 downstream)																																			---	---	---	---
EPHA4	2043	broad.mit.edu	37	2	222382358	222382358	+	Intron	DEL	T	-	-	rs113966046		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222382358delT	uc002vmq.2	-						EPHA4_uc002vmr.2_Intron|EPHA4_uc010zlm.1_Intron|EPHA4_uc010zln.1_Intron	NM_004438	NP_004429			ephrin receptor EphA4 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)														---	---	---	---
PAX3	5077	broad.mit.edu	37	2	223092449	223092449	+	Intron	DEL	A	-	-	rs34964275		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223092449delA	uc010fwo.2	-						PAX3_uc002vmt.1_Intron|PAX3_uc002vmy.1_Intron|PAX3_uc002vmv.1_Intron|PAX3_uc002vmw.1_Intron|PAX3_uc002vmx.1_Intron	NM_181457	NP_852122			paired box 3 isoform PAX3						apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)				T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						---	---	---	---
Unknown	0	broad.mit.edu	37	2	224423972	224423972	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224423972delG								KCNE4 (503619 upstream) : SCG2 (37688 downstream)																																			---	---	---	---
DOCK10	55619	broad.mit.edu	37	2	225636555	225636556	+	Intron	INS	-	G	G	rs139341952	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225636555_225636556insG	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron	NM_014689	NP_055504			dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	226997987	226997988	+	IGR	INS	-	T	T	rs72537630	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226997987_226997988insT								KIAA1486 (402516 upstream) : IRS1 (598046 downstream)																																			---	---	---	---
COL4A4	1286	broad.mit.edu	37	2	227990246	227990246	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227990246delA	uc010zlt.1	-							NM_000092	NP_000083			alpha 4 type IV collagen precursor						axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	230174550	230174555	+	IGR	DEL	TGTGTG	-	-	rs67877745		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230174550_230174555delTGTGTG								PID1 (38493 upstream) : DNER (47791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	230597822	230597823	+	IGR	INS	-	ACACAT	ACACAT	rs150632363	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230597822_230597823insACACAT								DNER (18536 upstream) : TRIP12 (34107 downstream)																																			---	---	---	---
CAB39	51719	broad.mit.edu	37	2	231619020	231619021	+	Intron	INS	-	TTCTTCC	TTCTTCC	rs114678642	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231619020_231619021insTTCTTCC	uc002vqx.2	+						CAB39_uc010fxr.2_Intron|CAB39_uc010fxq.2_Intron	NM_016289	NP_057373			calcium binding protein 39						cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	kinase binding			central_nervous_system(1)	1		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	232451623	232451623	+	IGR	DEL	A	-	-	rs78129699		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232451623delA								NMUR1 (56441 upstream) : C2orf57 (5989 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	235506992	235506993	+	IGR	INS	-	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235506992_235506993insC								ARL4C (101299 upstream) : SH3BP4 (353635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	236077954	236077954	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236077954delA								SH3BP4 (113598 upstream) : AGAP1 (324782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	239416936	239416937	+	IGR	INS	-	T	T	rs35981451		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239416936_239416937insT								ASB1 (56046 upstream) : TWIST2 (339736 downstream)																																			---	---	---	---
SNED1	25992	broad.mit.edu	37	2	242021000	242021001	+	Intron	INS	-	TCAGG	TCAGG	rs140631844	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242021000_242021001insTCAGG	uc002wah.1	+						SNED1_uc002wai.1_Intron|SNED1_uc002waj.1_Intron	NM_001080437	NP_001073906			6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)														---	---	---	---
ANO7	50636	broad.mit.edu	37	2	242141254	242141255	+	Intron	INS	-	CTGA	CTGA	rs77494415		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242141254_242141255insCTGA	uc002wax.2	+							NM_001001891	NP_001001891			transmembrane protein 16G isoform NGEP long							cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	552377	552378	+	IGR	INS	-	CA	CA	rs144533765	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:552377_552378insCA								CHL1 (101282 upstream) : CNTN6 (582242 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	1698267	1698267	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1698267delC								CNTN6 (252990 upstream) : CNTN4 (442283 downstream)																																			---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	2719074	2719075	+	Intron	INS	-	GAGATCTATGTATCTATACATAGATATAGAGA	GAGATCTATGTATCTATACATAGATATAGAGA	rs146264276	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2719074_2719075insGAGATCTATGTATCTATACATAGATATAGAGA	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron|CNTN4_uc003bpd.1_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	2842866	2842866	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2842866delC	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron|CNTN4_uc003bpd.1_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
IL5RA	3568	broad.mit.edu	37	3	3118006	3118007	+	Intron	DEL	TG	-	-	rs3217673		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3118006_3118007delTG	uc011ask.1	-						IL5RA_uc010hbq.2_Intron|IL5RA_uc010hbr.2_Intron|IL5RA_uc010hbs.2_Intron|IL5RA_uc011asl.1_Intron|IL5RA_uc010hbp.2_Intron	NM_000564	NP_000555			interleukin 5 receptor, alpha isoform 1						cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity			ovary(1)	1				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)														---	---	---	---
SUMF1	285362	broad.mit.edu	37	3	4464633	4464634	+	Intron	DEL	CT	-	-	rs143537670		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4464633_4464634delCT	uc003bpz.1	-						SUMF1_uc003bps.1_Intron|SUMF1_uc011ass.1_Intron|SUMF1_uc010hby.1_Intron|SUMF1_uc011ast.1_Intron	NM_182760	NP_877437			sulfatase modifying factor 1 isoform 1							endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity			upper_aerodigestive_tract(1)	1		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)														---	---	---	---
GRM7	2917	broad.mit.edu	37	3	7592101	7592104	+	Intron	DEL	CTCC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7592101_7592104delCTCC	uc003bqm.2	+						GRM7_uc011ata.1_Intron|GRM7_uc011atb.1_Intron|GRM7_uc010hcf.2_Intron|GRM7_uc011atc.1_Intron|GRM7_uc010hcg.2_Intron|GRM7_uc003bql.2_Intron|GRM7_uc003bqn.1_Intron|GRM7_uc010hch.1_Intron	NM_000844	NP_000835			glutamate receptor, metabotropic 7 isoform a						negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)													---	---	---	---
GRM7	2917	broad.mit.edu	37	3	7729689	7729689	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7729689delT	uc003bqm.2	+						GRM7_uc011ata.1_Intron|GRM7_uc011atb.1_Intron|GRM7_uc010hcf.2_Intron|GRM7_uc011atc.1_Intron|GRM7_uc010hcg.2_Intron|GRM7_uc003bql.2_Intron	NM_000844	NP_000835			glutamate receptor, metabotropic 7 isoform a						negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	8067930	8067937	+	IGR	DEL	TGTGTGTG	-	-	rs9848423		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8067930_8067937delTGTGTGTG								GRM7 (284712 upstream) : LMCD1 (475574 downstream)																																			---	---	---	---
ANKRD28	23243	broad.mit.edu	37	3	15827760	15827760	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15827760delA	uc003caj.1	-						ANKRD28_uc011avz.1_Intron|ANKRD28_uc003cak.1_Intron|ANKRD28_uc011awa.1_Intron|ANKRD28_uc003cal.1_Intron|ANKRD28_uc003cam.2_Intron	NM_015199	NP_056014			ankyrin repeat domain 28							nucleoplasm	protein binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	18917852	18917853	+	IGR	DEL	TG	-	-	rs149824003		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18917852_18917853delTG								SATB1 (437600 upstream) : KCNH8 (272164 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	20752225	20752226	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20752225_20752226insT								SGOL1 (524542 upstream) : VENTXP7 (694992 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	25866832	25866832	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25866832delA								OXSM (30808 upstream) : LRRC3B (797468 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	28097895	28097895	+	IGR	DEL	T	-	-	rs34422967		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28097895delT								EOMES (333689 upstream) : CMC1 (185229 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	31466353	31466354	+	IGR	INS	-	GAGG	GAGG	rs141926427	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31466353_31466354insGAGG								GADL1 (530200 upstream) : STT3B (108137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	39569885	39569886	+	IGR	INS	-	AA	AA	rs141027734	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39569885_39569886insAA								MOBP (2030 upstream) : MYRIP (281417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	40659284	40659285	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40659284_40659285insT								ZNF621 (78241 upstream) : CTNNB1 (577116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	41130445	41130445	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41130445delA								ZNF621 (549402 upstream) : CTNNB1 (105956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	45111976	45111976	+	IGR	DEL	C	-	-	rs5848724		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45111976delC								CLEC3B (34414 upstream) : CDCP1 (11794 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	45402347	45402348	+	IGR	INS	-	TTGTTG	TTGTTG	rs140765373	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45402347_45402348insTTGTTG								TMEM158 (134533 upstream) : LARS2 (27727 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	53229642	53229643	+	IGR	INS	-	ATGA	ATGA	rs148106830	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53229642_53229643insATGA								PRKCD (2911 upstream) : TKT (29081 downstream)																																			---	---	---	---
DCP1A	55802	broad.mit.edu	37	3	53356841	53356841	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53356841delT	uc003dgs.3	-						DCP1A_uc003dgt.3_Intron	NM_018403	NP_060873			DCP1 decapping enzyme homolog A						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus	hydrolase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	54007470	54007471	+	IGR	INS	-	GATG	GATG	rs142885510	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54007470_54007471insGATG								SELK (81481 upstream) : CACNA2D3 (149222 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	55239488	55239489	+	IGR	INS	-	A	A	rs144878315	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55239488_55239489insA								CACNA2D3 (130906 upstream) : WNT5A (260255 downstream)																																			---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56441602	56441603	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56441602_56441603delAC	uc003dhr.1	-							NM_015576	NP_056391			cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
FHIT	2272	broad.mit.edu	37	3	60042357	60042357	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60042357delC	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
Unknown	0	broad.mit.edu	37	3	70134168	70134168	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70134168delG								MITF (116682 upstream) : FOXP1 (870569 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	73146406	73146407	+	IGR	DEL	AG	-	-	rs72104581		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73146406_73146407delAG								PPP4R2 (31395 upstream) : PDZRN3 (285245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	74075839	74075842	+	IGR	DEL	ACAC	-	-	rs138711642		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74075839_74075842delACAC								PDZRN3 (401767 upstream) : CNTN3 (235880 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75175640	75175641	+	IGR	INS	-	G	G	rs150030629	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75175640_75175641insG								CNTN3 (605297 upstream) : FAM86D (295064 downstream)																																			---	---	---	---
ZNF717	100131827	broad.mit.edu	37	3	75807638	75807641	+	Intron	DEL	TTAG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75807638_75807641delTTAG	uc011bgi.1	-						ZNF717_uc003dpw.3_Intron	NM_001128223	NP_001121695			zinc finger protein 717						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	80852554	80852554	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80852554delT								None (None upstream) : GBE1 (686296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	81905100	81905100	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81905100delA								GBE1 (94150 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	98994328	98994328	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98994328delT								DCBLD2 (373795 upstream) : COL8A1 (363126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	99105040	99105040	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99105040delA								DCBLD2 (484507 upstream) : COL8A1 (252414 downstream)																																			---	---	---	---
TOMM70A	9868	broad.mit.edu	37	3	100106487	100106488	+	Intron	INS	-	TT	TT	rs112940589		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100106487_100106488insTT	uc003dtw.2	-							NM_014820	NP_055635			translocase of outer mitochondrial membrane 70						protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane translocase complex	protein binding|protein transmembrane transporter activity			ovary(1)	1																		---	---	---	---
ABI3BP	25890	broad.mit.edu	37	3	100504892	100504893	+	Intron	INS	-	C	C	rs144568772	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100504892_100504893insC	uc003dun.2	-						ABI3BP_uc003duj.2_Intron|ABI3BP_uc003duk.2_Intron|ABI3BP_uc003dul.2_Intron|ABI3BP_uc011bhd.1_Intron|ABI3BP_uc003dum.2_Intron	NM_015429	NP_056244			ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	100789034	100789035	+	IGR	INS	-	GGGCTGAAT	GGGCTGAAT	rs149013660	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100789034_100789035insGGGCTGAAT								ABI3BP (76700 upstream) : IMPG2 (156253 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	104261521	104261522	+	IGR	DEL	AC	-	-	rs139420647		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104261521_104261522delAC								None (None upstream) : ALCAM (824191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	104819051	104819051	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104819051delT								None (None upstream) : ALCAM (266662 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	106391162	106391162	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106391162delA								CBLB (802896 upstream) : LOC100302640 (164498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	108966581	108966581	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108966581delA								C3orf66 (62474 upstream) : DPPA2 (46055 downstream)																																			---	---	---	---
C3orf52	79669	broad.mit.edu	37	3	111810555	111810557	+	Intron	DEL	AAG	-	-	rs72448416		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111810555_111810557delAAG	uc003dyq.3	+						C3orf52_uc011bhs.1_Intron|C3orf52_uc011bht.1_Intron	NM_024616	NP_078892			TPA-induced transmembrane protein							endoplasmic reticulum membrane|integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	112172675	112172676	+	IGR	INS	-	A	A	rs147556324	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112172675_112172676insA								CD200 (91019 upstream) : BTLA (10139 downstream)																																			---	---	---	---
ARHGAP31	57514	broad.mit.edu	37	3	119016757	119016758	+	Intron	DEL	AC	-	-	rs150235900		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119016757_119016758delAC	uc003ecj.3	+							NM_020754	NP_065805			Cdc42 GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2																		---	---	---	---
ARHGAP31	57514	broad.mit.edu	37	3	119136933	119136933	+	3'UTR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119136933delT	uc003ecj.3	+	12						NM_020754	NP_065805			Cdc42 GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2																		---	---	---	---
POLQ	10721	broad.mit.edu	37	3	121243785	121243788	+	Intron	DEL	ACAC	-	-	rs141928562		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121243785_121243788delACAC	uc003eee.3	-							NM_199420	NP_955452			DNA polymerase theta						DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)									DNA_polymerases_(catalytic_subunits)					---	---	---	---
SLC15A2	6565	broad.mit.edu	37	3	121639399	121639399	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121639399delT	uc003eep.2	+						SLC15A2_uc011bjn.1_Intron	NM_021082	NP_066568			peptide transporter 2 isoform a						protein transport	integral to plasma membrane	peptide:hydrogen symporter activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.0967)	Cefadroxil(DB01140)													---	---	---	---
KPNA1	3836	broad.mit.edu	37	3	122171411	122171411	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122171411delG	uc003efd.1	-						KPNA1_uc003efb.1_Intron|KPNA1_uc003efc.1_Intron|KPNA1_uc011bjr.1_Intron|KPNA1_uc010hrh.2_Intron|KPNA1_uc003efe.2_Intron	NM_002264	NP_002255			karyopherin alpha 1						DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|regulation of DNA recombination|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein binding|protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.0898)														---	---	---	---
SEMA5B	54437	broad.mit.edu	37	3	122673818	122673818	+	Intron	DEL	T	-	-	rs28569371		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122673818delT	uc003efz.1	-						SEMA5B_uc011bju.1_Intron|SEMA5B_uc003ega.1_Intron|SEMA5B_uc003egb.1_Intron|SEMA5B_uc010hro.1_Intron|SEMA5B_uc010hrp.1_Intron	NM_001031702	NP_001026872			semaphorin 5B isoform 1						cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)														---	---	---	---
ITGB5	3693	broad.mit.edu	37	3	124499557	124499557	+	Intron	DEL	C	-	-	rs111552815		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124499557delC	uc003eho.2	-						ITGB5_uc010hrx.2_Intron	NM_002213	NP_002204			integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	125993666	125993667	+	IGR	INS	-	T	T	rs79235618		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125993666_125993667insT								ALDH1L1 (94181 upstream) : KLF15 (67811 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	126262579	126262580	+	IGR	DEL	GA	-	-	rs144490553		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126262579_126262580delGA								CHST13 (446 upstream) : C3orf22 (5940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	131072506	131072506	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131072506delA	uc003eoc.1	-											Homo sapiens hypothetical LOC339874, mRNA (cDNA clone IMAGE:5271589).																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	133813052	133813053	+	IGR	INS	-	T	T	rs142297113	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133813052_133813053insT								SLCO2A1 (64132 upstream) : RYK (62925 downstream)																																			---	---	---	---
MSL2	55167	broad.mit.edu	37	3	135903295	135903296	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135903295_135903296insT	uc003eqx.1	-						MSL2_uc011bmb.1_Intron	NM_018133	NP_060603			ring finger protein 184 isoform 1						histone H4-K16 acetylation	MSL complex	zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	137101642	137101644	+	IGR	DEL	TTC	-	-	rs62945960		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137101642_137101644delTTC								IL20RB (371722 upstream) : SOX14 (381935 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	137876775	137876776	+	IGR	INS	-	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137876775_137876776insC								A4GNT (25546 upstream) : DBR1 (3077 downstream)																																			---	---	---	---
CEP70	80321	broad.mit.edu	37	3	138272852	138272852	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138272852delA	uc003esl.2	-						CEP70_uc011bmk.1_Intron|CEP70_uc011bml.1_Intron|CEP70_uc011bmm.1_Intron|CEP70_uc003esm.2_Intron|CEP70_uc003esn.2_Intron	NM_024491	NP_077817			centrosomal protein 70 kDa						G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding			skin(1)	1																		---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	143191849	143191849	+	Intron	DEL	T	-	-	rs35078461		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143191849delT	uc003evn.2	-							NM_173653	NP_775924			solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	143666209	143666209	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143666209delA								SLC9A9 (98863 upstream) : C3orf58 (24431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	144057203	144057203	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144057203delG								C3orf58 (345994 upstream) : None (None downstream)																																			---	---	---	---
PLSCR5	389158	broad.mit.edu	37	3	146301793	146301794	+	Intron	INS	-	T	T	rs149903075	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146301793_146301794insT	uc003ewb.2	-						PLSCR5_uc010hvb.2_Intron	NM_001085420	NP_001078889			phospholipid scramblase family, member 5												0																		---	---	---	---
SIAH2	6478	broad.mit.edu	37	3	150472657	150472657	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150472657delC	uc003eyi.2	-							NM_005067	NP_005058			seven in absentia homolog 2						apoptosis|axon guidance|cell cycle|negative regulation of canonical Wnt receptor signaling pathway|small GTPase mediated signal transduction|ubiquitin-dependent protein catabolic process	cytosol|nucleus	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)															---	---	---	---
CLRN1	7401	broad.mit.edu	37	3	150649835	150649835	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150649835delT	uc003eyk.1	-						CLRN1OS_uc011bny.1_Intron|CLRN1_uc003eyj.2_Intron|CLRN1_uc010hvj.1_Intron	NM_174878	NP_777367			clarin 1 isoform a						equilibrioception|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	153779709	153779710	+	Intron	DEL	AC	-	-	rs67597401		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153779709_153779710delAC	uc003ezu.1	-											Homo sapiens cDNA clone IMAGE:4823793.																														---	---	---	---
SCHIP1	29970	broad.mit.edu	37	3	159429186	159429187	+	Intron	DEL	AG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159429186_159429187delAG	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron	NM_014575	NP_055390			schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)															---	---	---	---
SCHIP1	29970	broad.mit.edu	37	3	159555512	159555512	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159555512delA	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron|SCHIP1_uc010hvz.1_Intron|SCHIP1_uc003fcu.1_5'Flank	NM_014575	NP_055390			schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	160794482	160794482	+	RNA	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160794482delA	uc003fdu.2	+	1		c.2042delA								Homo sapiens cDNA FLJ30761 fis, clone FEBRA2000538.																														---	---	---	---
NMD3	51068	broad.mit.edu	37	3	160967089	160967089	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160967089delA	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron|NMD3_uc010hwh.2_Intron	NM_015938	NP_057022			NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	162311529	162311529	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162311529delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	163373251	163373252	+	IGR	INS	-	A	A	rs139221247	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163373251_163373252insA								None (None upstream) : MIR1263 (516007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	169429091	169429091	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169429091delT								MECOM (47528 upstream) : TERC (53307 downstream)																																			---	---	---	---
CLDN11	5010	broad.mit.edu	37	3	170534229	170534229	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170534229delA	uc011bpt.1	+							NM_005602	NP_005593			claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)															---	---	---	---
SPATA16	83893	broad.mit.edu	37	3	172839165	172839165	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172839165delC	uc003fin.3	-							NM_031955	NP_114161			spermatogenesis associated 16						cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)															---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	175307223	175307223	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175307223delC	uc003fit.2	+						NAALADL2_uc010hwy.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	175808802	175808802	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175808802delC								NAALADL2 (285376 upstream) : TBL1XR1 (929741 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	178055494	178055495	+	Intron	DEL	TA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178055494_178055495delTA	uc003fja.1	-											Homo sapiens cDNA FLJ34436 fis, clone HLUNG2001013.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	178250675	178250676	+	Intron	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178250675_178250676delTC	uc003fjb.1	-											Homo sapiens clone N11 NTera2D1 teratocarcinoma mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	181600968	181600969	+	IGR	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181600968_181600969delAC								SOX2OT (141965 upstream) : ATP11B (910322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	181781257	181781257	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181781257delA								SOX2OT (322254 upstream) : ATP11B (730034 downstream)																																			---	---	---	---
ATP11B	23200	broad.mit.edu	37	3	182564086	182564087	+	Intron	INS	-	A	A	rs113773144		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182564086_182564087insA	uc003flb.2	+							NM_014616	NP_055431			ATPase, class VI, type 11B						aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)															---	---	---	---
MCCC1	56922	broad.mit.edu	37	3	182787633	182787634	+	Intron	INS	-	A	A	rs148865224	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182787633_182787634insA	uc003fle.2	-						MCCC1_uc010hxi.2_Intron|MCCC1_uc011bqo.1_Intron|MCCC1_uc003flf.2_Intron|MCCC1_uc003flg.2_Intron|MCCC1_uc011bqp.1_Intron|MCCC1_uc011bqq.1_Intron	NM_020166	NP_064551			methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)						biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)													---	---	---	---
MCCC1	56922	broad.mit.edu	37	3	182790914	182790916	+	Intron	DEL	AAC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182790914_182790916delAAC	uc003fle.2	-						MCCC1_uc010hxi.2_Intron|MCCC1_uc011bqo.1_Intron|MCCC1_uc003flf.2_Intron|MCCC1_uc003flg.2_Intron|MCCC1_uc011bqp.1_Intron|MCCC1_uc011bqq.1_Intron	NM_020166	NP_064551			methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)						biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)													---	---	---	---
ABCC5	10057	broad.mit.edu	37	3	183709094	183709095	+	Intron	INS	-	A	A	rs139038248	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183709094_183709095insA	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron|ABCC5_uc003fmh.2_Intron|ABCC5_uc010hxm.2_Intron|ABCC5_uc010hxn.2_Intron|ABCC5_uc010hxo.2_Intron	NM_005688	NP_005679			ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
ECE2	9718	broad.mit.edu	37	3	183994498	183994498	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183994498delG	uc003fni.3	+						ECE2_uc011brg.1_Intron|ECE2_uc011brh.1_Intron|ECE2_uc003fnl.3_Intron|ECE2_uc003fnm.3_Intron|ECE2_uc003fnk.3_Intron|ECE2_uc011bri.1_Intron|ECE2_uc010hxv.2_5'Flank	NM_014693	NP_055508			endothelin converting enzyme 2 isoform A						brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	186864326	186864327	+	IGR	DEL	GA	-	-	rs75171659	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186864326_186864327delGA								RPL39L (7063 upstream) : RTP1 (50947 downstream)																																			---	---	---	---
BCL6	604	broad.mit.edu	37	3	187458019	187458020	+	Intron	DEL	CA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187458019_187458020delCA	uc003frq.1	-							NM_001706	NP_001697			B-cell lymphoma 6 protein isoform 1						negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(1)	5	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)				T|Mis	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3	NHL|CLL						OREG0015977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
LPP	4026	broad.mit.edu	37	3	188002340	188002341	+	Intron	DEL	AG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188002340_188002341delAG	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
Unknown	0	broad.mit.edu	37	3	195920261	195920262	+	IGR	INS	-	TGTG	TGTG	rs141469241	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195920261_195920262insTGTG								TFRC (111229 upstream) : ZDHHC19 (4062 downstream)																																			---	---	---	---
SENP5	205564	broad.mit.edu	37	3	196606818	196606818	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196606818delT	uc003fwz.3	+						SENP5_uc011bty.1_Intron	NM_152699	NP_689912			SUMO1/sentrin specific peptidase 5						cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	1498679	1498680	+	IGR	INS	-	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1498679_1498680insG								CRIPAK (108897 upstream) : FAM53A (142929 downstream)																																			---	---	---	---
RNF4	6047	broad.mit.edu	37	4	2472303	2472303	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2472303delA	uc003gfb.2	+						RNF4_uc010ici.1_Intron|RNF4_uc010icj.2_Intron|RNF4_uc003gfc.2_Intron	NM_002938	NP_002929			ring finger protein 4						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|protein K63-linked ubiquitination|regulation of kinetochore assembly|regulation of spindle assembly|response to arsenic-containing substance	cytoplasm|PML body	androgen receptor binding|DNA binding|nucleosome binding|sequence-specific DNA binding transcription factor activity|SUMO polymer binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(65;0.241)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	2768578	2768579	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2768578_2768579insA								TNIP2 (10475 upstream) : SH3BP2 (26171 downstream)																																			---	---	---	---
HTT	3064	broad.mit.edu	37	4	3181316	3181317	+	Intron	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3181316_3181317delGT	uc011bvq.1	+							NM_002111	NP_002102			huntingtin						establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)														---	---	---	---
JAKMIP1	152789	broad.mit.edu	37	4	6069389	6069390	+	Intron	INS	-	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6069389_6069390insC	uc003giu.3	-						JAKMIP1_uc010idb.1_Intron|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Intron|JAKMIP1_uc010ide.2_Intron	NM_144720	NP_653321			janus kinase and microtubule interacting protein						protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	7077967	7077981	+	IGR	DEL	CTGTGCGCTGCCCCA	-	-	rs33916396	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7077967_7077981delCTGTGCGCTGCCCCA								GRPEL1 (8167 upstream) : FLJ36777 (21170 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	17359492	17359494	+	IGR	DEL	TTT	-	-	rs147311150		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17359492_17359494delTTT								LDB2 (459068 upstream) : QDPR (128526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	19731442	19731443	+	IGR	DEL	AG	-	-	rs34526816		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19731442_19731443delAG								None (None upstream) : SLIT2 (523792 downstream)																																			---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	20836309	20836310	+	Intron	INS	-	G	G	rs145205588	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20836309_20836310insG	uc003gqe.2	-						KCNIP4_uc003gqf.1_Intron|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqh.1_Intron|KCNIP4_uc003gqi.1_Intron|KCNIP4_uc010iel.2_Intron|KCNIP4_uc003gqd.3_Intron	NM_147182	NP_671711			Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	21310334	21310335	+	Intron	INS	-	GAGT	GAGT	rs150918892	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21310334_21310335insGAGT	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175			Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	21852766	21852767	+	Intron	INS	-	GC	GC	rs150374861	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21852766_21852767insGC	uc003gqi.1	-						NCRNA00099_uc003gqj.1_RNA	NM_147182	NP_671711			Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	33828804	33828805	+	IGR	DEL	TG	-	-	rs73804678	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33828804_33828805delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
PGM2	55276	broad.mit.edu	37	4	37839510	37839510	+	Intron	DEL	T	-	-	rs111996879		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37839510delT	uc011byb.1	+						PGM2_uc011bya.1_Intron|PGM2_uc011byc.1_Intron	NM_018290	NP_060760			phosphoglucomutase 2						glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity|phosphopentomutase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	38555033	38555034	+	IGR	DEL	AA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38555033_38555034delAA								TBC1D1 (414240 upstream) : FLJ13197 (59288 downstream)																																			---	---	---	---
FLJ13197	79667	broad.mit.edu	37	4	38649044	38649045	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38649044_38649045insT	uc003gte.1	-						FLJ13197_uc003gtf.2_Intron	NR_026804				Homo sapiens clone pp6414 unknown mRNA.												0																		---	---	---	---
WDR19	57728	broad.mit.edu	37	4	39216394	39216394	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39216394delT	uc003gtv.2	+						WDR19_uc010ifl.1_Intron|WDR19_uc003gtu.1_Intron|WDR19_uc011byi.1_Intron|WDR19_uc003gtw.1_5'Flank	NM_025132	NP_079408			WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	40732575	40732576	+	IGR	INS	-	AG	AG	rs146912327	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40732575_40732576insAG								RBM47 (99935 upstream) : NSUN7 (19338 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	44773374	44773375	+	IGR	INS	-	GA	GA	rs148242937	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44773374_44773375insGA								GNPDA2 (44762 upstream) : None (None downstream)																																			---	---	---	---
COX7B2	170712	broad.mit.edu	37	4	46780203	46780203	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46780203delA	uc003gxf.2	-						COX7B2_uc010ige.2_Intron	NM_130902	NP_570972			cytochrome c oxidase subunit VIIb2 precursor							integral to membrane|mitochondrial respiratory chain	cytochrome-c oxidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	48482003	48482003	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48482003delA								SLAIN2 (53790 upstream) : SLC10A4 (3357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49127200	49127200	+	IGR	DEL	A	-	-	rs149087470	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49127200delA								CWH43 (63107 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49133544	49133548	+	IGR	DEL	GGGTA	-	-	rs142760702		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49133544_49133548delGGGTA								CWH43 (69451 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49220742	49220743	+	IGR	DEL	AA	-	-	rs112450329		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49220742_49220743delAA								CWH43 (156649 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49642427	49642428	+	IGR	INS	-	G	G	rs141114608		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49642427_49642428insG								CWH43 (578334 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49644024	49644025	+	IGR	INS	-	ATGGA	ATGGA	rs138643557		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49644024_49644025insATGGA								CWH43 (579931 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	53164606	53164607	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53164606_53164607delTC								SPATA18 (201149 upstream) : USP46 (292522 downstream)																																			---	---	---	---
SCFD2	152579	broad.mit.edu	37	4	53890419	53890420	+	Intron	INS	-	TCT	TCT	rs5858202		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53890419_53890420insTCT	uc003gzu.2	-						SCFD2_uc010igm.2_Intron	NM_152540	NP_689753			sec1 family domain containing 2						protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	56161438	56161438	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56161438delT								KDR (169676 upstream) : SRD5A3 (50971 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	56961632	56961641	+	IGR	DEL	ATTCAGAAGG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56961632_56961641delATTCAGAAGG								CEP135 (62106 upstream) : KIAA1211 (74720 downstream)																																			---	---	---	---
LPHN3	23284	broad.mit.edu	37	4	62567900	62567900	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62567900delT	uc010ihh.2	+						LPHN3_uc003hcq.3_Intron|LPHN3_uc010ihg.1_Intron	NM_015236	NP_056051			latrophilin 3 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	63661016	63661017	+	IGR	INS	-	A	A	rs146055136	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63661016_63661017insA								LPHN3 (722849 upstream) : None (None downstream)																																			---	---	---	---
EPHA5	2044	broad.mit.edu	37	4	66499087	66499087	+	Intron	DEL	A	-	-	rs75839110		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66499087delA	uc003hcy.2	-						EPHA5_uc003hcx.2_Intron|EPHA5_uc003hcz.2_Intron|EPHA5_uc011cah.1_Intron|EPHA5_uc011cai.1_Intron|EPHA5_uc003hda.2_Intron	NM_004439	NP_004430			ephrin receptor EphA5 isoform a precursor						cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24															TSP Lung(17;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	68128401	68128402	+	IGR	DEL	CA	-	-	rs67330403		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68128401_68128402delCA								MIR1269 (985755 upstream) : CENPC1 (209587 downstream)																																			---	---	---	---
STAP1	26228	broad.mit.edu	37	4	68454059	68454060	+	Intron	INS	-	GAC	GAC	rs147434467	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68454059_68454060insGAC	uc003hde.3	+						STAP1_uc003hdf.2_Intron	NM_012108	NP_036240			signal transducing adaptor family member 1						cellular membrane fusion|intracellular protein transport	cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	73652746	73652746	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73652746delC								ADAMTS3 (218230 upstream) : COX18 (267670 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	73781382	73781382	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73781382delT								ADAMTS3 (346866 upstream) : COX18 (139034 downstream)																																			---	---	---	---
PPEF2	5470	broad.mit.edu	37	4	76807164	76807165	+	Intron	INS	-	G	G	rs34302831		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76807164_76807165insG	uc003hix.2	-						PPEF2_uc003hiy.2_Intron|PPEF2_uc003hiz.1_Intron	NM_006239	NP_006230			serine/threonine protein phosphatase with						detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	78057606	78057606	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78057606delA								CCNI (60481 upstream) : CCNG2 (20751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	78242807	78242808	+	IGR	INS	-	T	T	rs150861491	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78242807_78242808insT								CCNG2 (151597 upstream) : CXCL13 (190099 downstream)																																			---	---	---	---
FRAS1	80144	broad.mit.edu	37	4	79111603	79111603	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79111603delT	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron	NM_025074	NP_079350			Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	80250963	80250963	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80250963delA								NAA11 (3792 upstream) : GK2 (76545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	83176979	83176979	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83176979delT								RASGEF1B (783918 upstream) : HNRNPD (97488 downstream)																																			---	---	---	---
AFF1	4299	broad.mit.edu	37	4	87856954	87856958	+	Intron	DEL	ACTTA	-	-	rs147186961		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87856954_87856958delACTTA	uc011ccz.1	+						AFF1_uc011ccx.1_Intron|AFF1_uc003hqh.1_Intron|AFF1_uc011ccy.1_Intron|uc003hqf.1_5'Flank|uc003hqg.1_Intron|uc003hqi.1_5'Flank	NM_005935	NP_005926			myeloid/lymphoid or mixed-lineage leukemia							nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)														---	---	---	---
AFF1	4299	broad.mit.edu	37	4	87898342	87898342	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87898342delC	uc011ccz.1	+						AFF1_uc011ccx.1_Intron|AFF1_uc003hqh.1_Intron|AFF1_uc011ccy.1_Intron	NM_005935	NP_005926			myeloid/lymphoid or mixed-lineage leukemia							nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	88802904	88802904	+	IGR	DEL	A	-	-	rs28551055		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88802904delA								MEPE (34962 upstream) : SPP1 (93898 downstream)																																			---	---	---	---
TSPAN5	10098	broad.mit.edu	37	4	99436738	99436739	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99436738_99436739delAC	uc003hub.2	-						TSPAN5_uc011cdz.1_Intron	NM_005723	NP_005714			transmembrane 4 superfamily member 9							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)														---	---	---	---
DAPP1	27071	broad.mit.edu	37	4	100774223	100774223	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100774223delC	uc003hvf.3	+						DAPP1_uc011cek.1_Intron|DAPP1_uc010ilh.2_Intron	NM_014395	NP_055210			dual adaptor of phosphotyrosine and						signal transduction	cytoplasm|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein tyrosine phosphatase activity				0				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)														---	---	---	---
BANK1	55024	broad.mit.edu	37	4	102681040	102681041	+	Intron	DEL	CA	-	-	rs70964185		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102681040_102681041delCA	uc003hvx.3	+							NM_001083907	NP_001077376			B-cell scaffold protein with ankyrin repeats 1						B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	103413974	103413975	+	IGR	DEL	TA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103413974_103413975delTA								SLC39A8 (147319 upstream) : NFKB1 (8511 downstream)																																			---	---	---	---
MANBA	4126	broad.mit.edu	37	4	103635784	103635784	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103635784delC	uc003hwg.2	-						MANBA_uc011ces.1_Intron	NM_005908	NP_005899			mannosidase, beta A, lysosomal precursor						carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)														---	---	---	---
NHEDC1	150159	broad.mit.edu	37	4	103819849	103819850	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103819849_103819850insA	uc003hwu.2	-						NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron	NM_001100874	NP_001094344			Na+/H+ exchanger domain containing 1 isoform 2							integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)														---	---	---	---
BBS12	166379	broad.mit.edu	37	4	123665366	123665367	+	3'UTR	INS	-	A	A	rs147626341	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123665366_123665367insA	uc003ieu.2	+	2						NM_152618	NP_689831			Bardet-Biedl syndrome 12						cellular protein metabolic process	cilium	ATP binding			ovary(2)	2														Bardet-Biedl_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	4	124939672	124939673	+	IGR	INS	-	CCTTC	CCTTC	rs149639065	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124939672_124939673insCCTTC								LOC285419 (88154 upstream) : ANKRD50 (645795 downstream)																																			---	---	---	---
SCLT1	132320	broad.mit.edu	37	4	130004606	130004606	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130004606delA	uc003igp.2	-						SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron|SCLT1_uc003igr.2_Intron|SCLT1_uc003igs.2_Intron|SCLT1_uc003igt.3_Intron	NM_144643	NP_653244			sodium channel associated protein 1							centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	130693424	130693424	+	5'Flank	DEL	T	-	-	rs35688132		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130693424delT	uc003igv.2	-											Homo sapiens cDNA clone IMAGE:5265890.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	131201410	131201411	+	IGR	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131201410_131201411delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	131704372	131704372	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131704372delC								None (None upstream) : None (None downstream)																																			---	---	---	---
MAML3	55534	broad.mit.edu	37	4	140905264	140905264	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140905264delA	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187			mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	158864011	158864012	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158864011_158864012insT								LOC340017 (366716 upstream) : FAM198B (181721 downstream)																																			---	---	---	---
RXFP1	59350	broad.mit.edu	37	4	159494164	159494165	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159494164_159494165insT	uc003ipz.2	+						RXFP1_uc010iqj.1_Intron|RXFP1_uc011cja.1_Intron|RXFP1_uc010iqo.2_Intron|RXFP1_uc011cjb.1_Intron|RXFP1_uc010iqk.2_Intron|RXFP1_uc011cjc.1_Intron|RXFP1_uc011cjd.1_Intron|RXFP1_uc010iql.2_Intron|RXFP1_uc011cje.1_Intron|RXFP1_uc010iqm.2_Intron|RXFP1_uc011cjf.1_Intron|RXFP1_uc010iqn.2_Intron	NM_021634	NP_067647			relaxin/insulin-like family peptide receptor 1							integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)														---	---	---	---
SPOCK3	50859	broad.mit.edu	37	4	167784722	167784722	+	Intron	DEL	A	-	-	rs139592173		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167784722delA	uc003iri.1	-						SPOCK3_uc011cjp.1_Intron|SPOCK3_uc011cjq.1_Intron|SPOCK3_uc011cjr.1_Intron|SPOCK3_uc003irj.1_Intron|SPOCK3_uc011cjs.1_Intron|SPOCK3_uc011cjt.1_Intron|SPOCK3_uc011cju.1_Intron|SPOCK3_uc011cjv.1_Intron|SPOCK3_uc003irk.3_Intron	NM_016950	NP_058646			testican 3 isoform 2						signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)														---	---	---	---
GALNTL6	442117	broad.mit.edu	37	4	173586488	173586489	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173586488_173586489insA	uc003isv.2	+						uc003isw.3_5'Flank	NM_001034845	NP_001030017			N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	177326793	177326796	+	IGR	DEL	TGTG	-	-	rs7673591		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177326793_177326796delTGTG								SPCS3 (73399 upstream) : VEGFC (277895 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	184273171	184273172	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184273171_184273172insA								WWC2 (31244 upstream) : CDKN2AIP (92617 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190202119	190202120	+	IGR	DEL	AT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190202119_190202120delAT								None (None upstream) : FRG1 (659854 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190511955	190511956	+	IGR	INS	-	T	T	rs142515391		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190511955_190511956insT								None (None upstream) : FRG1 (350018 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190559268	190559283	+	IGR	DEL	CTCCAATGGCTCTTTA	-	-	rs112120109		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190559268_190559283delCTCCAATGGCTCTTTA								None (None upstream) : FRG1 (302691 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190582423	190582424	+	IGR	INS	-	A	A	rs143592182		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190582423_190582424insA								None (None upstream) : FRG1 (279550 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190594035	190594036	+	IGR	INS	-	T	T	rs141542782		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190594035_190594036insT								None (None upstream) : FRG1 (267938 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190606373	190606376	+	IGR	DEL	AGTT	-	-	rs71961273	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190606373_190606376delAGTT								None (None upstream) : FRG1 (255598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190614285	190614285	+	IGR	DEL	A	-	-	rs113246865		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190614285delA								None (None upstream) : FRG1 (247689 downstream)																																			---	---	---	---
FRG1	2483	broad.mit.edu	37	4	190880855	190880858	+	Intron	DEL	TACT	-	-	rs113251318		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190880855_190880858delTACT	uc003izs.2	+							NM_004477	NP_004468			FSHD region gene 1						rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)														---	---	---	---
AHRR	57491	broad.mit.edu	37	5	424330	424330	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:424330delG	uc003jav.2	+						AHRR_uc003jaw.2_Intron|AHRR_uc010isy.2_Intron|AHRR_uc010isz.2_Intron|AHRR_uc003jax.2_Intron|AHRR_uc003jay.2_Intron	NM_020731	NP_065782			arylhydrocarbon receptor repressor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)															---	---	---	---
CEP72	55722	broad.mit.edu	37	5	615141	615142	+	Intron	INS	-	T	T	rs77850929		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:615141_615142insT	uc003jbf.2	+						CEP72_uc011clz.1_Intron	NM_018140	NP_060610			centrosomal protein 72 kDa						G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	1047656	1047659	+	IGR	DEL	GTGA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1047656_1047659delGTGA								NKD2 (8731 upstream) : SLC12A7 (2832 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1047962	1047965	+	IGR	DEL	TGAG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1047962_1047965delTGAG								NKD2 (9037 upstream) : SLC12A7 (2526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1048514	1048525	+	IGR	DEL	GTGAATGGGTTA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1048514_1048525delGTGAATGGGTTA								NKD2 (9589 upstream) : SLC12A7 (1966 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1649912	1649913	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1649912_1649913delTC								LOC728613 (15792 upstream) : MRPL36 (148587 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1719996	1719996	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1719996delT								LOC728613 (85876 upstream) : MRPL36 (78504 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1782787	1782788	+	IGR	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1782787_1782788delTG								LOC728613 (148667 upstream) : MRPL36 (15712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1992889	1992889	+	IGR	DEL	T	-	-	rs113420676		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1992889delT								IRX4 (110009 upstream) : IRX2 (753392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2458301	2458302	+	IGR	INS	-	A	A	rs150954364	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2458301_2458302insA								IRX4 (575421 upstream) : IRX2 (287979 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3322411	3322412	+	IGR	INS	-	GTGTGT	GTGTGT			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3322411_3322412insGTGTGT								C5orf38 (566899 upstream) : IRX1 (273756 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3459970	3459970	+	Intron	DEL	A	-	-	rs75518423		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3459970delA	uc003jdd.2	-											Homo sapiens cDNA clone IMAGE:4823480.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	4247727	4247727	+	IGR	DEL	T	-	-	rs67531418		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4247727delT								IRX1 (646211 upstream) : LOC340094 (786745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4354201	4354202	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4354201_4354202insA								IRX1 (752685 upstream) : LOC340094 (680270 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5703455	5703455	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5703455delA								KIAA0947 (213118 upstream) : FLJ33360 (607099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	8739719	8739720	+	IGR	INS	-	T	T	rs139484022	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8739719_8739720insT								MTRR (838486 upstream) : SEMA5A (295418 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	8883830	8883830	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8883830delC								MTRR (982597 upstream) : SEMA5A (151308 downstream)																																			---	---	---	---
SEMA5A	9037	broad.mit.edu	37	5	9275638	9275638	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9275638delA	uc003jek.2	-							NM_003966	NP_003957			semaphorin 5A precursor						cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
LOC285692	285692	broad.mit.edu	37	5	9780803	9780804	+	Intron	DEL	GC	-	-	rs141409616	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9780803_9780804delGC	uc003jen.2	-							NR_027112				Homo sapiens clone TEE10 Cri-du-chat region mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	13013635	13013638	+	IGR	DEL	ATTG	-	-	rs140829694		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13013635_13013638delATTG								None (None upstream) : DNAH5 (676799 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	14093766	14093766	+	IGR	DEL	A	-	-	rs140723667		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14093766delA								DNAH5 (149177 upstream) : TRIO (50063 downstream)																																			---	---	---	---
TRIO	7204	broad.mit.edu	37	5	14335131	14335132	+	Intron	INS	-	GT	GT	rs144645388	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14335131_14335132insGT	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc011cna.1_Intron|TRIO_uc003jfh.1_Intron	NM_007118	NP_009049			triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)																	---	---	---	---
ANKH	56172	broad.mit.edu	37	5	14868818	14868818	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14868818delT	uc003jfm.3	-							NM_054027	NP_473368			progressive ankylosis protein						locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	17037590	17037590	+	IGR	DEL	A	-	-	rs11347320		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17037590delA								MYO10 (101205 upstream) : LOC285696 (92547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	17090467	17090468	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17090467_17090468insT								MYO10 (154082 upstream) : LOC285696 (39669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	19240517	19240517	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19240517delA								None (None upstream) : CDH18 (232640 downstream)																																			---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21462704	21462704	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21462704delT	uc010iub.2	+						GUSBP1_uc011cnn.1_Intron|GUSBP1_uc003jgh.3_Intron|GUSBP1_uc003jgf.3_Intron|GUSBP1_uc003jgg.3_Intron	NR_027028				SubName: Full=Putative uncharacterized protein GUSBL2;												0																		---	---	---	---
CDH12	1010	broad.mit.edu	37	5	22059874	22059875	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22059874_22059875insA	uc010iuc.2	-						CDH12_uc011cno.1_Intron|CDH12_uc003jgk.2_Intron	NM_004061	NP_004052			cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	25840246	25840246	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25840246delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	28940183	28940184	+	IGR	INS	-	T	T	rs35455422		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28940183_28940184insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	31002393	31002393	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31002393delT								None (None upstream) : CDH6 (191403 downstream)																																			---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	31744685	31744685	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31744685delA	uc003jhl.2	+							NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
ZFR	51663	broad.mit.edu	37	5	32399380	32399385	+	Intron	DEL	AAACAA	-	-	rs3065267		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32399380_32399385delAAACAA	uc003jhr.1	-							NM_016107	NP_057191			zinc finger RNA binding protein						multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding				0				STAD - Stomach adenocarcinoma(35;0.19)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	32485650	32485650	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32485650delC								ZFR (40806 upstream) : SUB1 (99955 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	32555965	32555965	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32555965delT								ZFR (111121 upstream) : SUB1 (29640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	38698747	38698747	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38698747delT								LIFR (103240 upstream) : OSMR (147381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	41623402	41623407	+	IGR	DEL	CATATT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41623402_41623407delCATATT								PLCXD3 (112672 upstream) : OXCT1 (106761 downstream)																																			---	---	---	---
OXCT1	5019	broad.mit.edu	37	5	41832436	41832441	+	Intron	DEL	AGAGAG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41832436_41832441delAGAGAG	uc003jmn.2	-							NM_000436	NP_000427			3-oxoacid CoA transferase 1 precursor						cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity			ovary(2)|large_intestine(1)	3					Succinic acid(DB00139)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	42285588	42285591	+	IGR	DEL	ACAG	-	-	rs71608642		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42285588_42285591delACAG								FBXO4 (343925 upstream) : GHR (138435 downstream)																																			---	---	---	---
ZNF131	7690	broad.mit.edu	37	5	43129665	43129665	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43129665delT	uc011cpw.1	+						ZNF131_uc010ivl.1_Intron|ZNF131_uc003jnj.3_Intron|ZNF131_uc003jnk.2_Intron|ZNF131_uc003jnn.3_Intron|ZNF131_uc003jnl.1_Intron|ZNF131_uc010ivm.1_Intron	NM_003432	NP_003423			zinc finger protein 131							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	45796684	45796685	+	IGR	DEL	CA	-	-	rs55793958		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45796684_45796685delCA								HCN1 (100464 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	45844263	45844264	+	IGR	INS	-	G	G	rs140998769	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45844263_45844264insG								HCN1 (148043 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	49493307	49493307	+	IGR	DEL	A	-	-	rs62386414		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49493307delA								None (None upstream) : EMB (198726 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	49944148	49944149	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49944148_49944149insA								EMB (206914 upstream) : PARP8 (17584 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	51696599	51696599	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51696599delA								None (None upstream) : ITGA1 (387175 downstream)																																			---	---	---	---
ITGA2	3673	broad.mit.edu	37	5	52344843	52344844	+	Intron	DEL	TT	-	-	rs111756330		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52344843_52344844delTT	uc003joy.2	+						ITGA2_uc011cqa.1_Intron|ITGA2_uc011cqb.1_Intron|ITGA2_uc011cqc.1_Intron|ITGA2_uc011cqd.1_Intron|ITGA2_uc011cqe.1_Intron	NM_002203	NP_002194			integrin alpha 2 precursor						axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity			lung(1)	1		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	52508834	52508835	+	IGR	INS	-	TTC	TTC	rs149308104	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52508834_52508835insTTC								MOCS2 (103236 upstream) : FST (267760 downstream)																																			---	---	---	---
ARL15	54622	broad.mit.edu	37	5	53245647	53245648	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53245647_53245648insT	uc003jpg.1	-						ARL15_uc010ivs.1_Intron	NM_019087	NP_061960			ADP-ribosylation factor-like 15								GTP binding			ovary(1)	1		Lung NSC(810;0.000779)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	55562650	55562650	+	IGR	DEL	T	-	-	rs34077957		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55562650delT								ANKRD55 (33464 upstream) : MAP3K1 (548250 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	55888157	55888158	+	IGR	INS	-	ACTC	ACTC	rs149760458	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55888157_55888158insACTC								ANKRD55 (358971 upstream) : MAP3K1 (222742 downstream)																																			---	---	---	---
RAB3C	115827	broad.mit.edu	37	5	57879685	57879685	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57879685delT	uc003jrp.2	+							NM_138453	NP_612462			RAB3C, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			ovary(1)|central_nervous_system(1)	2		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)														---	---	---	---
FLJ37543	285668	broad.mit.edu	37	5	60952038	60952038	+	Intron	DEL	G	-	-	rs11360159		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60952038delG	uc003jst.1	+							NM_173667	NP_775938			hypothetical protein LOC285668 precursor							extracellular region					0		Lung NSC(810;0.000468)|Prostate(74;0.0283)|Breast(144;0.237)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	65703968	65703968	+	IGR	DEL	C	-	-	rs76657721		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65703968delC								SFRS12 (227256 upstream) : MAST4 (188208 downstream)																																			---	---	---	---
PIK3R1	5295	broad.mit.edu	37	5	67570325	67570325	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67570325delT	uc003jva.2	+						PIK3R1_uc003jvb.2_Intron	NM_181523	NP_852664			phosphoinositide-3-kinase, regulatory subunit 1						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	67810911	67810916	+	IGR	DEL	TGTTGT	-	-	rs10565084		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67810911_67810916delTGTTGT								PIK3R1 (213264 upstream) : SLC30A5 (578902 downstream)																																			---	---	---	---
ZNF366	167465	broad.mit.edu	37	5	71784042	71784042	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71784042delA	uc003kce.1	-							NM_152625	NP_689838			zinc finger protein 366						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	73301267	73301267	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73301267delC								RGNEF (63854 upstream) : ENC1 (621968 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	89657132	89657132	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89657132delA								None (None upstream) : CETN3 (32399 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	95526514	95526514	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95526514delT								MIR583 (111598 upstream) : PCSK1 (199605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	95897891	95897892	+	IGR	INS	-	CA	CA	rs140470508	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95897891_95897892insCA								PCSK1 (128939 upstream) : CAST (99885 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	102642403	102642404	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102642403_102642404insT								C5orf30 (28042 upstream) : NUDT12 (242153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	104650164	104650165	+	IGR	DEL	GT	-	-	rs71812923		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:104650164_104650165delGT								RAB9BP1 (214366 upstream) : None (None downstream)																																			---	---	---	---
EFNA5	1946	broad.mit.edu	37	5	106854282	106854283	+	Intron	INS	-	A	A	rs149169932		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106854282_106854283insA	uc003kol.2	-						EFNA5_uc010jbr.1_Intron	NM_001962	NP_001953			ephrin-A5 precursor						cell-cell signaling	anchored to plasma membrane|caveola|extracellular space	ephrin receptor binding				0		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	107968548	107968548	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107968548delT								FBXL17 (250749 upstream) : FER (114975 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	108652106	108652106	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108652106delA								FER (128733 upstream) : PJA2 (18305 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	114784359	114784360	+	IGR	INS	-	G	G	rs11372090		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114784359_114784360insG								CCDC112 (151901 upstream) : FEM1C (72248 downstream)																																			---	---	---	---
SEMA6A	57556	broad.mit.edu	37	5	115849298	115849298	+	Intron	DEL	T	-	-	rs138397170		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115849298delT	uc010jck.2	-						SEMA6A_uc003krx.3_Intron	NM_020796	NP_065847			sema domain, transmembrane domain (TM), and						apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)														---	---	---	---
DMXL1	1657	broad.mit.edu	37	5	118443038	118443038	+	Intron	DEL	A	-	-	rs112070732		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118443038delA	uc003ksd.2	+						DMXL1_uc010jcl.1_Intron|DMXL1_uc003ksc.1_Intron	NM_005509	NP_005500			Dmx-like 1											ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	121941248	121941248	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121941248delT								SNCAIP (141454 upstream) : SNX2 (169502 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	127093491	127093492	+	IGR	DEL	CT	-	-	rs112955117	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127093491_127093492delCT								CTXN3 (99170 upstream) : FLJ33630 (182643 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	132488790	132488790	+	IGR	DEL	T	-	-	rs34915069		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132488790delT								HSPA4 (48082 upstream) : FSTL4 (43362 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	133252562	133252562	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133252562delA								FSTL4 (304339 upstream) : C5orf15 (38637 downstream)																																			---	---	---	---
SKP1	6500	broad.mit.edu	37	5	133504806	133504806	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133504806delA	uc003kzc.3	-						SKP1_uc003kzd.3_Intron|SKP1_uc010jdv.2_Intron	NM_170679	NP_733779			S-phase kinase-associated protein 1 isoform b						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|G1/S transition of mitotic cell cycle|histone H2A monoubiquitination|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|viral reproduction	cytosol|nucleoplasm|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	133925110	133925110	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133925110delG								PHF15 (6192 upstream) : SAR1B (17010 downstream)																																			---	---	---	---
TIFAB	497189	broad.mit.edu	37	5	134790597	134790600	+	5'Flank	DEL	AATG	-	-	rs72141676		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134790597_134790600delAATG	uc003law.3	-							NM_001099221	NP_001092691			TIFA-related protein TIFAB												0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	141226503	141226504	+	IGR	INS	-	TG	TG	rs148154440	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141226503_141226504insTG								ARAP3 (164703 upstream) : PCDH1 (6179 downstream)																																			---	---	---	---
FGF1	2246	broad.mit.edu	37	5	141981742	141981742	+	Intron	DEL	T	-	-	rs111602806		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141981742delT	uc003lmm.2	-						FGF1_uc011dbi.1_Intron|FGF1_uc003lmn.3_Intron|FGF1_uc003lmp.3_Intron|FGF1_uc003lmq.2_Intron|FGF1_uc010jgj.2_Intron|FGF1_uc003lmr.2_Intron|FGF1_uc003lms.3_Intron	NM_001144892	NP_001138364			fibroblast growth factor 1 (acidic) isoform 1						angiogenesis|cellular response to heat|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of angiogenesis|positive regulation of cell division|positive regulation of cell migration|positive regulation of cholesterol biosynthetic process|positive regulation of intracellular protein kinase cascade|positive regulation of transcription from RNA polymerase II promoter	cell cortex|cytosol|extracellular space	fibroblast growth factor receptor binding|growth factor activity|heparin binding|S100 alpha binding				0		all_neural(839;0.0416)|Ovarian(839;0.0955)|all_hematologic(541;0.1)|Prostate(461;0.157)|Lung NSC(810;0.21)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00032)	Pentosan Polysulfate(DB00686)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	145290401	145290402	+	IGR	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145290401_145290402delGT								GRXCR2 (37870 upstream) : SH3RF2 (25724 downstream)																																			---	---	---	---
PPP2R2B	5521	broad.mit.edu	37	5	146244857	146244860	+	Intron	DEL	ACAC	-	-	rs142180079		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146244857_146244860delACAC	uc003loe.2	-						PPP2R2B_uc010jgm.2_Intron|PPP2R2B_uc003log.3_Intron|PPP2R2B_uc003lof.3_Intron|PPP2R2B_uc003loi.3_Intron|PPP2R2B_uc003loh.3_Intron|PPP2R2B_uc003loj.3_Intron|PPP2R2B_uc003lok.3_Intron|PPP2R2B_uc011dbu.1_Intron|PPP2R2B_uc011dbv.1_Intron	NM_004576	NP_004567			beta isoform of regulatory subunit B55, protein						apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
SPINK5	11005	broad.mit.edu	37	5	147488628	147488628	+	Intron	DEL	T	-	-	rs113070270		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147488628delT	uc003lox.2	+						SPINK5_uc010jgs.1_Intron|SPINK5_uc010jgr.2_Intron|SPINK5_uc003low.2_Intron|SPINK5_uc003loy.2_Intron	NM_006846	NP_006837			serine peptidase inhibitor, Kazal type 5 isoform						anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
SH3TC2	79628	broad.mit.edu	37	5	148380729	148380730	+	3'UTR	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148380729_148380730delAC	uc003lpu.2	-	17					SH3TC2_uc003lpp.1_Intron|SH3TC2_uc010jgw.2_3'UTR|SH3TC2_uc003lps.2_RNA|SH3TC2_uc003lpt.2_3'UTR|SH3TC2_uc010jgx.2_3'UTR	NM_024577	NP_078853			SH3 domain and tetratricopeptide repeats 2								binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	149062283	149062290	+	IGR	DEL	GAAGGAAG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149062283_149062290delGAAGGAAG								ARHGEF37 (47756 upstream) : PPARGC1B (47574 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	152175043	152175043	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152175043delA	uc003lux.1	-											Homo sapiens cDNA FLJ35529 fis, clone SPLEN2001912.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	152719063	152719064	+	IGR	DEL	CT	-	-	rs144609832		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152719063_152719064delCT								NMUR2 (934223 upstream) : GRIA1 (150111 downstream)																																			---	---	---	---
CNOT8	9337	broad.mit.edu	37	5	154242596	154242597	+	Intron	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154242596_154242597delTG	uc003lvu.2	+						CNOT8_uc011ddf.1_Intron|CNOT8_uc011ddg.1_Intron|CNOT8_uc011ddh.1_Intron|CNOT8_uc003lvv.2_Intron|CNOT8_uc010jig.2_Intron|CNOT8_uc010jif.2_Intron|CNOT8_uc003lvw.2_Intron|CNOT8_uc011ddi.1_Intron|CNOT8_uc011ddj.1_Intron	NM_004779	NP_004770			CCR4-NOT transcription complex, subunit 8						negative regulation of cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)										Direct_reversal_of_damage					---	---	---	---
CLINT1	9685	broad.mit.edu	37	5	157248848	157248848	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157248848delA	uc003lxj.1	-						CLINT1_uc003lxi.1_Intron|CLINT1_uc011ddv.1_Intron	NM_014666	NP_055481			epsin 4						endocytosis|post-Golgi vesicle-mediated transport	clathrin-coated vesicle|cytosol|Golgi apparatus|membrane|perinuclear region of cytoplasm	clathrin binding|lipid binding			ovary(2)|pancreas(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
ATP10B	23120	broad.mit.edu	37	5	160122497	160122500	+	Intron	DEL	GTGT	-	-	rs145392520		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160122497_160122500delGTGT	uc003lym.1	-						ATP10B_uc003lyp.2_Intron|ATP10B_uc011deg.1_Intron	NM_025153	NP_079429			ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
ODZ2	57451	broad.mit.edu	37	5	167092447	167092447	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167092447delA	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)														---	---	---	---
KCNIP1	30820	broad.mit.edu	37	5	170086163	170086163	+	Intron	DEL	T	-	-	rs150339237		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170086163delT	uc003mas.2	+						KCNIP1_uc003map.2_Intron|KCNIP1_uc003mat.2_Intron|KCNIP1_uc010jjp.2_Intron|KCNIP1_uc010jjq.2_Intron	NM_001034837	NP_001030009			Kv channel interacting protein 1 isoform 1						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
RANBP17	64901	broad.mit.edu	37	5	170475482	170475483	+	Intron	INS	-	T	T	rs60927783		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170475482_170475483insT	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron	NM_022897	NP_075048			RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)					T	TRD@	ALL								---	---	---	---
STK10	6793	broad.mit.edu	37	5	171606554	171606554	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171606554delA	uc003mbo.1	-							NM_005990	NP_005981			serine/threonine kinase 10								ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	173284167	173284168	+	IGR	INS	-	GTGTGTGTGTGT	GTGTGTGTGTGT	rs140014404	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173284167_173284168insGTGTGTGTGTGT								BOD1 (240501 upstream) : CPEB4 (31163 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	173702744	173702744	+	IGR	DEL	T	-	-	rs144741624		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173702744delT								HMP19 (166563 upstream) : MSX2 (448831 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	173820984	173820984	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173820984delA								HMP19 (284803 upstream) : MSX2 (330591 downstream)																																			---	---	---	---
UIMC1	51720	broad.mit.edu	37	5	176353639	176353641	+	Intron	DEL	AAC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176353639_176353641delAAC	uc011dfp.1	-						UIMC1_uc003mfc.1_Intron|UIMC1_uc003mfd.1_Intron|UIMC1_uc003mfe.1_Intron|UIMC1_uc003mff.1_Intron	NM_016290	NP_057374			ubiquitin interaction motif containing 1						double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|negative regulation of transcription, DNA-dependent|positive regulation of DNA repair|response to ionizing radiation|transcription, DNA-dependent	BRCA1-A complex	histone binding|K63-linked polyubiquitin binding			ovary(3)|skin(1)	4	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	362319	362320	+	IGR	INS	-	T	T	rs72551076		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:362319_362320insT								DUSP22 (10966 upstream) : IRF4 (29432 downstream)																																			---	---	---	---
WRNIP1	56897	broad.mit.edu	37	6	2765025	2765026	+	5'Flank	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2765025_2765026insA	uc003mtz.2	+						WRNIP1_uc003mua.2_5'Flank	NM_020135	NP_064520			Werner helicase interacting protein isoform 1						DNA replication|DNA synthesis involved in DNA repair|regulation of DNA-dependent DNA replication initiation	mitochondrion|nucleus|perinuclear region of cytoplasm	ATP binding|ATPase activity|DNA binding|metal ion binding|protein binding			ovary(1)|pancreas(1)	2	Ovarian(93;0.0412)	all_hematologic(90;0.0895)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	4961586	4961587	+	IGR	INS	-	AGG	AGG	rs149966106	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4961586_4961587insAGG								CDYL (5809 upstream) : RPP40 (33694 downstream)																																			---	---	---	---
F13A1	2162	broad.mit.edu	37	6	6150593	6150593	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6150593delT	uc003mwv.2	-						F13A1_uc011dib.1_Intron	NM_000129	NP_000120			coagulation factor XIII A1 subunit precursor						peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)													---	---	---	---
RREB1	6239	broad.mit.edu	37	6	7130853	7130854	+	Intron	INS	-	T	T	rs150504185		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7130853_7130854insT	uc003mxc.2	+						RREB1_uc010jnw.2_Intron|RREB1_uc003mxb.2_Intron|RREB1_uc010jnx.2_Intron|RREB1_uc003mxd.2_Intron	NM_001003698	NP_001003698			ras responsive element binding protein 1 isoform						multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)																---	---	---	---
TXNDC5	81567	broad.mit.edu	37	6	8006486	8006488	+	Intron	DEL	AAA	-	-	rs141814305		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8006486_8006488delAAA	uc003mxw.2	-							NM_001145549	NP_001139021			thioredoxin domain containing 5 isoform 3						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)																	---	---	---	---
TXNDC5	81567	broad.mit.edu	37	6	8050835	8050835	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8050835delT	uc003mxw.2	-						MUTED_uc003mxy.2_Intron|MUTED_uc010joc.2_Intron|MUTED_uc010job.2_Intron	NM_001145549	NP_001139021			thioredoxin domain containing 5 isoform 3						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)																	---	---	---	---
PHACTR1	221692	broad.mit.edu	37	6	12977613	12977616	+	Intron	DEL	CACA	-	-	rs147157052		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12977613_12977616delCACA	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210			phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)															---	---	---	---
GMPR	2766	broad.mit.edu	37	6	16275842	16275843	+	Intron	INS	-	A	A	rs146289969	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16275842_16275843insA	uc003nbs.2	+							NM_006877	NP_006868			guanosine monophosphate reductase						nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage|response to cold	cytosol	GMP reductase activity|metal ion binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	16906251	16906252	+	IGR	DEL	AC	-	-	rs71535089		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16906251_16906252delAC								ATXN1 (144530 upstream) : RBM24 (375557 downstream)																																			---	---	---	---
FAM8A1	51439	broad.mit.edu	37	6	17598363	17598363	+	5'Flank	DEL	A	-	-	rs111961171		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17598363delA	uc003ncc.2	+							NM_016255	NP_057339			family with sequence similarity 8, member A1							integral to membrane					0	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)															---	---	---	---
KDM1B	221656	broad.mit.edu	37	6	18184505	18184505	+	5'Flank	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18184505delT	uc003nco.1	+						KDM1B_uc003ncn.1_Intron	NM_153042	NP_694587			amine oxidase (flavin containing) domain 1						multicellular organismal development|regulation of DNA methylation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-monomethyl-K4 specific)|oxidoreductase activity|zinc ion binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	18508756	18508757	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18508756_18508757insA								RNF144B (39908 upstream) : MIR548A1 (63258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	19691450	19691450	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19691450delA								None (None upstream) : ID4 (146167 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	20076757	20076757	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20076757delA								ID4 (235843 upstream) : MBOAT1 (24178 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	23499587	23499588	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23499587_23499588insT								HDGFL1 (928838 upstream) : NRSN1 (626826 downstream)																																			---	---	---	---
CMAH	8418	broad.mit.edu	37	6	25169493	25169495	+	5'Flank	DEL	AGC	-	-	rs150393239		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25169493_25169495delAGC	uc011djv.1	-											Homo sapiens CMP-N-acetylneuraminic acid hydroxylase mRNA, complete cds.												0																		---	---	---	---
TRIM38	10475	broad.mit.edu	37	6	25980652	25980652	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25980652delT	uc003nfm.2	+						TRIM38_uc003nfn.2_Intron|TRIM38_uc010jqd.2_Intron	NM_006355	NP_006346			tripartite motif-containing 38						positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular	signal transducer activity|zinc ion binding				0																		---	---	---	---
HIST1H1T	3010	broad.mit.edu	37	6	26109345	26109346	+	5'Flank	INS	-	A	A	rs113146571		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26109345_26109346insA	uc003ngj.2	-							NM_005323	NP_005314			histone cluster 1, H1t						cell differentiation|multicellular organismal development|nucleosome assembly|spermatogenesis	nucleosome	DNA binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	27191333	27191334	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27191333_27191334delTC								HIST1H2AH (75988 upstream) : PRSS16 (24174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	27697977	27697977	+	IGR	DEL	T	-	-	rs111764616		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27697977delT								ZNF184 (257080 upstream) : HIST1H2BL (77281 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	28430903	28430904	+	IGR	INS	-	GT	GT	rs141225604	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28430903_28430904insGT								ZSCAN23 (19624 upstream) : GPX6 (40169 downstream)																																			---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29850826	29850826	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29850826delT	uc011dmb.1	+							NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	30662539	30662539	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30662539delT								NRM (3481 upstream) : MDC1 (5046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	30782619	30782620	+	Intron	INS	-	TCTTTATT	TCTTTATT	rs139856443	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30782619_30782620insTCTTTATT	uc003nrp.1	-											RecName: Full=Putative uncharacterized protein C6orf214;																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	30826946	30826946	+	IGR	DEL	A	-	-	rs148995140		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30826946delA								IER3 (114619 upstream) : DDR1 (23748 downstream)																																			---	---	---	---
HLA-DRB5	3127	broad.mit.edu	37	6	32557176	32557176	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32557176delG	uc003obk.3	-						HLA-DRB1_uc003obp.3_Intron	NM_002125	NP_002116			major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	33528928	33528928	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33528928delA								ZBTB9 (103610 upstream) : BAK1 (11396 downstream)																																			---	---	---	---
GRM4	2914	broad.mit.edu	37	6	34020891	34020892	+	Intron	INS	-	T	T	rs139815961	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34020891_34020892insT	uc003oir.3	-						GRM4_uc011dsn.1_Intron|GRM4_uc010jvh.2_Intron|GRM4_uc010jvi.2_Intron|GRM4_uc003oio.2_Intron|GRM4_uc003oip.2_Intron|GRM4_uc011dsl.1_Intron|GRM4_uc003oiq.2_Intron|GRM4_uc011dsm.1_Intron	NM_000841	NP_000832			glutamate receptor, metabotropic 4 precursor						activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	34116917	34116918	+	IGR	INS	-	CCCA	CCCA	rs6900891	byFrequency;by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34116917_34116918insCCCA								GRM4 (3048 upstream) : HMGA1 (87659 downstream)																																			---	---	---	---
C6orf106	64771	broad.mit.edu	37	6	34596106	34596107	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34596106_34596107insT	uc003ojr.2	-						C6orf106_uc003ojs.2_Intron	NM_024294	NP_077270			chromosome 6 open reading frame 106 isoform a											skin(2)|ovary(1)	3																		---	---	---	---
ETV7	51513	broad.mit.edu	37	6	36329975	36329976	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36329975_36329976insA	uc003olz.1	-						ETV7_uc003oma.1_Intron	NM_016135	NP_057219			ets variant 7						organ morphogenesis|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	36385545	36385545	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36385545delA								PXT1 (17234 upstream) : KCTD20 (24999 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37050315	37050316	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37050315_37050316insA								FGD2 (53470 upstream) : PIM1 (87606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37098701	37098702	+	IGR	DEL	TT	-	-	rs9349025	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37098701_37098702delTT								FGD2 (101856 upstream) : PIM1 (39220 downstream)																																			---	---	---	---
BTBD9	114781	broad.mit.edu	37	6	38172053	38172053	+	Intron	DEL	T	-	-	rs34441561		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38172053delT	uc003ooa.3	-						BTBD9_uc003ony.3_Intron|BTBD9_uc010jwv.2_Intron|BTBD9_uc010jww.2_Intron|BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125			BTB (POZ) domain containing 9 isoform a						cell adhesion						0																		---	---	---	---
BTBD9	114781	broad.mit.edu	37	6	38179211	38179212	+	Intron	INS	-	A	A	rs115927740		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38179211_38179212insA	uc003ooa.3	-						BTBD9_uc003ony.3_Intron|BTBD9_uc010jwv.2_Intron|BTBD9_uc010jww.2_Intron|BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125			BTB (POZ) domain containing 9 isoform a						cell adhesion						0																		---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38948805	38948806	+	Intron	DEL	GT	-	-	rs71543954		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38948805_38948806delGT	uc003ooe.1	+						DNAH8_uc003oog.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
NFYA	4800	broad.mit.edu	37	6	41053946	41053946	+	Intron	DEL	A	-	-	rs10712220		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41053946delA	uc003opo.2	+						NFYA_uc003opp.2_Intron|NFYA_uc003opq.2_Intron	NM_002505	NP_002496			nuclear transcription factor Y, alpha isoform 1						transcription from RNA polymerase II promoter	CCAAT-binding factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(28;0.0418)|Colorectal(47;0.196)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	41479056	41479056	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41479056delA	uc003oqk.1	+											Homo sapiens mRNA sequence.																														---	---	---	---
TRERF1	55809	broad.mit.edu	37	6	42315941	42315942	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42315941_42315942delAC	uc003osd.2	-						TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037			transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
XPO5	57510	broad.mit.edu	37	6	43492091	43492091	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43492091delA	uc003ovp.2	-						POLR1C_uc003ovo.1_Intron	NM_020750	NP_065801			exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)															---	---	---	---
MAD2L1BP	9587	broad.mit.edu	37	6	43606882	43606882	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43606882delT	uc003ovv.2	+						MAD2L1BP_uc003ovu.2_Intron	NM_014628	NP_055443			MAD2L1 binding protein isoform 2						mitotic cell cycle checkpoint|regulation of exit from mitosis	cytoplasm|nucleus|spindle	protein binding				0	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000351)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)															---	---	---	---
LOC100132354	100132354	broad.mit.edu	37	6	43858933	43858934	+	RNA	INS	-	TC	TC	rs143500986	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43858933_43858934insTC	uc011dvm.1	+	1		c.169_170insTC				NR_024478				Homo sapiens cDNA FLJ38229 fis, clone FCBBF2004256.												0																		---	---	---	---
RUNX2	860	broad.mit.edu	37	6	45480981	45480981	+	Intron	DEL	C	-	-	rs34735942		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45480981delC	uc011dvx.1	+						RUNX2_uc011dvy.1_Intron|RUNX2_uc003oxt.2_Intron	NM_001024630	NP_001019801			runt-related transcription factor 2 isoform a						negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3																		---	---	---	---
CLIC5	53405	broad.mit.edu	37	6	46039974	46039974	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46039974delA	uc003oxv.3	-							NM_001114086	NP_001107558			chloride intracellular channel 5 isoform a						female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	49022060	49022060	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49022060delT								C6orf138 (943117 upstream) : MUT (376934 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	50462689	50462690	+	Intron	DEL	CA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50462689_50462690delCA	uc003pae.1	+											full-length cDNA clone CS0DD007YH13 of Neuroblastoma Cot 50-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	52055824	52055825	+	IGR	INS	-	TTGTTT	TTGTTT	rs144603145	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52055824_52055825insTTGTTT								IL17A (388 upstream) : IL17F (45659 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	52834172	52834173	+	IGR	DEL	CT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52834172_52834173delCT								GSTA3 (59676 upstream) : GSTA4 (8574 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	54381838	54381839	+	IGR	INS	-	A	A	rs145115539	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54381838_54381839insA								TINAG (126888 upstream) : FAM83B (329730 downstream)																																			---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57208555	57208555	+	Intron	DEL	A	-	-	rs11324461		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57208555delA	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57235410	57235411	+	Intron	INS	-	T	T	rs140893721	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57235410_57235411insT	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57238019	57238020	+	Intron	INS	-	AGT	AGT	rs149497221		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57238019_57238020insAGT	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57270722	57270730	+	Intron	DEL	CCCAGCAAG	-	-	rs11276813		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57270722_57270730delCCCAGCAAG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57352832	57352836	+	Intron	DEL	AAGTT	-	-	rs143762532		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57352832_57352836delAAGTT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57360568	57360569	+	Intron	DEL	AT	-	-	rs140251188		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57360568_57360569delAT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57362938	57362939	+	Intron	INS	-	CATCTGC	CATCTGC	rs144736456	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57362938_57362939insCATCTGC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57375667	57375668	+	Intron	INS	-	G	G	rs150523374		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57375667_57375668insG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57380824	57380825	+	Intron	INS	-	TT	TT	rs145567229		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57380824_57380825insTT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57465760	57465761	+	Intron	INS	-	T	T	rs142805285		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57465760_57465761insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57486637	57486638	+	Intron	INS	-	TA	TA	rs138188703	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57486637_57486638insTA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57519622	57519622	+	IGR	DEL	A	-	-	rs66662983		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57519622delA								PRIM2 (6247 upstream) : GUSBL2 (726537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57538660	57538665	+	IGR	DEL	TTATTG	-	-	rs68111592		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57538660_57538665delTTATTG								PRIM2 (25285 upstream) : GUSBL2 (707494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57553541	57553542	+	IGR	DEL	AG	-	-	rs113085434		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57553541_57553542delAG								PRIM2 (40166 upstream) : GUSBL2 (692617 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57561859	57561860	+	IGR	DEL	AA	-	-	rs3996741		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57561859_57561860delAA								PRIM2 (48484 upstream) : GUSBL2 (684299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57575464	57575464	+	IGR	DEL	A	-	-	rs68142183		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57575464delA								PRIM2 (62089 upstream) : GUSBL2 (670695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57597040	57597040	+	IGR	DEL	T	-	-	rs75401139		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57597040delT								PRIM2 (83665 upstream) : GUSBL2 (649119 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57606508	57606509	+	IGR	INS	-	CTA	CTA	rs148508108		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57606508_57606509insCTA								PRIM2 (93133 upstream) : GUSBL2 (639650 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	58776105	58776106	+	IGR	INS	-	T	T	rs74529147		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58776105_58776106insT								GUSBL2 (488381 upstream) : None (None downstream)																																			---	---	---	---
RIMS1	22999	broad.mit.edu	37	6	72947379	72947379	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72947379delA	uc003pga.2	+						RIMS1_uc011dyb.1_Intron|RIMS1_uc003pgc.2_Intron|RIMS1_uc010kaq.2_Intron|RIMS1_uc011dyc.1_Intron|RIMS1_uc010kar.2_Intron|RIMS1_uc011dyd.1_Intron|RIMS1_uc003pgb.3_Intron|RIMS1_uc010kas.1_Intron	NM_014989	NP_055804			regulating synaptic membrane exocytosis 1						calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	77723753	77723753	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77723753delT								IMPG1 (941418 upstream) : HTR1B (448195 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	80454798	80454799	+	IGR	INS	-	A	A	rs74399602		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80454798_80454799insA								RNY4 (3129 upstream) : ELOVL4 (169737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	80477062	80477063	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80477062_80477063insT								RNY4 (25393 upstream) : ELOVL4 (147473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	83049877	83049878	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83049877_83049878delTC								IBTK (92429 upstream) : TPBG (23045 downstream)																																			---	---	---	---
UBE2CBP	90025	broad.mit.edu	37	6	83687862	83687862	+	Intron	DEL	G	-	-	rs10715152		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83687862delG	uc003pjp.2	-						UBE2CBP_uc011dyx.1_Intron	NM_198920	NP_944602			ubiquitin-conjugating enzyme E2C binding							cytoplasm	ligase activity			ovary(1)	1		all_cancers(76;0.000374)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0548)		BRCA - Breast invasive adenocarcinoma(397;0.0944)														---	---	---	---
ME1	4199	broad.mit.edu	37	6	84127090	84127092	+	Intron	DEL	TTG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84127090_84127092delTTG	uc003pjy.2	-						ME1_uc011dzb.1_Intron|ME1_uc011dzc.1_Intron	NM_002395	NP_002386			cytosolic malic enzyme 1						carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)													---	---	---	---
SNX14	57231	broad.mit.edu	37	6	86251852	86251852	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86251852delA	uc003pkr.2	-						SNX14_uc003pkp.2_Intron|SNX14_uc003pkq.2_Intron|SNX14_uc011dzg.1_Intron|SNX14_uc003pks.2_Intron|SNX14_uc003pkt.2_Intron	NM_153816	NP_722523			sorting nexin 14 isoform a						cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)														---	---	---	---
SYNCRIP	10492	broad.mit.edu	37	6	86339700	86339700	+	Intron	DEL	A	-	-	rs67582775		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86339700delA	uc003pla.2	-						SYNCRIP_uc003pku.2_Intron|SYNCRIP_uc003pkw.2_Intron|SYNCRIP_uc003pky.2_Intron|SYNCRIP_uc003pkv.2_Intron|SYNCRIP_uc003pkx.2_Intron|SYNCRIP_uc003pkz.2_Intron	NM_006372	NP_006363			synaptotagmin binding, cytoplasmic RNA						CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding			ovary(2)	2		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)														---	---	---	---
SYNCRIP	10492	broad.mit.edu	37	6	86350406	86350406	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86350406delA	uc003pla.2	-						SYNCRIP_uc003pku.2_Intron|SYNCRIP_uc003pkw.2_Intron|SYNCRIP_uc003pky.2_Intron|SYNCRIP_uc003pkv.2_Intron|SYNCRIP_uc003pkx.2_Intron|SYNCRIP_uc003pkz.2_Intron	NM_006372	NP_006363			synaptotagmin binding, cytoplasmic RNA						CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding			ovary(2)	2		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)														---	---	---	---
BACH2	60468	broad.mit.edu	37	6	90929505	90929508	+	Intron	DEL	ACAC	-	-	rs146457839		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90929505_90929508delACAC	uc011eab.1	-						BACH2_uc003pnw.2_Intron|BACH2_uc010kch.2_Intron	NM_021813	NP_068585			BTB and CNC homology 1, basic leucine zipper							nucleus	protein dimerization activity|sequence-specific DNA binding			ovary(3)|pancreas(1)|lung(1)|skin(1)	6		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	91870072	91870072	+	IGR	DEL	A	-	-	rs66758376		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91870072delA								MAP3K7 (573165 upstream) : None (None downstream)																																			---	---	---	---
KIAA0776	23376	broad.mit.edu	37	6	96973962	96973962	+	Intron	DEL	A	-	-	rs79722507		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96973962delA	uc003por.2	+						KIAA0776_uc010kck.2_Intron	NM_015323	NP_056138			hypothetical protein LOC23376						negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|protein ufmylation	endoplasmic reticulum|nucleus	protein binding|UFM1 conjugating enzyme activity			ovary(1)	1		all_cancers(76;5.83e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0604)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0934)														---	---	---	---
PREP	5550	broad.mit.edu	37	6	105743033	105743033	+	Intron	DEL	T	-	-	rs67811165		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105743033delT	uc003prc.2	-							NM_002726	NP_002717			prolyl endopeptidase						proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)													---	---	---	---
SLC35F1	222553	broad.mit.edu	37	6	118606145	118606146	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118606145_118606146insT	uc003pxx.3	+						SLC35F1_uc003pxy.1_Intron	NM_001029858	NP_001025029			solute carrier family 35, member F1						transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)												OREG0017635	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
C6orf204	387119	broad.mit.edu	37	6	118974873	118974874	+	5'Flank	INS	-	CTA	CTA	rs79984064		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118974873_118974874insCTA	uc003pxz.1	-						C6orf204_uc003pya.1_Intron|C6orf204_uc003pyb.2_5'Flank|C6orf204_uc011ebj.1_5'Flank|C6orf204_uc003pyc.2_Intron|C6orf204_uc011ebl.1_5'Flank	NM_001042475	NP_001035940			chromosome 6 open reading frame 204 isoform a							centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124135000	124135001	+	Intron	INS	-	T	T	rs35564028		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124135000_124135001insT	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010kep.1_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124444230	124444231	+	Intron	DEL	CT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124444230_124444231delCT	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010kep.1_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	127384124	127384125	+	Intron	DEL	GT	-	-	rs146490292		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127384124_127384125delGT	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																														---	---	---	---
L3MBTL3	84456	broad.mit.edu	37	6	130389708	130389708	+	Intron	DEL	A	-	-	rs67334159		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130389708delA	uc003qbt.2	+						L3MBTL3_uc003qbu.2_Intron	NM_032438	NP_115814			l(3)mbt-like 3 isoform a						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)														---	---	---	---
L3MBTL3	84456	broad.mit.edu	37	6	130433880	130433881	+	Intron	INS	-	GTA	GTA	rs144833768	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130433880_130433881insGTA	uc003qbt.2	+						L3MBTL3_uc003qbu.2_Intron	NM_032438	NP_115814			l(3)mbt-like 3 isoform a						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	130463630	130463630	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130463630delA								L3MBTL3 (1046 upstream) : SAMD3 (1833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	131032214	131032215	+	IGR	DEL	GT	-	-	rs72579787		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131032214_131032215delGT								TMEM200A (268006 upstream) : LOC285733 (116109 downstream)																																			---	---	---	---
C6orf192	116843	broad.mit.edu	37	6	133112616	133112616	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133112616delT	uc003qdw.1	-						C6orf192_uc011eco.1_Intron	NM_052831	NP_439896			hypothetical protein LOC116843						transmembrane transport	integral to membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;0.00303)|GBM - Glioblastoma multiforme(226;0.0265)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	134791869	134791870	+	Intron	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134791869_134791870delTC	uc003qeq.1	-						uc003qer.1_Intron|uc003qes.1_Intron|uc003qet.1_Intron|uc003qeu.1_Intron					Homo sapiens cDNA clone IMAGE:4837072.																														---	---	---	---
MAP7	9053	broad.mit.edu	37	6	136859610	136859610	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136859610delT	uc003qgz.2	-						MAP7_uc010kgq.1_Intron|MAP7_uc003qha.1_Intron	NM_003980	NP_003971			microtubule-associated protein 7						establishment or maintenance of cell polarity|microtubule cytoskeleton organization|protein localization in plasma membrane|response to osmotic stress	basolateral plasma membrane|microtubule|microtubule associated complex|nucleus|perinuclear region of cytoplasm	receptor binding|structural molecule activity				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)														---	---	---	---
C6orf94	153918	broad.mit.edu	37	6	144225113	144225114	+	Intron	DEL	AG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144225113_144225114delAG	uc010khk.2	+						C6orf94_uc010khj.2_Intron|C6orf94_uc011edy.1_Intron	NM_001013623	NP_001013645			hypothetical protein LOC153918												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	148617263	148617264	+	IGR	INS	-	TTG	TTG	rs141110755	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148617263_148617264insTTG								SAMD5 (726106 upstream) : SASH1 (46465 downstream)																																			---	---	---	---
UST	10090	broad.mit.edu	37	6	149379482	149379483	+	Intron	DEL	TG	-	-	rs72464997		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149379482_149379483delTG	uc003qmg.2	+							NM_005715	NP_005706			uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)														---	---	---	---
TAB2	23118	broad.mit.edu	37	6	149679777	149679778	+	Intron	DEL	TG	-	-	rs66629777		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149679777_149679778delTG	uc003qmj.2	+						TAB2_uc011eec.1_Intron|TAB2_uc010kia.1_Intron|TAB2_uc010kib.1_Intron|TAB2_uc003qmk.3_Intron	NM_015093	NP_055908			mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding				0																		---	---	---	---
PPP1R14C	81706	broad.mit.edu	37	6	150489100	150489101	+	Intron	DEL	CT	-	-	rs74508153		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150489100_150489101delCT	uc003qnt.2	+							NM_030949	NP_112211			protein phosphatase 1, regulatory (inhibitor)						regulation of phosphorylation	cytoplasm|membrane					0		Ovarian(120;0.0284)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;9.14e-12)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152786902	152786903	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152786902_152786903delAC	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qpa.1_Intron|SYNE1_uc003qow.2_5'Flank|SYNE1_uc003qox.1_Intron|SYNE1_uc003qoz.2_Intron|SYNE1_uc003qoy.2_Intron	NM_182961	NP_892006			spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
RGS17	26575	broad.mit.edu	37	6	153420076	153420077	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153420076_153420077insA	uc003qpm.2	-							NM_012419	NP_036551			regulator of G-protein signalling 17						negative regulation of signal transduction	cytoplasm|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			pancreas(1)	1		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)										Lung_Cancer_Familial_Clustering_of				---	---	---	---
IPCEF1	26034	broad.mit.edu	37	6	154527740	154527740	+	Intron	DEL	A	-	-	rs66503762		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154527740delA	uc003qpx.2	-						OPRM1_uc003qpt.1_Intron|IPCEF1_uc003qpv.2_Intron|IPCEF1_uc003qpw.2_Intron|IPCEF1_uc010kjh.2_Intron	NM_015553	NP_056368			phosphoinositide-binding protein PIP3-E isoform						response to oxidative stress	cytoplasm|plasma membrane	oxygen transporter activity|peroxidase activity				0																		---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162484963	162484964	+	Intron	DEL	AC	-	-	rs112746630		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162484963_162484964delAC	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	164387074	164387075	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164387074_164387075insT								QKI (392182 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	164406302	164406302	+	IGR	DEL	C	-	-	rs66514357		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164406302delC								QKI (411410 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	165217961	165217964	+	Intron	DEL	GTGA	-	-	rs68072313		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165217961_165217964delGTGA	uc003qul.1	-											Homo sapiens cDNA FLJ33469 fis, clone BRAMY2002005.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	166308682	166308683	+	Intron	INS	-	AAAT	AAAT	rs138007849	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166308682_166308683insAAAT	uc003qup.1	-											Homo sapiens cDNA FLJ33369 fis, clone BRACE2005904.																														---	---	---	---
FAM20C	56975	broad.mit.edu	37	7	208606	208607	+	Intron	INS	-	G	G	rs147319194		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:208606_208607insG	uc003sip.2	+							NM_020223	NP_064608			family with sequence similarity 20, member C							extracellular region					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)														---	---	---	---
FAM20C	56975	broad.mit.edu	37	7	298051	298051	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:298051delG	uc003sip.2	+						FAM20C_uc011jvn.1_Intron	NM_020223	NP_064608			family with sequence similarity 20, member C							extracellular region					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	506976	506977	+	IGR	INS	-	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:506976_506977insC								FAM20C (206265 upstream) : PDGFA (29922 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	574182	574183	+	IGR	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:574182_574183delAC								PDGFA (14701 upstream) : PRKAR1B (15204 downstream)																																			---	---	---	---
MAD1L1	8379	broad.mit.edu	37	7	2002369	2002369	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2002369delA	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron	NM_001013836	NP_001013858			MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)														---	---	---	---
CHST12	55501	broad.mit.edu	37	7	2466788	2466788	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2466788delC	uc003smc.2	+						CHST12_uc003smd.2_Intron	NM_018641	NP_061111			carbohydrate sulfotransferase 12						dermatan sulfate biosynthetic process	integral to Golgi membrane	3'-phosphoadenosine 5'-phosphosulfate binding|chondroitin 4-sulfotransferase activity|protein binding			kidney(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	3206277	3206278	+	Intron	INS	-	T	T	rs143491495		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3206277_3206278insT	uc003smw.1	-											Homo sapiens hypothetical protein LOC389457, mRNA (cDNA clone IMAGE:5267367).																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	5844854	5844858	+	IGR	DEL	ACTTT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5844854_5844858delACTTT								RNF216 (23562 upstream) : ZNF815 (17933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	9410676	9410676	+	IGR	DEL	A	-	-	rs35807979		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9410676delA								NXPH1 (618084 upstream) : PER4 (263224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	10959840	10959840	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10959840delT								None (None upstream) : NDUFA4 (12975 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	19070099	19070099	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19070099delT								HDAC9 (33115 upstream) : TWIST1 (84994 downstream)																																			---	---	---	---
MACC1	346389	broad.mit.edu	37	7	20245823	20245823	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20245823delT	uc003sus.3	-						MACC1_uc010kug.2_Intron	NM_182762	NP_877439			putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	20880807	20880807	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20880807delT								RPL23P8 (13368 upstream) : SP4 (586882 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	21113108	21113108	+	IGR	DEL	C	-	-	rs66850556		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21113108delC								RPL23P8 (245669 upstream) : SP4 (354581 downstream)																																			---	---	---	---
IGF2BP3	10643	broad.mit.edu	37	7	23456679	23456682	+	Intron	DEL	AAAC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23456679_23456682delAAAC	uc003swg.2	-						IGF2BP3_uc003swh.1_Intron	NM_006547	NP_006538			insulin-like growth factor 2 mRNA binding						anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			ovary(2)	2																		---	---	---	---
IGF2BP3	10643	broad.mit.edu	37	7	23502766	23502766	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23502766delA	uc003swg.2	-						IGF2BP3_uc003swh.1_Intron	NM_006547	NP_006538			insulin-like growth factor 2 mRNA binding						anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	25464013	25464013	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25464013delC								NPVF (195908 upstream) : MIR148A (525526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	25925031	25925031	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25925031delT								NPVF (656926 upstream) : MIR148A (64508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	26619818	26619818	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26619818delA								KIAA0087 (41374 upstream) : C7orf71 (57672 downstream)																																			---	---	---	---
TAX1BP1	8887	broad.mit.edu	37	7	27868618	27868618	+	3'UTR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27868618delT	uc003szl.2	+	17					TAX1BP1_uc011jzo.1_3'UTR|TAX1BP1_uc003szk.2_3'UTR|TAX1BP1_uc011jzp.1_3'UTR	NM_006024	NP_006015			Tax1 (human T-cell leukemia virus type I)						anti-apoptosis|apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production	cytosol	identical protein binding|kinase binding|zinc ion binding			breast(1)	1			GBM - Glioblastoma multiforme(3;0.0823)															---	---	---	---
ZNRF2	223082	broad.mit.edu	37	7	30406585	30406585	+	3'UTR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30406585delA	uc003tat.2	+	5						NM_147128	NP_667339			zinc finger/RING finger 2							cell junction|endosome membrane|lysosomal membrane|presynaptic membrane	ligase activity|zinc ion binding				0																		---	---	---	---
PDE1C	5137	broad.mit.edu	37	7	32128339	32128359	+	Intron	DEL	GACAGGCTCACTCCAGTGAGC	-	-	rs11269781	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32128339_32128359delGACAGGCTCACTCCAGTGAGC	uc003tco.1	-							NM_005020	NP_005011			phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	35381045	35381046	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35381045_35381046delTC								TBX20 (87803 upstream) : HERPUD2 (291226 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	36496574	36496575	+	IGR	INS	-	TATC	TATC	rs145812628	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36496574_36496575insTATC								ANLN (3176 upstream) : AOAH (56035 downstream)																																			---	---	---	---
ELMO1	9844	broad.mit.edu	37	7	37430060	37430060	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37430060delT	uc003tfk.1	-						ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615			engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
C7orf10	79783	broad.mit.edu	37	7	40480558	40480558	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40480558delA	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004			dermal papilla derived protein 13								transferase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	41986379	41986379	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41986379delA								LOC285954 (167405 upstream) : GLI3 (14171 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	44865467	44865467	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44865467delT								PPIA (22752 upstream) : H2AFV (1021 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	47096038	47096039	+	IGR	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47096038_47096039delGT								None (None upstream) : TNS3 (218714 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	48699797	48699797	+	IGR	DEL	T	-	-	rs79675071		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48699797delT								ABCA13 (12706 upstream) : CDC14C (264360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	48902777	48902778	+	IGR	INS	-	T	T	rs142330028	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48902777_48902778insT								ABCA13 (215686 upstream) : CDC14C (61379 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	49346049	49346050	+	IGR	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49346049_49346050delTG								CDC14C (379000 upstream) : VWC2 (467207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52481710	52481713	+	IGR	DEL	AAGA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52481710_52481713delAAGA								None (None upstream) : POM121L12 (621636 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54006507	54006508	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54006507_54006508insA								POM121L12 (901890 upstream) : HPVC1 (262409 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54095098	54095098	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54095098delG								POM121L12 (990481 upstream) : HPVC1 (173819 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54996189	54996189	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54996189delA								SEC61G (169250 upstream) : EGFR (90536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57555622	57555624	+	IGR	DEL	ATC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57555622_57555624delATC								ZNF716 (22357 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57607602	57607602	+	IGR	DEL	C	-	-	rs76455162		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57607602delC								ZNF716 (74337 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57914934	57914935	+	IGR	DEL	CC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57914934_57914935delCC								ZNF716 (381669 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57918643	57918643	+	IGR	DEL	C	-	-	rs77154328		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57918643delC								ZNF716 (385378 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57946474	57946475	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57946474_57946475insT								ZNF716 (413209 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57958635	57958636	+	IGR	INS	-	TTT	TTT	rs143128400		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57958635_57958636insTTT								ZNF716 (425370 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61821497	61821497	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61821497delC								None (None upstream) : LOC643955 (930175 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61893981	61893982	+	IGR	INS	-	A	A	rs138035920	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61893981_61893982insA								None (None upstream) : LOC643955 (857690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61975522	61975522	+	IGR	DEL	A	-	-	rs75673613	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61975522delA								None (None upstream) : LOC643955 (776150 downstream)																																			---	---	---	---
VKORC1L1	154807	broad.mit.edu	37	7	65409904	65409904	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65409904delA	uc003tul.2	+						VKORC1L1_uc011kds.1_Intron	NM_173517	NP_775788			vitamin K epoxide reductase complex, subunit							integral to membrane					0		Lung NSC(55;0.197)			Menadione(DB00170)|Warfarin(DB00682)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	65961231	65961232	+	IGR	INS	-	G	G	rs150633754	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65961231_65961232insG								NCRNA00174 (95836 upstream) : LOC493754 (32214 downstream)																																			---	---	---	---
LOC493754	493754	broad.mit.edu	37	7	66006077	66006079	+	Intron	DEL	AGG	-	-	rs66924815		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66006077_66006079delAGG	uc010lac.1	-						LOC493754_uc010lad.2_Intron					Homo sapiens cDNA FLJ14309 fis, clone PLACE3000221.												0																		---	---	---	---
LOC729156	729156	broad.mit.edu	37	7	66282053	66282053	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66282053delT	uc003tvj.1	-							NR_003934				Homo sapiens cDNA FLJ36054 fis, clone TESTI2018290.												0																		---	---	---	---
TYW1	55253	broad.mit.edu	37	7	66617038	66617040	+	Intron	DEL	TCT	-	-	rs34535941		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66617038_66617040delTCT	uc003tvn.2	+						TYW1_uc010lai.2_Intron|TYW1_uc011kef.1_Intron	NM_018264	NP_060734			radical S-adenosyl methionine and flavodoxin						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	66947334	66947335	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66947334_66947335delTC								STAG3L4 (160822 upstream) : None (None downstream)																																			---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69815904	69815905	+	Intron	DEL	TA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69815904_69815905delTA	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
WBSCR17	64409	broad.mit.edu	37	7	70606827	70606830	+	Intron	DEL	TGTG	-	-	rs34121771		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70606827_70606830delTGTG	uc003tvy.2	+							NM_022479	NP_071924			UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	72835068	72835069	+	IGR	DEL	AA	-	-	rs79101532		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72835068_72835069delAA								FKBP6 (62427 upstream) : FZD9 (13040 downstream)																																			---	---	---	---
MLXIPL	51085	broad.mit.edu	37	7	73025162	73025162	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73025162delT	uc003tyn.1	-						MLXIPL_uc003tyk.1_Intron|MLXIPL_uc003tyl.1_Intron|MLXIPL_uc003tym.1_Intron|MLXIPL_uc003tyo.1_Intron|MLXIPL_uc003typ.1_Intron	NM_032951	NP_116569			Williams Beuren syndrome chromosome region 14						anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	73090315	73090316	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73090315_73090316insT								VPS37D (3876 upstream) : DNAJC30 (4932 downstream)																																			---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73660729	73660729	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73660729delA	uc003uaj.2	-						RFC2_uc011kfa.1_Intron|RFC2_uc003uak.2_Intron|RFC2_uc010lbp.2_Intron|RFC2_uc003ual.2_Intron	NM_181471	NP_852136			replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	74065169	74065170	+	IGR	DEL	GA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74065169_74065170delGA								GTF2IRD1 (48251 upstream) : GTF2I (6860 downstream)																																			---	---	---	---
HIP1	3092	broad.mit.edu	37	7	75280860	75280860	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75280860delG	uc003uds.1	-							NM_005338	NP_005329			huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8								T	PDGFRB	CMML								---	---	---	---
Unknown	0	broad.mit.edu	37	7	76932150	76932150	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76932150delT								CCDC146 (7631 upstream) : PION (7920 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	81153270	81153270	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81153270delA								SEMA3C (601595 upstream) : HGF (178175 downstream)																																			---	---	---	---
CACNA2D1	781	broad.mit.edu	37	7	81666796	81666796	+	Intron	DEL	A	-	-	rs113083970		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81666796delA	uc003uhr.1	-							NM_000722	NP_000713			calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)													---	---	---	---
CACNA2D1	781	broad.mit.edu	37	7	81983825	81983825	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81983825delA	uc003uhr.1	-							NM_000722	NP_000713			calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)													---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82728633	82728633	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82728633delA	uc003uhx.2	-						PCLO_uc003uhv.2_Intron	NM_033026	NP_149015			piccolo isoform 1						cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	83390219	83390220	+	IGR	INS	-	A	A	rs148078566	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83390219_83390220insA								SEMA3E (111895 upstream) : SEMA3A (197445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	84492394	84492394	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84492394delG								SEMA3A (668177 upstream) : SEMA3D (132480 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85723667	85723668	+	IGR	INS	-	A	A	rs145635765	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85723667_85723668insA								SEMA3D (907496 upstream) : GRM3 (549562 downstream)																																			---	---	---	---
KIAA1324L	222223	broad.mit.edu	37	7	86536402	86536403	+	Intron	DEL	TA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86536402_86536403delTA	uc011kha.1	-						KIAA1324L_uc003uif.1_Intron|KIAA1324L_uc011kgz.1_Intron|KIAA1324L_uc003uie.2_Intron	NM_001142749	NP_001136221			hypothetical protein LOC222223 isoform 1							integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)																	---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88695565	88695566	+	Intron	INS	-	T	T	rs150350171	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88695565_88695566insT	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90115782	90115782	+	Intron	DEL	T	-	-	rs17864038		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90115782delT	uc003ukt.1	+							NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	92585224	92585225	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92585224_92585225insA								CDK6 (119283 upstream) : SAMD9 (143607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	92604387	92604388	+	IGR	DEL	AC	-	-	rs72001208		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92604387_92604388delAC								CDK6 (138446 upstream) : SAMD9 (124444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	95320079	95320079	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95320079delT								PDK4 (94154 upstream) : DYNC1I1 (81739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	97255254	97255255	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97255254_97255255insT								ACN9 (444181 upstream) : TAC1 (106016 downstream)																																			---	---	---	---
BAIAP2L1	55971	broad.mit.edu	37	7	97960147	97960148	+	Intron	DEL	CT	-	-	rs141771288		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97960147_97960148delCT	uc003upj.2	-							NM_018842	NP_061330			BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
BAIAP2L1	55971	broad.mit.edu	37	7	98032871	98032872	+	5'Flank	INS	-	AG	AG			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98032871_98032872insAG	uc003upj.2	-							NM_018842	NP_061330			BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
TRRAP	8295	broad.mit.edu	37	7	98515744	98515744	+	Intron	DEL	A	-	-	rs72457326		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98515744delA	uc003upp.2	+						TRRAP_uc011kis.1_Intron|TRRAP_uc003upr.2_Intron	NM_003496	NP_003487			transformation/transcription domain-associated						histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	99406076	99406076	+	IGR	DEL	T	-	-	rs112026678		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99406076delT								CYP3A4 (24268 upstream) : CYP3A43 (19560 downstream)																																			---	---	---	---
AGFG2	3268	broad.mit.edu	37	7	100157441	100157442	+	Intron	INS	-	AA	AA			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100157441_100157442insAA	uc003uvf.2	+						AGFG2_uc010lgy.2_Intron	NM_006076	NP_006067			ArfGAP with FG repeats 2						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	101421021	101421022	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101421021_101421022delTC								MYL10 (148445 upstream) : CUX1 (38270 downstream)																																			---	---	---	---
CUX1	1523	broad.mit.edu	37	7	101471987	101471988	+	Intron	INS	-	G	G	rs143329702	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101471987_101471988insG	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530			cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
CUX1	1523	broad.mit.edu	37	7	101515136	101515136	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101515136delA	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530			cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
CUX1	1523	broad.mit.edu	37	7	101557649	101557656	+	Intron	DEL	TCCCTCCC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101557649_101557656delTCCCTCCC	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530			cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
POLR2J	5439	broad.mit.edu	37	7	102116771	102116772	+	Intron	DEL	CT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102116771_102116772delCT	uc003uzp.1	-							NM_006234	NP_006225			DNA directed RNA polymerase II polypeptide J						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|LRR domain binding|protein dimerization activity			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	102801251	102801251	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102801251delT								NAPEPLD (11244 upstream) : DPY19L2P2 (14213 downstream)																																			---	---	---	---
SLC26A5	375611	broad.mit.edu	37	7	103080011	103080012	+	Intron	DEL	CA	-	-	rs35040423		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103080011_103080012delCA	uc003vbz.2	-						SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_Intron|SLC26A5_uc003vbx.2_Intron|SLC26A5_uc003vby.2_Intron|SLC26A5_uc010liy.2_Intron	NM_198999	NP_945350			prestin isoform a						regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	105696122	105696122	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105696122delA								CDHR3 (19246 upstream) : SYPL1 (34831 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	106289571	106289572	+	Intron	INS	-	AC	AC	rs149714036	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106289571_106289572insAC	uc003vds.2	-											Homo sapiens full length insert cDNA clone ZC44D09.																														---	---	---	---
LAMB1	3912	broad.mit.edu	37	7	107582101	107582101	+	Intron	DEL	T	-	-	rs67531076		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107582101delT	uc003vew.2	-						LAMB1_uc003vev.2_Intron	NM_002291	NP_002282			laminin, beta 1 precursor						axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	113691008	113691008	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113691008delT								PPP1R3A (131926 upstream) : FOXP2 (35374 downstream)																																			---	---	---	---
CAV1	857	broad.mit.edu	37	7	116084437	116084437	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116084437delA	uc010lkd.1	+						CAV2_uc003vhv.2_Intron|CAV2_uc003vhw.2_Intron|CAV2_uc003vhx.2_Intron|CAV2_uc010lkb.1_Intron|CAV2_uc010lkc.2_Intron|CAV2_uc003vib.2_Intron|CAV2_uc003vhz.2_Intron|CAV2_uc003via.2_Intron|CAV1_uc010lke.1_Intron	NM_001753	NP_001744			caveolin 1						blood coagulation|calcium ion transport|caveola assembly|cellular response to starvation|cholesterol homeostasis|cytosolic calcium ion homeostasis|inactivation of MAPK activity|interspecies interaction between organisms|leukocyte migration|lipid storage|maintenance of protein location in cell|mammary gland involution|membrane depolarization|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of endothelial cell proliferation|negative regulation of epithelial cell differentiation|negative regulation of nitric oxide biosynthetic process|negative regulation of peptidyl-serine phosphorylation|negative regulation of protein binding|negative regulation of transcription from RNA polymerase II promoter|nitric oxide homeostasis|nitric oxide metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of metalloenzyme activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of vasoconstriction|protein homooligomerization|receptor internalization|regulation of blood coagulation|regulation of fatty acid metabolic process|regulation of nitric-oxide synthase activity|regulation of smooth muscle contraction|response to calcium ion|response to estrogen stimulus|response to hypoxia|response to progesterone stimulus|skeletal muscle tissue development|T cell costimulation|triglyceride metabolic process|vasculogenesis|vesicle organization	apical plasma membrane|basolateral plasma membrane|caveola|caveola|cytosol|endoplasmic reticulum|endosome|Golgi membrane|lipid particle|perinuclear region of cytoplasm	cholesterol binding|nitric-oxide synthase binding|peptidase activator activity|protein binding|protein complex scaffold|receptor binding				0	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)															---	---	---	---
ST7	7982	broad.mit.edu	37	7	116771509	116771509	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116771509delG	uc003vin.2	+						ST7_uc011knl.1_Intron|ST7_uc003vio.2_Intron|ST7_uc003viq.2_Intron|ST7_uc011knm.1_Intron|ST7_uc003vir.2_Intron|ST7OT2_uc003viu.2_Intron|ST7_uc011knn.1_Intron|ST7OT2_uc003viw.2_Intron|ST7_uc003vix.1_Intron	NM_021908	NP_068708			suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	116888828	116888828	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116888828delT								ST7 (18755 upstream) : WNT2 (27860 downstream)																																			---	---	---	---
KCND2	3751	broad.mit.edu	37	7	120112617	120112618	+	Intron	DEL	AC	-	-	rs34841098		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120112617_120112618delAC	uc003vjj.1	+							NM_012281	NP_036413			potassium voltage-gated channel, Shal-related						regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)																	---	---	---	---
PTPRZ1	5803	broad.mit.edu	37	7	121530889	121530890	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121530889_121530890insT	uc003vjy.2	+						PTPRZ1_uc003vjz.2_Intron	NM_002851	NP_002842			protein tyrosine phosphatase, receptor-type,						central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9																		---	---	---	---
PTPRZ1	5803	broad.mit.edu	37	7	121612216	121612216	+	Intron	DEL	T	-	-	rs35457086		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121612216delT	uc003vjy.2	+						PTPRZ1_uc003vjz.2_Intron	NM_002851	NP_002842			protein tyrosine phosphatase, receptor-type,						central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	122601492	122601493	+	IGR	DEL	TT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122601492_122601493delTT								CADPS2 (74938 upstream) : TAS2R16 (33266 downstream)																																			---	---	---	---
WASL	8976	broad.mit.edu	37	7	123373968	123373970	+	Intron	DEL	AAA	-	-	rs33913069		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123373968_123373970delAAA	uc003vkz.2	-							NM_003941	NP_003932			Wiskott-Aldrich syndrome gene-like protein						actin polymerization or depolymerization|axon guidance|cellular component movement|nitric oxide metabolic process|protein complex assembly|regulation of nitric-oxide synthase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|cytosol|nucleolus|plasma membrane	actin binding|small GTPase regulator activity				0																		---	---	---	---
GPR37	2861	broad.mit.edu	37	7	124408474	124408474	+	5'Flank	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124408474delT	uc003vli.2	-							NM_005302	NP_005293			G protein-coupled receptor 37 precursor							endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	124767182	124767183	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124767182_124767183delAC	uc010lkx.1	+						uc003vlp.2_Intron|uc003vlq.1_Intron					Homo sapiens cDNA FLJ33356 fis, clone BRACE2005160.																														---	---	---	---
SND1	27044	broad.mit.edu	37	7	127314964	127314964	+	Intron	DEL	A	-	-	rs11334816		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127314964delA	uc003vmi.2	+							NM_014390	NP_055205			staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
SND1	27044	broad.mit.edu	37	7	127698343	127698343	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127698343delT	uc003vmi.2	+						SND1_uc010lle.2_Intron|uc010llg.1_5'Flank	NM_014390	NP_055205			staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
KLHDC10	23008	broad.mit.edu	37	7	129762856	129762857	+	Intron	INS	-	ATGG	ATGG	rs148285640	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129762856_129762857insATGG	uc003vpj.1	+						KLHDC10_uc003vpk.1_Intron|KLHDC10_uc010lmb.1_Intron	NM_014997	NP_055812			kelch domain containing 10												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	131701927	131701930	+	IGR	DEL	AAAC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131701927_131701930delAAAC								PODXL (460551 upstream) : PLXNA4 (106162 downstream)																																			---	---	---	---
LRGUK	136332	broad.mit.edu	37	7	133837715	133837718	+	Intron	DEL	AAGA	-	-	rs34341084		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133837715_133837718delAAGA	uc003vrm.1	+							NM_144648	NP_653249			leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	134279138	134279138	+	IGR	DEL	A	-	-	rs140746803		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134279138delA								AKR1B15 (14838 upstream) : BPGM (52393 downstream)																																			---	---	---	---
AGBL3	340351	broad.mit.edu	37	7	134697493	134697494	+	Intron	DEL	AA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134697493_134697494delAA	uc011kpw.1	+							NM_178563	NP_848658			carboxypeptidase 3, cytosolic						proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding				0																		---	---	---	---
HIPK2	28996	broad.mit.edu	37	7	139318697	139318697	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139318697delA	uc003vvf.3	-						HIPK2_uc003vvd.3_Intron	NM_022740	NP_073577			homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	142773307	142773307	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142773307delA								OR6W1P (12425 upstream) : PIP (55867 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	142851516	142851516	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142851516delA								PIP (14682 upstream) : TAS2R39 (28996 downstream)																																			---	---	---	---
TPK1	27010	broad.mit.edu	37	7	144447724	144447725	+	Intron	DEL	AA	-	-	rs10617992		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144447724_144447725delAA	uc003weq.2	-						TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890			thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	144618133	144618133	+	IGR	DEL	A	-	-	rs66847975		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144618133delA								TPK1 (84987 upstream) : None (None downstream)																																			---	---	---	---
KRBA1	84626	broad.mit.edu	37	7	149414261	149414262	+	Intron	DEL	CT	-	-	rs72280609		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149414261_149414262delCT	uc003wfz.2	+						KRBA1_uc010lpj.2_Intron|KRBA1_uc003wga.2_5'Flank	NM_032534	NP_115923			KRAB A domain containing 1											ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)															---	---	---	---
SSPO	23145	broad.mit.edu	37	7	149530271	149530272	+	Intron	DEL	TT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149530271_149530272delTT	uc010lpk.2	+							NM_198455	NP_940857			SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)															---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152111340	152111343	+	Intron	DEL	TGGC	-	-	rs141489729		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152111340_152111343delTGGC	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	7	152913891	152913891	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152913891delG								ACTR3B (361428 upstream) : DPP6 (670528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155012995	155012996	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155012995_155012996insT								HTR5A (135536 upstream) : INSIG1 (76490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155120873	155120874	+	IGR	DEL	CT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155120873_155120874delCT								INSIG1 (18931 upstream) : EN2 (129950 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155853818	155853819	+	IGR	INS	-	TGTA	TGTA			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155853818_155853819insTGTA								SHH (248851 upstream) : C7orf4 (479366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	156012204	156012206	+	IGR	DEL	CTC	-	-	rs35000995		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156012204_156012206delCTC								SHH (407237 upstream) : C7orf4 (320979 downstream)																																			---	---	---	---
LMBR1	64327	broad.mit.edu	37	7	156661356	156661356	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156661356delC	uc003wmw.3	-						LMBR1_uc003wmx.3_Intron|LMBR1_uc010lqn.2_Intron|LMBR1_uc011kvx.1_Intron|LMBR1_uc010lqo.2_Intron	NM_022458	NP_071903			limb region 1 protein							integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157664456	157664457	+	Intron	INS	-	AC	AC	rs144520789	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157664456_157664457insAC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157811070	157811071	+	Intron	DEL	CT	-	-	rs139253548		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157811070_157811071delCT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157912307	157912308	+	Intron	DEL	GA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157912307_157912308delGA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
NCAPG2	54892	broad.mit.edu	37	7	158450842	158450842	+	Intron	DEL	A	-	-	rs67715294		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158450842delA	uc003wnv.1	-						NCAPG2_uc010lqu.1_Intron|NCAPG2_uc003wnw.1_Intron|NCAPG2_uc003wnx.1_Intron|NCAPG2_uc011kwe.1_Intron|NCAPG2_uc011kwc.1_Intron|NCAPG2_uc011kwd.1_Intron	NM_017760	NP_060230			leucine zipper protein 5						cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	1442893	1442893	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1442893delA								ERICH1 (761667 upstream) : DLGAP2 (6676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2214614	2214614	+	IGR	DEL	A	-	-	rs35938363		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2214614delA								MYOM2 (121235 upstream) : CSMD1 (578262 downstream)																																			---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	4407852	4407853	+	Intron	DEL	CA	-	-	rs113175561		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4407852_4407853delCA	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	7339348	7339348	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7339348delA								DEFB104A (6744 upstream) : DEFB106A (678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	7999307	7999307	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7999307delC								MIR548I3 (52696 upstream) : FLJ10661 (86785 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9328092	9328099	+	IGR	DEL	GATAGATA	-	-	rs71915029		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9328092_9328099delGATAGATA								PPP1R3B (319008 upstream) : TNKS (85346 downstream)																																			---	---	---	---
XKR6	286046	broad.mit.edu	37	8	10998407	10998408	+	Intron	INS	-	A	A	rs76615554		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10998407_10998408insA	uc003wtk.1	-							NM_173683	NP_775954			XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	28135824	28135824	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28135824delA								ELP3 (87157 upstream) : PNOC (38825 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	29889623	29889623	+	IGR	DEL	T	-	-	rs74421684		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29889623delT								LOC286135 (78502 upstream) : TMEM66 (31009 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	30203363	30203363	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30203363delC								DCTN6 (162304 upstream) : RBPMS (38581 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	32671800	32671801	+	IGR	INS	-	AC	AC	rs147871531	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32671800_32671801insAC								NRG1 (49242 upstream) : FUT10 (556545 downstream)																																			---	---	---	---
FUT10	84750	broad.mit.edu	37	8	33313422	33313422	+	Intron	DEL	A	-	-	rs67865907		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33313422delA	uc003xje.2	-						FUT10_uc003xjc.2_5'Flank|FUT10_uc003xjd.2_Intron|FUT10_uc011lbi.1_Intron|FUT10_uc003xjf.2_Intron|FUT10_uc003xjg.2_Intron|FUT10_uc003xjh.2_Intron|FUT10_uc003xji.1_Intron	NM_032664	NP_116053			fucosyltransferase 10						embryo development|fertilization|hemopoiesis|L-fucose catabolic process|nervous system development|protein folding|protein glycosylation|protein targeting|wound healing	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			ovary(1)|pancreas(1)	2				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	35049410	35049411	+	IGR	DEL	AG	-	-	rs35043786		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35049410_35049411delAG								None (None upstream) : UNC5D (43564 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	35994041	35994044	+	IGR	DEL	GTGT	-	-	rs73673231		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35994041_35994044delGTGT								UNC5D (341861 upstream) : KCNU1 (647798 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	36944417	36944417	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36944417delT								KCNU1 (150776 upstream) : ZNF703 (608884 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	39766256	39766257	+	IGR	INS	-	AAAC	AAAC	rs138204975	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39766256_39766257insAAAC								ADAM2 (70477 upstream) : IDO1 (5071 downstream)																																			---	---	---	---
IDO2	169355	broad.mit.edu	37	8	39817848	39817849	+	Intron	INS	-	CTC	CTC	rs141548742	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39817848_39817849insCTC	uc010lwy.1	+						IDO2_uc003xno.1_Intron	NM_194294	NP_919270			indoleamine-pyrrole 2,3 dioxygenase-like 1						tryptophan catabolic process to kynurenine	cytosol	heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			ovary(2)	2																		---	---	---	---
SFRP1	6422	broad.mit.edu	37	8	41164000	41164001	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41164000_41164001delAC	uc003xnt.2	-							NM_003012	NP_003003			secreted frizzled-related protein 1 precursor						brain development|canonical Wnt receptor signaling pathway|cellular response to BMP stimulus|cellular response to estradiol stimulus|cellular response to fibroblast growth factor stimulus|cellular response to heparin|cellular response to hypoxia|cellular response to interleukin-1|cellular response to prostaglandin E stimulus|cellular response to starvation|cellular response to transforming growth factor beta stimulus|cellular response to tumor necrosis factor|cellular response to vitamin D|DNA fragmentation involved in apoptotic nuclear change|dorsal/ventral axis specification|hemopoietic progenitor cell differentiation|hemopoietic stem cell differentiation|menstrual cycle phase|negative regulation of androgen receptor signaling pathway|negative regulation of B cell differentiation|negative regulation of bone remodeling|negative regulation of canonical Wnt receptor signaling pathway involved in controlling type B pancreatic cell proliferation|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cysteine-type endopeptidase activity|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast apoptosis|negative regulation of fibroblast proliferation|negative regulation of insulin secretion|negative regulation of ossification|negative regulation of osteoblast proliferation|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|osteoblast differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell growth|positive regulation of epithelial cell proliferation|positive regulation of fat cell differentiation|positive regulation of fibroblast apoptosis|positive regulation of focal adhesion assembly|positive regulation of non-canonical Wnt receptor signaling pathway|positive regulation of Rac GTPase activity|positive regulation of smoothened signaling pathway|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|regulation of angiogenesis|regulation of cell cycle process|response to drug|response to organic cyclic compound|vasculature development	cell surface|cytosol|extracellular space|plasma membrane|proteinaceous extracellular matrix	cysteine-type endopeptidase activity|drug binding|frizzled binding|heparin binding|identical protein binding|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	41276544	41276544	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41276544delA								SFRP1 (109564 upstream) : GOLGA7 (71537 downstream)																																			---	---	---	---
POLB	5423	broad.mit.edu	37	8	42228944	42228944	+	Intron	DEL	T	-	-	rs79893094		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42228944delT	uc003xoz.1	+						POLB_uc003xpa.1_Intron|POLB_uc011lcs.1_Intron	NM_002690	NP_002681			DNA-directed DNA polymerase beta						DNA-dependent DNA replication	cytoplasm|nucleoplasm|spindle microtubule	DNA-(apurinic or apyrimidinic site) lyase activity|DNA-directed DNA polymerase activity|enzyme binding|metal ion binding|microtubule binding			ovary(1)|breast(1)	2	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)								DNA_polymerases_(catalytic_subunits)					---	---	---	---
SLC20A2	6575	broad.mit.edu	37	8	42372287	42372288	+	Intron	INS	-	A	A	rs112188608		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42372287_42372288insA	uc010lxm.2	-						SLC20A2_uc003xpe.2_Intron	NM_006749	NP_006740			solute carrier family 20, member 2						interspecies interaction between organisms	integral to plasma membrane|membrane fraction	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			ovary(2)	2	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)															---	---	---	---
KIAA0146	23514	broad.mit.edu	37	8	48288629	48288629	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48288629delT	uc003xqd.2	+						KIAA0146_uc011lcz.1_Intron|KIAA0146_uc011lda.1_Intron|KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron	NM_001080394	NP_001073863			hypothetical protein LOC23514												0		Lung NSC(58;0.175)																---	---	---	---
PRKDC	5591	broad.mit.edu	37	8	48853690	48853690	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48853690delA	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835			protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)											NHEJ					---	---	---	---
Unknown	0	broad.mit.edu	37	8	52170030	52170031	+	IGR	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52170030_52170031delAC								SNTG1 (464603 upstream) : PXDNL (62113 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	54543999	54544006	+	IGR	DEL	AGATAGAT	-	-	rs145878711	by1000genomes;byFrequency	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54543999_54544006delAGATAGAT								OPRK1 (379805 upstream) : ATP6V1H (84110 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	55362651	55362652	+	IGR	DEL	AC	-	-	rs35944577		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55362651_55362652delAC								MRPL15 (301577 upstream) : SOX17 (7843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	58259830	58259830	+	RNA	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58259830delG	uc003xth.2	+	4		c.826delG								Homo sapiens cDNA clone IMAGE:5267652.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	60048079	60048079	+	IGR	DEL	A	-	-	rs11354374		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60048079delA								TOX (16312 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	60470986	60470986	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60470986delA								TOX (439219 upstream) : CA8 (630437 downstream)																																			---	---	---	---
CLVS1	157807	broad.mit.edu	37	8	62251524	62251525	+	Intron	DEL	TG	-	-	rs71689192		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62251524_62251525delTG	uc003xuh.2	+						CLVS1_uc003xug.2_Intron|CLVS1_uc003xui.2_Intron|CLVS1_uc010lyp.2_Intron	NM_173519	NP_775790			retinaldehyde binding protein 1-like 1						lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	64466117	64466118	+	IGR	DEL	AA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64466117_64466118delAA								YTHDF3 (340772 upstream) : MIR124-2 (825588 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	64807504	64807504	+	IGR	DEL	C	-	-	rs11343481		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64807504delC								YTHDF3 (682159 upstream) : MIR124-2 (484202 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	64832095	64832096	+	IGR	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64832095_64832096delTG								YTHDF3 (706750 upstream) : MIR124-2 (459610 downstream)																																			---	---	---	---
TRIM55	84675	broad.mit.edu	37	8	67046170	67046171	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67046170_67046171delAC	uc003xvv.2	+						TRIM55_uc003xvu.2_Intron|TRIM55_uc003xvw.2_Intron|TRIM55_uc003xvx.2_Intron	NM_184085	NP_908973			tripartite motif-containing 55 isoform 1							cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	67312667	67312667	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67312667delT								CRH (221969 upstream) : RRS1 (28596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	70085074	70085075	+	IGR	INS	-	TTCTT	TTCTT	rs142932966	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70085074_70085075insTTCTT								C8orf34 (353818 upstream) : SULF1 (293784 downstream)																																			---	---	---	---
SLCO5A1	81796	broad.mit.edu	37	8	70633412	70633422	+	Intron	DEL	ACTGGACTGCC	-	-	rs6150643		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70633412_70633422delACTGGACTGCC	uc003xyl.2	-						SLCO5A1_uc010lzb.2_Intron|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Intron|SLCO5A1_uc010lzc.2_Intron	NM_030958	NP_112220			solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)															---	---	---	---
EYA1	2138	broad.mit.edu	37	8	72243095	72243096	+	Intron	INS	-	GC	GC			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72243095_72243096insGC	uc003xys.3	-						EYA1_uc003xyr.3_Intron|EYA1_uc003xyt.3_Intron|EYA1_uc010lzf.2_Intron|EYA1_uc003xyu.2_Intron|EYA1_uc011lfe.1_Intron|EYA1_uc003xyv.2_Intron	NM_172058	NP_742055			eyes absent 1 isoform b						double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)															---	---	---	---
KCNB2	9312	broad.mit.edu	37	8	73822678	73822678	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73822678delA	uc003xzb.2	+							NM_004770	NP_004761			potassium voltage-gated channel, Shab-related						regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)															---	---	---	---
HNF4G	3174	broad.mit.edu	37	8	76415588	76415589	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76415588_76415589delAC	uc003yaq.2	+						HNF4G_uc003yap.1_Intron	NM_004133	NP_004124			hepatocyte nuclear factor 4, gamma						endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	76825292	76825293	+	IGR	DEL	AG	-	-	rs71275718		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76825292_76825293delAG								HNF4G (346233 upstream) : LOC100192378 (697822 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78945000	78945000	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78945000delT								None (None upstream) : PKIA (483336 downstream)																																			---	---	---	---
IL7	3574	broad.mit.edu	37	8	79662469	79662469	+	Intron	DEL	A	-	-	rs139998786	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79662469delA	uc003ybg.2	-						IL7_uc003ybe.2_Intron|IL7_uc011lfm.1_Intron|IL7_uc003ybh.2_Intron|IL7_uc003ybi.3_Intron	NM_000880	NP_000871			interleukin 7 precursor						bone resorption|cell-cell signaling|humoral immune response|organ morphogenesis|positive regulation of B cell proliferation|positive regulation of T cell differentiation	extracellular space	cytokine activity|growth factor activity|interleukin-7 receptor binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	79738355	79738356	+	IGR	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79738355_79738356delTG								IL7 (20597 upstream) : STMN2 (785024 downstream)																																			---	---	---	---
MRPS28	28957	broad.mit.edu	37	8	80933242	80933242	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80933242delT	uc003ybp.2	-						MRPS28_uc003ybo.2_Intron|TPD52_uc010lzr.2_Intron	NM_014018	NP_054737			mitochondrial ribosomal protein S28							mitochondrial small ribosomal subunit					0	Lung NSC(7;1.86e-06)|all_lung(9;6.91e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00769)|Epithelial(68;0.0208)|all cancers(69;0.0805)															---	---	---	---
CA13	377677	broad.mit.edu	37	8	86151424	86151425	+	Intron	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86151424_86151425delTG	uc003ydf.1	+											Homo sapiens cDNA FLJ36434 fis, clone THYMU2012002.						one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0																		---	---	---	---
CALB1	793	broad.mit.edu	37	8	91094033	91094034	+	Intron	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91094033_91094034delTC	uc003yel.1	-						CALB1_uc003yem.1_Intron|CALB1_uc011lge.1_5'Flank	NM_004929	NP_004920			calbindin 1							nucleus	calcium ion binding|vitamin D binding			pancreas(1)	1			BRCA - Breast invasive adenocarcinoma(11;0.00953)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	91509316	91509316	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91509316delT								CALB1 (401629 upstream) : TMEM64 (124907 downstream)																																			---	---	---	---
TMEM55A	55529	broad.mit.edu	37	8	92055807	92055807	+	5'Flank	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92055807delT	uc003yes.2	-							NM_018710	NP_061180			transmembrane protein 55A							integral to membrane|late endosome membrane|lysosomal membrane	hydrolase activity				0			BRCA - Breast invasive adenocarcinoma(11;0.033)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	94198424	94198424	+	IGR	DEL	A	-	-	rs75517518		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94198424delA								C8orf83 (168523 upstream) : FAM92A1 (514349 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	94372824	94372825	+	IGR	INS	-	AC	AC	rs144943727	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94372824_94372825insAC								C8orf83 (342923 upstream) : FAM92A1 (339948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	96605013	96605013	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96605013delT								C8orf37 (323576 upstream) : GDF6 (549547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	98870479	98870479	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98870479delT								LAPTM4B (5650 upstream) : MATN2 (10832 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	101385084	101385084	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101385084delA								RNF19A (62757 upstream) : ANKRD46 (136903 downstream)																																			---	---	---	---
UBR5	51366	broad.mit.edu	37	8	103378273	103378273	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103378273delA	uc003ykr.1	-						UBR5_uc003yks.1_Intron	NM_015902	NP_056986			ubiquitin protein ligase E3 component n-recognin						cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	103508735	103508735	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103508735delA								UBR5 (84240 upstream) : ODF1 (55113 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	111547041	111547042	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:111547041_111547042delTC								KCNV1 (558965 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	112239437	112239438	+	IGR	DEL	TG	-	-	rs67706393		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:112239437_112239438delTG								None (None upstream) : CSMD3 (995723 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	117586531	117586531	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117586531delA								TRPS1 (905303 upstream) : EIF3H (70525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	117643722	117643722	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117643722delC								TRPS1 (962494 upstream) : EIF3H (13334 downstream)																																			---	---	---	---
SAMD12	401474	broad.mit.edu	37	8	119469634	119469634	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119469634delT	uc003yom.2	-						SAMD12_uc010mda.1_Intron|SAMD12_uc010mdb.1_Intron	NM_207506	NP_997389			sterile alpha motif domain containing 12 isoform											ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	120036819	120036820	+	IGR	DEL	AC	-	-	rs111968537		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120036819_120036820delAC								TNFRSF11B (72436 upstream) : COLEC10 (42604 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	122021770	122021770	+	IGR	DEL	A	-	-	rs34753327		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122021770delA								SNTB1 (197461 upstream) : HAS2 (603501 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	122724935	122724936	+	IGR	DEL	AT	-	-	rs34131260		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122724935_122724936delAT								HAS2AS (68002 upstream) : None (None downstream)																																			---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125722697	125722697	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125722697delA	uc003yrk.2	-						MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566			metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	126584217	126584217	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126584217delA								TRIB1 (133575 upstream) : FAM84B (980470 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128188337	128188355	+	IGR	DEL	CTAGAACATGGGCTCCATG	-	-	rs148874372		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128188337_128188355delCTAGAACATGGGCTCCATG								FAM84B (617871 upstream) : LOC727677 (113707 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129304435	129304435	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129304435delT								MIR1208 (142001 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	130130260	130130261	+	IGR	INS	-	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130130260_130130261insC								MIR1208 (967826 upstream) : GSDMC (630182 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	130377733	130377734	+	IGR	INS	-	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130377733_130377734insC								None (None upstream) : GSDMC (382709 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	131554392	131554394	+	IGR	DEL	AGG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131554392_131554394delAGG								ASAP1 (140176 upstream) : ADCY8 (238154 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	131566547	131566547	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131566547delT								ASAP1 (152331 upstream) : ADCY8 (226001 downstream)																																			---	---	---	---
EFR3A	23167	broad.mit.edu	37	8	132932932	132932932	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132932932delT	uc003yte.2	+							NM_015137	NP_055952			EFR3 homolog A							plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)															---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133260217	133260218	+	Intron	INS	-	TAT	TAT	rs149364452	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133260217_133260218insTAT	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133409230	133409231	+	Intron	DEL	AG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133409230_133409231delAG	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
TG	7038	broad.mit.edu	37	8	134104170	134104171	+	Intron	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134104170_134104171delTG	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron|SLA_uc003ytz.2_Intron|SLA_uc011lje.1_Intron|SLA_uc011ljf.1_Intron|SLA_uc011ljg.1_Intron|SLA_uc010mea.2_Intron	NM_003235	NP_003226			thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)														---	---	---	---
NDRG1	10397	broad.mit.edu	37	8	134292668	134292669	+	Intron	INS	-	T	T	rs34104549		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134292668_134292669insT	uc003yuh.2	-						NDRG1_uc003yug.2_Intron|NDRG1_uc010mee.2_Intron|NDRG1_uc010mef.2_Intron|NDRG1_uc011ljh.1_Intron|NDRG1_uc011lji.1_Intron	NM_001135242	NP_001128714			N-myc downstream regulated 1						cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	134435650	134435651	+	IGR	DEL	AC	-	-	rs72126273		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134435650_134435651delAC								NDRG1 (126103 upstream) : ST3GAL1 (31440 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135276290	135276291	+	IGR	INS	-	A	A	rs140943625	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135276290_135276291insA								ST3GAL1 (692107 upstream) : ZFAT (213742 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135369950	135369954	+	IGR	DEL	CTCAG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135369950_135369954delCTCAG								ST3GAL1 (785767 upstream) : ZFAT (120079 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	136370233	136370235	+	IGR	DEL	GTT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136370233_136370235delGTT								LOC286094 (58274 upstream) : KHDRBS3 (99481 downstream)																																			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139643939	139643940	+	Intron	INS	-	G	G	rs149488217	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139643939_139643940insG	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	139970431	139970432	+	IGR	DEL	TG	-	-	rs34053716		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139970431_139970432delTG								COL22A1 (44195 upstream) : KCNK9 (642650 downstream)																																			---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	140840346	140840347	+	Intron	INS	-	AC	AC	rs148886474	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140840346_140840347insAC	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	141530800	141530800	+	IGR	DEL	A	-	-	rs33974530		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141530800delA								CHRAC1 (3548 upstream) : EIF2C2 (10465 downstream)																																			---	---	---	---
TSNARE1	203062	broad.mit.edu	37	8	143382818	143382820	+	Intron	DEL	CCC	-	-	rs113725850		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143382818_143382820delCCC	uc003ywk.2	-						TSNARE1_uc011lju.1_Intron|TSNARE1_uc003ywj.2_Intron|TSNARE1_uc003ywl.3_Intron	NM_145003	NP_659440			t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	143513747	143513748	+	IGR	INS	-	CCATCA	CCATCA	rs144949638		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143513747_143513748insCCATCA								TSNARE1 (29204 upstream) : BAI1 (31629 downstream)																																			---	---	---	---
BAI1	575	broad.mit.edu	37	8	143611526	143611527	+	Intron	DEL	GT	-	-	rs140153425	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143611526_143611527delGT	uc003ywm.2	+							NM_001702	NP_001693			brain-specific angiogenesis inhibitor 1						axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)																	---	---	---	---
CYP11B1	1584	broad.mit.edu	37	8	143959745	143959745	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143959745delG	uc003yxi.2	-						CYP11B1_uc010mex.2_5'Flank|CYP11B1_uc003yxh.2_5'Flank|CYP11B1_uc003yxj.2_Intron|CYP11B1_uc010mey.2_Intron	NM_000497	NP_000488			cytochrome P450, family 11, subfamily B,						aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)									Familial_Hyperaldosteronism_type_I				---	---	---	---
Unknown	0	broad.mit.edu	37	8	144869348	144869351	+	IGR	DEL	GGTC	-	-	rs67522673		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144869348_144869351delGGTC								FAM83H (53434 upstream) : SCRIB (3739 downstream)																																			---	---	---	---
BOP1	23246	broad.mit.edu	37	8	145507885	145507889	+	Intron	DEL	AAAAC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145507885_145507889delAAAAC	uc003zbr.1	-							NM_015201	NP_056016			block of proliferation 1						cell proliferation|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	nucleoplasm|PeBoW complex	protein binding				0	all_cancers(97;4.06e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;2.61e-39)|all cancers(56;1.37e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.087)															---	---	---	---
ARHGAP39	80728	broad.mit.edu	37	8	145767356	145767356	+	Intron	DEL	T	-	-	rs72228369		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145767356delT	uc003zdt.1	-						ARHGAP39_uc011llk.1_Intron|ARHGAP39_uc003zds.1_Intron	NM_025251	NP_079527			KIAA1688 protein						axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	752366	752366	+	IGR	DEL	A	-	-	rs111613029		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:752366delA								KANK1 (6262 upstream) : DMRT1 (89324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	2276370	2276370	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2276370delT								SMARCA2 (82749 upstream) : FLJ35024 (146332 downstream)																																			---	---	---	---
GLIS3	169792	broad.mit.edu	37	9	4283099	4283100	+	Intron	DEL	AC	-	-	rs5896058		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4283099_4283100delAC	uc003zhx.1	-						GLIS3_uc003zic.1_Intron|GLIS3_uc003zie.1_Intron|GLIS3_uc010mhh.1_Intron|GLIS3_uc003zid.1_Intron|GLIS3_uc010mhi.1_Intron|GLIS3_uc003zif.1_Intron|GLIS3_uc003zig.1_Intron|GLIS3_uc003zih.1_Intron	NM_001042413	NP_001035878			GLIS family zinc finger 3 isoform a						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)														---	---	---	---
SLC1A1	6505	broad.mit.edu	37	9	4488107	4488108	+	5'Flank	INS	-	GTTG	GTTG	rs144189670	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4488107_4488108insGTTG	uc003zij.1	+							NM_004170	NP_004161			solute carrier family 1, member 1						D-aspartate import|L-glutamate import|synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0		Acute lymphoblastic leukemia(2;0.0359)|Breast(48;0.0457)		GBM - Glioblastoma multiforme(50;0.0124)|Lung(218;0.183)	L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)													---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	7116659	7116659	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7116659delT	uc003zkh.2	+						KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron|KDM4C_uc011lml.1_Intron	NM_015061	NP_055876			jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	7859370	7859371	+	IGR	INS	-	GA	GA			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7859370_7859371insGA								C9orf123 (59571 upstream) : PTPRD (454876 downstream)																																			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8819661	8819661	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8819661delA	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8973321	8973321	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8973321delT	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	9	21446625	21446626	+	IGR	INS	-	T	T	rs147907508	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21446625_21446626insT								IFNA1 (5310 upstream) : LOC554202 (7641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	22982884	22982884	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22982884delA								DMRTA1 (530412 upstream) : ELAVL2 (707221 downstream)																																			---	---	---	---
LINGO2	158038	broad.mit.edu	37	9	28282180	28282180	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28282180delT	uc003zqu.1	-						LINGO2_uc010mjf.1_Intron|LINGO2_uc003zqv.1_Intron	NM_152570	NP_689783			leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)														---	---	---	---
SUGT1P1	441394	broad.mit.edu	37	9	33502847	33502847	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33502847delT	uc010mjq.1	-							NR_003667				Homo sapiens suppressor of G2 allele of SKP1 pseudogene (S. cerevisiae) (SUGT1P), non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	34155036	34155036	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34155036delT								DCAF12 (28265 upstream) : UBAP1 (23975 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	36186337	36186338	+	IGR	INS	-	T	T	rs113621266		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36186337_36186338insT								CCIN (15008 upstream) : CLTA (4554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	36514315	36514315	+	IGR	DEL	A	-	-	rs111595877		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36514315delA								RNF38 (113120 upstream) : MELK (58590 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	43752329	43752330	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43752329_43752330insA	uc004acz.1	+											Homo sapiens cDNA FLJ30083 fis, clone BGGI12001097, weakly similar to Homo sapiens contactin associated protein (Caspr) mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	66463697	66463698	+	Intron	DEL	CA	-	-	rs112864621		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66463697_66463698delCA	uc004aec.2	+											Homo sapiens, clone IMAGE:5213378, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	66478266	66478267	+	IGR	INS	-	T	T	rs9987965		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66478266_66478267insT								FAM74A4 (983880 upstream) : LOC442421 (18203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68402732	68402733	+	IGR	INS	-	TGAAT	TGAAT			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68402732_68402733insTGAAT								FAM27B (608543 upstream) : MIR1299 (599506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	70188644	70188645	+	Intron	DEL	TA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70188644_70188645delTA	uc004afw.2	-											Homo sapiens COBW domain containing 5, mRNA (cDNA clone IMAGE:5287337), complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	71210252	71210252	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71210252delC								C9orf71 (54469 upstream) : PIP5K1B (110364 downstream)																																			---	---	---	---
PIP5K1B	8395	broad.mit.edu	37	9	71424128	71424128	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71424128delT	uc004agu.2	+						PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_003558	NP_003549			phosphatidylinositol-4-phosphate 5-kinase, type							endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)														---	---	---	---
C9orf135	138255	broad.mit.edu	37	9	72495929	72495929	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72495929delT	uc004ahl.2	+						C9orf135_uc011lrw.1_Intron|C9orf135_uc010moq.2_Intron|C9orf135_uc011lrx.1_Intron|C9orf135_uc010mop.2_Intron	NM_001010940	NP_001010940			hypothetical protein LOC138255							integral to membrane				ovary(1)	1																		---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	73886545	73886545	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73886545delA	uc004aii.2	-							NM_206948	NP_996831			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	74017478	74017481	+	Intron	DEL	CAAA	-	-	rs35593398		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74017478_74017481delCAAA	uc004aii.2	-							NM_206948	NP_996831			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	74199248	74199248	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74199248delA								TRPM3 (137428 upstream) : TMEM2 (99034 downstream)																																			---	---	---	---
TMC1	117531	broad.mit.edu	37	9	75144583	75144584	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75144583_75144584insT	uc004aiz.1	+							NM_138691	NP_619636			transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1																		---	---	---	---
TMC1	117531	broad.mit.edu	37	9	75348761	75348762	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75348761_75348762insT	uc004aiz.1	+						TMC1_uc010moz.1_Intron|TMC1_uc004aja.1_Intron|TMC1_uc004ajb.1_Intron|TMC1_uc004ajc.1_Intron|TMC1_uc010mpa.1_Intron	NM_138691	NP_619636			transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1																		---	---	---	---
TRPM6	140803	broad.mit.edu	37	9	77368284	77368284	+	Intron	DEL	A	-	-	rs74467397		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77368284delA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajj.1_Intron	NM_017662	NP_060132			transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	78054635	78054635	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78054635delT								OSTF1 (292522 upstream) : PCSK5 (450925 downstream)																																			---	---	---	---
PCSK5	5125	broad.mit.edu	37	9	78523402	78523403	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78523402_78523403insT	uc004ajz.2	+						PCSK5_uc004ajy.2_Intron|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191			proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3																		---	---	---	---
VPS13A	23230	broad.mit.edu	37	9	79886673	79886676	+	Intron	DEL	CTTG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79886673_79886676delCTTG	uc004akr.2	+						VPS13A_uc004akp.3_Intron|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648			vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	80803076	80803077	+	IGR	INS	-	C	C	rs148333923	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80803076_80803077insC								GNAQ (156884 upstream) : CEP78 (47914 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	81646960	81646964	+	IGR	DEL	TTTAT	-	-	rs5898611		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81646960_81646964delTTTAT								PSAT1 (701953 upstream) : TLE4 (539914 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	82030962	82030962	+	IGR	DEL	A	-	-	rs34128325		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82030962delA								None (None upstream) : TLE4 (155916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	82897596	82897597	+	IGR	DEL	TG	-	-	rs72122337		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82897596_82897597delTG								TLE4 (555939 upstream) : None (None downstream)																																			---	---	---	---
FRMD3	257019	broad.mit.edu	37	9	85894723	85894723	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85894723delG	uc004ams.1	-						FRMD3_uc004amr.1_Intron	NM_174938	NP_777598			FERM domain containing 3							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	88384977	88384978	+	IGR	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88384977_88384978delTG								AGTPBP1 (28033 upstream) : NAA35 (171079 downstream)																																			---	---	---	---
NAA35	60560	broad.mit.edu	37	9	88566052	88566053	+	Intron	INS	-	A	A	rs74941867		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88566052_88566053insA	uc004aoi.3	+						NAA35_uc004aoj.3_Intron|NAA35_uc004aok.1_Intron	NM_024635	NP_078911			corneal wound healing-related protein						smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	90017199	90017200	+	IGR	INS	-	A	A	rs145985594	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90017199_90017200insA								C9orf170 (242558 upstream) : DAPK1 (95458 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91112124	91112124	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91112124delG								SPIN1 (18504 upstream) : NXNL2 (37892 downstream)																																			---	---	---	---
SHC3	53358	broad.mit.edu	37	9	91723455	91723456	+	Intron	INS	-	AC	AC	rs141450227	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91723455_91723456insAC	uc004aqg.2	-							NM_016848	NP_058544			src homology 2 domain-containing transforming						central nervous system development|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	protein binding|signal transducer activity			lung(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	92795990	92795990	+	IGR	DEL	T	-	-	rs34409364		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92795990delT								LOC100129066 (461316 upstream) : DIRAS2 (576124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	93810177	93810177	+	IGR	DEL	T	-	-	rs35173255		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93810177delT								SYK (149344 upstream) : AUH (165922 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	94211817	94211817	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94211817delT								NFIL3 (25673 upstream) : ROR2 (113556 downstream)																																			---	---	---	---
WNK2	65268	broad.mit.edu	37	9	96043656	96043656	+	Intron	DEL	A	-	-	rs11311059		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96043656delA	uc004ati.1	+						WNK2_uc011lud.1_Intron|WNK2_uc004atj.2_Intron|WNK2_uc004atk.2_Intron	NM_006648	NP_006639			WNK lysine deficient protein kinase 2						intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	96466474	96466474	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96466474delG								PHF2 (24607 upstream) : BARX1 (247437 downstream)																																			---	---	---	---
PTCH1	5727	broad.mit.edu	37	9	98214610	98214611	+	Intron	INS	-	ACACACAC	ACACACAC	rs143947528	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98214610_98214611insACACACAC	uc004avk.3	-						PTCH1_uc010mrn.2_5'Flank|PTCH1_uc010mro.2_Intron|PTCH1_uc010mrp.2_Intron|PTCH1_uc010mrq.2_Intron|PTCH1_uc004avl.3_Intron|PTCH1_uc010mrr.2_Intron|PTCH1_uc004avm.3_Intron	NM_000264	NP_000255			patched isoform L						embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity			skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)												Basal_Cell_Nevus_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	9	98978824	98978826	+	IGR	DEL	AAG	-	-	rs71948154		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98978824_98978826delAAG								NCRNA00092 (194787 upstream) : HSD17B3 (18763 downstream)																																			---	---	---	---
TMOD1	7111	broad.mit.edu	37	9	100286801	100286804	+	Intron	DEL	TGTA	-	-	rs71369515		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100286801_100286804delTGTA	uc004axk.1	+						TMOD1_uc004axl.1_Intron	NM_003275	NP_003266			tropomodulin 1						muscle filament sliding	cytosol	actin binding				0		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	106349823	106349824	+	IGR	INS	-	C	C	rs140284665	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106349823_106349824insC								CYLC2 (569053 upstream) : SMC2 (506717 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	109490901	109490901	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109490901delT								TMEM38B (953457 upstream) : ZNF462 (134477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	110515934	110515935	+	IGR	DEL	GA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110515934_110515935delGA								KLF4 (263887 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	112093165	112093165	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112093165delG								EPB41L4B (10144 upstream) : PTPN3 (44809 downstream)																																			---	---	---	---
C9orf84	158401	broad.mit.edu	37	9	114511040	114511040	+	Intron	DEL	C	-	-	rs148734331	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114511040delC	uc004bfr.2	-						C9orf84_uc011lwt.1_Intron|C9orf84_uc004bfs.1_Intron|C9orf84_uc004bfq.2_Intron|C9orf84_uc010mug.2_Intron	NM_173521	NP_775792			hypothetical protein LOC158401 isoform 1											ovary(2)	2																		---	---	---	---
C9orf84	158401	broad.mit.edu	37	9	114541923	114541923	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114541923delA	uc004bfr.2	-						C9orf84_uc011lwt.1_Intron|C9orf84_uc004bfs.1_Intron	NM_173521	NP_775792			hypothetical protein LOC158401 isoform 1											ovary(2)	2																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119554948	119554948	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119554948delA	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	121867932	121867933	+	IGR	INS	-	A	A	rs143011253		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121867932_121867933insA								None (None upstream) : DBC1 (60975 downstream)																																			---	---	---	---
CDK5RAP2	55755	broad.mit.edu	37	9	123342823	123342823	+	5'Flank	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123342823delA	uc004bkf.2	-						CDK5RAP2_uc004bkg.2_5'Flank|CDK5RAP2_uc011lxw.1_5'Flank|CDK5RAP2_uc011lxx.1_5'Flank|CDK5RAP2_uc011lxy.1_5'Flank|CDK5RAP2_uc011lxz.1_5'Flank|CDK5RAP2_uc011lya.1_5'Flank|CDK5RAP2_uc004bkh.1_5'Flank	NM_018249	NP_060719			CDK5 regulatory subunit associated protein 2						brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	124880991	124880991	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124880991delT								TTLL11 (25106 upstream) : NDUFA8 (25349 downstream)																																			---	---	---	---
RABGAP1	23637	broad.mit.edu	37	9	125799096	125799096	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125799096delT	uc011lzh.1	+						RABGAP1_uc004bnl.3_Intron|RABGAP1_uc011lzj.1_Intron	NM_012197	NP_036329			RAB GTPase activating protein 1						cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5																		---	---	---	---
CRB2	286204	broad.mit.edu	37	9	126117101	126117101	+	5'Flank	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126117101delG	uc004bnx.1	+						CRB2_uc004bnw.1_5'Flank	NM_173689	NP_775960			crumbs homolog 2 precursor							extracellular region|integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	126704578	126704582	+	IGR	DEL	GACAG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126704578_126704582delGACAG								DENND1A (12161 upstream) : LHX2 (69307 downstream)																																			---	---	---	---
MAPKAP1	79109	broad.mit.edu	37	9	128332775	128332775	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128332775delC	uc004bpv.2	-						MAPKAP1_uc011lzt.1_Intron|MAPKAP1_uc010mwz.2_Intron|MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron|MAPKAP1_uc010mxb.1_Intron|MAPKAP1_uc004bqa.2_Intron|MAPKAP1_uc010mxc.1_Intron	NM_001006617	NP_001006618			mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	128820884	128820885	+	IGR	INS	-	TT	TT	rs141486006	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128820884_128820885insTT								PBX3 (91231 upstream) : FAM125B (268243 downstream)																																			---	---	---	---
DNM1	1759	broad.mit.edu	37	9	131012114	131012114	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131012114delA	uc011mau.1	+						DNM1_uc011mat.1_Intron|DNM1_uc004bub.1_Intron|DNM1_uc004buc.1_Intron|DNM1_uc004bud.3_Intron	NM_004408	NP_004399			dynamin 1 isoform 1						receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity			ovary(2)	2																		---	---	---	---
CCBL1	883	broad.mit.edu	37	9	131598582	131598582	+	Intron	DEL	T	-	-	rs71497420		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131598582delT	uc004bwh.2	-						CCBL1_uc004bwf.2_Intron|CCBL1_uc004bwg.2_Intron|CCBL1_uc010myn.2_Intron|CCBL1_uc004bwj.2_Intron|CCBL1_uc011mbl.1_Intron|CCBL1_uc004bwi.2_Intron|CCBL1_uc010myo.2_Intron	NM_004059	NP_004050			kynurenine aminotransferase I isoform a						kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)													---	---	---	---
CCBL1	883	broad.mit.edu	37	9	131636535	131636536	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131636535_131636536insA	uc004bwh.2	-						CCBL1_uc010myn.2_Intron|CCBL1_uc004bwj.2_Intron|CCBL1_uc011mbl.1_Intron|CCBL1_uc004bwi.2_Intron|CCBL1_uc010myo.2_Intron	NM_004059	NP_004050			kynurenine aminotransferase I isoform a						kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	132205660	132205662	+	IGR	DEL	ATA	-	-	rs67329146		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132205660_132205662delATA								C9orf106 (120778 upstream) : C9orf50 (168844 downstream)																																			---	---	---	---
PRRX2	51450	broad.mit.edu	37	9	132467485	132467486	+	Intron	INS	-	GGG	GGG	rs137874391	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132467485_132467486insGGG	uc004byh.2	+							NM_016307	NP_057391			paired related homeobox 2							nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1		Ovarian(14;0.00556)																---	---	---	---
LAMC3	10319	broad.mit.edu	37	9	133894200	133894200	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133894200delG	uc004caa.1	+							NM_006059	NP_006050			laminin, gamma 3 precursor						cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)												OREG0019555	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
NUP214	8021	broad.mit.edu	37	9	134051258	134051258	+	Intron	DEL	T	-	-	rs74366436		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134051258delT	uc004cag.2	+						NUP214_uc004cah.2_Intron|NUP214_uc004cai.2_Intron|NUP214_uc004caf.1_Intron|NUP214_uc010mzf.2_Intron	NM_005085	NP_005076			nucleoporin 214kDa						carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding			breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)				T	DEK|SET|ABL1	AML|T-ALL								---	---	---	---
C9orf98	158067	broad.mit.edu	37	9	135735667	135735668	+	Intron	INS	-	GC	GC	rs146679139	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135735667_135735668insGC	uc004cbu.1	-						C9orf98_uc010mzx.1_Intron|C9orf98_uc004cbv.1_Intron	NM_152572	NP_689785			putative adenylate kinase-like protein C9orf98							cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	137143193	137143194	+	IGR	INS	-	G	G	rs149905478	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137143193_137143194insG								RNU6ATAC (113507 upstream) : RXRA (65750 downstream)																																			---	---	---	---
CAMSAP1	157922	broad.mit.edu	37	9	138718041	138718042	+	Intron	DEL	CA	-	-	rs60377963		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138718041_138718042delCA	uc004cgr.3	-						CAMSAP1_uc004cgq.3_Intron|CAMSAP1_uc010nbg.2_Intron	NM_015447	NP_056262			calmodulin regulated spectrin-associated protein							cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	139070254	139070254	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139070254delA								C9orf69 (59523 upstream) : LHX3 (17844 downstream)																																			---	---	---	---
QSOX2	169714	broad.mit.edu	37	9	139105813	139105814	+	Intron	INS	-	AC	AC	rs142959742	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139105813_139105814insAC	uc010nbi.2	-							NM_181701	NP_859052			quiescin Q6 sulfhydryl oxidase 2 precursor						cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity			ovary(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)														---	---	---	---
GRIN1	2902	broad.mit.edu	37	9	140039096	140039096	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140039096delA	uc004clk.2	+						GRIN1_uc004cli.1_Intron|GRIN1_uc004clj.1_Intron|GRIN1_uc004cll.2_Intron|GRIN1_uc004clm.2_Intron|GRIN1_uc004cln.2_Intron|GRIN1_uc004clo.2_Intron	NM_007327	NP_015566			NMDA receptor 1 isoform NR1-3 precursor						ionotropic glutamate receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|regulation of excitatory postsynaptic membrane potential|response to ethanol|visual learning	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane|synaptic vesicle|synaptosome	calcium ion binding|calmodulin binding|extracellular-glutamate-gated ion channel activity|glutamate binding|glycine binding			skin(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)													---	---	---	---
EHMT1	79813	broad.mit.edu	37	9	140564001	140564001	+	Intron	DEL	G	-	-	rs11289791		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140564001delG	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033			euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	316287	316288	+	IGR	INS	-	A	A	rs141835998	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:316287_316288insA								ZMYND11 (15711 upstream) : DIP2C (3844 downstream)																																			---	---	---	---
DIP2C	22982	broad.mit.edu	37	10	559119	559120	+	Intron	INS	-	GCTGTA	GCTGTA	rs145740693	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:559119_559120insGCTGTA	uc001ifp.2	-							NM_014974	NP_055789			DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	2962271	2962272	+	IGR	DEL	AA	-	-	rs141204191		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2962271_2962272delAA								None (None upstream) : PFKP (147480 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	3289624	3289624	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3289624delA								PITRM1 (74621 upstream) : KLF6 (528565 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	4174449	4174450	+	IGR	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4174449_4174450delAC								KLF6 (346976 upstream) : LOC100216001 (446994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	4476200	4476200	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4476200delA								KLF6 (648727 upstream) : LOC100216001 (145244 downstream)																																			---	---	---	---
PRKCQ	5588	broad.mit.edu	37	10	6545653	6545655	+	Intron	DEL	CTC	-	-	rs141538404		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6545653_6545655delCTC	uc001ijj.1	-						PRKCQ_uc009xim.1_Intron|PRKCQ_uc001iji.1_Intron|PRKCQ_uc009xin.1_Intron|PRKCQ_uc010qax.1_Intron	NM_006257	NP_006248			protein kinase C, theta						axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6																		---	---	---	---
ITIH5	80760	broad.mit.edu	37	10	7621492	7621492	+	Intron	DEL	A	-	-	rs76643718		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7621492delA	uc001ijq.2	-						ITIH5_uc001ijp.2_Intron|ITIH5_uc001ijr.1_Intron	NM_030569	NP_085046			inter-alpha trypsin inhibitor heavy chain						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	8373996	8373997	+	IGR	DEL	AC	-	-	rs72152637		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8373996_8373997delAC								GATA3 (256834 upstream) : None (None downstream)																																			---	---	---	---
MCM10	55388	broad.mit.edu	37	10	13245805	13245806	+	Intron	DEL	AG	-	-	rs150411895		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13245805_13245806delAG	uc001ima.2	+						MCM10_uc001imb.2_Intron|MCM10_uc001imc.2_Intron	NM_182751	NP_877428			minichromosome maintenance complex component 10						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	13610405	13610405	+	IGR	DEL	T	-	-	rs72023500		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13610405delT								BEND7 (65429 upstream) : PRPF18 (18534 downstream)																																			---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	13722435	13722435	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13722435delA	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron	NM_018027	NP_060497			FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	13832172	13832173	+	Intron	INS	-	C	C	rs148612015	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13832172_13832173insC	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497			FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	14509631	14509632	+	IGR	INS	-	A	A	rs7475534		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14509631_14509632insA								FRMD4A (5488 upstream) : FAM107B (50927 downstream)																																			---	---	---	---
FAM107B	83641	broad.mit.edu	37	10	14802699	14802699	+	Intron	DEL	G	-	-	rs145645150		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14802699delG	uc001ina.1	-						FAM107B_uc010qbu.1_Intron	NM_031453	NP_113641			hypothetical protein LOC83641											breast(4)	4																		---	---	---	---
CACNB2	783	broad.mit.edu	37	10	18776893	18776893	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18776893delA	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron|CACNB2_uc009xkb.1_Intron|CACNB2_uc010qcm.1_Intron|CACNB2_uc001ipz.2_Intron|CACNB2_uc001ipy.2_Intron|CACNB2_uc010qcn.1_Intron|CACNB2_uc010qco.1_Intron|CACNB2_uc001iqa.2_Intron	NM_201596	NP_963890			calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	19229161	19229161	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19229161delT								ARL5B (262221 upstream) : PLXDC2 (876211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	23892011	23892011	+	IGR	DEL	T	-	-	rs5783847		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23892011delT								OTUD1 (160703 upstream) : KIAA1217 (91664 downstream)																																			---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24207694	24207695	+	Intron	INS	-	AT	AT	rs60147505		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24207694_24207695insAT	uc001irs.2	+							NM_001098500	NP_001091970			sickle tail isoform 2						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	25088156	25088156	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25088156delA								ARHGAP21 (75559 upstream) : PRTFDC1 (49398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	25957943	25957944	+	Intron	DEL	CA	-	-	rs112100294		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25957943_25957944delCA	uc001isl.1	+											Homo sapiens cDNA FLJ41446 fis, clone BRSTN2003590.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	26069899	26069900	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26069899_26069900insT								GPR158 (178744 upstream) : MYO3A (153102 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	30196399	30196399	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30196399delT								SVIL (170535 upstream) : KIAA1462 (105330 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	30900648	30900652	+	IGR	DEL	AAAGA	-	-	rs137937328		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30900648_30900652delAAAGA								MAP3K8 (149887 upstream) : LYZL2 (57 downstream)																																			---	---	---	---
ZNF438	220929	broad.mit.edu	37	10	31192945	31192946	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31192945_31192946insA	uc010qdz.1	-						ZNF438_uc001ivn.2_Intron|ZNF438_uc010qdy.1_Intron|ZNF438_uc001ivo.3_Intron|ZNF438_uc009xlg.2_Intron|ZNF438_uc001ivp.3_Intron|ZNF438_uc010qea.1_Intron|ZNF438_uc010qeb.1_Intron|ZNF438_uc010qec.1_Intron	NM_182755	NP_877432			zinc finger protein 438 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	31511462	31511462	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31511462delT								ZNF438 (190596 upstream) : LOC220930 (93996 downstream)																																			---	---	---	---
PARD3	56288	broad.mit.edu	37	10	35074915	35074916	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35074915_35074916insA	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565			partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)																---	---	---	---
FZD8	8325	broad.mit.edu	37	10	35927346	35927346	+	3'UTR	DEL	A	-	-	rs71523387		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35927346delA	uc001iyz.1	-	1						NM_031866	NP_114072			frizzled 8 precursor						axonogenesis|brain development|canonical Wnt receptor signaling pathway|embryo development|gonad development|T cell differentiation in thymus|vasculature development	cell projection|Golgi apparatus|integral to membrane|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	36411718	36411719	+	IGR	INS	-	TT	TT	rs140234668	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36411718_36411719insTT								FZD8 (481356 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	37171150	37171150	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37171150delA								None (None upstream) : ANKRD30A (243635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38622570	38622570	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38622570delT								LOC100129055 (119298 upstream) : HSD17B7P2 (22738 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38790336	38790340	+	IGR	DEL	ACTCA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38790336_38790340delACTCA								LOC399744 (49256 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38794747	38794750	+	IGR	DEL	AGAA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38794747_38794750delAGAA								LOC399744 (53667 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39090898	39090898	+	IGR	DEL	T	-	-	rs145632232		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39090898delT								LOC399744 (349818 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42647234	42647237	+	IGR	DEL	TAGT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42647234_42647237delTAGT								None (None upstream) : LOC441666 (180078 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42654510	42654510	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42654510delT								None (None upstream) : LOC441666 (172805 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42800222	42800226	+	IGR	DEL	TTGGG	-	-	rs147989481		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42800222_42800226delTTGGG								None (None upstream) : LOC441666 (27089 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42816027	42816031	+	IGR	DEL	CCATT	-	-	rs149650414	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42816027_42816031delCCATT								None (None upstream) : LOC441666 (11284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	44713405	44713405	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44713405delC								HNRNPA3P1 (427540 upstream) : CXCL12 (152202 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	44780455	44780455	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44780455delA								HNRNPA3P1 (494590 upstream) : CXCL12 (85152 downstream)																																			---	---	---	---
SYT15	83849	broad.mit.edu	37	10	46962762	46962762	+	Intron	DEL	T	-	-	rs10712659		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46962762delT	uc001jea.2	-						SYT15_uc001jdz.2_Intron|SYT15_uc001jeb.2_Intron|SYT15_uc010qfp.1_Intron	NM_031912	NP_114118			synaptotagmin XV isoform a							integral to membrane|plasma membrane					0																		---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47047087	47047088	+	Intron	INS	-	A	A	rs142033998		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47047087_47047088insA	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
C10orf72	196740	broad.mit.edu	37	10	50262984	50262984	+	Intron	DEL	G	-	-	rs71465495		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50262984delG	uc001jhf.2	-							NM_001031746	NP_001026916			hypothetical protein LOC196740 isoform 1							integral to membrane|plasma membrane					0																		---	---	---	---
C10orf128	170371	broad.mit.edu	37	10	50397257	50397257	+	5'Flank	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50397257delT	uc001jhn.3	-						C10orf128_uc001jhm.3_5'Flank|C10orf128_uc010qgo.1_5'Flank|C10orf128_uc001jho.3_5'Flank	NM_001010863	NP_001010863			hypothetical protein LOC170371 precursor							integral to membrane				lung(1)	1																		---	---	---	---
PARG	8505	broad.mit.edu	37	10	51505371	51505371	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51505371delT	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron	NM_003631	NP_003622			poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)														---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	52764365	52764365	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52764365delT	uc001jjm.2	+						PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53478916	53478917	+	Intron	INS	-	AAAAGAG	AAAAGAG	rs144411331	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53478916_53478917insAAAAGAG	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	59790259	59790260	+	IGR	INS	-	T	T	rs79062074		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59790259_59790260insT								None (None upstream) : IPMK (165358 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	64868616	64868617	+	IGR	INS	-	C	C	rs149251907	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64868616_64868617insC								EGR2 (289689 upstream) : NRBF2 (24390 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	65477585	65477586	+	IGR	INS	-	C	C	rs143100078	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65477585_65477586insC								REEP3 (95614 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	66241929	66241930	+	IGR	INS	-	T	T	rs146419084	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66241929_66241930insT								REEP3 (859958 upstream) : ANXA2P3 (343355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	67432033	67432034	+	IGR	INS	-	T	T	rs138797511	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67432033_67432034insT								ANXA2P3 (845399 upstream) : CTNNA3 (247691 downstream)																																			---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68512615	68512616	+	Intron	DEL	CA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68512615_68512616delCA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
DNA2	1763	broad.mit.edu	37	10	70186097	70186097	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70186097delC	uc001jof.2	-						DNA2_uc001jog.1_Intron|DNA2_uc001joh.1_Intron	NM_001080449	NP_001073918			DNA replication helicase 2 homolog						base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base				0																		---	---	---	---
STOX1	219736	broad.mit.edu	37	10	70640355	70640355	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70640355delT	uc001jos.2	+						STOX1_uc001jor.2_Intron|STOX1_uc009xpy.2_Intron|STOX1_uc001joq.2_Intron	NM_001130161	NP_001123633			storkhead box 1 isoform a							cytoplasm|nucleolus	DNA binding			kidney(1)|skin(1)	2																		---	---	---	---
VPS26A	9559	broad.mit.edu	37	10	70901649	70901649	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70901649delT	uc001jpb.2	+						VPS26A_uc001jpc.2_Intron|VPS26A_uc009xqa.2_Intron|VPS26A_uc001jpd.2_Intron	NM_004896	NP_004887			vacuolar protein sorting 26 A isoform 1						retrograde transport, endosome to Golgi|vacuolar transport	cytosol|endosome membrane|retromer complex|vesicle	protein binding|protein transporter activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	71180806	71180807	+	IGR	INS	-	A	A	rs34194307		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71180806_71180807insA								TACR2 (4132 upstream) : TSPAN15 (30419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	72954063	72954063	+	IGR	DEL	A	-	-	rs71975951		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72954063delA								PCBD1 (305522 upstream) : UNC5B (18235 downstream)																																			---	---	---	---
CDH23	64072	broad.mit.edu	37	10	73424669	73424670	+	Intron	INS	-	C	C	rs145773476	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73424669_73424670insC	uc001jrx.3	+						CDH23_uc001jry.2_Intron|CDH23_uc001jrz.2_Intron	NM_022124	NP_071407			cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11																		---	---	---	---
OIT3	170392	broad.mit.edu	37	10	74679840	74679840	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74679840delT	uc001jte.1	+						OIT3_uc009xqs.1_Intron	NM_152635	NP_689848			oncoprotein-induced transcript 3 precursor							nuclear envelope	calcium ion binding			ovary(2)	2	Prostate(51;0.0198)																	---	---	---	---
PPP3CB	5532	broad.mit.edu	37	10	75202212	75202213	+	Intron	DEL	GA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75202212_75202213delGA	uc001jue.2	-						PPP3CB_uc001juf.2_Intron|PPP3CB_uc001jug.2_Intron|PPP3CB_uc010qkj.1_Intron	NM_021132	NP_066955			protein phosphatase 3, catalytic subunit, beta											skin(1)	1	Prostate(51;0.0119)																	---	---	---	---
C10orf11	83938	broad.mit.edu	37	10	77975297	77975297	+	Intron	DEL	A	-	-	rs111919971		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77975297delA	uc001jxi.2	+							NM_032024	NP_114413			chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)																	---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	78673519	78673519	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78673519delA	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxl.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	80086375	80086375	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80086375delT	uc010qlp.1	+						uc001jzw.1_Intron					SubName: Full=cDNA FLJ57363;																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	80464353	80464353	+	IGR	DEL	A	-	-	rs34709839		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80464353delA								RPS24 (647783 upstream) : LOC283050 (238731 downstream)																																			---	---	---	---
ZMIZ1	57178	broad.mit.edu	37	10	80951130	80951131	+	Intron	INS	-	G	G	rs149086627	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80951130_80951131insG	uc001kaf.2	+						ZMIZ1_uc001kae.2_Intron	NM_020338	NP_065071			retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	82718517	82718518	+	IGR	INS	-	T	T	rs75139263	byFrequency;by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82718517_82718518insT								SH2D4B (312201 upstream) : NRG3 (916552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	85563266	85563267	+	IGR	DEL	CA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85563266_85563267delCA								NRG3 (816331 upstream) : GHITM (335918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	86502447	86502447	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86502447delT								FAM190B (224171 upstream) : GRID1 (856865 downstream)																																			---	---	---	---
GRID1	2894	broad.mit.edu	37	10	88102051	88102051	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88102051delA	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021			glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
LDB3	11155	broad.mit.edu	37	10	88490912	88490912	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88490912delA	uc001kdv.2	+						LDB3_uc010qmm.1_Intron|LDB3_uc001kdu.2_Intron|LDB3_uc009xsz.2_Intron	NM_007078	NP_009009			LIM domain binding 3 isoform 1							cytoskeleton|perinuclear region of cytoplasm|pseudopodium	zinc ion binding			ovary(1)	1																		---	---	---	---
MYOF	26509	broad.mit.edu	37	10	95095461	95095462	+	Intron	INS	-	TTTCC	TTTCC	rs148769270	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95095461_95095462insTTTCC	uc001kin.2	-						MYOF_uc001kio.2_Intron|MYOF_uc009xue.2_Intron	NM_013451	NP_038479			myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4																		---	---	---	---
SORBS1	10580	broad.mit.edu	37	10	97170102	97170103	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97170102_97170103insT	uc001kkp.2	-						SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126			sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)														---	---	---	---
ENTPD1	953	broad.mit.edu	37	10	97529895	97529895	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97529895delA	uc001klh.3	+						ENTPD1_uc001kle.1_Intron|ENTPD1_uc001kli.3_Intron|uc001klg.1_Intron|ENTPD1_uc010qoj.1_Intron|ENTPD1_uc010qok.1_Intron|ENTPD1_uc010qol.1_Intron|ENTPD1_uc010qom.1_Intron|ENTPD1_uc010qon.1_Intron|ENTPD1_uc009xva.2_Intron|ENTPD1_uc009xuz.2_Intron	NM_001776	NP_001767			ectonucleoside triphosphate diphosphohydrolase 1						cell adhesion	integral to plasma membrane	ATP binding			ovary(3)	3		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	98566320	98566320	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98566320delT								PIK3AP1 (86041 upstream) : MIR607 (22106 downstream)																																			---	---	---	---
PYROXD2	84795	broad.mit.edu	37	10	100175530	100175530	+	5'Flank	DEL	A	-	-	rs113578769		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100175530delA	uc001kpc.2	-						PYROXD2_uc001kpd.2_5'Flank|PYROXD2_uc010qpe.1_5'Flank	NM_032709	NP_116098			pyridine nucleotide-disulphide oxidoreductase								oxidoreductase activity			central_nervous_system(1)	1																		---	---	---	---
DNMBP	23268	broad.mit.edu	37	10	101659434	101659435	+	Intron	INS	-	TTGT	TTGT	rs145935732	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101659434_101659435insTTGT	uc001kqj.2	-						DNMBP_uc010qpl.1_5'Flank|DNMBP_uc001kqg.2_Intron|DNMBP_uc001kqh.2_Intron	NM_015221	NP_056036			dynamin binding protein						intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	102097900	102097900	+	IGR	DEL	T	-	-	rs111386364		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102097900delT								PKD2L1 (7657 upstream) : SCD (8872 downstream)																																	OREG0020437	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
LZTS2	84445	broad.mit.edu	37	10	102765511	102765512	+	Intron	DEL	AG	-	-	rs34809526		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102765511_102765512delAG	uc001ksj.2	+						LZTS2_uc010qpw.1_Intron|LZTS2_uc001ksk.2_Intron|LZTS2_uc001ksl.2_Intron|LZTS2_uc001ksm.2_Intron	NM_032429	NP_115805			leucine zipper, putative tumor suppressor 2						cell division|mitosis|Wnt receptor signaling pathway	membrane|microtubule|microtubule organizing center				ovary(2)|large_intestine(1)|breast(1)	4				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)														---	---	---	---
HABP2	3026	broad.mit.edu	37	10	115313876	115313877	+	Intron	DEL	AT	-	-	rs151157794		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115313876_115313877delAT	uc001lai.3	+						HABP2_uc010qrz.1_Intron|HABP2_uc010qry.1_Intron	NM_004132	NP_004123			hyaluronan binding protein 2 preproprotein						cell adhesion|proteolysis	extracellular space	glycosaminoglycan binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)														---	---	---	---
TDRD1	56165	broad.mit.edu	37	10	115985616	115985617	+	Intron	DEL	AA	-	-	rs74608976		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115985616_115985617delAA	uc001lbg.1	+						TDRD1_uc001lbf.2_Intron|TDRD1_uc001lbh.1_Intron|TDRD1_uc001lbi.1_Intron|TDRD1_uc010qsc.1_Intron|TDRD1_uc001lbj.2_Intron	NM_198795	NP_942090			tudor domain containing 1						DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)														---	---	---	---
ABLIM1	3983	broad.mit.edu	37	10	116529323	116529326	+	5'Flank	DEL	AAGA	-	-	rs112032076		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116529323_116529326delAAGA	uc001lbz.1	-						uc001lca.1_Intron					Homo sapiens cDNA FLJ25105 fis, clone CBR01442.						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)														---	---	---	---
CASC2	255082	broad.mit.edu	37	10	119887544	119887545	+	Intron	DEL	CA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119887544_119887545delCA	uc001ldm.3	+						CASC2_uc009xzc.2_Intron	NR_026939				Homo sapiens mRNA for IGM1 protein.												0																		---	---	---	---
ATE1	11101	broad.mit.edu	37	10	123670162	123670164	+	Intron	DEL	AGT	-	-	rs77952359		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123670162_123670164delAGT	uc001lfp.2	-						ATE1_uc001lfq.2_Intron|ATE1_uc010qtr.1_Intron|ATE1_uc010qts.1_Intron|ATE1_uc010qtt.1_Intron|ATE1_uc001lfr.2_Intron|ATE1_uc009xzu.2_Intron	NM_007041	NP_008972			arginyltransferase 1 isoform 2						protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity				0		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	124828108	124828109	+	IGR	DEL	AT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124828108_124828109delAT								ACADSB (10303 upstream) : HMX3 (67458 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	124828490	124828490	+	IGR	DEL	T	-	-	rs66469023		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124828490delT								ACADSB (10685 upstream) : HMX3 (67077 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	125160344	125160345	+	Intron	INS	-	GTACAG	GTACAG			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125160344_125160345insGTACAG	uc001lhg.1	+											full-length cDNA clone CS0DD008YJ14 of Neuroblastoma Cot 50-normalized of Homo sapiens (human).																														---	---	---	---
CPXM2	119587	broad.mit.edu	37	10	125540252	125540255	+	Intron	DEL	CCTT	-	-	rs66915589		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125540252_125540255delCCTT	uc001lhk.1	-						CPXM2_uc001lhj.2_Intron	NM_198148	NP_937791			carboxypeptidase X (M14 family), member 2						cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)														---	---	---	---
LHPP	64077	broad.mit.edu	37	10	126275340	126275341	+	Intron	INS	-	A	A	rs140420123	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126275340_126275341insA	uc001lhs.1	+						LHPP_uc001lht.1_Intron|LHPP_uc009yai.1_Intron	NM_022126	NP_071409			phospholysine phosphohistidine inorganic						protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)														---	---	---	---
ZRANB1	54764	broad.mit.edu	37	10	126632123	126632126	+	Intron	DEL	TATG	-	-	rs112785914		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126632123_126632126delTATG	uc001lic.2	+						ZRANB1_uc010qug.1_Intron	NM_017580	NP_060050			zinc finger, RAN-binding domain containing 1						positive regulation of Wnt receptor signaling pathway|protein K63-linked deubiquitination|Wnt receptor signaling pathway	aggresome|centrosome|intermediate filament cytoskeleton|nucleolus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	128532171	128532172	+	IGR	DEL	AG	-	-	rs150370746		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128532171_128532172delAG								C10orf90 (173092 upstream) : DOCK1 (61851 downstream)																																			---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	128815601	128815602	+	Intron	INS	-	CA	CA	rs147034815	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128815601_128815602insCA	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	131994586	131994587	+	IGR	DEL	TG	-	-	rs113782668		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131994586_131994587delTG								GLRX3 (11802 upstream) : TCERG1L (896069 downstream)																																			---	---	---	---
STK32C	282974	broad.mit.edu	37	10	134087127	134087128	+	Intron	INS	-	GAA	GAA	rs56831391		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134087127_134087128insGAA	uc001lle.1	-						STK32C_uc001lld.1_Intron|STK32C_uc010quu.1_Intron|STK32C_uc009ybc.1_Intron|STK32C_uc009ybd.1_Intron	NM_173575	NP_775846			serine/threonine kinase 32C								ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|breast(1)	5		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)														---	---	---	---
TUBGCP2	10844	broad.mit.edu	37	10	135105528	135105528	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135105528delT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_5'Flank|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650			tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)														---	---	---	---
FAM99B	100132464	broad.mit.edu	37	11	1707866	1707881	+	5'Flank	DEL	CTTCTTCCCTCCCTCA	-	-	rs113231874		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1707866_1707881delCTTCTTCCCTCCCTCA	uc010qxa.1	-						uc001ltz.1_5'Flank	NR_026642				Homo sapiens family with sequence similarity 99, member B (FAM99B), non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	2081637	2081638	+	IGR	INS	-	T	T	rs145230663	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2081637_2081638insT								H19 (62572 upstream) : IGF2 (68710 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	7931607	7931608	+	IGR	INS	-	GTAT	GTAT	rs148929065	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7931607_7931608insGTAT								OR5E1P (60490 upstream) : OR10A6 (17658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	7998283	7998283	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7998283delA								NLRP10 (13224 upstream) : EIF3F (10162 downstream)																																			---	---	---	---
TEAD1	7003	broad.mit.edu	37	11	12773271	12773271	+	Intron	DEL	A	-	-	rs35328068		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12773271delA	uc001mkj.3	+							NM_021961	NP_068780			TEA domain family member 1						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)														---	---	---	---
SOX6	55553	broad.mit.edu	37	11	16191911	16191911	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16191911delA	uc001mme.2	-						SOX6_uc001mmd.2_Intron|SOX6_uc001mmf.2_Intron|SOX6_uc001mmg.2_Intron	NM_001145819	NP_001139291			SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	17245714	17245715	+	IGR	INS	-	T	T	rs150625529		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17245714_17245715insT								PIK3C2A (16184 upstream) : NUCB2 (36172 downstream)																																			---	---	---	---
HPS5	11234	broad.mit.edu	37	11	18340591	18340591	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18340591delA	uc001mod.1	-						HPS5_uc001moe.1_Intron|HPS5_uc001mof.1_Intron|HPS5_uc001mog.1_Intron	NM_181507	NP_852608			Hermansky-Pudlak syndrome 5 isoform a							cytosol				ovary(1)|pancreas(1)|skin(1)	3														Hermansky-Pudlak_syndrome				---	---	---	---
NELL1	4745	broad.mit.edu	37	11	21021522	21021523	+	Intron	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21021522_21021523delTG	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148			nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	21795858	21795858	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21795858delT								NELL1 (198631 upstream) : ANO5 (418864 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	23130206	23130207	+	IGR	INS	-	AC	AC	rs3050460		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:23130206_23130207insAC								SVIP (278824 upstream) : None (None downstream)																																			---	---	---	---
KIF18A	81930	broad.mit.edu	37	11	28053225	28053225	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28053225delA	uc001msc.2	-							NM_031217	NP_112494			kinesin family member 18A						blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2																		---	---	---	---
RCN1	5954	broad.mit.edu	37	11	32081056	32081057	+	Intron	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32081056_32081057delGT	uc010rea.1	+							NM_002901	NP_002892			reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	35105148	35105149	+	IGR	INS	-	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35105148_35105149insG								PDHX (87474 upstream) : CD44 (55268 downstream)																																			---	---	---	---
TRIM44	54765	broad.mit.edu	37	11	35737518	35737518	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35737518delA	uc001mwi.2	+							NM_017583	NP_060053			DIPB protein							intracellular	protein binding|zinc ion binding			skin(1)	1	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)																---	---	---	---
COMMD9	29099	broad.mit.edu	37	11	36293806	36293806	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36293806delA	uc009yki.1	-											Homo sapiens cDNA FLJ45212 fis, clone BRCAN2018667.											ovary(1)	1	all_lung(20;0.211)	all_hematologic(20;0.107)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	37295100	37295100	+	IGR	DEL	T	-	-	rs140690893		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37295100delT								C11orf74 (598710 upstream) : None (None downstream)																																			---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40862343	40862343	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40862343delA	uc001mxc.1	-						LRRC4C_uc001mxd.1_Intron	NM_020929	NP_065980			netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
TSPAN18	90139	broad.mit.edu	37	11	44950343	44950344	+	Intron	INS	-	A	A	rs147237475	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44950343_44950344insA	uc001mye.3	+						TP53I11_uc001myf.1_Intron|TSPAN18_uc001myg.2_Intron|TSPAN18_uc001myh.1_5'Flank	NM_130783	NP_570139			tetraspanin 18 isoform 2							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	45066020	45066020	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45066020delC								LOC221122 (66444 upstream) : PRDM11 (49544 downstream)																																			---	---	---	---
CRY2	1408	broad.mit.edu	37	11	45881398	45881398	+	Intron	DEL	G	-	-	rs139670444		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45881398delG	uc010rgn.1	+						CRY2_uc009ykw.2_Intron|CRY2_uc010rgo.1_5'Flank	NM_021117	NP_066940			cryptochrome 2 (photolyase-like) isoform 1						DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	blue light photoreceptor activity|damaged DNA binding|DNA photolyase activity|nucleotide binding|protein binding|single-stranded DNA binding			central_nervous_system(1)	1																		---	---	---	---
AMBRA1	55626	broad.mit.edu	37	11	46568174	46568174	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46568174delA	uc010rgu.1	-						AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron	NM_017749	NP_060219			activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	48356970	48356971	+	IGR	INS	-	TCCTTG	TCCTTG	rs11040732		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48356970_48356971insTCCTTG								OR4C3 (9490 upstream) : OR4C45 (9931 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48574758	48574758	+	IGR	DEL	T	-	-	rs145096639		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48574758delT								OR4A47 (63486 upstream) : FOLH1 (593430 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48858835	48858835	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48858835delG								OR4A47 (347563 upstream) : FOLH1 (309353 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	58405639	58405639	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58405639delC								ZFP91-CNTF (12436 upstream) : GLYAT (70592 downstream)																																			---	---	---	---
C11orf64	283197	broad.mit.edu	37	11	60393028	60393029	+	Intron	INS	-	TTC	TTC	rs149579536	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60393028_60393029insTTC	uc001npt.2	+						C11orf64_uc001npu.2_Intron	NR_026946				Homo sapiens cDNA FLJ25394 fis, clone TST02552.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	60491427	60491428	+	IGR	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60491427_60491428delAC								MS4A8B (8145 upstream) : MS4A15 (32912 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	61429969	61429969	+	IGR	DEL	A	-	-	rs35340864		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61429969delA								RPLP0P2 (23048 upstream) : DAGLA (17941 downstream)																																			---	---	---	---
DAGLA	747	broad.mit.edu	37	11	61471151	61471154	+	Intron	DEL	ATGG	-	-	rs111872893		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61471151_61471154delATGG	uc001nsa.2	+							NM_006133	NP_006124			neural stem cell-derived dendrite regulator						cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3				READ - Rectum adenocarcinoma(4;0.219)														---	---	---	---
EEF1G	1937	broad.mit.edu	37	11	62335180	62335181	+	Intron	INS	-	T	T	rs71458421		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62335180_62335181insT	uc001ntm.1	-						EEF1G_uc010rlw.1_Intron|EEF1G_uc001ntn.1_Intron	NM_001404	NP_001395			eukaryotic translation elongation factor 1						response to virus	cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity				0																		---	---	---	---
RTN3	10313	broad.mit.edu	37	11	63473652	63473653	+	Intron	INS	-	TTG	TTG			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63473652_63473653insTTG	uc001nxq.2	+						RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Intron|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Intron|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831			reticulon 3 isoform b						apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1																		---	---	---	---
STIP1	10963	broad.mit.edu	37	11	63954962	63954962	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63954962delT	uc001nyk.1	+						STIP1_uc001nyj.2_Intron|STIP1_uc010rnb.1_Intron	NM_006819	NP_006810			stress-induced-phosphoprotein 1						axon guidance|response to stress	Golgi apparatus|nucleus				ovary(2)|liver(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	68784270	68784273	+	Intron	DEL	ATCC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68784270_68784273delATCC	uc001ooq.2	+											Homo sapiens, clone IMAGE:5587905, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	69030830	69030833	+	IGR	DEL	ATCC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69030830_69030833delATCC								TPCN2 (100923 upstream) : MYEOV (30789 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	69410610	69410611	+	IGR	DEL	CA	-	-	rs10545489		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69410610_69410611delCA								MYEOV (254161 upstream) : CCND1 (45262 downstream)																																			---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70893190	70893190	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70893190delA	uc001oqc.2	-							NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	72966839	72966839	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72966839delT								P2RY2 (19446 upstream) : P2RY6 (8731 downstream)																																			---	---	---	---
FAM168A	23201	broad.mit.edu	37	11	73141323	73141324	+	Intron	DEL	GT	-	-	rs35239246		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73141323_73141324delGT	uc001otz.1	-						FAM168A_uc001oty.1_Intron|FAM168A_uc009ytp.1_Intron	NM_015159	NP_055974			hypothetical protein LOC23201												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	76511280	76511295	+	IGR	DEL	AAGAAGGAAAGAAGGA	-	-	rs149769890	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76511280_76511295delAAGAAGGAAAGAAGGA								TSKU (2083 upstream) : ACER3 (60622 downstream)																																			---	---	---	---
MYO7A	4647	broad.mit.edu	37	11	76858446	76858447	+	Intron	INS	-	TTTC	TTTC	rs146046718	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76858446_76858447insTTTC	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron	NM_000260	NP_000251			myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	79593013	79593014	+	IGR	DEL	AG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79593013_79593014delAG								ODZ4 (441318 upstream) : None (None downstream)																																			---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83423673	83423673	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83423673delA	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc001pal.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83656997	83656997	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83656997delT	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
C11orf73	51501	broad.mit.edu	37	11	86011893	86011896	+	5'Flank	DEL	TTAG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86011893_86011896delTTAG	uc001pbu.2	+						C11orf73_uc001pbt.2_5'Flank|C11orf73_uc010rto.1_5'Flank|C11orf73_uc010rtp.1_5'Flank|C11orf73_uc001pbv.2_5'Flank	NM_016401	NP_057485			lethal, Chr 7, Rinchik 6							cytoplasm					0		Acute lymphoblastic leukemia(157;1.17e-07)|all_hematologic(158;0.000556)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	88803058	88803059	+	IGR	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88803058_88803059delGT								GRM5 (3945 upstream) : TYR (107981 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	90094468	90094468	+	IGR	DEL	A	-	-	rs138230727	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90094468delA								CHORDC1 (137936 upstream) : MIR1261 (507821 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	90648203	90648204	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90648203_90648204insA								MIR1261 (45833 upstream) : None (None downstream)																																			---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92551674	92551674	+	Intron	DEL	C	-	-	rs143129076		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92551674delC	uc001pdj.3	+							NM_001008781	NP_001008781			FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
Unknown	0	broad.mit.edu	37	11	92656960	92656960	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92656960delA								FAT3 (27327 upstream) : MTNR1B (45829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	93004539	93004540	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93004539_93004540insA								SLC36A4 (73444 upstream) : CCDC67 (58616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	94878340	94878341	+	IGR	INS	-	CAG	CAG	rs142363540	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94878340_94878341insCAG								ENDOD1 (12525 upstream) : SESN3 (27792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	96246193	96246194	+	IGR	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96246193_96246194delAC								JRKL (119466 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	97924083	97924084	+	IGR	DEL	TG	-	-	rs143719632		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97924083_97924084delTG								None (None upstream) : CNTN5 (967787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	102754848	102754849	+	IGR	INS	-	AC	AC	rs144353605	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102754848_102754849insAC								MMP12 (9136 upstream) : MMP13 (58876 downstream)																																			---	---	---	---
KBTBD3	143879	broad.mit.edu	37	11	105929470	105929470	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105929470delT	uc001pja.2	-						KBTBD3_uc001pjb.2_Intron|KBTBD3_uc009yxm.2_Intron	NM_198439	NP_940841			BTB and kelch domain containing 3											ovary(1)|central_nervous_system(1)	2		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	106335602	106335602	+	IGR	DEL	T	-	-	rs71825069		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106335602delT								AASDHPPT (366183 upstream) : GUCY1A2 (222308 downstream)																																			---	---	---	---
ALKBH8	91801	broad.mit.edu	37	11	107432109	107432110	+	Intron	INS	-	A	A	rs35555057		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107432109_107432110insA	uc010rvr.1	-						ALKBH8_uc009yxp.2_Intron|ALKBH8_uc001pjl.2_Intron	NM_138775	NP_620130			alkB, alkylation repair homolog 8						response to DNA damage stimulus	cytosol|nucleus	metal ion binding|nucleotide binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|protein binding|RNA binding|tRNA (uracil) methyltransferase activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	107850800	107850800	+	IGR	DEL	G	-	-	rs35621100		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107850800delG								RAB39 (16594 upstream) : CUL5 (28608 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	108812387	108812387	+	IGR	DEL	T	-	-	rs10713743		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108812387delT								DDX10 (741 upstream) : C11orf87 (480488 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	109431607	109431608	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109431607_109431608insT								C11orf87 (131769 upstream) : ZC3H12C (532318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	111253669	111253670	+	IGR	DEL	GT	-	-	rs113917703		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111253669_111253670delGT								POU2AF1 (3512 upstream) : BTG4 (84588 downstream)																																			---	---	---	---
FAM55B	120406	broad.mit.edu	37	11	114554655	114554661	+	Intron	DEL	GTTACAT	-	-	rs148687233		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114554655_114554661delGTTACAT	uc009yyy.2	+							NM_182495	NP_872301			hypothetical protein LOC120406							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	116989711	116989712	+	IGR	DEL	AA	-	-	rs79370468		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116989711_116989712delAA								SIK3 (20718 upstream) : PAFAH1B2 (25328 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	117003798	117003799	+	IGR	INS	-	T	T	rs35612329		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117003798_117003799insT								SIK3 (34805 upstream) : PAFAH1B2 (11241 downstream)																																			---	---	---	---
CEP164	22897	broad.mit.edu	37	11	117229257	117229257	+	Intron	DEL	T	-	-	rs151296814		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117229257delT	uc001prc.2	+						CEP164_uc001prb.2_Intron|CEP164_uc010rxk.1_Intron	NM_014956	NP_055771			centrosomal protein 164kDa						cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)														---	---	---	---
AMICA1	120425	broad.mit.edu	37	11	118066848	118066848	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118066848delT	uc001psk.2	-						AMICA1_uc001psg.2_Intron|AMICA1_uc001psh.2_Intron|AMICA1_uc009yzw.1_Intron|AMICA1_uc001psi.2_Intron|AMICA1_uc001psj.2_Intron|AMICA1_uc010rxw.1_Intron	NM_001098526	NP_001091996			adhesion molecule, interacts with CXADR antigen						blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	cell junction|integral to membrane				ovary(1)	1	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)														---	---	---	---
UBE4A	9354	broad.mit.edu	37	11	118243701	118243701	+	Intron	DEL	A	-	-	rs34104337		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118243701delA	uc001psw.2	+						UBE4A_uc001psv.2_Intron	NM_004788	NP_004779			ubiquitination factor E4A						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)														---	---	---	---
MLL	4297	broad.mit.edu	37	11	118353468	118353468	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118353468delA	uc001pta.2	+						MLL_uc001ptb.2_Intron|MLL_uc001pte.1_Intron|MLL_uc009zab.1_Intron	NM_005933	NP_005924			myeloid/lymphoid or mixed-lineage leukemia						apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)				T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	11	119222980	119222981	+	IGR	INS	-	AGAT	AGAT	rs150652066	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119222980_119222981insAGAT								MFRP (5597 upstream) : USP2 (2945 downstream)																																			---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120543126	120543126	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120543126delA	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434			glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	121192985	121192985	+	IGR	DEL	T	-	-	rs4537768	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121192985delT								SC5DL (8868 upstream) : SORL1 (129976 downstream)																																			---	---	---	---
ASAM	79827	broad.mit.edu	37	11	123021188	123021189	+	Intron	DEL	AA	-	-	rs11219028		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123021188_123021189delAA	uc001pyt.2	-							NM_024769	NP_079045			adipocyte-specific adhesion molecule precursor							integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	123176100	123176100	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123176100delA								ASAM (110093 upstream) : GRAMD1B (220428 downstream)																																			---	---	---	---
FEZ1	9638	broad.mit.edu	37	11	125332778	125332778	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125332778delC	uc001qbx.2	-						FEZ1_uc010sbc.1_Intron	NM_005103	NP_005094			zygin 1 isoform 1						axon guidance|cell adhesion|transport	microtubule|plasma membrane				central_nervous_system(3)|ovary(1)	4	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)														---	---	---	---
CDON	50937	broad.mit.edu	37	11	125890572	125890572	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125890572delT	uc009zbw.2	-						CDON_uc001qdc.3_Intron|CDON_uc001qdd.3_Intron|CDON_uc009zbx.2_Intron	NM_016952	NP_058648			surface glycoprotein, Ig superfamily member						cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	127617402	127617413	+	IGR	DEL	TTCAAGGCCTTT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127617402_127617413delTTCAAGGCCTTT								KIRREL3 (744047 upstream) : ETS1 (711243 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	127819044	127819044	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127819044delT								KIRREL3 (945689 upstream) : ETS1 (509612 downstream)																																			---	---	---	---
KCNJ5	3762	broad.mit.edu	37	11	128764079	128764079	+	Intron	DEL	T	-	-	rs67767049		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128764079delT	uc001qet.2	+						KCNJ5_uc009zck.2_Intron	NM_000890	NP_000881			potassium inwardly-rectifying channel J5						synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glibenclamide(DB01016)													---	---	---	---
KCNJ5	3762	broad.mit.edu	37	11	128774650	128774651	+	Intron	INS	-	CTGA	CTGA	rs139705490	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128774650_128774651insCTGA	uc001qet.2	+						KCNJ5_uc009zck.2_Intron|C11orf45_uc001qeu.2_Intron|C11orf45_uc009zcl.2_Intron|C11orf45_uc001qev.2_Intron	NM_000890	NP_000881			potassium inwardly-rectifying channel J5						synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glibenclamide(DB01016)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	129326466	129326467	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129326466_129326467insT								BARX2 (4293 upstream) : TMEM45B (359274 downstream)																																			---	---	---	---
ST14	6768	broad.mit.edu	37	11	130037613	130037614	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130037613_130037614insT	uc001qfw.2	+							NM_021978	NP_068813			matriptase						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)													---	---	---	---
ADAMTS8	11095	broad.mit.edu	37	11	130283948	130283948	+	Intron	DEL	T	-	-	rs34035393		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130283948delT	uc001qgg.3	-						ADAMTS8_uc001qgf.2_5'Flank	NM_007037	NP_008968			ADAM metallopeptidase with thrombospondin type 1						negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	130694905	130694907	+	IGR	DEL	TCC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130694905_130694907delTCC								ADAMTS15 (351190 upstream) : SNX19 (50860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	130933909	130933910	+	IGR	INS	-	GT	GT	rs148369105	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130933909_130933910insGT								SNX19 (147527 upstream) : NTM (306461 downstream)																																	OREG0021525	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
NTM	50863	broad.mit.edu	37	11	131240386	131240387	+	5'UTR	DEL	GT	-	-	rs67752684		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131240386_131240387delGT	uc010sci.1	+	1					NTM_uc001qgm.2_5'UTR|NTM_uc010sch.1_5'UTR	NM_001144058	NP_001137530			neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																OREG0003960	type=REGULATORY REGION|Gene=AY358331|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
NTM	50863	broad.mit.edu	37	11	131629411	131629411	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131629411delT	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530			neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
NTM	50863	broad.mit.edu	37	11	132171216	132171216	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132171216delC	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron|NTM_uc001qgr.2_Intron	NM_016522	NP_057606			neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	4298616	4298616	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4298616delT								PARP11 (316008 upstream) : CCND2 (84286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	5512843	5512844	+	IGR	INS	-	A	A	rs143279354	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5512843_5512844insA								KCNA5 (356895 upstream) : NTF3 (28436 downstream)																																			---	---	---	---
ANO2	57101	broad.mit.edu	37	12	5922220	5922223	+	Intron	DEL	AGGA	-	-	rs147780677		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5922220_5922223delAGGA	uc001qnm.2	-							NM_020373	NP_065106			anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	8314097	8314098	+	IGR	INS	-	T	T	rs143410500	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8314097_8314098insT								CLEC4A (22894 upstream) : ZNF705A (11052 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	8969489	8969490	+	IGR	INS	-	TT	TT	rs113627581		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8969489_8969490insTT								RIMKLB (33804 upstream) : A2ML1 (5660 downstream)																																			---	---	---	---
PRB4	5545	broad.mit.edu	37	12	11171563	11171563	+	Intron	DEL	G	-	-	rs112482285		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11171563delG	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qzj.2_Intron	NM_002723	NP_002714			proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1															HNSCC(22;0.051)			---	---	---	---
Unknown	0	broad.mit.edu	37	12	13430284	13430284	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13430284delT								EMP1 (60577 upstream) : C12orf36 (93739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	15448916	15448917	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15448916_15448917delTC								RERG (74612 upstream) : PTPRO (26570 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	15954867	15954867	+	IGR	DEL	A	-	-	rs75934028		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15954867delA								EPS8 (12357 upstream) : STRAP (80421 downstream)																																			---	---	---	---
SLCO1B1	10599	broad.mit.edu	37	12	21382188	21382189	+	Intron	INS	-	AGTCCAC	AGTCCAC	rs145590730	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21382188_21382189insAGTCCAC	uc001req.3	+							NM_006446	NP_006437			solute carrier organic anion transporter family,						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	21561648	21561669	+	IGR	DEL	GTGTGTGTGTGTGTGTGTGTGT	-	-	rs72333559		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21561648_21561669delGTGTGTGTGTGTGTGTGTGTGT								SLCO1A2 (13277 upstream) : PYROXD1 (28869 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	25872987	25872990	+	IGR	DEL	ACAC	-	-	rs72161584		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25872987_25872990delACAC								IFLTD1 (71499 upstream) : RASSF8 (238979 downstream)																																			---	---	---	---
PKP2	5318	broad.mit.edu	37	12	33048982	33048982	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33048982delT	uc001rlj.3	-						PKP2_uc001rlk.3_Intron|PKP2_uc010skj.1_Intron	NM_004572	NP_004563			plakophilin 2 isoform 2b						cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	34470094	34470095	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34470094_34470095insT								ALG10 (288860 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38089527	38089527	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38089527delG								None (None upstream) : ALG10B (621030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38092606	38092607	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38092606_38092607insT								None (None upstream) : ALG10B (617950 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	39417432	39417433	+	IGR	INS	-	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39417432_39417433insG								CPNE8 (118012 upstream) : KIF21A (269598 downstream)																																			---	---	---	---
LRRK2	120892	broad.mit.edu	37	12	40630660	40630660	+	Intron	DEL	T	-	-	rs72262656		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40630660delT	uc001rmg.3	+							NM_198578	NP_940980			leucine-rich repeat kinase 2						activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	42182978	42182979	+	IGR	INS	-	T	T	rs75335135		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42182978_42182979insT								PDZRN4 (214594 upstream) : GXYLT1 (292671 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	43003268	43003270	+	IGR	DEL	GAG	-	-	rs139324279		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43003268_43003270delGAG								PRICKLE1 (19696 upstream) : ADAMTS20 (744743 downstream)																																			---	---	---	---
ACVR1B	91	broad.mit.edu	37	12	52379530	52379530	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52379530delT	uc001rzn.2	+						ACVR1B_uc001rzl.2_Intron|ACVR1B_uc001rzm.2_Intron|ACVR1B_uc010snn.1_Intron	NM_004302	NP_004293			activin A receptor, type IB isoform a precursor						G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|peptidyl-threonine phosphorylation|positive regulation of activin receptor signaling pathway|positive regulation of erythrocyte differentiation|protein autophosphorylation|transmembrane receptor protein serine/threonine kinase signaling pathway	cell surface	activin receptor activity, type I|ATP binding|metal ion binding|SMAD binding|transforming growth factor beta receptor activity|ubiquitin protein ligase binding			pancreas(4)|breast(2)|ovary(1)|lung(1)|kidney(1)	9				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)													---	---	---	---
KRT8	3856	broad.mit.edu	37	12	53309158	53309158	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53309158delA	uc009zmk.1	-						KRT8_uc009zml.1_Intron|KRT8_uc009zmm.1_Intron	NM_002273	NP_002264			keratin 8						cytoskeleton organization|interspecies interaction between organisms	cytoplasm|keratin filament|nuclear matrix|nucleoplasm	protein binding|structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.108)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	54527792	54527792	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54527792delC								LOC400043 (1173 upstream) : SMUG1 (45991 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	54551776	54551776	+	IGR	DEL	A	-	-	rs111490088		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54551776delA								LOC400043 (25157 upstream) : SMUG1 (22007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	54818585	54818586	+	IGR	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54818585_54818586delGT								ITGA5 (5535 upstream) : GTSF1 (31151 downstream)																																			---	---	---	---
R3HDM2	22864	broad.mit.edu	37	12	57732134	57732137	+	Intron	DEL	AAAC	-	-	rs147577978		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57732134_57732137delAAAC	uc001snt.2	-						R3HDM2_uc001sns.2_Intron|R3HDM2_uc009zpo.1_Intron	NM_014925	NP_055740			R3H domain containing 2							nucleus	nucleic acid binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	64552557	64552558	+	IGR	INS	-	A	A	rs10878112	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64552557_64552558insA								SRGAP1 (10944 upstream) : C12orf66 (33862 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	66062396	66062396	+	IGR	DEL	T	-	-	rs147015854	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66062396delT								MSRB3 (201716 upstream) : RPSAP52 (89407 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	67649535	67649536	+	IGR	INS	-	AT	AT	rs138648867	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67649535_67649536insAT								GRIP1 (451641 upstream) : CAND1 (13525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	70347979	70347981	+	Intron	DEL	CTT	-	-	rs141644187		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70347979_70347981delCTT	uc001svu.1	+						uc010stn.1_Intron					RecName: Full=Uncharacterized protein C12orf28; Flags: Precursor;																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	74338944	74338945	+	IGR	INS	-	ACAC	ACAC	rs138798661	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74338944_74338945insACAC								None (None upstream) : ATXN7L3B (592606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	76696490	76696490	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76696490delT								NAP1L1 (217752 upstream) : BBS10 (41776 downstream)																																			---	---	---	---
SYT1	6857	broad.mit.edu	37	12	79618901	79618901	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79618901delA	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron|SYT1_uc001syv.2_Intron	NM_001135805	NP_001129277			synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	83865480	83865480	+	IGR	DEL	T	-	-	rs5799631		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83865480delT								TMTC2 (337417 upstream) : None (None downstream)																																			---	---	---	---
LRRIQ1	84125	broad.mit.edu	37	12	85624826	85624826	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85624826delA	uc001tac.2	+							NM_001079910	NP_001073379			leucine-rich repeats and IQ motif containing 1											ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	87651869	87651874	+	IGR	DEL	AAGAAA	-	-	rs111864134		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:87651869_87651874delAAGAAA								MGAT4C (419188 upstream) : C12orf50 (721942 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	89708690	89708691	+	IGR	INS	-	C	C	rs144162032	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89708690_89708691insC								KITLG (734452 upstream) : DUSP6 (33148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	90470654	90470654	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90470654delT								LOC338758 (364926 upstream) : C12orf12 (875339 downstream)																																			---	---	---	---
CDK17	5128	broad.mit.edu	37	12	96774061	96774062	+	Intron	DEL	GT	-	-	rs60657909		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96774061_96774062delGT	uc001tep.1	-						CDK17_uc009ztk.2_Intron|CDK17_uc010svb.1_Intron	NM_002595	NP_002586			PCTAIRE protein kinase 2								ATP binding|cyclin-dependent protein kinase activity			ovary(3)|lung(2)|kidney(1)|central_nervous_system(1)	7																		---	---	---	---
ANO4	121601	broad.mit.edu	37	12	101147133	101147133	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101147133delT	uc010svl.1	+											Homo sapiens cDNA FLJ34272 fis, clone FEBRA2003128.							chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6															HNSCC(74;0.22)			---	---	---	---
Unknown	0	broad.mit.edu	37	12	103198173	103198173	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103198173delT								IGF1 (323795 upstream) : PAH (33931 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	105855494	105855494	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105855494delT								C12orf75 (90199 upstream) : NUAK1 (601631 downstream)																																			---	---	---	---
ANAPC7	51434	broad.mit.edu	37	12	110840137	110840138	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110840137_110840138insT	uc001tqo.2	-						ANAPC7_uc001tqp.3_Intron	NM_016238	NP_057322			anaphase-promoting complex subunit 7 isoform a						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding				0																		---	---	---	---
GPN3	51184	broad.mit.edu	37	12	110904804	110904805	+	Intron	DEL	TT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110904804_110904805delTT	uc001tqr.2	-						GPN3_uc001tqs.2_Intron|C12orf24_uc010sxz.1_5'Flank|C12orf24_uc009zvo.2_5'Flank|C12orf24_uc001tqt.2_5'Flank|C12orf24_uc001tqu.3_5'Flank|C12orf24_uc001tqv.3_5'Flank	NM_016301	NP_057385			GPN-loop GTPase 3 isoform 1							protein complex	GTP binding				0																		---	---	---	---
ERP29	10961	broad.mit.edu	37	12	112453293	112453293	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112453293delA	uc001ttk.1	+						ERP29_uc001ttl.1_Intron|TMEM116_uc001ttc.1_5'Flank|TMEM116_uc001ttd.1_5'Flank|TMEM116_uc001tte.1_5'Flank|TMEM116_uc001ttf.1_5'Flank|TMEM116_uc001ttg.1_5'Flank|TMEM116_uc001tth.1_5'Flank|TMEM116_uc001tti.1_5'Flank|TMEM116_uc001ttj.1_5'Flank	NM_006817	NP_006808			endoplasmic reticulum protein 29 isoform 1						intracellular protein transport|protein folding|protein secretion	endoplasmic reticulum lumen|melanosome	protein disulfide isomerase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	115432595	115432595	+	IGR	DEL	A	-	-	rs35096603		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115432595delA								TBX3 (310626 upstream) : MED13L (963788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	115438342	115438343	+	IGR	DEL	AG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115438342_115438343delAG								TBX3 (316373 upstream) : MED13L (958040 downstream)																																			---	---	---	---
KSR2	283455	broad.mit.edu	37	12	118264512	118264513	+	Intron	DEL	CA	-	-	rs66856479		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118264512_118264513delCA	uc001two.2	-							NM_173598	NP_775869			kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	119141280	119141280	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119141280delG								SUDS3 (285441 upstream) : SRRM4 (278116 downstream)																																			---	---	---	---
GCN1L1	10985	broad.mit.edu	37	12	120624178	120624178	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120624178delA	uc001txo.2	-							NM_006836	NP_006827			GCN1 general control of amino-acid synthesis						regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
MPHOSPH9	10198	broad.mit.edu	37	12	123701753	123701753	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123701753delT	uc001uel.2	-						MPHOSPH9_uc010tal.1_Intron|MPHOSPH9_uc010tam.1_Intron|MPHOSPH9_uc001uem.2_Intron	NM_022782	NP_073619			M-phase phosphoprotein 9						M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	124150675	124150677	+	IGR	DEL	AAG	-	-	rs55658652		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124150675_124150677delAAG								GTF2H3 (5341 upstream) : TCTN2 (4983 downstream)																																			---	---	---	---
DNAH10	196385	broad.mit.edu	37	12	124308405	124308405	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124308405delT	uc001uft.3	+							NM_207437	NP_997320			dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---
SCARB1	949	broad.mit.edu	37	12	125339519	125339519	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125339519delC	uc001ugo.3	-						SCARB1_uc001ugn.3_Intron|SCARB1_uc001ugm.3_Intron|SCARB1_uc010tbd.1_Intron|SCARB1_uc001ugp.3_Intron	NM_005505	NP_005496			scavenger receptor class B, member 1 isoform 1						adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	127217068	127217069	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127217068_127217069delAC	uc001uhk.3	-											Homo sapiens cDNA clone IMAGE:6160413.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	132190900	132190901	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132190900_132190901insA								LOC116437 (493425 upstream) : SFRS8 (4734 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	133032044	133032047	+	IGR	DEL	ATAT	-	-	rs112553798		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133032044_133032047delATAT								GALNT9 (126139 upstream) : FBRSL1 (35110 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	19320620	19320620	+	5'Flank	DEL	T	-	-	rs113823012		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19320620delT	uc001ulv.1	-											DQ586768																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	19532389	19532389	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19532389delT								LOC284232 (86280 upstream) : LOC348021 (50010 downstream)																																			---	---	---	---
LATS2	26524	broad.mit.edu	37	13	21610914	21610916	+	Intron	DEL	AAC	-	-	rs34174523		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21610914_21610916delAAC	uc009zzs.2	-						LATS2_uc001unr.3_Intron	NM_014572	NP_055387			LATS, large tumor suppressor, homolog 2						cell division|G1/S transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|intracellular protein kinase cascade|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus|spindle pole	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(3)|ovary(2)|breast(1)|pancreas(1)	10		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)														---	---	---	---
MIPEP	4285	broad.mit.edu	37	13	24325199	24325199	+	Intron	DEL	A	-	-	rs34114610		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24325199delA	uc001uox.3	-							NM_005932	NP_005923			mitochondrial intermediate peptidase precursor						protein processing involved in protein targeting to mitochondrion|proteolysis	mitochondrial matrix	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)														---	---	---	---
SHISA2	387914	broad.mit.edu	37	13	26627561	26627561	+	5'Flank	DEL	C	-	-	rs35235498		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26627561delC	uc001uqm.1	-							NM_001007538	NP_001007539			shisa homolog 2 precursor						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	30230641	30230642	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30230641_30230642insT								SLC7A1 (60816 upstream) : UBL3 (107904 downstream)																																			---	---	---	---
HMGB1	3146	broad.mit.edu	37	13	31145429	31145430	+	Intron	INS	-	T	T	rs75242519		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31145429_31145430insT	uc001usz.2	-							NM_002128	NP_002119			high-mobility group box 1						base-excision repair, DNA ligation|dendritic cell chemotaxis|DNA fragmentation involved in apoptotic nuclear change|DNA topological change|inflammatory response to antigenic stimulus|innate immune response|myeloid dendritic cell activation|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|neuron projection development|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|V(D)J recombination	cell surface|condensed chromosome|extracellular space|nucleolus|nucleoplasm	chemoattractant activity|cytokine activity|damaged DNA binding|DNA bending activity|double-stranded DNA binding|RAGE receptor binding|repressing transcription factor binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(1)	1		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	32003190	32003191	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32003190_32003191insT								B3GALTL (96781 upstream) : RXFP2 (310488 downstream)																																			---	---	---	---
FRY	10129	broad.mit.edu	37	13	32756423	32756423	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32756423delA	uc001utx.2	+						FRY_uc010tdw.1_Intron	NM_023037	NP_075463			furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	34925306	34925309	+	IGR	DEL	TGGA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34925306_34925309delTGGA								RFC3 (384612 upstream) : NBEA (591147 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	34937304	34937308	+	IGR	DEL	ACCCT	-	-	rs10563837		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34937304_34937308delACCCT								RFC3 (396610 upstream) : NBEA (579148 downstream)																																			---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36487475	36487475	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36487475delA	uc001uvf.2	-							NM_004734	NP_004725			doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
SMAD9	4093	broad.mit.edu	37	13	37457606	37457606	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37457606delG	uc001uvw.2	-						SMAD9_uc001uvx.2_Intron	NM_001127217	NP_001120689			SMAD family member 9 isoform a						BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)														---	---	---	---
DGKH	160851	broad.mit.edu	37	13	42682987	42682988	+	Intron	INS	-	AAGGA	AAGGA	rs140473533	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42682987_42682988insAAGGA	uc001uyl.1	+						DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron	NM_178009	NP_821077			diacylglycerol kinase, eta isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	42946932	42946932	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42946932delT								AKAP11 (49530 upstream) : TNFSF11 (189940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	46852715	46852715	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46852715delA								LCP1 (96256 upstream) : C13orf18 (63424 downstream)																																			---	---	---	---
DLEU2	8847	broad.mit.edu	37	13	50566079	50566079	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50566079delT	uc001vdn.1	-						DLEU2_uc001vdo.1_Intron	NR_002612				Homo sapiens BCMS-upstream neighbor (BCMSUN) mRNA, partial sequence.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	53550049	53550050	+	IGR	DEL	TT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53550049_53550050delTT								PCDH8 (127275 upstream) : OLFM4 (52922 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	55717626	55717626	+	IGR	DEL	T	-	-	rs35382663		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55717626delT								MIR1297 (831443 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57894606	57894606	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57894606delA								PRR20B (150254 upstream) : PCDH17 (311183 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63637291	63637291	+	IGR	DEL	T	-	-	rs75453829		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63637291delT								None (None upstream) : OR7E156P (674277 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	72684767	72684768	+	IGR	INS	-	GT	GT			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72684767_72684768insGT								DACH1 (243437 upstream) : C13orf37 (597727 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	73948068	73948068	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73948068delA								KLF5 (296393 upstream) : KLF12 (312082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	74114958	74114958	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74114958delT								KLF5 (463283 upstream) : KLF12 (145192 downstream)																																			---	---	---	---
KLF12	11278	broad.mit.edu	37	13	74519785	74519786	+	Intron	INS	-	A	A	rs144188323	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74519785_74519786insA	uc001vjf.2	-						KLF12_uc010aeq.2_Intron|KLF12_uc001vjg.3_Intron	NM_007249	NP_009180			Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)														---	---	---	---
KLF12	11278	broad.mit.edu	37	13	74663872	74663872	+	Intron	DEL	A	-	-	rs144139873		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74663872delA	uc001vjf.2	-						KLF12_uc010aeq.2_Intron|KLF12_uc001vjg.3_Intron	NM_007249	NP_009180			Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	76941047	76941047	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76941047delG								LMO7 (507043 upstream) : KCTD12 (513257 downstream)																																			---	---	---	---
SLAIN1	122060	broad.mit.edu	37	13	78298068	78298068	+	Intron	DEL	A	-	-	rs10718987		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78298068delA	uc010thy.1	+						SLAIN1_uc001vkk.1_Intron	NM_144595	NP_653196			SLAIN motif family, member 1 B											ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)														---	---	---	---
SLAIN1	122060	broad.mit.edu	37	13	78304036	78304037	+	Intron	INS	-	TG	TG	rs146215187	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78304036_78304037insTG	uc010thy.1	+						SLAIN1_uc001vkk.1_Intron	NM_144595	NP_653196			SLAIN motif family, member 1 B											ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)														---	---	---	---
RNF219	79596	broad.mit.edu	37	13	79217022	79217022	+	Intron	DEL	A	-	-	rs34161628		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79217022delA	uc001vkw.1	-						RNF219_uc010afb.1_Intron|RNF219_uc010afc.2_Intron	NM_024546	NP_078822			ring finger protein 219								zinc ion binding			large_intestine(2)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	79339724	79339725	+	IGR	INS	-	T	T	rs145005058	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79339724_79339725insT								RNF219 (105024 upstream) : RBM26 (554375 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	79842603	79842606	+	IGR	DEL	TCAG	-	-	rs151146628		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79842603_79842606delTCAG								RNF219 (607903 upstream) : RBM26 (51494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	89853224	89853224	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89853224delT								None (None upstream) : None (None downstream)																																			---	---	---	---
ABCC4	10257	broad.mit.edu	37	13	95714740	95714741	+	Intron	INS	-	CACACACA	CACACACA	rs141058174	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95714740_95714741insCACACACA	uc001vmd.3	-						ABCC4_uc010afj.2_Intron|ABCC4_uc010afk.2_Intron	NM_005845	NP_005836			ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)													---	---	---	---
UGGT2	55757	broad.mit.edu	37	13	96619411	96619411	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96619411delT	uc001vmt.2	-							NM_020121	NP_064506			UDP-glucose ceramide glucosyltransferase-like 2						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	104636891	104636891	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104636891delT								SLC10A2 (917695 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	105014713	105014713	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105014713delT								None (None upstream) : None (None downstream)																																			---	---	---	---
COL4A2	1284	broad.mit.edu	37	13	111164629	111164630	+	3'UTR	DEL	AA	-	-	rs5806862		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111164629_111164630delAA	uc001vqx.2	+	48						NM_001846	NP_001837			alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)															---	---	---	---
Unknown	0	broad.mit.edu	37	14	19021998	19021998	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19021998delA								None (None upstream) : OR11H12 (355596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19088901	19088902	+	IGR	DEL	TT	-	-	rs71431938		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19088901_19088902delTT								None (None upstream) : OR11H12 (288692 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20047744	20047747	+	IGR	DEL	AGTC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20047744_20047747delAGTC								P704P (27472 upstream) : OR4Q3 (167840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	21581977	21581979	+	IGR	DEL	TTT	-	-	rs72381315		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21581977_21581979delTTT								ZNF219 (9114 upstream) : OR5AU1 (41118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	31298050	31298051	+	IGR	INS	-	AC	AC	rs145818862	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31298050_31298051insAC								SCFD1 (93032 upstream) : COCH (45690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	32477556	32477557	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32477556_32477557delTC								NUBPL (147139 upstream) : C14orf128 (67069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	33311972	33311973	+	IGR	INS	-	G	G	rs139114660	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33311972_33311973insG								AKAP6 (9705 upstream) : NPAS3 (96486 downstream)																																			---	---	---	---
KIAA0391	9692	broad.mit.edu	37	14	35649732	35649733	+	Intron	INS	-	TG	TG	rs140304917	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35649732_35649733insTG	uc001wsy.1	+						KIAA0391_uc010tps.1_Intron|KIAA0391_uc001wsz.1_Intron|KIAA0391_uc001wta.2_Intron|KIAA0391_uc001wtb.1_Intron|KIAA0391_uc001wtc.1_Intron	NM_014672	NP_055487			mitochondrial RNase P protein 3 precursor						tRNA processing	mitochondrion					0	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	37107698	37107698	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37107698delC								NKX2-8 (55912 upstream) : PAX9 (19084 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	43417008	43417008	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43417008delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	45044850	45044850	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45044850delA								FSCB (68351 upstream) : C14orf28 (321657 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	57793538	57793539	+	IGR	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57793538_57793539delAC								MUDENG (36742 upstream) : NAA30 (63732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	58194213	58194213	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58194213delT								SLC35F4 (130598 upstream) : C14orf37 (276596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	58846149	58846150	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58846149_58846150insT								ARID4A (5701 upstream) : TOMM20L (16494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	59316709	59316712	+	IGR	DEL	AAGA	-	-	rs10579961		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59316709_59316712delAAGA								DACT1 (201673 upstream) : DAAM1 (338687 downstream)																																			---	---	---	---
PPM1A	5494	broad.mit.edu	37	14	60756379	60756379	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60756379delT	uc010apn.2	+						PPM1A_uc001xew.3_Intron|PPM1A_uc001xey.3_Intron	NM_021003	NP_066283			protein phosphatase 1A isoform 1						cell cycle arrest|insulin receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|protein dephosphorylation|Wnt receptor signaling pathway	cytosol|nucleus|protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein serine/threonine phosphatase activity|signal transducer activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.046)														---	---	---	---
SIX6	4990	broad.mit.edu	37	14	60974907	60974907	+	5'Flank	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60974907delC	uc001xfa.3	+							NM_007374	NP_031400			SIX homeobox 6						organ morphogenesis|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.088)														---	---	---	---
RAD51L1	5890	broad.mit.edu	37	14	69193198	69193199	+	Intron	INS	-	AC	AC	rs4902638		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69193198_69193199insAC	uc001xkg.1	+							NM_133510	NP_598194			RAD51-like 1 isoform 2						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)				T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
Unknown	0	broad.mit.edu	37	14	70306198	70306199	+	IGR	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70306198_70306199delTG								SLC10A1 (42192 upstream) : SMOC1 (39944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	71627120	71627120	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71627120delT								PCNX (45021 upstream) : SNORD56B (237934 downstream)																																			---	---	---	---
YLPM1	56252	broad.mit.edu	37	14	75253446	75253446	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75253446delT	uc001xqj.3	+						YLPM1_uc001xql.3_Intron	NM_019589	NP_062535			YLP motif containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	75857712	75857713	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75857712_75857713insT								FOS (108777 upstream) : JDP2 (36796 downstream)																																			---	---	---	---
C14orf179	112752	broad.mit.edu	37	14	76516437	76516437	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76516437delG	uc010asm.1	+						C14orf179_uc001xsf.2_Intron|C14orf179_uc010asl.1_Intron|C14orf179_uc001xsg.2_Intron|C14orf179_uc010tve.1_Intron|C14orf179_uc001xse.2_Intron	NM_001102564	NP_001096034			hypothetical protein LOC112752 isoform 2						cilium morphogenesis|intraflagellar retrograde transport						0				BRCA - Breast invasive adenocarcinoma(234;0.0199)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	80230968	80230968	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80230968delT	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc001xup.2_Intron|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
STON2	85439	broad.mit.edu	37	14	81896278	81896279	+	5'Flank	INS	-	A	A	rs74327512		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81896278_81896279insA	uc001xvk.1	-							NM_033104	NP_149095			stonin 2						endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding			skin(3)|pancreas(2)	5				BRCA - Breast invasive adenocarcinoma(234;0.0348)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	83666349	83666349	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83666349delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84659795	84659795	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84659795delT								None (None upstream) : None (None downstream)																																			---	---	---	---
GALC	2581	broad.mit.edu	37	14	88416809	88416809	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88416809delT	uc001xvt.2	-						GALC_uc010tvw.1_Intron|GALC_uc010tvx.1_Intron|GALC_uc010tvy.1_Intron|GALC_uc010tvz.1_Intron	NM_000153	NP_000144			galactosylceramidase isoform a precursor						carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0																		---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	90065696	90065697	+	Intron	INS	-	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90065696_90065697insC	uc001xxo.3	-						FOXN3_uc010atk.2_Intron|FOXN3_uc001xxp.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	91891892	91891892	+	IGR	DEL	T	-	-	rs72473878		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91891892delT								CCDC88C (7759 upstream) : SMEK1 (32066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	91907216	91907216	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91907216delT								CCDC88C (23083 upstream) : SMEK1 (16742 downstream)																																			---	---	---	---
ATXN3	4287	broad.mit.edu	37	14	92537089	92537089	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92537089delT	uc001yac.3	-						ATXN3_uc010aug.2_Intron|ATXN3_uc001yad.3_Intron|ATXN3_uc010auh.2_Intron|ATXN3_uc001yae.3_Intron	NM_004993	NP_004984			ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)														---	---	---	---
SLC24A4	123041	broad.mit.edu	37	14	92818048	92818049	+	Intron	INS	-	A	A	rs145029634	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92818048_92818049insA	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron	NM_153646	NP_705932			solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	94177726	94177726	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94177726delA								KIAA1409 (4037 upstream) : PRIMA1 (6918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99026709	99026710	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99026709_99026710delTC								C14orf64 (582248 upstream) : C14orf177 (151240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99039617	99039618	+	IGR	DEL	AC	-	-	rs34261867		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99039617_99039618delAC								C14orf64 (595156 upstream) : C14orf177 (138332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	102224794	102224795	+	IGR	DEL	CA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102224794_102224795delCA								C14orf72 (25934 upstream) : PPP2R5C (3340 downstream)																																			---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	107157560	107157561	+	Intron	INS	-	T	T	rs72527153	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107157560_107157561insT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20480900	20480901	+	IGR	INS	-	G	G	rs141078893		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20480900_20480901insG								None (None upstream) : GOLGA6L6 (256193 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20866888	20866889	+	IGR	INS	-	A	A	rs148671060		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20866888_20866889insA								GOLGA8C (85862 upstream) : BCL8 (3167 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22152284	22152285	+	IGR	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22152284_22152285delTG								CXADRP2 (135406 upstream) : LOC727924 (125747 downstream)																																			---	---	---	---
ATP10A	57194	broad.mit.edu	37	15	25983290	25983291	+	Intron	INS	-	G	G	rs146948744	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25983290_25983291insG	uc010ayu.2	-							NM_024490	NP_077816			ATPase, class V, type 10A						ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	26299642	26299643	+	IGR	DEL	AG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26299642_26299643delAG								ATP10A (189325 upstream) : GABRB3 (489052 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	26443240	26443240	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26443240delA								ATP10A (332923 upstream) : GABRB3 (345455 downstream)																																			---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27711614	27711617	+	Intron	DEL	TTAT	-	-	rs10574794		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27711614_27711617delTTAT	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
OCA2	4948	broad.mit.edu	37	15	28230842	28230842	+	Intron	DEL	T	-	-	rs67771409		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28230842delT	uc001zbh.3	-						OCA2_uc010ayv.2_Intron	NM_000275	NP_000266			oculocutaneous albinism II						eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)										Oculocutaneous_Albinism				---	---	---	---
DKFZP434L187	26082	broad.mit.edu	37	15	30595506	30595506	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30595506delT	uc001zds.2	+											Homo sapiens cDNA FLJ43588 fis, clone SKNSH2009991.												0																		---	---	---	---
DKFZP434L187	26082	broad.mit.edu	37	15	30618580	30618581	+	Intron	DEL	CT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30618580_30618581delCT	uc001zds.2	+											Homo sapiens cDNA FLJ43588 fis, clone SKNSH2009991.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	31042816	31042817	+	Intron	INS	-	AAG	AAG			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31042816_31042817insAAG	uc001zev.2	+											Homo sapiens hypothetical LOC440261, mRNA (cDNA clone IMAGE:7479697), complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	35658429	35658430	+	IGR	INS	-	TG	TG	rs34291490		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35658429_35658430insTG								LOC723972 (128167 upstream) : ATPBD4 (4741 downstream)																																			---	---	---	---
CASC5	57082	broad.mit.edu	37	15	40884375	40884376	+	5'Flank	INS	-	T	T	rs35254447		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40884375_40884376insT	uc010bbs.1	+						CASC5_uc010ucq.1_5'Flank|CASC5_uc001zme.2_5'Flank|CASC5_uc010bbt.1_5'Flank	NM_170589	NP_733468			cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)														---	---	---	---
ADAL	161823	broad.mit.edu	37	15	43627124	43627124	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43627124delT	uc010udo.1	+						ADAL_uc001zrh.2_Intron	NM_001159280	NP_001152752			adenosine deaminase-like isoform 1						adenosine catabolic process|inosine biosynthetic process|purine ribonucleoside monophosphate biosynthetic process		adenosine deaminase activity|metal ion binding				0		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;9.31e-07)														---	---	---	---
FRMD5	84978	broad.mit.edu	37	15	44312335	44312335	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44312335delT	uc001ztl.2	-						FRMD5_uc001ztk.1_Intron|FRMD5_uc001ztm.2_Intron|FRMD5_uc001ztn.2_Intron	NM_032892	NP_116281			FERM domain containing 5 isoform 2							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	45245220	45245220	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45245220delT								TRIM69 (185195 upstream) : C15orf43 (3683 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	51187574	51187574	+	IGR	DEL	A	-	-	rs34383805		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51187574delA								SPPL2A (129664 upstream) : AP4E1 (13372 downstream)																																			---	---	---	---
DMXL2	23312	broad.mit.edu	37	15	51764859	51764859	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51764859delT	uc002abf.2	-						DMXL2_uc002abd.2_Intron|DMXL2_uc010ufy.1_Intron|DMXL2_uc010bfa.2_Intron	NM_015263	NP_056078			Dmx-like 2							cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	56097732	56097733	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56097732_56097733insA								PRTG (62555 upstream) : NEDD4 (21398 downstream)																																			---	---	---	---
RORA	6095	broad.mit.edu	37	15	61115269	61115270	+	Intron	INS	-	CCTT	CCTT	rs143616698	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61115269_61115270insCCTT	uc002agx.2	-							NM_134261	NP_599023			RAR-related orphan receptor A isoform a						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
ANKDD1A	348094	broad.mit.edu	37	15	65246443	65246447	+	Intron	DEL	TCTTT	-	-	rs150846909	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65246443_65246447delTCTTT	uc002aoa.2	+						ANKDD1A_uc002aoc.2_Intron|ANKDD1A_uc010bha.2_Intron	NM_182703	NP_874362			ankyrin repeat and death domain containing 1A						signal transduction					ovary(1)	1																		---	---	---	---
SNAPC5	10302	broad.mit.edu	37	15	66791616	66791616	+	5'Flank	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66791616delA	uc002apu.1	-							NM_006049	NP_006040			small nuclear RNA activating complex,						transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase III promoter	nucleoplasm	sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
PAQR5	54852	broad.mit.edu	37	15	69686459	69686459	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69686459delT	uc002arz.2	+						PAQR5_uc002asa.2_Intron	NM_017705	NP_060175			progestin and adipoQ receptor family member V						cell differentiation|multicellular organismal development|oogenesis	integral to membrane	receptor activity|steroid binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	73960667	73960668	+	IGR	DEL	TT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73960667_73960668delTT								NPTN (34914 upstream) : CD276 (15954 downstream)																																			---	---	---	---
COX5A	9377	broad.mit.edu	37	15	75231235	75231236	+	5'Flank	DEL	CT	-	-	rs10570797		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75231235_75231236delCT	uc002azi.3	-							NM_004255	NP_004246			cytochrome c oxidase subunit Va precursor						respiratory electron transport chain	mitochondrial inner membrane	cytochrome-c oxidase activity|electron carrier activity|metal ion binding				0																		---	---	---	---
IMP3	55272	broad.mit.edu	37	15	75933566	75933566	+	Intron	DEL	A	-	-	rs67465263		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75933566delA	uc002bat.2	-						IMP3_uc010bkl.1_5'Flank	NM_018285	NP_060755			IMP3, U3 small nucleolar ribonucleoprotein						rRNA processing	nucleolus|ribonucleoprotein complex	protein binding|rRNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	77387335	77387335	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77387335delT								TSPAN3 (23822 upstream) : SGK269 (13136 downstream)																																			---	---	---	---
SGK269	79834	broad.mit.edu	37	15	77457248	77457248	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77457248delT	uc002bcm.2	-						SGK269_uc002bcn.2_Intron	NM_024776	NP_079052			NKF3 kinase family member						cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	80251641	80251641	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80251641delT								C15orf37 (34445 upstream) : BCL2A1 (1592 downstream)																																			---	---	---	---
ZFAND6	54469	broad.mit.edu	37	15	80414786	80414786	+	Intron	DEL	T	-	-	rs71455309		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80414786delT	uc002bfe.1	+						ZFAND6_uc002bff.1_Intron|ZFAND6_uc002bfg.1_Intron|ZFAND6_uc002bfh.1_Intron|ZFAND6_uc002bfi.1_Intron	NM_019006	NP_061879			zinc finger, AN1-type domain 6								DNA binding|zinc ion binding				0																		---	---	---	---
ARNT2	9915	broad.mit.edu	37	15	80708633	80708634	+	Intron	INS	-	T	T	rs34998163		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80708633_80708634insT	uc002bfr.2	+						ARNT2_uc002bfq.2_Intron	NM_014862	NP_055677			aryl hydrocarbon receptor nuclear translocator						central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)															---	---	---	---
STARD5	80765	broad.mit.edu	37	15	81611436	81611436	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81611436delA	uc002bgm.2	-						STARD5_uc002bgn.2_Intron	NM_181900	NP_871629			StAR-related lipid transfer protein 5						C21-steroid hormone biosynthetic process|lipid transport	cytosol	lipid binding			ovary(1)	1																		---	---	---	---
FSD2	123722	broad.mit.edu	37	15	83458942	83458944	+	Intron	DEL	ACA	-	-	rs72113049		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83458942_83458944delACA	uc002bjd.2	-						FSD2_uc010uol.1_Intron|FSD2_uc010uom.1_Intron	NM_001007122	NP_001007123			fibronectin type III and SPRY domain containing											central_nervous_system(1)	1																		---	---	---	---
HOMER2	9455	broad.mit.edu	37	15	83572413	83572414	+	Intron	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83572413_83572414delAC	uc002bjg.2	-						HOMER2_uc002bjh.2_Intron|HOMER2_uc002bjj.2_Intron|HOMER2_uc002bji.2_Intron	NM_199330	NP_955362			homer 2 isoform 2						metabotropic glutamate receptor signaling pathway	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane					0																		---	---	---	---
DET1	55070	broad.mit.edu	37	15	89080192	89080192	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89080192delC	uc002bmr.2	-						DET1_uc002bmp.3_Intron|DET1_uc010bnk.2_Intron|DET1_uc002bmq.2_Intron	NM_001144074	NP_001137546			de-etiolated 1 isoform 2							nucleus				lung(1)|pancreas(1)	2	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)															---	---	---	---
FAM174B	400451	broad.mit.edu	37	15	93266442	93266442	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93266442delA	uc002bsl.3	-											Homo sapiens cDNA PSEC0264 fis, clone NT2RP3002337.							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	93292694	93292694	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93292694delT								FAM174B (15390 upstream) : CHD2 (136739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	94595094	94595095	+	IGR	INS	-	CT	CT			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94595094_94595095insCT								RGMA (962661 upstream) : MCTP2 (179706 downstream)																																			---	---	---	---
LOC145820	145820	broad.mit.edu	37	15	96031505	96031505	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96031505delA	uc002btn.2	+						LOC145820_uc010urh.1_Intron	NR_027132				Homo sapiens cDNA FLJ32775 fis, clone TESTI2002012.												0																		---	---	---	---
IGF1R	3480	broad.mit.edu	37	15	99247289	99247290	+	Intron	INS	-	A	A	rs138885496	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99247289_99247290insA	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron	NM_000875	NP_000866			insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)													---	---	---	---
IGF1R	3480	broad.mit.edu	37	15	99294601	99294601	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99294601delA	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron	NM_000875	NP_000866			insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)													---	---	---	---
ADAMTS17	170691	broad.mit.edu	37	15	100690355	100690355	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100690355delA	uc002bvv.1	-						ADAMTS17_uc002bvx.1_Intron	NM_139057	NP_620688			ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	101804442	101804442	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101804442delA								CHSY1 (12316 upstream) : SELS (6772 downstream)																																			---	---	---	---
PRSS22	64063	broad.mit.edu	37	16	2905349	2905351	+	Intron	DEL	AAA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2905349_2905351delAAA	uc002cry.1	-						PRSS22_uc002crz.1_Intron	NM_022119	NP_071402			protease, serine, 22 precursor						proteolysis	extracellular region	serine-type endopeptidase activity			central_nervous_system(1)	1																		---	---	---	---
CREBBP	1387	broad.mit.edu	37	16	3794079	3794079	+	Intron	DEL	A	-	-	rs79367415		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3794079delA	uc002cvv.2	-						CREBBP_uc002cvw.2_Intron	NM_004380	NP_004371			CREB binding protein isoform a						cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)				T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7280179	7280179	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7280179delT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7715231	7715231	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7715231delT	uc002cys.2	+						A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
EMP2	2013	broad.mit.edu	37	16	10626598	10626598	+	3'UTR	DEL	T	-	-	rs67718108		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10626598delT	uc002czx.2	-	5						NM_001424	NP_001415			epithelial membrane protein 2						cell proliferation	integral to membrane					0																		---	---	---	---
ABCC1	4363	broad.mit.edu	37	16	16160760	16160760	+	Intron	DEL	A	-	-	rs67635436		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16160760delA	uc010bvi.2	+						ABCC1_uc010bvj.2_Intron|ABCC1_uc010bvk.2_Intron|ABCC1_uc010bvl.2_Intron|ABCC1_uc010bvm.2_Intron|ABCC1_uc002del.3_Intron	NM_004996	NP_004987			ATP-binding cassette, sub-family C, member 1						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
ABCC6	368	broad.mit.edu	37	16	16252312	16252313	+	Intron	INS	-	TCCC	TCCC	rs149907344	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16252312_16252313insTCCC	uc002den.3	-						ABCC6_uc010bvo.2_Intron|ABCC6_uc002dem.2_5'Flank	NM_001171	NP_001162			ATP-binding cassette, sub-family C, member 6						response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	17619057	17619057	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17619057delA								XYLT1 (54319 upstream) : NOMO2 (892126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	18063781	18063784	+	IGR	DEL	CATC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18063781_18063784delCATC								XYLT1 (499043 upstream) : NOMO2 (447399 downstream)																																			---	---	---	---
GPR139	124274	broad.mit.edu	37	16	20072550	20072553	+	Intron	DEL	TGGA	-	-	rs113302227		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20072550_20072553delTGGA	uc002dgu.1	-						GPR139_uc010vaw.1_Intron	NM_001002911	NP_001002911			G protein-coupled receptor 139							integral to membrane|plasma membrane				ovary(2)	2																		---	---	---	---
LOC653786	653786	broad.mit.edu	37	16	22565894	22565894	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22565894delT	uc002dlh.3	+							NR_003676				RecName: Full=Otoancorin; Flags: Precursor;												0																		---	---	---	---
SCNN1G	6340	broad.mit.edu	37	16	23193483	23193484	+	5'Flank	INS	-	AAA	AAA	rs72508644		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23193483_23193484insAAA	uc002dlm.1	+							NM_001039	NP_001030			sodium channel, nonvoltage-gated 1, gamma						excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	25241054	25241054	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25241054delA								AQP8 (802 upstream) : ZKSCAN2 (6270 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26523780	26523781	+	IGR	DEL	TG	-	-	rs10539097		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26523780_26523781delTG								HS3ST4 (374772 upstream) : C16orf82 (554438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	27030609	27030609	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27030609delA								HS3ST4 (881601 upstream) : C16orf82 (47610 downstream)																																			---	---	---	---
KIAA0556	23247	broad.mit.edu	37	16	27688009	27688010	+	Intron	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27688009_27688010delTG	uc002dow.2	+						KIAA0556_uc002dox.1_Intron	NM_015202	NP_056017			hypothetical protein LOC23247											ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	29140544	29140544	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29140544delG	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	29249688	29249690	+	Intron	DEL	GGT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29249688_29249690delGGT	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	32118178	32118178	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32118178delG								ZNF267 (189552 upstream) : HERC2P4 (44432 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32546122	32546123	+	IGR	INS	-	A	A	rs149439922		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32546122_32546123insA								HERC2P4 (382248 upstream) : TP53TG3B (138718 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32817862	32817864	+	IGR	DEL	TTT	-	-	rs150100349		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32817862_32817864delTTT								TP53TG3B (128984 upstream) : SLC6A10P (70933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32846910	32846911	+	IGR	DEL	TT	-	-	rs113284600		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32846910_32846911delTT								TP53TG3B (158032 upstream) : SLC6A10P (41886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33388293	33388293	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33388293delT								SLC6A10P (491830 upstream) : MIR1826 (577215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33590243	33590243	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33590243delA								SLC6A10P (693780 upstream) : MIR1826 (375265 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33680867	33680868	+	IGR	DEL	AC	-	-	rs72258376		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33680867_33680868delAC								SLC6A10P (784404 upstream) : MIR1826 (284640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33831935	33831936	+	IGR	INS	-	T	T	rs147532074		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33831935_33831936insT								SLC6A10P (935472 upstream) : MIR1826 (133572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33943375	33943389	+	IGR	DEL	CCGGGATGTAGGTCT	-	-	rs74015488		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33943375_33943389delCCGGGATGTAGGTCT								None (None upstream) : MIR1826 (22119 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33951596	33951598	+	IGR	DEL	TTC	-	-	rs148603429		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33951596_33951598delTTC								None (None upstream) : MIR1826 (13910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33955276	33955277	+	IGR	INS	-	TG	TG			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33955276_33955277insTG								None (None upstream) : MIR1826 (10231 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46463268	46463268	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46463268delC								None (None upstream) : ANKRD26P1 (39981 downstream)																																			---	---	---	---
ANKRD26P1	124149	broad.mit.edu	37	16	46604226	46604226	+	5'Flank	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46604226delG	uc002eeb.3	-							NR_026556				Homo sapiens cDNA FLJ43980 fis, clone TESTI4018806.												0																		---	---	---	---
ABCC11	85320	broad.mit.edu	37	16	48208534	48208534	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48208534delA	uc002eff.1	-						ABCC11_uc002efg.1_Intron|ABCC11_uc002efh.1_Intron|ABCC11_uc010cbg.1_Intron	NM_033151	NP_149163			ATP-binding cassette, sub-family C, member 11							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)												Cerumen_Type				---	---	---	---
N4BP1	9683	broad.mit.edu	37	16	48613591	48613591	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48613591delA	uc002efp.2	-							NM_153029	NP_694574			Nedd4 binding protein 1						negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	50721177	50721178	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50721177_50721178insA								SNX20 (5913 upstream) : NOD2 (6336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51014739	51014740	+	IGR	DEL	CA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51014739_51014740delCA								CYLD (178893 upstream) : SALL1 (155146 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52824060	52824060	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52824060delT								TOX3 (242346 upstream) : CHD9 (264885 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	54352504	54352509	+	IGR	DEL	GCGCGC	-	-	rs1968662		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54352504_54352509delGCGCGC								IRX3 (32126 upstream) : IRX5 (612602 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	55191551	55191557	+	IGR	DEL	AAAAGAA	-	-	rs71389044		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55191551_55191557delAAAAGAA								IRX5 (223158 upstream) : IRX6 (166914 downstream)																																			---	---	---	---
AMFR	267	broad.mit.edu	37	16	56419532	56419532	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56419532delT	uc002eiy.2	-						AMFR_uc002eix.2_Intron	NM_001144	NP_001135			autocrine motility factor receptor						endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein oligomerization|protein polyubiquitination	integral to endoplasmic reticulum membrane|integral to membrane of membrane fraction	protein binding|protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding			breast(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	57453685	57453686	+	IGR	INS	-	C	C	rs150765723	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57453685_57453686insC								CCL17 (3711 upstream) : CIAPIN1 (8401 downstream)																																			---	---	---	---
CIAPIN1	57019	broad.mit.edu	37	16	57467435	57467436	+	Intron	INS	-	TGTG	TGTG	rs147834361	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57467435_57467436insTGTG	uc002ell.1	-						CIAPIN1_uc002elk.1_Intron|CIAPIN1_uc002elm.1_Intron|CIAPIN1_uc002eln.1_Intron|CIAPIN1_uc010cda.1_Intron|CIAPIN1_uc002elo.1_Intron	NM_020313	NP_064709			cytokine induced apoptosis inhibitor 1						anti-apoptosis|apoptosis	cytoplasm|nucleolus					0																		---	---	---	---
CNGB1	1258	broad.mit.edu	37	16	57922372	57922373	+	Intron	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57922372_57922373delTC	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288			cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4																		---	---	---	---
PRSS54	221191	broad.mit.edu	37	16	58322791	58322792	+	Intron	INS	-	AATT	AATT	rs148329812	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58322791_58322792insAATT	uc002enf.2	-						PRSS54_uc002eng.2_Intron|PRSS54_uc010vie.1_Intron	NM_001080492	NP_001073961			plasma kallikrein-like protein 4 precursor						proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	58443615	58443616	+	IGR	INS	-	T	T	rs11453726		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58443615_58443616insT								GINS3 (3568 upstream) : NDRG4 (53933 downstream)																																			---	---	---	---
NDRG4	65009	broad.mit.edu	37	16	58507675	58507675	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58507675delT	uc002enm.2	+						NDRG4_uc002enk.2_Intron|NDRG4_uc010vif.1_Intron	NM_001130487	NP_001123959			NDRG family member 4 isoform 2						cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	58791272	58791273	+	IGR	INS	-	TCT	TCT	rs143371899	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58791272_58791273insTCT								GOT2 (23026 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	58821034	58821035	+	IGR	DEL	TT	-	-	rs34742981		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58821034_58821035delTT								GOT2 (52788 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59355207	59355208	+	IGR	INS	-	A	A	rs75592655		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59355207_59355208insA								GOT2 (586961 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	60170077	60170077	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60170077delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	60271781	60271782	+	IGR	INS	-	T	T	rs35679549		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60271781_60271782insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	60382115	60382116	+	IGR	DEL	GA	-	-	rs146636423		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60382115_60382116delGA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	66120353	66120353	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66120353delT								LOC283867 (510150 upstream) : CDH5 (280172 downstream)																																			---	---	---	---
CMTM4	146223	broad.mit.edu	37	16	66704188	66704188	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66704188delA	uc002epz.2	-						CMTM4_uc002eqa.2_Intron	NM_178818	NP_848933			chemokine-like factor superfamily 4 isoform 1						chemotaxis	extracellular space|integral to membrane	cytokine activity			pancreas(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0811)|Epithelial(162;0.214)														---	---	---	---
RANBP10	57610	broad.mit.edu	37	16	67797574	67797574	+	Intron	DEL	A	-	-	rs11296847		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67797574delA	uc002eud.2	-						RANBP10_uc010ceo.2_Intron|RANBP10_uc010vju.1_Intron|RANBP10_uc010vjv.1_Intron|RANBP10_uc010vjx.1_Intron|RANBP10_uc010vjy.1_Intron	NM_020850	NP_065901			RAN binding protein 10											ovary(1)	1		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)														---	---	---	---
TMCO7	79613	broad.mit.edu	37	16	68877377	68877377	+	5'Flank	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68877377delA	uc002ewi.3	+						TMCO7_uc002ewh.2_5'Flank	NM_024562	NP_078838			transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)														---	---	---	---
TMCO7	79613	broad.mit.edu	37	16	69048661	69048661	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69048661delG	uc002ewi.3	+							NM_024562	NP_078838			transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)														---	---	---	---
COG4	25839	broad.mit.edu	37	16	70537498	70537499	+	Intron	INS	-	T	T	rs72084772		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70537498_70537499insT	uc002ezc.2	-						COG4_uc002ezb.2_Intron|COG4_uc010cfu.2_Intron|COG4_uc002ezd.2_Intron|COG4_uc002eze.2_Intron	NM_015386	NP_056201			component of oligomeric golgi complex 4						Golgi organization|Golgi vesicle prefusion complex stabilization|protein transport|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0		Ovarian(137;0.0694)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	71645902	71645902	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71645902delA								TAT (34904 upstream) : MARVELD3 (14168 downstream)																																			---	---	---	---
ZFHX3	463	broad.mit.edu	37	16	72931765	72931766	+	Intron	INS	-	A	A	rs146682192	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72931765_72931766insA	uc002fck.2	-						ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816			zinc finger homeobox 3 isoform A						muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	73214568	73214568	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73214568delT								HTA (86898 upstream) : None (None downstream)																																			---	---	---	---
GLG1	2734	broad.mit.edu	37	16	74636683	74636683	+	Intron	DEL	A	-	-	rs72349063		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74636683delA	uc002fcy.3	-						GLG1_uc002fcx.2_Intron|GLG1_uc002fcw.3_Intron|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139			golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2																		---	---	---	---
ZNRF1	84937	broad.mit.edu	37	16	75057594	75057595	+	Intron	DEL	AC	-	-	rs146054857	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75057594_75057595delAC	uc002fdk.2	+						ZNRF1_uc010vmz.1_Intron|ZNRF1_uc002fdl.1_Intron|ZNRF1_uc010cgr.1_Intron	NM_032268	NP_115644			zinc and ring finger protein 1							cell junction|endosome|lysosome|synaptic vesicle membrane	ligase activity|protein binding|zinc ion binding				0																		---	---	---	---
CFDP1	10428	broad.mit.edu	37	16	75465541	75465542	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75465541_75465542insA	uc002fdy.2	-						CFDP1_uc002fdz.2_Intron|CFDP1_uc002fea.1_Intron	NM_006324	NP_006315			craniofacial development protein 1						multicellular organismal development					upper_aerodigestive_tract(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	75881345	75881346	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75881345_75881346insT								TERF2IP (190017 upstream) : CNTNAP4 (429830 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	76723759	76723759	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76723759delC								CNTNAP4 (130624 upstream) : MON1B (501077 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	77084399	77084400	+	IGR	INS	-	T	T	rs79250668		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77084399_77084400insT								CNTNAP4 (491264 upstream) : MON1B (140436 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	77710457	77710459	+	IGR	DEL	TAA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77710457_77710459delTAA								ADAMTS18 (241446 upstream) : NUDT7 (45952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	78067314	78067314	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78067314delA								CLEC3A (1317 upstream) : WWOX (66237 downstream)																																			---	---	---	---
WWOX	51741	broad.mit.edu	37	16	78737351	78737351	+	Intron	DEL	T	-	-	rs112258892		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78737351delT	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457			WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)														---	---	---	---
WWOX	51741	broad.mit.edu	37	16	79087891	79087892	+	Intron	INS	-	A	A	rs143855467	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79087891_79087892insA	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457			WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	79284974	79284975	+	IGR	INS	-	C	C	rs144229458	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79284974_79284975insC								WWOX (38411 upstream) : MAF (342771 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	79399479	79399479	+	IGR	DEL	T	-	-	rs67588991		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79399479delT								WWOX (152916 upstream) : MAF (228267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	80841429	80841431	+	IGR	DEL	CTT	-	-	rs72057562		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80841429_80841431delCTT								CDYL2 (3254 upstream) : C16orf61 (168270 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	81114070	81114071	+	IGR	INS	-	A	A	rs147818854	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81114070_81114071insA								C16orf46 (3198 upstream) : GCSH (1860 downstream)																																			---	---	---	---
PKD1L2	114780	broad.mit.edu	37	16	81157762	81157763	+	Intron	INS	-	T	T	rs67758173		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81157762_81157763insT	uc002fgh.1	-						PKD1L2_uc002fgf.1_Intron|PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124			polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
PKD1L2	114780	broad.mit.edu	37	16	81161713	81161713	+	Intron	DEL	A	-	-	rs113658800		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81161713delA	uc002fgh.1	-						PKD1L2_uc002fgf.1_Intron|PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124			polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
PKD1L2	114780	broad.mit.edu	37	16	81237725	81237725	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81237725delA	uc002fgh.1	-						PKD1L2_uc002fgj.2_Intron	NM_052892	NP_443124			polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
BCMO1	53630	broad.mit.edu	37	16	81289723	81289723	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81289723delT	uc002fgn.1	+						BCMO1_uc002fgm.1_Intron|BCMO1_uc010vnp.1_Intron	NM_017429	NP_059125			beta-carotene 15,15'-monooxygenase						retinoid metabolic process|steroid metabolic process	cytosol	beta-carotene 15,15'-monooxygenase activity|metal ion binding|monooxygenase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	82453833	82453834	+	IGR	INS	-	T	T	rs147379514	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82453833_82453834insT								MPHOSPH6 (250004 upstream) : CDH13 (206744 downstream)																																			---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83218488	83218489	+	Intron	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83218488_83218489delGT	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83525503	83525506	+	Intron	DEL	TTTC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83525503_83525506delTTTC	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
ATP2C2	9914	broad.mit.edu	37	16	84429830	84429831	+	Intron	DEL	GT	-	-	rs145187227		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84429830_84429831delGT	uc002fhx.2	+						ATP2C2_uc010chj.2_Intron	NM_014861	NP_055676			ATPase, Ca++ transporting, type 2C, member 2						ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	84943953	84943954	+	IGR	INS	-	ACAC	ACAC	rs140263038	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84943953_84943954insACAC								CRISPLD2 (837 upstream) : ZDHHC7 (64113 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	85606555	85606555	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85606555delA								FAM92B (460441 upstream) : KIAA0182 (38474 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	85735989	85735991	+	IGR	DEL	CTT	-	-	rs75455471		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85735989_85735991delCTT								GINS2 (13401 upstream) : C16orf74 (5135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86038361	86038362	+	IGR	INS	-	A	A	rs139359549	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86038361_86038362insA								IRF8 (82152 upstream) : LOC732275 (327094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86297095	86297095	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86297095delT								IRF8 (340886 upstream) : LOC732275 (68361 downstream)																																			---	---	---	---
LOC732275	732275	broad.mit.edu	37	16	86374879	86374879	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86374879delA	uc002fjj.2	-						LOC732275_uc010chr.2_Intron|LOC732275_uc010von.1_5'Flank	NR_024406				Homo sapiens cDNA FLJ35925 fis, clone TESTI2010734.												0																OREG0024015	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	16	86518927	86518927	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86518927delC								LOC732275 (139642 upstream) : FOXF1 (25206 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	87108568	87108570	+	IGR	DEL	CTT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87108568_87108570delCTT								FOXL1 (493265 upstream) : FBXO31 (254374 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	87114307	87114307	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87114307delA								FOXL1 (499004 upstream) : FBXO31 (248637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	87216714	87216726	+	Intron	DEL	TGCAGTATATGGC	-	-	rs112291402		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87216714_87216726delTGCAGTATATGGC	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	87244607	87244609	+	Intron	DEL	TGA	-	-	rs34946803		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87244607_87244609delTGA	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	87615312	87615313	+	IGR	INS	-	A	A	rs149539014	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87615312_87615313insA								ZCCHC14 (89852 upstream) : JPH3 (20128 downstream)																																			---	---	---	---
JPH3	57338	broad.mit.edu	37	16	87671029	87671030	+	Intron	DEL	TG	-	-	rs10686570		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87671029_87671030delTG	uc002fkd.2	+						JPH3_uc010vou.1_Intron	NM_020655	NP_065706			junctophilin 3						calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding			ovary(1)|pancreas(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0287)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	88197104	88197115	+	IGR	DEL	ATGGATGGATGG	-	-	rs140789092		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88197104_88197115delATGGATGGATGG								BANP (86181 upstream) : ZNF469 (296764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	88219089	88219090	+	IGR	DEL	CT	-	-	rs34391862		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88219089_88219090delCT								BANP (108166 upstream) : ZNF469 (274789 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	88468124	88468131	+	IGR	DEL	TGGATGGG	-	-	rs141467546		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88468124_88468131delTGGATGGG								BANP (357201 upstream) : ZNF469 (25748 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	89126384	89126385	+	IGR	INS	-	CAAA	CAAA	rs141839750	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89126384_89126385insCAAA								CBFA2T3 (82983 upstream) : ACSF3 (33869 downstream)																																			---	---	---	---
SPIRE2	84501	broad.mit.edu	37	16	89934248	89934249	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89934248_89934249insT	uc002foz.1	+						SPIRE2_uc010ciw.1_Intron|SPIRE2_uc002fpa.1_Intron|SPIRE2_uc010cix.1_Intron	NM_032451	NP_115827			spire homolog 2						transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	89980590	89980591	+	RNA	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89980590_89980591delTG	uc010ciy.1	+	2		c.1093_1094delTG								Homo sapiens cDNA clone IMAGE:40002380.																														---	---	---	---
RPH3AL	9501	broad.mit.edu	37	17	166905	166905	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:166905delA	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918			rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)														---	---	---	---
NXN	64359	broad.mit.edu	37	17	756720	756720	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:756720delC	uc002fsa.2	-						NXN_uc002fsb.1_Intron|NXN_uc002frz.2_Intron|NXN_uc010vqe.1_Intron	NM_022463	NP_071908			nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)														---	---	---	---
METT10D	79066	broad.mit.edu	37	17	2350047	2350047	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2350047delT	uc002fut.2	-						METT10D_uc002fuu.3_Intron|METT10D_uc010cka.2_Intron|METT10D_uc002fuv.2_Intron|METT10D_uc010vqx.1_Intron|METT10D_uc010vqy.1_Intron	NM_024086	NP_076991			methyltransferase 10 domain containing								methyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	3065645	3065646	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3065645_3065646insT								OR1G1 (34800 upstream) : OR1A2 (35167 downstream)																																			---	---	---	---
ATP2A3	489	broad.mit.edu	37	17	3843326	3843326	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3843326delT	uc002fxb.1	-						ATP2A3_uc002fwx.1_Intron|ATP2A3_uc002fwy.1_Intron|ATP2A3_uc002fwz.1_Intron|ATP2A3_uc002fxa.1_Intron|ATP2A3_uc002fxc.1_Intron|ATP2A3_uc002fxd.1_Intron	NM_174955	NP_777615			ATPase, Ca++ transporting, ubiquitous isoform b						ATP biosynthetic process|platelet activation	integral to membrane|nuclear membrane|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			ovary(3)|breast(1)|central_nervous_system(1)	5				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)														---	---	---	---
C17orf87	388325	broad.mit.edu	37	17	5131161	5131161	+	Intron	DEL	C	-	-	rs145724341		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5131161delC	uc002gbh.2	-						uc002gbg.1_Intron|C17orf87_uc010clb.1_Intron|C17orf87_uc002gbi.2_Intron	NM_207103	NP_996986			hypothetical protein LOC388325							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	6559524	6559525	+	IGR	DEL	AG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6559524_6559525delAG								C17orf100 (2907 upstream) : SLC13A5 (28516 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	6580816	6580816	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6580816delC								C17orf100 (24199 upstream) : SLC13A5 (7225 downstream)																																			---	---	---	---
NTN1	9423	broad.mit.edu	37	17	9130705	9130706	+	Intron	INS	-	ACTT	ACTT	rs151039427		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9130705_9130706insACTT	uc002glw.3	+							NM_004822	NP_004813			netrin 1 precursor						apoptosis|axon guidance		protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	16410726	16410727	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16410726_16410727insA								C17orf76 (15246 upstream) : ZNF287 (42904 downstream)																																			---	---	---	---
CCDC144NL	339184	broad.mit.edu	37	17	20772154	20772155	+	Intron	INS	-	A	A	rs140129415		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20772154_20772155insA	uc002gyf.2	-						uc002gyg.1_Intron|uc002gyh.1_Intron	NM_001004306	NP_001004306			coiled-coil domain containing 144 family,												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	21548187	21548188	+	IGR	DEL	AG	-	-	rs113251852		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21548187_21548188delAG								C17orf51 (70456 upstream) : FAM27L (277182 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21557548	21557548	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21557548delT								C17orf51 (79817 upstream) : FAM27L (267822 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25280239	25280240	+	IGR	INS	-	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25280239_25280240insC								None (None upstream) : WSB1 (340866 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25293615	25293627	+	IGR	DEL	ATGAAATGAAATA	-	-	rs148138052	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25293615_25293627delATGAAATGAAATA								None (None upstream) : WSB1 (327479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	26023221	26023222	+	IGR	INS	-	AA	AA	rs139448564	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26023221_26023222insAA								LGALS9 (46636 upstream) : NOS2 (60571 downstream)																																			---	---	---	---
SEZ6	124925	broad.mit.edu	37	17	27319418	27319419	+	Intron	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27319418_27319419delGT	uc002hdp.2	-						SEZ6_uc010cry.1_Intron|SEZ6_uc002hdq.1_Intron|SEZ6_uc010crz.1_Intron	NM_178860	NP_849191			seizure related 6 homolog isoform 1							integral to membrane|plasma membrane				large_intestine(1)|central_nervous_system(1)	2	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)															---	---	---	---
RNF135	84282	broad.mit.edu	37	17	29317767	29317767	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29317767delT	uc002hfz.2	+						RNF135_uc002hga.2_Intron|RNF135_uc010csm.2_Intron|RNF135_uc002hgb.2_Intron	NM_032322	NP_115698			ring finger protein 135 isoform 1						innate immune response|negative regulation of type I interferon production|positive regulation of interferon-beta production|regulation of innate immune response	cytosol	protein binding|ribonucleoprotein binding|ubiquitin-protein ligase activity|zinc ion binding	p.?(1)		skin(2)	2		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)																---	---	---	---
UTP6	55813	broad.mit.edu	37	17	30216089	30216089	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30216089delA	uc002hgr.2	-						UTP6_uc002hgq.2_5'Flank|UTP6_uc010cst.2_Intron|UTP6_uc010wbw.1_Intron	NM_018428	NP_060898			hepatocellular carcinoma-associated antigen 66						rRNA processing	nucleolus	binding			ovary(1)	1		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)																---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31756203	31756203	+	Intron	DEL	T	-	-	rs77886146		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31756203delT	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
MMP28	79148	broad.mit.edu	37	17	34093206	34093206	+	3'UTR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34093206delG	uc002hjy.1	-	10					MMP28_uc002hjw.1_Intron	NM_024302	NP_077278			matrix metalloproteinase 28 isoform 1						proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)														---	---	---	---
MMP28	79148	broad.mit.edu	37	17	34107845	34107845	+	Intron	DEL	A	-	-	rs112660920		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34107845delA	uc002hjy.1	-						MMP28_uc002hjw.1_Intron|MMP28_uc002hjz.1_Intron|MMP28_uc002hka.2_Intron	NM_024302	NP_077278			matrix metalloproteinase 28 isoform 1						proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)														---	---	---	---
MYO19	80179	broad.mit.edu	37	17	34884985	34884985	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34884985delT	uc010wcy.1	-						MYO19_uc002hmw.2_Intron|MYO19_uc010cuu.2_Intron|MYO19_uc010wcz.1_Intron|MYO19_uc010wda.1_Intron|MYO19_uc002hmx.2_Intron	NM_001163735	NP_001157207			myosin XIX isoform 2							mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)	1		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	38625057	38625057	+	IGR	DEL	T	-	-	rs72351807		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38625057delT								IGFBP4 (11076 upstream) : TNS4 (7025 downstream)																																			---	---	---	---
KRT20	54474	broad.mit.edu	37	17	39037480	39037481	+	Intron	DEL	TG	-	-	rs149120741		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39037480_39037481delTG	uc002hvl.2	-							NM_019010	NP_061883			keratin 20						apoptosis|intermediate filament organization	Golgi apparatus|intermediate filament	protein binding|structural constituent of cytoskeleton			large_intestine(1)|kidney(1)|skin(1)	3		Breast(137;0.000301)|Ovarian(249;0.15)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	40546159	40546159	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40546159delT								STAT3 (5646 upstream) : PTRF (8309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	41763859	41763859	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41763859delT								MEOX1 (24597 upstream) : SOST (67240 downstream)																																			---	---	---	---
C17orf65	339201	broad.mit.edu	37	17	42261416	42261417	+	Intron	DEL	AA	-	-	rs72309580		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42261416_42261417delAA	uc002ifn.2	-						TMUB2_uc002ifo.2_5'Flank|TMUB2_uc002ifp.2_5'Flank|TMUB2_uc010wiu.1_5'Flank|TMUB2_uc002ifq.2_5'Flank|TMUB2_uc002ifr.2_5'Flank	NM_178542	NP_848637			hypothetical protein LOC339201												0		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)														---	---	---	---
RUNDC3A	10900	broad.mit.edu	37	17	42391047	42391048	+	Intron	DEL	TT	-	-	rs10550102		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42391047_42391048delTT	uc002igl.3	+						RUNDC3A_uc002igi.2_Intron|RUNDC3A_uc002igj.2_Intron|RUNDC3A_uc002igk.2_Intron	NM_001144825	NP_001138297			RUN domain containing 3A isoform 1						small GTPase mediated signal transduction		small GTPase regulator activity				0		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	48329828	48329828	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48329828delC								COL1A1 (50828 upstream) : TMEM92 (22009 downstream)																																			---	---	---	---
SPAG9	9043	broad.mit.edu	37	17	49128394	49128395	+	Intron	INS	-	A	A	rs145934583	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49128394_49128395insA	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron	NM_001130528	NP_001124000			sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)															---	---	---	---
ANKFN1	162282	broad.mit.edu	37	17	54421044	54421045	+	Intron	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54421044_54421045delTC	uc002iun.1	+							NM_153228	NP_694960			ankyrin-repeat and fibronectin type III domain											large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	54957700	54957700	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54957700delA								DGKE (11666 upstream) : MTVR2 (3763 downstream)																																			---	---	---	---
TEX14	56155	broad.mit.edu	37	17	56673877	56673877	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56673877delA	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207			testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
TLK2	11011	broad.mit.edu	37	17	60617430	60617436	+	Intron	DEL	CTTTCTT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60617430_60617436delCTTTCTT	uc010ddp.2	+						TLK2_uc002izx.3_Intron|TLK2_uc002izz.3_Intron|TLK2_uc002jaa.3_Intron|TLK2_uc010wpd.1_Intron	NM_006852	NP_006843			tousled-like kinase 2 isoform A						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2																		---	---	---	---
STRADA	92335	broad.mit.edu	37	17	61819681	61819681	+	5'Flank	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61819681delT	uc002jbm.2	-						STRADA_uc002jbn.2_5'Flank|STRADA_uc002jbo.2_5'Flank|STRADA_uc002jbp.2_5'Flank|STRADA_uc002jbq.2_5'Flank|STRADA_uc010wpq.1_5'Flank|STRADA_uc010wpr.1_5'Flank|STRADA_uc010ddw.2_5'Flank|STRADA_uc002jbr.2_5'Flank	NM_001003787	NP_001003787			STE20-related kinase adaptor alpha isoform 1						activation of protein kinase activity|cell cycle arrest|insulin receptor signaling pathway|protein export from nucleus|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|kinase binding|protein kinase activity			ovary(1)	1																		---	---	---	---
HELZ	9931	broad.mit.edu	37	17	65221837	65221837	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65221837delA	uc010wqk.1	-						HELZ_uc002jfv.3_Intron|HELZ_uc002jfx.3_Intron|HELZ_uc010des.1_Intron	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)																	---	---	---	---
PITPNC1	26207	broad.mit.edu	37	17	65426908	65426908	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65426908delA	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549			phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	70405250	70405251	+	Intron	DEL	CT	-	-	rs71925423		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70405250_70405251delCT	uc002jix.2	-						uc002jiz.1_Intron|uc002jiy.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																														---	---	---	---
SDK2	54549	broad.mit.edu	37	17	71333192	71333193	+	3'UTR	INS	-	TG	TG	rs148766000	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71333192_71333193insTG	uc010dfm.2	-	45					SDK2_uc002jjt.3_3'UTR	NM_001144952	NP_001138424			sidekick 2						cell adhesion	integral to membrane				ovary(2)	2																		---	---	---	---
RAB37	326624	broad.mit.edu	37	17	72670455	72670455	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72670455delA	uc010dfu.2	+						RAB37_uc002jlc.2_Intron|RAB37_uc002jld.2_Intron	NM_175738	NP_783865			RAB37, member RAS oncogene family isoform 3						protein transport|small GTPase mediated signal transduction	ER-Golgi intermediate compartment	GTP binding			ovary(1)	1																		---	---	---	---
TNRC6C	57690	broad.mit.edu	37	17	76037422	76037422	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76037422delG	uc002jud.2	+						TNRC6C_uc002juf.2_Intron	NM_018996	NP_061869			trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	78990069	78990069	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78990069delA								CHMP6 (16137 upstream) : FLJ90757 (12864 downstream)																																			---	---	---	---
TBCD	6904	broad.mit.edu	37	17	80870279	80870280	+	Intron	INS	-	TT	TT	rs145754070	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80870279_80870280insTT	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kgb.1_Intron	NM_005993	NP_005984			beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	10094	10095	+	IGR	INS	-	A	A	rs139658026		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10094_10095insA								None (None upstream) : USP14 (148388 downstream)																																			---	---	---	---
COLEC12	81035	broad.mit.edu	37	18	479548	479549	+	Intron	INS	-	CA	CA			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:479548_479549insCA	uc002kkm.2	-							NM_130386	NP_569057			collectin sub-family member 12						carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	1054891	1054894	+	IGR	DEL	GTGT	-	-	rs111246421		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1054891_1054894delGTGT								ADCYAP1 (142720 upstream) : C18orf2 (199496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	2049700	2049700	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2049700delA								C18orf2 (642519 upstream) : METTL4 (487825 downstream)																																			---	---	---	---
NDC80	10403	broad.mit.edu	37	18	2611045	2611045	+	Intron	DEL	T	-	-	rs68074365		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2611045delT	uc002kli.2	+							NM_006101	NP_006092			kinetochore associated 2						attachment of spindle microtubules to kinetochore|cell division|establishment of mitotic spindle orientation|mitotic prometaphase|mitotic sister chromatid segregation|mitotic spindle organization|phosphatidylinositol-mediated signaling	condensed nuclear chromosome outer kinetochore|cytosol|Ndc80 complex	protein binding			ovary(1)	1																		---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	3595499	3595500	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3595499_3595500insA	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron|FLJ35776_uc010wza.1_Intron|FLJ35776_uc010wzb.1_RNA	NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	3869155	3869155	+	Intron	DEL	T	-	-	rs11355986		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3869155delT	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmk.2_Intron	NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	4988202	4988202	+	IGR	DEL	T	-	-	rs140577346	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4988202delT								DLGAP1 (532936 upstream) : LOC642597 (155470 downstream)																																			---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	7793487	7793487	+	Intron	DEL	T	-	-	rs11308222		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7793487delT	uc002knn.3	+						PTPRM_uc010dkv.2_Intron	NM_002845	NP_002836			protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
ANKRD12	23253	broad.mit.edu	37	18	9205321	9205321	+	Intron	DEL	T	-	-	rs66488563		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9205321delT	uc002knv.2	+						ANKRD12_uc010wzn.1_Intron|ANKRD12_uc002knw.2_Intron|ANKRD12_uc002knx.2_Intron	NM_015208	NP_056023			ankyrin repeat domain 12 isoform 1							nucleus				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	9702632	9702632	+	IGR	DEL	T	-	-	rs112827914		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9702632delT								PPP4R1 (88032 upstream) : RAB31 (5596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	10346567	10346568	+	IGR	DEL	CA	-	-	rs72413514		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10346567_10346568delCA								VAPA (386550 upstream) : APCDD1 (108057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	10949494	10949495	+	IGR	INS	-	CT	CT	rs151197497	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10949494_10949495insCT								FAM38B (247515 upstream) : GNAL (739641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	11933815	11933816	+	IGR	INS	-	TG	TG	rs5823184		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11933815_11933816insTG								MPPE1 (25174 upstream) : IMPA2 (47241 downstream)																																			---	---	---	---
SPIRE1	56907	broad.mit.edu	37	18	12461481	12461482	+	Intron	DEL	AT	-	-	rs5823219		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12461481_12461482delAT	uc002kre.2	-						SPIRE1_uc002krc.2_Intron|SPIRE1_uc010wzw.1_Intron|SPIRE1_uc010wzx.1_Intron|SPIRE1_uc010wzy.1_Intron	NM_001128626	NP_001122098			spire homolog 1 isoform a							cytoskeleton|perinuclear region of cytoplasm	actin binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	13848531	13848531	+	IGR	DEL	G	-	-	rs66700024		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13848531delG								MC5R (21791 upstream) : MC2R (33512 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	19812335	19812335	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19812335delC								GATA6 (30108 upstream) : CTAGE1 (181229 downstream)																																			---	---	---	---
LAMA3	3909	broad.mit.edu	37	18	21408559	21408560	+	Intron	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21408559_21408560delTG	uc002kuq.2	+						LAMA3_uc002kur.2_Intron	NM_198129	NP_937762			laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
LAMA3	3909	broad.mit.edu	37	18	21479634	21479634	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21479634delA	uc002kuq.2	+						LAMA3_uc002kur.2_Intron|LAMA3_uc002kus.3_Intron|LAMA3_uc002kut.3_Intron	NM_198129	NP_937762			laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	18	21536680	21536680	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21536680delT								LAMA3 (1653 upstream) : TTC39C (36057 downstream)																																			---	---	---	---
TTC39C	125488	broad.mit.edu	37	18	21700820	21700821	+	Intron	DEL	AT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21700820_21700821delAT	uc002kuw.2	+						TTC39C_uc002kuu.2_Intron	NM_001135993	NP_001129465			tetratricopeptide repeat domain 39C isoform 1								binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	22069400	22069401	+	IGR	INS	-	TG	TG	rs139789729	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22069400_22069401insTG								HRH4 (9480 upstream) : ZNF521 (572487 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	25864662	25864663	+	IGR	DEL	TT	-	-	rs138031226		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25864662_25864663delTT								CDH2 (107217 upstream) : None (None downstream)																																			---	---	---	---
SETBP1	26040	broad.mit.edu	37	18	42606763	42606764	+	Intron	INS	-	TG	TG	rs150865752	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42606763_42606764insTG	uc010dni.2	+							NM_015559	NP_056374			SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)										Schinzel-Giedion_syndrome				---	---	---	---
SLC14A2	8170	broad.mit.edu	37	18	43067438	43067438	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43067438delT	uc010dnj.2	+						SLC14A2_uc002lbb.2_Intron|uc002lbc.1_Intron|uc002lbd.1_Intron	NM_007163	NP_009094			solute carrier family 14 (urea transporter),							apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
POLI	11201	broad.mit.edu	37	18	51821540	51821541	+	3'UTR	INS	-	G	G	rs151011064	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51821540_51821541insG	uc002lfj.3	+	10					POLI_uc010xds.1_3'UTR|POLI_uc002lfk.3_3'UTR|POLI_uc010dpg.2_3'UTR	NM_007195	NP_009126			DNA polymerase iota						DNA repair|DNA replication	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding|protein binding			ovary(2)|kidney(1)	3				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)									DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
Unknown	0	broad.mit.edu	37	18	52436994	52436994	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52436994delT								C18orf26 (170270 upstream) : RAB27B (58846 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	53832082	53832082	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53832082delT								TCF4 (528897 upstream) : TXNL1 (437973 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	54005507	54005507	+	IGR	DEL	A	-	-	rs111452300		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54005507delA								TCF4 (702322 upstream) : TXNL1 (264548 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	54981896	54981896	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54981896delT								WDR7 (284860 upstream) : ST8SIA3 (37825 downstream)																																			---	---	---	---
KIAA1468	57614	broad.mit.edu	37	18	59867605	59867606	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59867605_59867606insT	uc002lil.2	+						KIAA1468_uc002lik.1_Intron|KIAA1468_uc010xel.1_Intron	NM_020854	NP_065905			hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	71355706	71355707	+	IGR	DEL	AC	-	-	rs66969599		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71355706_71355707delAC								NETO1 (820896 upstream) : FBXO15 (384881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	73888593	73888594	+	IGR	INS	-	TG	TG	rs150889527	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73888593_73888594insTG								C18orf62 (749004 upstream) : ZNF516 (183025 downstream)																																			---	---	---	---
ATP9B	374868	broad.mit.edu	37	18	77030300	77030301	+	Intron	DEL	CT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77030300_77030301delCT	uc002lmx.2	+						ATP9B_uc002lmv.1_Intron|ATP9B_uc002lmw.1_Intron|ATP9B_uc002lmy.1_Intron|ATP9B_uc002lmz.1_Intron	NM_198531	NP_940933			ATPase, class II, type 9B						ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)														---	---	---	---
TMPRSS9	360200	broad.mit.edu	37	19	2400974	2400975	+	Intron	DEL	AA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2400974_2400975delAA	uc010xgx.1	+						TMPRSS9_uc002lvv.1_Intron	NM_182973	NP_892018			transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	4729809	4729809	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4729809delA								DPP9 (5954 upstream) : C19orf30 (39308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	5515848	5515849	+	IGR	DEL	CA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5515848_5515849delCA								ZNRF4 (58982 upstream) : PLAC2 (42331 downstream)																																	OREG0025180	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
DUS3L	56931	broad.mit.edu	37	19	5789039	5789040	+	Intron	INS	-	ACCAGAGTGGG	ACCAGAGTGGG	rs140764504	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5789039_5789040insACCAGAGTGGG	uc002mdc.2	-						DUS3L_uc002mdd.2_Intron|DUS3L_uc010duk.2_Intron|DUS3L_uc010xiw.1_Intron	NM_020175	NP_064560			dihydrouridine synthase 3-like isoform 1						tRNA processing		flavin adenine dinucleotide binding|nucleic acid binding|tRNA dihydrouridine synthase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	7949345	7949348	+	IGR	DEL	AAGG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7949345_7949348delAAGG								EVI5L (19484 upstream) : LRRC8E (4042 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	9097210	9097210	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9097210delC								MUC16 (5192 upstream) : OR1M1 (106711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	9165527	9165527	+	IGR	DEL	G	-	-	rs113031685		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9165527delG								MUC16 (73509 upstream) : OR1M1 (38394 downstream)																																			---	---	---	---
OR7G2	390882	broad.mit.edu	37	19	9214543	9214543	+	5'Flank	DEL	T	-	-	rs112173212		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9214543delT	uc010xkk.1	-							NM_001005193	NP_001005193			olfactory receptor, family 7, subfamily G,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	9321384	9321384	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9321384delA								OR7D2 (21891 upstream) : OR7D4 (3191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	10187316	10187318	+	IGR	DEL	AGA	-	-	rs34886019		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10187316_10187318delAGA								C3P1 (2505 upstream) : C19orf66 (9488 downstream)																																			---	---	---	---
S1PR2	9294	broad.mit.edu	37	19	10336722	10336722	+	Intron	DEL	G	-	-	rs34638919		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10336722delG	uc002mnl.2	-							NM_004230	NP_004221			endothelial differentiation, sphingolipid						activation of MAPK activity|positive regulation of cell proliferation	integral to membrane|plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity			lung(1)|central_nervous_system(1)	2																		---	---	---	---
RAB3D	9545	broad.mit.edu	37	19	11447650	11447651	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11447650_11447651insA	uc002mqy.2	-							NM_004283	NP_004274			RAB3D, member RAS oncogene family						exocytosis|protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(2)	2																		---	---	---	---
GIPC1	10755	broad.mit.edu	37	19	14600799	14600799	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14600799delG	uc002myt.2	-						GIPC1_uc002myu.2_Intron|GIPC1_uc002myv.2_Intron|GIPC1_uc002myw.2_Intron|GIPC1_uc002myx.2_Intron|GIPC1_uc002myy.2_Intron	NM_005716	NP_005707			regulator of G-protein signalling 19 interacting						endothelial cell migration|G-protein coupled receptor protein signaling pathway|glutamate secretion|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|protein targeting|regulation of protein stability|regulation of synaptic plasticity|synaptic transmission	cell cortex|dendritic shaft|dendritic spine|membrane fraction|soluble fraction|synaptic vesicle|vesicle membrane	actin binding|myosin binding|protein homodimerization activity|receptor binding				0																		---	---	---	---
DNAJB1	3337	broad.mit.edu	37	19	14627023	14627024	+	Intron	DEL	AA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14627023_14627024delAA	uc002myz.1	-						DNAJB1_uc010xnr.1_Intron	NM_006145	NP_006136			DnaJ (Hsp40) homolog, subfamily B, member 1						chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	18291866	18291867	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18291866_18291867delTC								PIK3R2 (2939 upstream) : MPV17L2 (12173 downstream)																																			---	---	---	---
NCAN	1463	broad.mit.edu	37	19	19355537	19355538	+	Intron	INS	-	TT	TT	rs112721108		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19355537_19355538insTT	uc002nlz.2	+						NCAN_uc002nma.2_Intron	NM_004386	NP_004377			chondroitin sulfate proteoglycan 3 precursor						axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	28344688	28344688	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28344688delA								LOC148189 (59840 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28510222	28510222	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28510222delA								LOC148189 (225374 upstream) : LOC148145 (945818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29913584	29913585	+	Intron	INS	-	AC	AC	rs138747356	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29913584_29913585insAC	uc002nse.1	-											Homo sapiens cDNA FLJ37474 fis, clone BRAWH2012619.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	30274908	30274909	+	IGR	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30274908_30274909delTG								C19orf12 (68456 upstream) : CCNE1 (27992 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	30839707	30839707	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30839707delT								C19orf2 (333096 upstream) : ZNF536 (23621 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31458848	31458849	+	IGR	DEL	AC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31458848_31458849delAC								ZNF536 (409883 upstream) : DKFZp566F0947 (181934 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31528709	31528709	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31528709delT								ZNF536 (479744 upstream) : DKFZp566F0947 (112074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31990555	31990556	+	IGR	DEL	TG	-	-	rs72241662		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31990555_31990556delTG								TSHZ3 (150365 upstream) : ZNF507 (845958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	34453295	34453296	+	IGR	DEL	GA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34453295_34453296delGA								KCTD15 (146630 upstream) : LSM14A (210056 downstream)																																			---	---	---	---
KIAA0355	9710	broad.mit.edu	37	19	34776008	34776009	+	Intron	DEL	GT	-	-	rs10415025	byFrequency;by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34776008_34776009delGT	uc002nvd.3	+						KIAA0355_uc010edk.1_Intron	NM_014686	NP_055501			hypothetical protein LOC9710											ovary(1)	1	Esophageal squamous(110;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	35399691	35399692	+	IGR	DEL	TT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35399691_35399692delTT								ZNF599 (135557 upstream) : ZNF30 (18115 downstream)																																			---	---	---	---
KRTDAP	388533	broad.mit.edu	37	19	35980962	35980962	+	Intron	DEL	T	-	-	rs67414364		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35980962delT	uc002nzh.2	-							NM_207392	NP_997275			keratinocyte differentiation-associated protein						cell differentiation	extracellular region					0	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)															---	---	---	---
RYR1	6261	broad.mit.edu	37	19	39060193	39060193	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39060193delA	uc002oit.2	+						RYR1_uc002oiu.2_Intron	NM_000540	NP_000531			skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)													---	---	---	---
CLC	1178	broad.mit.edu	37	19	40226844	40226844	+	Intron	DEL	G	-	-	rs367156	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40226844delG	uc002omh.2	-							NM_001828	NP_001819			Charcot-Leyden crystal protein						lipid catabolic process|multicellular organismal development		carboxylesterase activity|lysophospholipase activity|sugar binding				0	all_cancers(60;2.99e-06)|all_lung(34;4.7e-08)|Lung NSC(34;5.46e-08)|Ovarian(47;0.06)	Renal(1328;0.000147)|Hepatocellular(1079;0.0202)|Myeloproliferative disorder(2;0.0255)	Epithelial(26;6.43e-25)|OV - Ovarian serous cystadenocarcinoma(5;1.07e-24)|all cancers(26;8.38e-23)	GBM - Glioblastoma multiforme(1328;4.97e-06)|STAD - Stomach adenocarcinoma(1328;0.00655)														---	---	---	---
ADCK4	79934	broad.mit.edu	37	19	41204903	41204903	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41204903delT	uc002oor.2	-						ADCK4_uc002oop.1_Intron|ADCK4_uc002ooq.1_Intron	NM_024876	NP_079152			aarF domain containing kinase 4 isoform a							integral to membrane	protein serine/threonine kinase activity				0			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)															---	---	---	---
PRR19	284338	broad.mit.edu	37	19	42813398	42813398	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42813398delG	uc002oti.2	+						PRR19_uc002oth.1_Intron|PRR19_uc002otj.2_5'UTR	NM_199285	NP_954979			proline rich 19												0		Prostate(69;0.00682)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	44414716	44414717	+	IGR	INS	-	T	T	rs36059907		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44414716_44414717insT								ZNF404 (30428 upstream) : ZNF45 (2064 downstream)																																			---	---	---	---
ZFP112	7771	broad.mit.edu	37	19	44866174	44866175	+	Intron	INS	-	T	T	rs142441255	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44866174_44866175insT	uc010xwy.1	-						ZFP112_uc010xwz.1_Intron	NM_013380	NP_037512			zinc finger protein 228 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)	5																		---	---	---	---
RELB	5971	broad.mit.edu	37	19	45529499	45529500	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45529499_45529500insA	uc002paj.1	+							NM_006509	NP_006500			reticuloendotheliosis viral oncogene homolog B							nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	47745427	47745429	+	IGR	DEL	ATT	-	-	rs34300947		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47745427_47745429delATT								BBC3 (9404 upstream) : CCDC9 (14302 downstream)																																			---	---	---	---
VRK3	51231	broad.mit.edu	37	19	50510585	50510586	+	Intron	INS	-	CCTT	CCTT	rs150699086	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50510585_50510586insCCTT	uc002prg.2	-						VRK3_uc002prh.1_Intron|VRK3_uc002pri.1_Intron|VRK3_uc010ens.2_Intron|VRK3_uc010ybl.1_Intron|VRK3_uc010ybm.1_Intron|VRK3_uc002prj.1_Intron|VRK3_uc002prk.1_Intron|VRK3_uc010ent.1_Intron|VRK3_uc002prl.2_Intron|VRK3_uc010ybn.1_Intron	NM_016440	NP_057524			vaccinia related kinase 3 isoform 1							nucleus	ATP binding|protein kinase activity			stomach(1)|skin(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)														---	---	---	---
SHANK1	50944	broad.mit.edu	37	19	51187486	51187487	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51187486_51187487insT	uc002psx.1	-						SHANK1_uc002psw.1_Intron	NM_016148	NP_057232			SH3 and multiple ankyrin repeat domains 1						cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)														---	---	---	---
ZNF836	162962	broad.mit.edu	37	19	52673048	52673049	+	Intron	INS	-	A	A	rs78764034		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52673048_52673049insA	uc010ydi.1	-						ZNF836_uc010ydj.1_Intron	NM_001102657	NP_001096127			zinc finger protein 836						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ZNF528	84436	broad.mit.edu	37	19	52908470	52908471	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52908470_52908471insA	uc002pzh.2	+						ZNF528_uc002pzi.2_Intron	NM_032423	NP_115799			zinc finger protein 528						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)														---	---	---	---
VSTM1	284415	broad.mit.edu	37	19	54548874	54548875	+	Intron	INS	-	TCTC	TCTC	rs147000930	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54548874_54548875insTCTC	uc002qcw.3	-						VSTM1_uc010erb.2_Intron|VSTM1_uc002qcx.3_Intron	NM_198481	NP_940883			V-set and transmembrane domain containing 1							integral to membrane					0	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	54592506	54592507	+	IGR	INS	-	AAAGGAAGGA	AAAGGAAGGA	rs138343301	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54592506_54592507insAAAGGAAGGA								TARM1 (7872 upstream) : OSCAR (5428 downstream)																																			---	---	---	---
NLRP2	55655	broad.mit.edu	37	19	55512434	55512438	+	3'UTR	DEL	CTTAT	-	-	rs4200	byFrequency	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55512434_55512438delCTTAT	uc002qij.2	+	13					NLRP2_uc010yfp.1_3'UTR|NLRP2_uc010esn.2_3'UTR|NLRP2_uc010eso.2_3'UTR|NLRP2_uc010esp.2_3'UTR	NM_017852	NP_060322			NLR family, pyrin domain containing 2						apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)														---	---	---	---
PTPRH	5794	broad.mit.edu	37	19	55703327	55703329	+	Intron	DEL	CCT	-	-	rs10545294		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55703327_55703329delCCT	uc002qjq.2	-						PTPRH_uc010esv.2_Intron|uc002qjr.2_In_Frame_Del_p.L142del	NM_002842	NP_002833			protein tyrosine phosphatase, receptor type, H						apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)														---	---	---	---
ZSCAN5A	79149	broad.mit.edu	37	19	56759530	56759530	+	Intron	DEL	T	-	-	rs34362340		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56759530delT	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279			zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
ZNF587	84914	broad.mit.edu	37	19	58348630	58348630	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58348630delT	uc002qqb.2	+						uc002qqh.1_Intron|ZNF587_uc010yhh.1_Intron|ZNF587_uc002qqi.1_Intron|uc010yhj.1_Intron|ZNF587_uc002qqj.1_Intron	NM_032828	NP_116217			zinc finger protein 587						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)														---	---	---	---
TMC2	117532	broad.mit.edu	37	20	2521303	2521303	+	Intron	DEL	A	-	-	rs139807662		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2521303delA	uc002wgf.1	+						TMC2_uc002wgg.1_Intron	NM_080751	NP_542789			transmembrane cochlear-expressed protein 2							integral to membrane				ovary(3)	3																		---	---	---	---
EBF4	57593	broad.mit.edu	37	20	2702969	2702969	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2702969delT	uc002wgt.3	+						EBF4_uc002wgs.3_Intron	NM_001110514	NP_001103984			early B-cell factor 4						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding				0																		---	---	---	---
SLC4A11	83959	broad.mit.edu	37	20	3217988	3218006	+	Intron	DEL	ATGGGCAGCCTGCCCTCTC	-	-	rs6037508	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3217988_3218006delATGGGCAGCCTGCCCTCTC	uc002wig.2	-						SLC4A11_uc010zqe.1_Intron|SLC4A11_uc002wih.2_Intron|SLC4A11_uc010zqf.1_Intron	NM_032034	NP_114423			solute carrier family 4 member 11						cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	5468037	5468037	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5468037delT								PROKR2 (170659 upstream) : LOC149837 (11181 downstream)																																			---	---	---	---
PLCB4	5332	broad.mit.edu	37	20	9109063	9109063	+	Intron	DEL	T	-	-	rs117130418	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9109063delT	uc002wnf.2	+						PLCB4_uc010gbw.1_Intron|PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron	NM_182797	NP_877949			phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15																		---	---	---	---
PLCB4	5332	broad.mit.edu	37	20	9276851	9276853	+	Intron	DEL	AAC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9276851_9276853delAAC	uc002wnf.2	+						PLCB4_uc010gbw.1_Intron|PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron	NM_182797	NP_877949			phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	12042893	12042894	+	IGR	DEL	AA	-	-	rs145773886		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12042893_12042894delAA								BTBD3 (135651 upstream) : SPTLC3 (946733 downstream)																																			---	---	---	---
ESF1	51575	broad.mit.edu	37	20	13703335	13703335	+	Intron	DEL	T	-	-	rs35588189		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13703335delT	uc002woj.2	-							NM_016649	NP_057733			ABT1-associated protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm				ovary(1)	1																		---	---	---	---
POLR3F	10621	broad.mit.edu	37	20	18462628	18462629	+	Intron	DEL	TT	-	-	rs72041815		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18462628_18462629delTT	uc002wqv.2	+						POLR3F_uc002wqw.2_Intron|POLR3F_uc002wqx.2_Intron	NM_006466	NP_006457			DNA-directed RNA polymerase III 39 kDa						innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|protein binding				0																		---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19407561	19407562	+	Intron	INS	-	A	A	rs137947418	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19407561_19407562insA	uc002wrl.2	+							NM_020689	NP_065740			solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1																		---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19415221	19415221	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19415221delC	uc002wrl.2	+							NM_020689	NP_065740			solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1																		---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19637029	19637030	+	Intron	INS	-	TCAGAATG	TCAGAATG	rs143840575	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19637029_19637030insTCAGAATG	uc002wrl.2	+							NM_020689	NP_065740			solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	20975580	20975581	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20975580_20975581insA								RALGAPA2 (282314 upstream) : PLK1S1 (131043 downstream)																																			---	---	---	---
XRN2	22803	broad.mit.edu	37	20	21347200	21347200	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21347200delA	uc002wsf.1	+						XRN2_uc002wsg.1_Intron|XRN2_uc010zsk.1_Intron	NM_012255	NP_036387			5'-3' exoribonuclease 2						cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	22353099	22353099	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22353099delA								PAX1 (656479 upstream) : LOC284788 (27872 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24983905	24983905	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24983905delA								C20orf3 (10480 upstream) : ACSS1 (2969 downstream)																																			---	---	---	---
PYGB	5834	broad.mit.edu	37	20	25237774	25237774	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25237774delT	uc002wup.2	+							NM_002862	NP_002853			brain glycogen phosphorylase						glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					Pyridoxal Phosphate(DB00114)													---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25829595	25829596	+	Intron	INS	-	GAA	GAA	rs143279219	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25829595_25829596insGAA	uc002wvd.1	-						FAM182B_uc002wve.2_Intron					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	26080322	26080334	+	IGR	DEL	CCACAGGCTCTTT	-	-	rs111960742		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26080322_26080334delCCACAGGCTCTTT								FAM182A (12770 upstream) : C20orf191 (3719 downstream)																																			---	---	---	---
C20orf191	149934	broad.mit.edu	37	20	26088917	26088919	+	Intron	DEL	ATT	-	-	rs76371026		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26088917_26088919delATT	uc002wvj.3	-							NR_003678				SubName: Full=Putative uncharacterized protein ENSP00000323172;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	26210810	26210812	+	IGR	DEL	ACA	-	-	rs149589991		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26210810_26210812delACA								MIR663 (21896 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26312267	26312267	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26312267delT								MIR663 (123353 upstream) : None (None downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29624401	29624401	+	Intron	DEL	T	-	-	rs112995863		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29624401delT	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
HCK	3055	broad.mit.edu	37	20	30646409	30646410	+	Intron	DEL	AC	-	-	rs71977852		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30646409_30646410delAC	uc002wxh.2	+						HCK_uc010gdy.2_Intron|HCK_uc002wxi.2_Intron	NM_002110	NP_002101			hemopoietic cell kinase isoform p61HCK						interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	30690801	30690802	+	IGR	DEL	CA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30690801_30690802delCA								HCK (1146 upstream) : TM9SF4 (6507 downstream)																																			---	---	---	---
TRPC4AP	26133	broad.mit.edu	37	20	33639902	33639902	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33639902delT	uc002xbk.2	-						TRPC4AP_uc002xbl.2_Intron|TRPC4AP_uc010zur.1_Intron|TRPC4AP_uc002xbm.1_Intron	NM_015638	NP_056453			TRPC4-associated protein isoform a						protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)															---	---	---	---
CEP250	11190	broad.mit.edu	37	20	34049215	34049216	+	Intron	INS	-	TCT	TCT	rs144048444	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34049215_34049216insTCT	uc002xcm.2	+						CEP250_uc010zve.1_Intron|CEP250_uc010gfe.1_Intron|CEP250_uc010zvd.1_Intron	NM_007186	NP_009117			centrosomal protein 2						centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)															---	---	---	---
RBL1	5933	broad.mit.edu	37	20	35687168	35687168	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35687168delT	uc002xgi.2	-						RBL1_uc010zvt.1_Intron|RBL1_uc002xgj.1_Intron|RBL1_uc010gfv.1_Intron	NM_002895	NP_002886			retinoblastoma-like protein 1 isoform a						cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	35898847	35898847	+	IGR	DEL	A	-	-	rs72209222		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35898847delA								GHRH (8609 upstream) : MANBAL (19204 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	36039565	36039566	+	IGR	DEL	GT	-	-	rs66479976		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36039565_36039566delGT								SRC (5746 upstream) : BLCAP (106254 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37980687	37980687	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37980687delA								LOC339568 (127296 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	38416232	38416235	+	IGR	DEL	TGAT	-	-	rs138776178		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38416232_38416235delTGAT								LOC339568 (562841 upstream) : MAFB (898284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	38658301	38658302	+	IGR	INS	-	GGG	GGG	rs117008347	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38658301_38658302insGGG								LOC339568 (804910 upstream) : MAFB (656217 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	39595621	39595621	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39595621delC								MAFB (277745 upstream) : TOP1 (61841 downstream)																																			---	---	---	---
TOP1	7150	broad.mit.edu	37	20	39673433	39673434	+	Intron	INS	-	GA	GA	rs138421052	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39673433_39673434insGA	uc002xjl.2	+						TOP1_uc010gge.1_Intron	NM_003286	NP_003277			DNA topoisomerase I						DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding			breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)			T	NUP98	AML*								---	---	---	---
ZHX3	23051	broad.mit.edu	37	20	39848227	39848228	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39848227_39848228insT	uc002xjs.1	-						ZHX3_uc002xjq.1_Intron|ZHX3_uc002xjr.1_Intron|ZHX3_uc002xjt.1_Intron|ZHX3_uc002xju.1_Intron|ZHX3_uc002xjv.1_Intron|ZHX3_uc002xjw.1_Intron	NM_015035	NP_055850			zinc fingers and homeoboxes 3						negative regulation of transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Myeloproliferative disorder(115;0.00425)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	41856571	41856572	+	IGR	INS	-	A	A	rs78599377		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41856571_41856572insA								PTPRT (38014 upstream) : SFRS6 (229932 downstream)																																			---	---	---	---
R3HDML	140902	broad.mit.edu	37	20	42977123	42977137	+	Intron	DEL	TCCTTTCCTTTCCTT	-	-	rs10570463		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42977123_42977137delTCCTTTCCTTTCCTT	uc002xls.1	+							NM_178491	NP_848586			R3H domain containing-like precursor							extracellular region	peptidase inhibitor activity				0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
KCNK15	60598	broad.mit.edu	37	20	43374018	43374019	+	5'Flank	INS	-	GAAAG	GAAAG	rs150750005	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43374018_43374019insGAAAG	uc002xmr.2	+							NM_022358	NP_071753			potassium family, subfamily K, member 15							integral to membrane	potassium channel activity|voltage-gated ion channel activity				0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
STK4	6789	broad.mit.edu	37	20	43607423	43607423	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43607423delT	uc002xnb.2	+						STK4_uc010ggx.2_Intron|STK4_uc010ggy.2_Intron|STK4_uc010ggw.1_Intron	NM_006282	NP_006273			serine/threonine kinase 4						apoptosis|cell morphogenesis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of apoptosis|protein autophosphorylation	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein homodimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity|transcription factor binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	43886327	43886328	+	IGR	INS	-	A	A	rs113140008		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43886327_43886328insA								SLPI (3121 upstream) : MATN4 (35759 downstream)																																			---	---	---	---
WFDC8	90199	broad.mit.edu	37	20	44188522	44188523	+	Intron	DEL	TT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44188522_44188523delTT	uc002xow.2	-						WFDC8_uc002xox.2_Intron	NM_181510	NP_852611			WAP four-disulfide core domain 8 precursor							extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	44768605	44768606	+	IGR	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44768605_44768606delGT								CD40 (10221 upstream) : CDH22 (33770 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	45476697	45476697	+	IGR	DEL	T	-	-	rs11478684		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45476697delT								SLC2A10 (111714 upstream) : EYA2 (46566 downstream)																																			---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45731944	45731944	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45731944delC	uc002xsm.2	+						EYA2_uc010ghp.2_Intron|EYA2_uc002xsn.2_Intron|EYA2_uc002xso.2_Intron|EYA2_uc002xsp.2_Intron|EYA2_uc002xsq.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
NCOA3	8202	broad.mit.edu	37	20	46199681	46199682	+	Intron	INS	-	AC	AC	rs1079917		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46199681_46199682insAC	uc002xtk.2	+						NCOA3_uc010ght.1_Intron|NCOA3_uc002xtl.2_Intron|NCOA3_uc002xtm.2_Intron|NCOA3_uc002xtn.2_Intron	NM_181659	NP_858045			nuclear receptor coactivator 3 isoform a						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	47094435	47094436	+	IGR	INS	-	TTATT	TTATT	rs141066356	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47094435_47094436insTTATT								LOC284749 (95054 upstream) : PREX1 (146357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48246063	48246064	+	IGR	INS	-	TGTG	TGTG	rs149452645	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48246063_48246064insTGTG								PTGIS (61356 upstream) : B4GALT5 (3421 downstream)																																			---	---	---	---
B4GALT5	9334	broad.mit.edu	37	20	48289916	48289917	+	Intron	INS	-	A	A	rs147796842	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48289916_48289917insA	uc002xuu.3	-							NM_004776	NP_004767			UDP-Gal:betaGlcNAc beta 1,4-						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	galactosyltransferase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	48784253	48784254	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48784253_48784254insT								TMEM189-UBE2V1 (13918 upstream) : CEBPB (23122 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48892955	48892956	+	Intron	INS	-	C	C	rs72536904		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48892955_48892956insC	uc010zyr.1	+											Homo sapiens cDNA, FLJ97140.																														---	---	---	---
FAM65C	140876	broad.mit.edu	37	20	49261198	49261199	+	Intron	INS	-	T	T	rs112545504	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49261198_49261199insT	uc010zyt.1	-						FAM65C_uc010zyu.1_Intron	NM_080829	NP_543019			hypothetical protein LOC140876											ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	49397625	49397625	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49397625delA								PARD6B (27348 upstream) : BCAS4 (13842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49600196	49600196	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49600196delT								MOCS3 (22376 upstream) : KCNG1 (19998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49664338	49664339	+	IGR	INS	-	TTT	TTT	rs146898252	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49664338_49664339insTTT								KCNG1 (24663 upstream) : NFATC2 (343427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	50620363	50620364	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50620363_50620364insT								SALL4 (201315 upstream) : ZFP64 (80187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	51216685	51216686	+	IGR	DEL	CA	-	-	rs112841727		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51216685_51216686delCA								ZFP64 (408161 upstream) : TSHZ2 (372191 downstream)																																			---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	52069138	52069138	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52069138delA	uc002xwo.2	+						uc002xwp.1_Intron	NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52523900	52523903	+	IGR	DEL	ACAC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52523900_52523903delACAC								SUMO1P1 (31652 upstream) : BCAS1 (36176 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	53863722	53863723	+	IGR	INS	-	TT	TT	rs144735684	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53863722_53863723insTT								DOK5 (596013 upstream) : CBLN4 (708774 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55448118	55448129	+	IGR	DEL	AAAGAAAGAAGG	-	-	rs146696155		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55448118_55448129delAAAGAAAGAAGG								TFAP2C (233782 upstream) : BMP7 (295680 downstream)																																			---	---	---	---
APCDD1L	164284	broad.mit.edu	37	20	57050920	57050920	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57050920delC	uc002xze.1	-						APCDD1L_uc010zzp.1_Intron	NM_153360	NP_699191			adenomatosis polyposis coli down-regulated							integral to membrane				ovary(1)	1	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)															---	---	---	---
NPEPL1	79716	broad.mit.edu	37	20	57261545	57261546	+	5'Flank	DEL	AA	-	-	rs67354534		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57261545_57261546delAA	uc010zzr.1	+							NM_024663	NP_078939			aminopeptidase-like 1						proteolysis	cytoplasm	aminopeptidase activity|manganese ion binding|metalloexopeptidase activity				0	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	57976058	57976059	+	IGR	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57976058_57976059delTG								EDN3 (75012 upstream) : PHACTR3 (176505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	58745967	58745968	+	Intron	INS	-	C	C	rs145076446	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58745967_58745968insC	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	59434460	59434461	+	IGR	INS	-	GGAGTCTGTG	GGAGTCTGTG	rs144829866	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59434460_59434461insGGAGTCTGTG								MIR646 (550835 upstream) : CDH4 (393098 downstream)																																			---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60010931	60010938	+	Intron	DEL	GCCCATGT	-	-	rs113283438		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60010931_60010938delGCCCATGT	uc002ybn.1	+							NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60319506	60319507	+	Intron	DEL	GA	-	-	rs113581527		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60319506_60319507delGA	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	60804681	60804682	+	5'Flank	DEL	CA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60804681_60804682delCA	uc002ycj.1	+											Homo sapiens cDNA FLJ44790 fis, clone BRACE3039288.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	61056085	61056086	+	IGR	INS	-	T	T	rs71266382		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61056085_61056086insT								GATA5 (5059 upstream) : C20orf200 (85469 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	61190181	61190182	+	IGR	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61190181_61190182delGT								C20orf166 (22211 upstream) : SLCO4A1 (83615 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	61190250	61190251	+	IGR	INS	-	TG	TG	rs137918555	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61190250_61190251insTG								C20orf166 (22280 upstream) : SLCO4A1 (83546 downstream)																																			---	---	---	---
SAMD10	140700	broad.mit.edu	37	20	62607540	62607541	+	Intron	INS	-	AAC	AAC	rs145569816	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62607540_62607541insAAC	uc002yhm.2	-						SAMD10_uc002yhn.2_Intron	NM_080621	NP_542188			sterile alpha motif domain containing 10												0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)																	---	---	---	---
Unknown	0	broad.mit.edu	37	21	9735165	9735166	+	Intron	DEL	AG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9735165_9735166delAG	uc011abu.1	+											Homo sapiens, clone IMAGE:4720764, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10821736	10821737	+	IGR	DEL	GA	-	-	rs74970823		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10821736_10821737delGA								None (None upstream) : TPTE (85006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10889095	10889096	+	IGR	INS	-	AGTA	AGTA			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10889095_10889096insAGTA								None (None upstream) : TPTE (17647 downstream)																																			---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11045626	11045626	+	Intron	DEL	G	-	-	rs60108847		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11045626delG	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	11115345	11115346	+	IGR	INS	-	CG	CG	rs112272936		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11115345_11115346insCG								BAGE (16408 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14631345	14631346	+	IGR	DEL	TT	-	-	rs75080853		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14631345_14631346delTT								C21orf99 (140776 upstream) : POTED (351152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	22361001	22361002	+	IGR	INS	-	GAAA	GAAA	rs141211222	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22361001_22361002insGAAA								C21orf131 (185575 upstream) : NCAM2 (9631 downstream)																																			---	---	---	---
NCAM2	4685	broad.mit.edu	37	21	22405262	22405263	+	Intron	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22405262_22405263insT	uc002yld.1	+						NCAM2_uc011acb.1_Intron	NM_004540	NP_004531			neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	24404252	24404253	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24404252_24404253insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	28286472	28286477	+	IGR	DEL	GTGTCT	-	-	rs5843254		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28286472_28286477delGTGTCT								ADAMTS1 (68744 upstream) : ADAMTS5 (3755 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29354064	29354064	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29354064delA								NCRNA00113 (230512 upstream) : C21orf94 (31618 downstream)																																			---	---	---	---
TIAM1	7074	broad.mit.edu	37	21	32688774	32688774	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32688774delA	uc002yow.1	-						TIAM1_uc002yox.1_Intron	NM_003253	NP_003244			T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10																		---	---	---	---
C21orf63	59271	broad.mit.edu	37	21	33798669	33798669	+	Intron	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33798669delG	uc002ypr.1	+						C21orf63_uc002ypq.1_Intron|C21orf63_uc002yps.1_Intron|C21orf63_uc010glw.1_Intron|C21orf63_uc002ypt.1_Intron	NM_058187	NP_478067			hypothetical protein LOC59271 precursor							integral to membrane	sugar binding			ovary(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	34491953	34491954	+	IGR	INS	-	A	A	rs112859281		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34491953_34491954insA								OLIG1 (47226 upstream) : C21orf54 (45823 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	37812177	37812177	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37812177delT								CHAF1B (23053 upstream) : CLDN14 (20743 downstream)																																			---	---	---	---
HLCS	3141	broad.mit.edu	37	21	38211009	38211009	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38211009delA	uc010gnb.2	-						HLCS_uc002yvs.2_Intron	NM_000411	NP_000402			holocarboxylase synthetase						cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)													---	---	---	---
DSCR10	259234	broad.mit.edu	37	21	39578019	39578020	+	5'Flank	DEL	TT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39578019_39578020delTT	uc010gnt.1	+							NR_027695				Homo sapiens DSCR10 mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	41054632	41054635	+	IGR	DEL	AAAC	-	-	rs72264388		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41054632_41054635delAAAC								B3GALT5 (19817 upstream) : IGSF5 (62699 downstream)																																			---	---	---	---
TRAPPC10	7109	broad.mit.edu	37	21	45462524	45462524	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45462524delT	uc002zea.2	+						TRAPPC10_uc010gpo.2_Intron|TRAPPC10_uc002zdz.2_Intron	NM_003274	NP_003265			trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
COL18A1	80781	broad.mit.edu	37	21	46872712	46872713	+	5'Flank	DEL	AT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46872712_46872713delAT	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_5'Flank	NM_130444	NP_569711			alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)														---	---	---	---
COL6A1	1291	broad.mit.edu	37	21	47419829	47419830	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47419829_47419830insA	uc002zhu.1	+						COL6A1_uc010gqd.1_Intron|COL6A1_uc002zhv.1_5'Flank|COL6A1_uc002zhw.1_5'Flank	NM_001848	NP_001839			collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)													---	---	---	---
PCNT	5116	broad.mit.edu	37	21	47797003	47797003	+	Intron	DEL	A	-	-	rs67048603		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47797003delA	uc002zji.3	+						PCNT_uc002zjj.2_Intron	NM_006031	NP_006022			pericentrin						cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)																	---	---	---	---
Unknown	0	broad.mit.edu	37	21	48096241	48096242	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:48096241_48096242insT								PRMT2 (11379 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	17239919	17239920	+	IGR	INS	-	T	T	rs148787711		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17239919_17239920insT								psiTPTE22 (60398 upstream) : XKR3 (24393 downstream)																																			---	---	---	---
CECR2	27443	broad.mit.edu	37	22	17911099	17911100	+	Intron	INS	-	T	T	rs139517696	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17911099_17911100insT	uc010gqv.1	+							NM_031413	NP_113601			cat eye syndrome chromosome region, candidate 2						chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	21897528	21897528	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21897528delT								PI4KAP2 (25748 upstream) : UBE2L3 (24429 downstream)																																			---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22562375	22562375	+	Intron	DEL	C	-	-	rs5844491		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22562375delC	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																OREG0026355	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22927526	22927527	+	Intron	DEL	TG	-	-	rs71318779		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22927526_22927527delTG	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
BCR	613	broad.mit.edu	37	22	23585836	23585836	+	Intron	DEL	T	-	-	rs143796680		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23585836delT	uc002zww.2	+						BCR_uc002zwx.2_Intron|BCR_uc011aiy.1_Intron	NM_004327	NP_004318			breakpoint cluster region isoform 1						regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	ATP binding|GTPase activator activity|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity		BCR/JAK2(6)	haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(3)|urinary_tract(1)|lung(1)|skin(1)	12								T	ABL1| FGFR1|JAK2 	CML|ALL|AML								---	---	---	---
KREMEN1	83999	broad.mit.edu	37	22	29537214	29537215	+	Intron	INS	-	GT	GT	rs149253438	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29537214_29537215insGT	uc011akm.1	+						KREMEN1_uc003ael.2_Intron|KREMEN1_uc011akn.1_Intron	NM_032045	NP_114434			kringle-containing transmembrane protein 1						cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5																		---	---	---	---
SEC14L4	284904	broad.mit.edu	37	22	30895862	30895862	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30895862delT	uc003aid.2	-						SEC14L4_uc011akz.1_Intron|SEC14L4_uc003aie.2_Intron|SEC14L4_uc003aif.2_Intron	NM_174977	NP_777637			SEC14p-like protein TAP3 isoform a							integral to membrane|intracellular	lipid binding|transporter activity			skin(1)	1					Vitamin E(DB00163)													---	---	---	---
LARGE	9215	broad.mit.edu	37	22	33898564	33898564	+	Intron	DEL	T	-	-	rs113468660		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33898564delT	uc003and.3	-						LARGE_uc011amd.1_Intron|LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron|LARGE_uc010gwq.1_Intron	NM_004737	NP_004728			like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	34997409	34997410	+	IGR	INS	-	TTG	TTG	rs150932806	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34997409_34997410insTTG								LARGE (678825 upstream) : ISX (464719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	39940262	39940263	+	IGR	INS	-	T	T	rs71326777		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39940262_39940263insT								RPS19BP1 (11402 upstream) : CACNA1I (26495 downstream)																																			---	---	---	---
GRAP2	9402	broad.mit.edu	37	22	40375611	40375618	+	Intron	DEL	TGAATGAA	-	-	rs72367412		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40375611_40375618delTGAATGAA	uc003ayi.2	+							NM_004810				GRB2-related adaptor protein 2						cell-cell signaling|Ras protein signal transduction|T cell costimulation|T cell receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2																		---	---	---	---
KIAA1644	85352	broad.mit.edu	37	22	44645110	44645111	+	3'UTR	DEL	CG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44645110_44645111delCG	uc003bet.2	-	5						NM_001099294	NP_001092764			hypothetical protein LOC85352 precursor							integral to membrane				ovary(1)	1		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	44948850	44948850	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44948850delA								LDOC1L (54845 upstream) : NCRNA00207 (16369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	45039697	45039698	+	IGR	DEL	AA	-	-	rs139918266		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45039697_45039698delAA								NCRNA00207 (71368 upstream) : PRR5 (24895 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	46417096	46417099	+	IGR	DEL	GAAA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46417096_46417099delGAAA								LOC730668 (10439 upstream) : LOC100271722 (18690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	50162155	50162156	+	IGR	INS	-	AC	AC	rs145585991	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50162155_50162156insAC								C22orf34 (110965 upstream) : BRD1 (4782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	50772398	50772399	+	IGR	DEL	GA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50772398_50772399delGA								FAM116B (6909 upstream) : SAPS2 (9361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	183998	183998	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:183998delT								None (None upstream) : PLCXD1 (8994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	376343	376344	+	IGR	INS	-	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:376343_376344insC								PPP2R3B (28716 upstream) : SHOX (208735 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	384828	384828	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:384828delA								PPP2R3B (37201 upstream) : SHOX (200251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	403152	403153	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:403152_403153insT								PPP2R3B (55525 upstream) : SHOX (181926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	697621	697622	+	IGR	DEL	GT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:697621_697622delGT								SHOX (77476 upstream) : CRLF2 (617265 downstream)																																			---	---	---	---
ARSE	415	broad.mit.edu	37	X	2856421	2856422	+	Intron	INS	-	TC	TC	rs142734776		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2856421_2856422insTC	uc004crc.3	-						ARSE_uc011mhi.1_Intron|ARSE_uc011mhh.1_Intron	NM_000047	NP_000038			arylsulfatase E precursor						skeletal system development	Golgi stack	arylsulfatase activity|metal ion binding			ovary(1)|central_nervous_system(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	3441624	3441625	+	IGR	DEL	AG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3441624_3441625delAG								MXRA5 (176940 upstream) : PRKX (80788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	5521441	5521441	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5521441delA								None (None upstream) : NLGN4X (286643 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	6444678	6444679	+	IGR	INS	-	A	A	rs67896690		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6444678_6444679insA								NLGN4X (297972 upstream) : VCX3A (6981 downstream)																																			---	---	---	---
STS	412	broad.mit.edu	37	X	7073210	7073210	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7073210delT	uc004crw.2	+						STS_uc011mhp.1_Intron|STS_uc004crx.1_Intron					Homo sapiens cDNA, FLJ94694, highly similar to Homo sapiens steroid sulfatase (microsomal), arylsulfatase C,isozyme S (STS), mRNA.						female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)									Ichthyosis				---	---	---	---
STS	412	broad.mit.edu	37	X	7187289	7187289	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7187289delT	uc004cry.3	+							NM_000351	NP_000342			steryl-sulfatase precursor						female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)									Ichthyosis				---	---	---	---
Unknown	0	broad.mit.edu	37	X	10244820	10244820	+	IGR	DEL	A	-	-	rs111898623		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10244820delA								CLCN4 (39123 upstream) : MID1 (168777 downstream)																																			---	---	---	---
ARHGAP6	395	broad.mit.edu	37	X	11424824	11424824	+	Intron	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11424824delC	uc004cup.1	-						ARHGAP6_uc004cuo.1_Intron|ARHGAP6_uc004cur.1_Intron|ARHGAP6_uc004cun.1_Intron	NM_013427	NP_038286			Rho GTPase activating protein 6 isoform 1						actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2																		---	---	---	---
FRMPD4	9758	broad.mit.edu	37	X	12159804	12159805	+	Intron	DEL	CA	-	-	rs66985849		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12159804_12159805delCA	uc004cuz.1	+						FRMPD4_uc011mij.1_Intron	NM_014728	NP_055543			FERM and PDZ domain containing 4						positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	13202002	13202003	+	IGR	DEL	TC	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13202002_13202003delTC								FAM9C (139202 upstream) : ATXN3L (134767 downstream)																																			---	---	---	---
CTPS2	56474	broad.mit.edu	37	X	16653080	16653080	+	Intron	DEL	G	-	-	rs63231762		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16653080delG	uc004cxk.2	-						CTPS2_uc004cxl.2_Intron|CTPS2_uc004cxm.2_Intron	NM_001144002	NP_001137474			cytidine triphosphate synthase II						glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine nucleotide biosynthetic process	cytosol	ATP binding|CTP synthase activity			ovary(1)	1	Hepatocellular(33;0.0997)																	---	---	---	---
SYAP1	94056	broad.mit.edu	37	X	16763861	16763861	+	Intron	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16763861delA	uc004cxp.2	+						SYAP1_uc004cxo.2_Intron|SYAP1_uc011miv.1_Intron	NM_032796	NP_116185			SYAP1 protein											skin(1)	1	Hepatocellular(33;0.0997)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	20004421	20004421	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20004421delA								CXorf23 (16039 upstream) : LOC729609 (514 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	20555527	20555528	+	IGR	INS	-	T	T	rs111524846		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20555527_20555528insT								RPS6KA3 (270004 upstream) : CNKSR2 (837452 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	22339588	22339589	+	IGR	DEL	AC	-	-	rs34846448		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22339588_22339589delAC								ZNF645 (47014 upstream) : DDX53 (678498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	30202816	30202818	+	IGR	DEL	AGG	-	-	rs140987228		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30202816_30202818delAGG								IL1RAPL1 (228799 upstream) : MAGEB2 (30857 downstream)																																			---	---	---	---
CXorf21	80231	broad.mit.edu	37	X	30597235	30597235	+	5'Flank	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30597235delA	uc004dcg.1	-							NM_025159	NP_079435			hypothetical protein LOC80231											ovary(1)	1																		---	---	---	---
DMD	1756	broad.mit.edu	37	X	32966231	32966234	+	Intron	DEL	ACAC	-	-	rs72126227		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32966231_32966234delACAC	uc004dda.1	-						DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Intron|DMD_uc010ngr.1_Intron	NM_004006	NP_003997			dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	38793774	38793775	+	IGR	DEL	CT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38793774_38793775delCT								MID1IP1 (127993 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	40855128	40855128	+	IGR	DEL	T	-	-	rs5917399	by1000genomes	TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40855128delT								LOC100132831 (162679 upstream) : USP9X (89760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	43094667	43094667	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:43094667delT								PPP1R2P9 (457181 upstream) : MAOA (420742 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	44251566	44251566	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44251566delT								EFHC2 (48643 upstream) : FUNDC1 (131320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	48997183	48997183	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48997183delT								GPKOW (17104 upstream) : MAGIX (21998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	54721087	54721088	+	IGR	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54721087_54721088insA								GNL3L (129114 upstream) : ITIH5L (54244 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	56990601	56990601	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56990601delA								LOC550643 (146599 upstream) : SPIN3 (12204 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	61762939	61762940	+	IGR	DEL	GA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61762939_61762940delGA								None (None upstream) : SPIN4 (804168 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	62106407	62106408	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62106407_62106408insT								None (None upstream) : SPIN4 (460700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	67209932	67209932	+	IGR	DEL	A	-	-	rs71970082		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67209932delA								AR (265813 upstream) : OPHN1 (52256 downstream)																																			---	---	---	---
BCYRN1	618	broad.mit.edu	37	X	70748929	70748929	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70748929delT	uc011mpt.1	-						TAF1_uc004dzx.2_Intron|TAF1_uc004dzy.2_Intron|TAF1_uc004dzw.1_Intron|TAF1_uc010nlg.1_Intron	NR_001568				Homo sapiens brain cytoplasmic RNA 1 (non-protein coding) (BCYRN1), non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	72211078	72211078	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72211078delA								CXorf50B (47489 upstream) : PABPC1L2B (12274 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	75513127	75513127	+	IGR	DEL	C	-	-	rs35688245		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75513127delC								CXorf26 (115094 upstream) : MAGEE1 (134990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	76288704	76288705	+	IGR	INS	-	C	C	rs150753741		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76288704_76288705insC								MIR325 (62778 upstream) : FGF16 (420942 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	76718670	76718670	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76718670delG								FGF16 (6659 upstream) : ATRX (41689 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	78118273	78118273	+	IGR	DEL	C	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78118273delC								LPAR4 (105697 upstream) : P2RY10 (82556 downstream)																																			---	---	---	---
PCDH11X	27328	broad.mit.edu	37	X	91364372	91364373	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91364372_91364373insA	uc004efk.1	+						PCDH11X_uc004efl.1_Intron|PCDH11X_uc004efo.1_Intron|PCDH11X_uc010nmv.1_Intron|PCDH11X_uc004efm.1_Intron|PCDH11X_uc004efn.1_Intron	NM_032968	NP_116750			protocadherin 11 X-linked isoform c						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	93845925	93845925	+	IGR	DEL	A	-	-	rs67310949		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:93845925delA								FAM133A (878664 upstream) : MIR548M (472215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	109817314	109817314	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109817314delG								TDGF3 (51065 upstream) : CHRDL1 (99771 downstream)																																			---	---	---	---
CAPN6	827	broad.mit.edu	37	X	110512525	110512526	+	Intron	DEL	CA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110512525_110512526delCA	uc004epc.1	-							NM_014289	NP_055104			calpain 6						microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6																		---	---	---	---
ZCCHC16	340595	broad.mit.edu	37	X	111405235	111405235	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111405235delT	uc004epo.1	+							NM_001004308	NP_001004308			zinc finger, CCHC domain containing 16								nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	113509414	113509415	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:113509414_113509415insT								None (None upstream) : HTR2C (309136 downstream)																																			---	---	---	---
KLHL13	90293	broad.mit.edu	37	X	117065447	117065447	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117065447delT	uc004eql.2	-						KLHL13_uc004eqk.2_Intron|KLHL13_uc011mtn.1_Intron|KLHL13_uc011mto.1_Intron|KLHL13_uc011mtp.1_Intron|KLHL13_uc004eqm.2_Intron|KLHL13_uc011mtq.1_Intron	NM_033495	NP_277030			kelch-like 13						cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	122953332	122953333	+	IGR	INS	-	AC	AC			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122953332_122953333insAC								THOC2 (86428 upstream) : XIAP (40329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	124198441	124198441	+	IGR	DEL	A	-	-	rs79489367		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:124198441delA								ODZ1 (100775 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	128098007	128098008	+	IGR	DEL	TG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128098007_128098008delTG								ACTRT1 (911625 upstream) : SMARCA1 (482472 downstream)																																			---	---	---	---
LOC286467	286467	broad.mit.edu	37	X	130889087	130889088	+	Intron	DEL	TT	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130889087_130889088delTT	uc004ewi.2	-						LOC286467_uc004ewj.1_Intron	NR_026975				Homo sapiens cDNA FLJ40592 fis, clone THYMU2010192.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	137368816	137368816	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:137368816delG								ZIC3 (714559 upstream) : LOC158696 (328076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	138445459	138445459	+	IGR	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138445459delT								FGF13 (158274 upstream) : F9 (167436 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	142884767	142884769	+	IGR	DEL	AGG	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142884767_142884769delAGG								SPANXN2 (80251 upstream) : UBE2NL (82404 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	149693429	149693430	+	IGR	DEL	CA	-	-	rs72398727		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149693429_149693430delCA								MAMLD1 (10983 upstream) : MTM1 (43617 downstream)																																			---	---	---	---
CD99L2	83692	broad.mit.edu	37	X	149999775	149999776	+	Intron	INS	-	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149999775_149999776insA	uc004fel.2	-						CD99L2_uc004fem.2_Intron|CD99L2_uc004fen.2_Intron|CD99L2_uc004feo.2_Intron|CD99L2_uc011myb.1_Intron	NM_031462	NP_113650			CD99 antigen-like 2 isoform E3'-E4'-E3-E4						cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
HAUS7	55559	broad.mit.edu	37	X	152724028	152724028	+	Intron	DEL	T	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152724028delT	uc004fho.1	-						HAUS7_uc004fhl.2_Intron|HAUS7_uc004fhm.2_Intron|HAUS7_uc004fhn.1_Intron|HAUS7_uc004fhp.1_Intron|HAUS7_uc011myq.1_Intron	NM_017518	NP_059988			HAUS augmin-like complex subunit 7						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleolus|plasma membrane|spindle	thioesterase binding				0																		---	---	---	---
IL9R	3581	broad.mit.edu	37	X	155238775	155238776	+	Intron	DEL	TA	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155238775_155238776delTA	uc004fnv.1	+						IL9R_uc004fnu.1_Intron	NM_002186	NP_002177			interleukin 9 receptor precursor						cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)																	---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9954434	9954434	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9954434delG								TTTY22 (303580 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9992532	9992532	+	IGR	DEL	A	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9992532delA								TTTY22 (341678 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10054250	10054250	+	IGR	DEL	G	-	-			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10054250delG								TTTY22 (403396 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10066700	10066701	+	IGR	INS	-	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10066700_10066701insT								TTTY22 (415846 upstream) : None (None downstream)																																			---	---	---	---
TP73	7161	broad.mit.edu	37	1	3638718	3638718	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3638718C>T	uc001akp.2	+	5	673	c.563C>T	c.(562-564)ACC>ATC	p.T188I	TP73_uc001akq.2_Missense_Mutation_p.T188I|TP73_uc010nzj.1_Missense_Mutation_p.T139I|TP73_uc001akr.2_Missense_Mutation_p.T139I|TP73_uc009vlk.1_Missense_Mutation_p.T139I|TP73_uc001aks.2_Missense_Mutation_p.T139I|TP73_uc010nzk.1_Missense_Mutation_p.T117I	NM_005427	NP_005418	O15350	P73_HUMAN	tumor protein p73 isoform a	188	DNA-binding (Potential).				cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mismatch repair|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of JUN kinase activity|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|protein tetramerization|response to gamma radiation|response to X-ray	chromatin|cytosol|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|metal ion binding|p53 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|transcription repressor activity			ovary(1)|lung(1)	2	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)														---	---	---	---
SLC45A1	50651	broad.mit.edu	37	1	8390300	8390300	+	Silent	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8390300C>T	uc001apb.2	+	4	747	c.747C>T	c.(745-747)GGC>GGT	p.G249G	SLC45A1_uc001apc.2_5'UTR	NM_001080397	NP_001073866	Q9Y2W3	S45A1_HUMAN	DNB5	249	Helical; (Potential).				carbohydrate transport	integral to membrane	symporter activity			central_nervous_system(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PADI3	51702	broad.mit.edu	37	1	17597370	17597370	+	Intron	SNP	G	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17597370G>C	uc001bai.2	+							NM_016233	NP_057317			peptidyl arginine deiminase, type III						peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(1)|breast(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)													---	---	---	---
TMEM39B	55116	broad.mit.edu	37	1	32568198	32568198	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32568198G>A	uc010ogv.1	+	9	1549	c.1403G>A	c.(1402-1404)CGG>CAG	p.R468Q	TMEM39B_uc001bue.3_Missense_Mutation_p.R469Q|TMEM39B_uc001buf.3_Missense_Mutation_p.R269Q|TMEM39B_uc010ogw.1_Missense_Mutation_p.R269Q	NM_018056	NP_060526	Q9GZU3	TM39B_HUMAN	transmembrane protein 39B	468						integral to membrane					0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)																---	---	---	---
TNNI3K	51086	broad.mit.edu	37	1	75009670	75009670	+	3'UTR	SNP	C	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75009670C>G	uc001dgf.1	+	25					TNNI3K_uc001dge.1_3'UTR	NM_015978	NP_057062			TNNI3 interacting kinase isoform b							cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10																		---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103354274	103354274	+	Intron	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103354274C>T	uc001dul.2	-						COL11A1_uc001duk.2_Intron|COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845			alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)														---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144906185	144906185	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144906185C>A	uc001elw.3	-	19	2739	c.2448G>T	c.(2446-2448)ATG>ATT	p.M816I	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.M882I|PDE4DIP_uc001emc.1_Missense_Mutation_p.M816I|PDE4DIP_uc001emd.1_Missense_Mutation_p.M816I|PDE4DIP_uc001emb.1_Missense_Mutation_p.M979I|PDE4DIP_uc001eme.1_Intron|PDE4DIP_uc001emf.1_Missense_Mutation_p.M601I	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	816	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PIP5K1A	8394	broad.mit.edu	37	1	151205130	151205130	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151205130A>T	uc001exj.2	+	7	1042	c.590A>T	c.(589-591)CAA>CTA	p.Q197L	PIP5K1A_uc001exi.2_Missense_Mutation_p.Q184L|PIP5K1A_uc010pcu.1_Missense_Mutation_p.Q185L|PIP5K1A_uc001exk.2_Missense_Mutation_p.Q184L|PIP5K1A_uc010pcv.1_5'Flank	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	197	PIPK.				phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
TCHH	7062	broad.mit.edu	37	1	152084997	152084997	+	Silent	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152084997C>T	uc001ezp.2	-	2	696	c.696G>A	c.(694-696)GAG>GAA	p.E232E	TCHH_uc009wne.1_Silent_p.E232E	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	232					keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
FLG2	388698	broad.mit.edu	37	1	152329493	152329493	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152329493T>C	uc001ezw.3	-	3	842	c.769A>G	c.(769-771)AGA>GGA	p.R257G	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	257	Ser-rich.|Filaggrin 1.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
OR10X1	128367	broad.mit.edu	37	1	158549211	158549211	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158549211A>G	uc010pin.1	-	1	479	c.479T>C	c.(478-480)CTT>CCT	p.L160P		NM_001004477	NP_001004477	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X,	160	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)																	---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158592947	158592947	+	Silent	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158592947T>C	uc001fst.1	-	43	6145	c.5946A>G	c.(5944-5946)CAA>CAG	p.Q1982Q		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1982	Spectrin 19.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
FAM5B	57795	broad.mit.edu	37	1	177247772	177247772	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177247772G>C	uc001glf.2	+	7	1398	c.1086G>C	c.(1084-1086)TGG>TGC	p.W362C	FAM5B_uc010pna.1_Missense_Mutation_p.W112C|FAM5B_uc001glg.2_Missense_Mutation_p.W257C	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	362						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
REN	5972	broad.mit.edu	37	1	204128714	204128714	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204128714T>C	uc001haq.2	-	5	546	c.502A>G	c.(502-504)ATC>GTC	p.I168V		NM_000537	NP_000528	P00797	RENI_HUMAN	renin preproprotein	168					angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity			skin(3)|central_nervous_system(1)	4	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)													---	---	---	---
SLC35F3	148641	broad.mit.edu	37	1	234452482	234452482	+	Intron	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234452482G>A	uc001hwa.1	+						SLC35F3_uc001hvy.1_Intron	NM_173508	NP_775779			solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)															---	---	---	---
RGS7	6000	broad.mit.edu	37	1	240990464	240990464	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240990464A>T	uc001hyv.2	-	10	948	c.618T>A	c.(616-618)TGT>TGA	p.C206*	RGS7_uc010pyh.1_Nonsense_Mutation_p.C180*|RGS7_uc010pyj.1_Nonsense_Mutation_p.C122*|RGS7_uc001hyu.2_Nonsense_Mutation_p.C206*|RGS7_uc009xgn.1_Nonsense_Mutation_p.C153*|RGS7_uc001hyw.2_Nonsense_Mutation_p.C206*|RGS7_uc001hyt.2_Nonsense_Mutation_p.C38*	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	206					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)															---	---	---	---
C2orf89	129293	broad.mit.edu	37	2	85097836	85097836	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85097836A>G	uc010ysl.1	-	2	271	c.182T>C	c.(181-183)GTC>GCC	p.V61A	C2orf89_uc002sou.3_Missense_Mutation_p.V61A|C2orf89_uc010fgc.1_Missense_Mutation_p.V61A	NM_001080824	NP_001074293	Q86V40	CB089_HUMAN	hypothetical protein LOC129293 precursor	61	Extracellular (Potential).					integral to membrane				ovary(1)	1																		---	---	---	---
CHST10	9486	broad.mit.edu	37	2	101009785	101009785	+	Silent	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101009785G>A	uc002tam.2	-	7	1352	c.993C>T	c.(991-993)GAC>GAT	p.D331D		NM_004854	NP_004845	O43529	CHSTA_HUMAN	HNK-1 sulfotransferase	331	Lumenal (Potential).				carbohydrate biosynthetic process|cell adhesion	Golgi membrane|integral to membrane|membrane fraction				ovary(1)	1																		---	---	---	---
ITGAV	3685	broad.mit.edu	37	2	187511490	187511490	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187511490T>A	uc002upq.2	+	13	1513	c.1237T>A	c.(1237-1239)TTG>ATG	p.L413M	ITGAV_uc010frs.2_Missense_Mutation_p.L377M|ITGAV_uc010zfv.1_Missense_Mutation_p.L367M	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor	413	FG-GAP 6.|Extracellular (Potential).				angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)														---	---	---	---
CRYGD	1421	broad.mit.edu	37	2	208988933	208988933	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208988933G>C	uc002vcn.3	-	2	271	c.155C>G	c.(154-156)TCG>TGG	p.S52W		NM_006891	NP_008822	P07320	CRGD_HUMAN	crystallin, gamma D	52	Beta/gamma crystallin 'Greek key' 2.				cellular response to reactive oxygen species|visual perception	soluble fraction	protein binding|structural constituent of eye lens				0				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)														---	---	---	---
COL4A4	1286	broad.mit.edu	37	2	227922324	227922324	+	Intron	SNP	G	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227922324G>T	uc010zlt.1	-							NM_000092	NP_000083			alpha 4 type IV collagen precursor						axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)														---	---	---	---
KCNH8	131096	broad.mit.edu	37	3	19384181	19384181	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19384181A>G	uc003cbk.1	+	4	740	c.545A>G	c.(544-546)GAA>GGA	p.E182G	KCNH8_uc011awe.1_Missense_Mutation_p.E182G|KCNH8_uc010hex.1_5'UTR	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	182	Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5																		---	---	---	---
BSN	8927	broad.mit.edu	37	3	49680337	49680337	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49680337T>A	uc003cxe.3	+	3	1384	c.1270T>A	c.(1270-1272)TCT>ACT	p.S424T		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	424					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)														---	---	---	---
SEMA3G	56920	broad.mit.edu	37	3	52472078	52472078	+	Silent	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52472078G>A	uc003dea.1	-	14	1647	c.1647C>T	c.(1645-1647)CAC>CAT	p.H549H		NM_020163	NP_064548	Q9NS98	SEM3G_HUMAN	semaphorin sem2 precursor	549					multicellular organismal development	extracellular region|membrane	receptor activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)														---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	62259361	62259361	+	Intron	SNP	T	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62259361T>G	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron|PTPRG_uc011bfi.1_Intron|uc010hno.2_Intron|uc003dld.3_Intron|uc010hnp.2_Intron|uc003dle.3_Intron	NM_002841	NP_002832			protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
PIK3R4	30849	broad.mit.edu	37	3	130422722	130422722	+	Silent	SNP	A	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130422722A>C	uc003enj.2	-	13	3524	c.2943T>G	c.(2941-2943)CCT>CCG	p.P981P		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	981					fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12																		---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134514520	134514520	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134514520C>A	uc003eqt.2	+	1	267	c.47C>A	c.(46-48)GCT>GAT	p.A16D	EPHB1_uc010htz.1_RNA|EPHB1_uc011bly.1_Missense_Mutation_p.A16D	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	16						integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
LRRC34	151827	broad.mit.edu	37	3	169514045	169514045	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169514045A>C	uc003ffx.2	-	8	901	c.886T>G	c.(886-888)TAT>GAT	p.Y296D	LRRC34_uc003ffy.2_Missense_Mutation_p.Y328D|LRRC34_uc011bpn.1_Missense_Mutation_p.Y328D|LRRC34_uc003ffz.2_Missense_Mutation_p.Y280D|LRRC34_uc003fga.3_Missense_Mutation_p.Y280D	NM_153353	NP_699184	Q8IZ02	LRC34_HUMAN	leucine rich repeat containing 34	296	LRR 2.										0	all_cancers(22;4.12e-22)|all_epithelial(15;7.54e-27)|all_lung(20;1.63e-16)|Lung NSC(18;6.92e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)															---	---	---	---
FAM43A	131583	broad.mit.edu	37	3	194407706	194407706	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194407706G>T	uc003fuj.2	+	1	1085	c.151G>T	c.(151-153)GGC>TGC	p.G51C		NM_153690	NP_710157	Q8N2R8	FA43A_HUMAN	hypothetical protein LOC131583	51										central_nervous_system(1)	1	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)														---	---	---	---
QDPR	5860	broad.mit.edu	37	4	17510923	17510923	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17510923T>C	uc003gpd.2	-	2	349	c.169A>G	c.(169-171)ACA>GCA	p.T57A	QDPR_uc003gpe.2_Intron|QDPR_uc003gpf.2_RNA	NM_000320	NP_000311	P09417	DHPR_HUMAN	quinoid dihydropteridine reductase	57					dihydrobiopterin metabolic process|L-phenylalanine catabolic process|tetrahydrobiopterin biosynthetic process	cytosol	6,7-dihydropteridine reductase activity|binding|electron carrier activity			ovary(1)	1					NADH(DB00157)													---	---	---	---
CDKL2	8999	broad.mit.edu	37	4	76521528	76521528	+	Intron	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76521528T>C	uc003hiq.2	-						CDKL2_uc011cbp.1_Intron	NM_003948	NP_003939			cyclin-dependent kinase-like 2						sex differentiation|signal transduction	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(2)|stomach(2)|breast(2)|skin(1)	7			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)															---	---	---	---
MIR1243	100302188	broad.mit.edu	37	4	114028077	114028077	+	RNA	SNP	T	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114028077T>G	hsa-mir-1243|MI0006373	+			c.59T>G			ANK2_uc003ibd.3_Intron|ANK2_uc003ibe.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc003ibc.2_Intron|ANK2_uc011cgb.1_Intron																	0																		---	---	---	---
ANKRD50	57182	broad.mit.edu	37	4	125593264	125593264	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125593264C>G	uc003ifg.3	-	3	1434	c.1168G>C	c.(1168-1170)GAT>CAT	p.D390H	ANKRD50_uc011cgo.1_Missense_Mutation_p.D211H|ANKRD50_uc010inw.2_Missense_Mutation_p.D390H	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	390										central_nervous_system(1)	1																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126370680	126370680	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126370680G>T	uc003ifj.3	+	9	8509	c.8509G>T	c.(8509-8511)GAT>TAT	p.D2837Y	FAT4_uc011cgp.1_Missense_Mutation_p.D1135Y|FAT4_uc003ifi.1_Missense_Mutation_p.D315Y	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	2837	Cadherin 27.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
PCDH18	54510	broad.mit.edu	37	4	138442172	138442172	+	3'UTR	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138442172G>A	uc003ihe.3	-	4					PCDH18_uc003ihf.3_3'UTR|PCDH18_uc011cgz.1_3'UTR|PCDH18_uc003ihg.3_3'UTR|PCDH18_uc011cha.1_3'UTR	NM_019035	NP_061908			protocadherin 18 precursor						brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			pancreas(3)|skin(2)	5	all_hematologic(180;0.24)																	---	---	---	---
MARCH6	10299	broad.mit.edu	37	5	10423905	10423905	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10423905C>G	uc003jet.1	+	23	2525	c.2342C>G	c.(2341-2343)CCT>CGT	p.P781R	MARCH6_uc011cmu.1_Missense_Mutation_p.P733R|MARCH6_uc003jeu.1_Missense_Mutation_p.P479R|MARCH6_uc011cmv.1_Missense_Mutation_p.P676R	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	781	Helical; (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2																		---	---	---	---
XRCC4	7518	broad.mit.edu	37	5	82400731	82400731	+	5'UTR	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82400731A>G	uc003kib.2	+	2					XRCC4_uc003kia.1_5'UTR|XRCC4_uc003kid.2_5'UTR|XRCC4_uc003kic.2_5'UTR|XRCC4_uc003kie.2_5'UTR|XRCC4_uc003kif.1_5'UTR	NM_022406	NP_071801			X-ray repair cross complementing protein 4						DNA ligation involved in DNA repair|double-strand break repair via nonhomologous end joining|initiation of viral infection|positive regulation of ligase activity|provirus integration|response to X-ray	cytosol|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|nucleoplasm	DNA binding|protein C-terminus binding			skin(3)	3		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)									NHEJ					---	---	---	---
DMXL1	1657	broad.mit.edu	37	5	118556293	118556293	+	Intron	SNP	C	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118556293C>A	uc003ksd.2	+						DMXL1_uc010jcl.1_Intron	NM_005509	NP_005500			Dmx-like 1											ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)														---	---	---	---
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139921808	139921808	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139921808C>T	uc003lfs.1	+	34	7745	c.7621C>T	c.(7621-7623)CAG>TAG	p.Q2541*	ANKHD1-EIF4EBP3_uc011czh.1_Nonsense_Mutation_p.Q1297*|ANKHD1-EIF4EBP3_uc003lfx.1_Nonsense_Mutation_p.Q686*	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	2541						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHB10	56126	broad.mit.edu	37	5	140572154	140572154	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140572154G>A	uc003lix.2	+	1	203	c.29G>A	c.(28-30)AGA>AAA	p.R10K		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	10					calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
ZNF454	285676	broad.mit.edu	37	5	178373460	178373460	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178373460A>G	uc003mjo.1	+	3	405	c.134A>G	c.(133-135)GAG>GGG	p.E45G	ZNF454_uc010jkz.1_Missense_Mutation_p.E45G|ZNF454_uc003mjp.2_Silent_p.G80G	NM_182594	NP_872400	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	45	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)														---	---	---	---
FLT4	2324	broad.mit.edu	37	5	180039587	180039587	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180039587C>G	uc003mma.3	-	26	3535	c.3456G>C	c.(3454-3456)TGG>TGC	p.W1152C	FLT4_uc003mlz.3_Missense_Mutation_p.W1152C	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	1152	Cytoplasmic (Potential).|Protein kinase.				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)									Congenital_Hereditary_Lymphedema				---	---	---	---
F13A1	2162	broad.mit.edu	37	6	6251035	6251035	+	Intron	SNP	G	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6251035G>C	uc003mwv.2	-						F13A1_uc011dib.1_Intron	NM_000129	NP_000120			coagulation factor XIII A1 subunit precursor						peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)													---	---	---	---
ATF6B	1388	broad.mit.edu	37	6	32095933	32095933	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32095933T>G	uc003nzn.2	-	1	85	c.52A>C	c.(52-54)ACC>CCC	p.T18P	ATF6B_uc003nzo.2_Missense_Mutation_p.T18P|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_Missense_Mutation_p.T18P	NM_004381	NP_004372	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta isoform	18	Cytoplasmic (Potential).|Transcription activation.				response to unfolded protein|signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
MTO1	25821	broad.mit.edu	37	6	74189511	74189511	+	Silent	SNP	T	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74189511T>A	uc003pgy.3	+	5	1006	c.882T>A	c.(880-882)ATT>ATA	p.I294I	MTO1_uc010kav.2_Silent_p.I294I|MTO1_uc003pgz.3_Silent_p.I294I|MTO1_uc003pha.3_5'UTR|MTO1_uc003phb.3_Silent_p.I220I|MTO1_uc010kaw.1_5'Flank	NM_133645	NP_598400	Q9Y2Z2	MTO1_HUMAN	mitochondrial translation optimization 1 homolog	294					tRNA processing	mitochondrion	flavin adenine dinucleotide binding			ovary(3)|skin(2)|pancreas(1)	6																OREG0003887	type=REGULATORY REGION|Gene=MTO1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
CLVS2	134829	broad.mit.edu	37	6	123332137	123332137	+	Silent	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123332137C>T	uc003pzi.1	+	3	1266	c.397C>T	c.(397-399)CTG>TTG	p.L133L		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	133	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
ADCYAP1R1	117	broad.mit.edu	37	7	31117679	31117679	+	Silent	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31117679C>T	uc003tca.1	+	4	454	c.231C>T	c.(229-231)TGC>TGT	p.C77C	ADCYAP1R1_uc003tcb.1_Silent_p.C77C|ADCYAP1R1_uc003tcc.1_Silent_p.C77C|ADCYAP1R1_uc003tcd.1_Silent_p.C77C|ADCYAP1R1_uc003tce.1_Silent_p.C77C	NM_001118	NP_001109	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1	77	Extracellular (Potential).				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|spermatogenesis	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	38289013	38289013	+	5'UTR	SNP	A	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38289013A>T	uc003tfu.3	-	2					uc003tfv.2_5'UTR|uc003tfw.2_RNA|uc003tfx.1_RNA|uc003tfz.1_RNA					SubName: Full=TARP protein;																														---	---	---	---
MRPL32	64983	broad.mit.edu	37	7	42974544	42974544	+	Intron	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42974544T>C	uc003tia.2	+						C7orf25_uc010kxr.2_5'Flank|PSMA2_uc003thy.2_5'Flank|PSMA2_uc010kxt.2_5'Flank|PSMA2_uc003thz.1_5'Flank|MRPL32_uc003tib.2_Intron|MRPL32_uc003tic.2_Intron	NM_031903	NP_114109			mitochondrial ribosomal protein L32 precursor						translation	large ribosomal subunit|mitochondrial ribosome	structural constituent of ribosome				0																		---	---	---	---
MYO1G	64005	broad.mit.edu	37	7	45009093	45009093	+	Intron	SNP	A	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45009093A>T	uc003tmh.2	-						MYO1G_uc003tmf.2_5'Flank|MYO1G_uc003tmg.2_Intron|MYO1G_uc010kym.2_Intron|MYO1G_uc003tmi.1_Intron|MYO1G_uc003tmj.2_Intron	NM_033054	NP_149043			myosin IG							myosin complex|plasma membrane	actin binding|ATP binding|calmodulin binding|motor activity			breast(2)|ovary(1)|pancreas(1)	4																		---	---	---	---
CCT6A	908	broad.mit.edu	37	7	56125803	56125803	+	Intron	SNP	T	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56125803T>G	uc003trl.1	+						PSPH_uc003trj.2_Intron|CCT6A_uc003trm.1_Intron|CCT6A_uc011kcu.1_Intron|SNORA15_uc003trn.1_5'Flank	NM_001762	NP_001753			chaperonin containing TCP1, subunit 6A isoform						'de novo' posttranslational protein folding	cytosol	ATP binding|unfolded protein binding			upper_aerodigestive_tract(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
SEMA3D	223117	broad.mit.edu	37	7	84685080	84685080	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84685080T>C	uc003uic.2	-	7	854	c.814A>G	c.(814-816)AGT>GGT	p.S272G	SEMA3D_uc010led.2_Missense_Mutation_p.S272G|SEMA3D_uc010lee.1_Missense_Mutation_p.S272G	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor	272	Sema.				cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5																		---	---	---	---
TAC1	6863	broad.mit.edu	37	7	97362020	97362020	+	Silent	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97362020C>T	uc003uop.3	+	2	342	c.96C>T	c.(94-96)TCC>TCT	p.S32S	TAC1_uc003uoq.3_Silent_p.S32S|TAC1_uc003uor.3_Silent_p.S32S|TAC1_uc003uos.3_Silent_p.S32S	NM_003182	NP_003173	P20366	TKN1_HUMAN	tachykinin 1 isoform beta precursor	32				S -> P (in Ref. 4; BAD96677).	detection of abiotic stimulus|elevation of cytosolic calcium ion concentration|insemination|neuropeptide signaling pathway|synaptic transmission|tachykinin receptor signaling pathway	extracellular space					0	all_cancers(62;3.95e-09)|all_epithelial(64;1.1e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0358)|all_lung(186;0.0384)				Bacitracin(DB00626)													---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	131878819	131878819	+	Splice_Site	SNP	A	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131878819A>C	uc003vra.3	-	14	3085	c.2856_splice	c.e14+1	p.M952_splice		NM_020911	NP_065962			plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
OR2A12	346525	broad.mit.edu	37	7	143792911	143792911	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143792911C>G	uc011kty.1	+	1	711	c.711C>G	c.(709-711)TTC>TTG	p.F237L		NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,	237	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)																	---	---	---	---
ZNF786	136051	broad.mit.edu	37	7	148768273	148768273	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148768273G>A	uc003wfh.2	-	4	1728	c.1591C>T	c.(1591-1593)CAC>TAC	p.H531Y	ZNF786_uc011kuk.1_Missense_Mutation_p.H494Y|ZNF786_uc003wfi.2_Missense_Mutation_p.H445Y	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786	531	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)															---	---	---	---
ZNF786	136051	broad.mit.edu	37	7	148768274	148768274	+	Silent	SNP	C	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148768274C>A	uc003wfh.2	-	4	1727	c.1590G>T	c.(1588-1590)GTG>GTT	p.V530V	ZNF786_uc011kuk.1_Silent_p.V493V|ZNF786_uc003wfi.2_Silent_p.V444V	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786	530	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)															---	---	---	---
ARHGEF10	9639	broad.mit.edu	37	8	1806253	1806253	+	Silent	SNP	T	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1806253T>G	uc003wpr.2	+	3	343	c.165T>G	c.(163-165)GCT>GCG	p.A55A	ARHGEF10_uc003wpq.1_Silent_p.A79A|ARHGEF10_uc003wps.2_Silent_p.A55A|ARHGEF10_uc003wpt.2_5'Flank|ARHGEF10_uc010lrd.1_5'Flank|ARHGEF10_uc003wpu.2_5'Flank	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	79					centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)														---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52321580	52321580	+	Silent	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52321580C>T	uc003xqu.3	-	17	2705	c.2604G>A	c.(2602-2604)GCG>GCA	p.A868A	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	868					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
FAM110B	90362	broad.mit.edu	37	8	59059766	59059766	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59059766G>A	uc003xtj.1	+	5	1857	c.977G>A	c.(976-978)AGT>AAT	p.S326N		NM_147189	NP_671722	Q8TC76	F110B_HUMAN	hypothetical protein LOC90362	326						microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)																---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77616403	77616403	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77616403T>G	uc003yav.2	+	2	467	c.80T>G	c.(79-81)CTT>CGT	p.L27R	ZFHX4_uc003yat.1_Missense_Mutation_p.L27R|ZFHX4_uc003yau.1_Missense_Mutation_p.L27R|ZFHX4_uc003yaw.1_Missense_Mutation_p.L27R	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	27						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77617268	77617268	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77617268T>G	uc003yav.2	+	2	1332	c.945T>G	c.(943-945)AAT>AAG	p.N315K	ZFHX4_uc003yat.1_Missense_Mutation_p.N315K|ZFHX4_uc003yau.1_Missense_Mutation_p.N315K|ZFHX4_uc003yaw.1_Missense_Mutation_p.N315K	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	315						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---
PKHD1L1	93035	broad.mit.edu	37	8	110450689	110450689	+	Intron	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110450689A>G	uc003yne.2	+							NM_177531	NP_803875			fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)												HNSCC(38;0.096)			---	---	---	---
EFR3A	23167	broad.mit.edu	37	8	132966069	132966069	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132966069C>G	uc003yte.2	+	6	694	c.493C>G	c.(493-495)CGA>GGA	p.R165G		NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A	165						plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)															---	---	---	---
ZNF7	7553	broad.mit.edu	37	8	146066746	146066746	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146066746C>T	uc003zeg.3	+	5	391	c.254C>T	c.(253-255)ACG>ATG	p.T85M	ZNF7_uc010mge.2_Missense_Mutation_p.T96M|ZNF7_uc011lln.1_Translation_Start_Site|ZNF7_uc003zeh.2_Intron|ZNF7_uc003zek.3_Translation_Start_Site|COMMD5_uc003zel.1_RNA	NM_003416	NP_003407	P17097	ZNF7_HUMAN	zinc finger protein 7	85					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)														---	---	---	---
ACO1	48	broad.mit.edu	37	9	32423334	32423334	+	Missense_Mutation	SNP	T	A	A	rs149639885		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32423334T>A	uc003zqw.3	+	9	1143	c.988T>A	c.(988-990)TTA>ATA	p.L330I	ACO1_uc010mjh.1_Missense_Mutation_p.L164I|ACO1_uc003zqx.3_Missense_Mutation_p.L330I|ACO1_uc003zqy.3_RNA	NM_002197	NP_002188	P21399	ACOC_HUMAN	aconitase 1	330					citrate metabolic process|response to iron(II) ion|tricarboxylic acid cycle	cytosol|endoplasmic reticulum|Golgi apparatus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron-responsive element binding|isocitrate hydro-lyase (cis-aconitate-forming) activity|metal ion binding|protein binding				0			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)														---	---	---	---
DAPK1	1612	broad.mit.edu	37	9	90219911	90219911	+	Silent	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90219911C>T	uc004apc.2	+	3	243	c.105C>T	c.(103-105)ACC>ACT	p.T35T	DAPK1_uc004ape.2_Silent_p.T35T|DAPK1_uc004apd.2_Silent_p.T35T|DAPK1_uc011ltg.1_Silent_p.T35T|DAPK1_uc011lth.1_5'UTR	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	35	Protein kinase.				apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2														Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				---	---	---	---
DAPK1	1612	broad.mit.edu	37	9	90219927	90219927	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90219927G>T	uc004apc.2	+	3	259	c.121G>T	c.(121-123)GCC>TCC	p.A41S	DAPK1_uc004ape.2_Missense_Mutation_p.A41S|DAPK1_uc004apd.2_Missense_Mutation_p.A41S|DAPK1_uc011ltg.1_Missense_Mutation_p.A41S|DAPK1_uc011lth.1_5'UTR	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	41	Protein kinase.				apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2														Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				---	---	---	---
ANP32B	10541	broad.mit.edu	37	9	100774732	100774732	+	Silent	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100774732T>C	uc004aya.2	+	6	1015	c.666T>C	c.(664-666)GAT>GAC	p.D222D		NM_006401	NP_006392	Q92688	AN32B_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32	222	Asp/Glu-rich (highly acidic).					cytoplasm|nucleus					0		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
CYLC2	1539	broad.mit.edu	37	9	105767920	105767920	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105767920A>T	uc004bbs.2	+	5	1077	c.1007A>T	c.(1006-1008)AAG>ATG	p.K336M		NM_001340	NP_001331	Q14093	CYLC2_HUMAN	cylicin 2	336	31 X 3 AA repeats of K-K-X.				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton			skin(1)	1		all_hematologic(171;0.125)																---	---	---	---
FAM78A	286336	broad.mit.edu	37	9	134136359	134136359	+	Silent	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134136359G>A	uc004cak.2	-	2	1042	c.702C>T	c.(700-702)CCC>CCT	p.P234P	FAM78A_uc004caj.2_Silent_p.P231P	NM_033387	NP_203745	Q5JUQ0	FA78A_HUMAN	hypothetical protein LOC286336	234										ovary(1)	1	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)														---	---	---	---
SVIL	6840	broad.mit.edu	37	10	29822323	29822323	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29822323C>G	uc001iut.1	-	8	1726	c.973G>C	c.(973-975)GAG>CAG	p.E325Q	SVIL_uc001iuu.1_Intron|SVIL_uc009xld.1_Missense_Mutation_p.E325Q	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	325					cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)																---	---	---	---
KIAA1462	57608	broad.mit.edu	37	10	30336642	30336642	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30336642T>C	uc001iux.2	-	1	159	c.100A>G	c.(100-102)AGG>GGG	p.R34G	KIAA1462_uc001iuy.2_Missense_Mutation_p.R34G|KIAA1462_uc001iuz.2_5'UTR|KIAA1462_uc009xle.1_Missense_Mutation_p.R34G	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	34										ovary(4)	4																		---	---	---	---
USP54	159195	broad.mit.edu	37	10	75276591	75276591	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75276591G>A	uc001juo.2	-	18	3610	c.3593C>T	c.(3592-3594)TCC>TTC	p.S1198F	USP54_uc010qkk.1_Missense_Mutation_p.S380F|USP54_uc001juk.2_Missense_Mutation_p.S286F|USP54_uc001jul.2_Missense_Mutation_p.S286F|USP54_uc001jum.2_RNA|USP54_uc001jun.2_RNA	NM_152586	NP_689799	Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1198					ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)																	---	---	---	---
OR51A7	119687	broad.mit.edu	37	11	4928970	4928970	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4928970T>C	uc010qyq.1	+	1	371	c.371T>C	c.(370-372)CTT>CCT	p.L124P		NM_001004749	NP_001004749	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A,	124	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
OR51I1	390063	broad.mit.edu	37	11	5462555	5462555	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5462555A>G	uc010qze.1	-	1	190	c.190T>C	c.(190-192)TTC>CTC	p.F64L	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005288	NP_001005288	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I,	64	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
TUB	7275	broad.mit.edu	37	11	8118945	8118945	+	Silent	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8118945G>A	uc001mga.2	+	7	1007	c.858G>A	c.(856-858)CTG>CTA	p.L286L	TUB_uc010rbk.1_Silent_p.L292L|TUB_uc001mfy.2_Silent_p.L341L	NM_177972	NP_813977	P50607	TUB_HUMAN	tubby isoform b	286					phagocytosis|positive regulation of phagocytosis|response to stimulus	cytoplasm|extracellular region|nucleus|plasma membrane				ovary(1)	1		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)														---	---	---	---
MRVI1	10335	broad.mit.edu	37	11	10602123	10602123	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10602123G>T	uc010rcc.1	-	20	2760	c.2374C>A	c.(2374-2376)CTA>ATA	p.L792I	uc001miu.2_Intron|MRVI1_uc001miw.2_Missense_Mutation_p.L783I|MRVI1_uc010rcb.1_Missense_Mutation_p.L784I|MRVI1_uc009ygb.1_Missense_Mutation_p.L477I|MRVI1_uc001mix.2_Missense_Mutation_p.L477I|MRVI1_uc001miz.2_Missense_Mutation_p.L701I|MRVI1_uc009ygc.1_Missense_Mutation_p.L701I|MRVI1_uc010rcd.1_Missense_Mutation_p.L586I|MRVI1_uc009ygd.1_Missense_Mutation_p.L477I	NM_001100167	NP_001093637	Q9Y6F6	MRVI1_HUMAN	JAW1-related protein isoform c	765	Glu-rich.				platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)														---	---	---	---
GTF2H1	2965	broad.mit.edu	37	11	18369442	18369442	+	Silent	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18369442C>T	uc001moi.2	+	10	1723	c.1029C>T	c.(1027-1029)GAC>GAT	p.D343D	GTF2H1_uc001moh.2_Silent_p.D343D|GTF2H1_uc009yhm.2_Silent_p.D227D|GTF2H1_uc001moj.2_Silent_p.D31D	NM_001142307	NP_001135779	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1,	343					mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding				0													NER					---	---	---	---
SLC17A6	57084	broad.mit.edu	37	11	22396445	22396445	+	Intron	SNP	A	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22396445A>C	uc001mqk.2	+							NM_020346	NP_065079			solute carrier family 17 (sodium-dependent						sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4																		---	---	---	---
ANO3	63982	broad.mit.edu	37	11	26681929	26681929	+	Silent	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26681929C>T	uc001mqt.3	+	27	3029	c.2884C>T	c.(2884-2886)CTG>TTG	p.L962L	ANO3_uc010rdr.1_Silent_p.L946L|ANO3_uc010rds.1_Silent_p.L801L|ANO3_uc010rdt.1_Silent_p.L816L	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	962	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
TNKS1BP1	85456	broad.mit.edu	37	11	57080530	57080530	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57080530C>A	uc001njr.2	-	4	1944	c.1632G>T	c.(1630-1632)CAG>CAT	p.Q544H	TNKS1BP1_uc001njs.2_Missense_Mutation_p.Q544H|TNKS1BP1_uc009ymd.1_Translation_Start_Site	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	544	Pro-rich.|Acidic.				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)																---	---	---	---
OR4D10	390197	broad.mit.edu	37	11	59245181	59245181	+	Silent	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59245181C>T	uc001nnz.1	+	1	279	c.279C>T	c.(277-279)TCC>TCT	p.S93S		NM_001004705	NP_001004705	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D,	93	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3																		---	---	---	---
OSBP	5007	broad.mit.edu	37	11	59344398	59344398	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59344398G>A	uc001noc.1	-	13	2641	c.2161C>T	c.(2161-2163)CAG>TAG	p.Q721*	OSBP_uc009ymr.1_RNA	NM_002556	NP_002547	P22059	OSBP1_HUMAN	oxysterol binding protein	721					lipid transport	Golgi membrane	oxysterol binding			large_intestine(1)	1		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)														---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	100179126	100179126	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100179126A>G	uc001pga.2	+	21	2995	c.2656A>G	c.(2656-2658)AGT>GGT	p.S886G	CNTN5_uc001pfz.2_Missense_Mutation_p.S886G|CNTN5_uc001pgb.2_Missense_Mutation_p.S812G|CNTN5_uc010ruk.1_Missense_Mutation_p.S157G	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	886	Fibronectin type-III 3.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
FAM55D	54827	broad.mit.edu	37	11	114453043	114453043	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114453043T>C	uc001ppc.2	-	3	978	c.797A>G	c.(796-798)TAT>TGT	p.Y266C	FAM55D_uc001ppd.2_Intron	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN	hypothetical protein LOC54827 isoform 1	266						extracellular region				ovary(2)|skin(2)	4		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)														---	---	---	---
CCND2	894	broad.mit.edu	37	12	4385317	4385317	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4385317G>T	uc001qmo.2	+	2	647	c.342G>T	c.(340-342)GAG>GAT	p.E114D		NM_001759	NP_001750	P30279	CCND2_HUMAN	cyclin D2	114	Cyclin N-terminal.				cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding			haematopoietic_and_lymphoid_tissue(1)|breast(1)|kidney(1)	3			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)					T	IGL@	NHL,CLL								---	---	---	---
ABCC9	10060	broad.mit.edu	37	12	21991087	21991087	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21991087T>G	uc001rfi.1	-	28	3511	c.3491A>C	c.(3490-3492)GAC>GCC	p.D1164A	ABCC9_uc001rfh.2_Missense_Mutation_p.D1164A|ABCC9_uc001rfj.1_Missense_Mutation_p.D1128A	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1164	Extracellular (Potential).|ABC transmembrane type-1 2.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)													---	---	---	---
LIN7A	8825	broad.mit.edu	37	12	81283099	81283099	+	Silent	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81283099T>C	uc001szj.1	-	2	325	c.132A>G	c.(130-132)GAA>GAG	p.E44E	LIN7A_uc001szk.1_RNA	NM_004664	NP_004655	O14910	LIN7A_HUMAN	lin-7 homolog A	44	L27.				exocytosis|protein complex assembly|protein transport	basolateral plasma membrane|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	L27 domain binding			ovary(1)|skin(1)	2																		---	---	---	---
C12orf63	374467	broad.mit.edu	37	12	97051697	97051697	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97051697G>T	uc001tet.1	+	4	491	c.413G>T	c.(412-414)TGT>TTT	p.C138F		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	138										skin(6)|ovary(1)	7																		---	---	---	---
IFT88	8100	broad.mit.edu	37	13	21166469	21166469	+	Intron	SNP	C	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21166469C>A	uc001unh.2	+						IFT88_uc001uni.2_Intron|IFT88_uc001unj.2_Intron|IFT88_uc010tcq.1_Intron	NM_175605	NP_783195			intraflagellar transport 88 homolog isoform 1						cilium morphogenesis	centriole|intraflagellar transport particle B|microtubule basal body|microtubule-based flagellum	protein binding			ovary(1)	1		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)														---	---	---	---
MTUS2	23281	broad.mit.edu	37	13	29599154	29599154	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29599154G>T	uc001usl.3	+	1	407	c.349G>T	c.(349-351)GAA>TAA	p.E117*		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	107						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0																		---	---	---	---
C13orf26	122046	broad.mit.edu	37	13	31526821	31526821	+	Silent	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31526821A>G	uc001uti.2	+	3	190	c.171A>G	c.(169-171)GGA>GGG	p.G57G		NM_152325	NP_689538	Q8N6G2	CM026_HUMAN	hypothetical protein LOC122046	57										ovary(2)|skin(1)	3		Lung SC(185;0.0281)		all cancers(112;0.0176)|Epithelial(112;0.0768)|OV - Ovarian serous cystadenocarcinoma(117;0.0852)														---	---	---	---
NBEA	26960	broad.mit.edu	37	13	35751192	35751192	+	Silent	SNP	T	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35751192T>G	uc001uvb.2	+	28	4820	c.4614T>G	c.(4612-4614)CTT>CTG	p.L1538L	NBEA_uc010abi.2_Silent_p.L226L	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	1538						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
MYH7	4625	broad.mit.edu	37	14	23894153	23894153	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23894153T>G	uc001wjx.2	-	22	2610	c.2504A>C	c.(2503-2505)AAG>ACG	p.K835T		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	835					adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)														---	---	---	---
RIN3	79890	broad.mit.edu	37	14	93081782	93081782	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93081782T>G	uc001yap.2	+	4	550	c.398T>G	c.(397-399)TTT>TGT	p.F133C	RIN3_uc010auk.2_Intron|RIN3_uc001yaq.2_Missense_Mutation_p.F58C	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	133	SH2.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)																---	---	---	---
MYEF2	50804	broad.mit.edu	37	15	48458308	48458308	+	Intron	SNP	A	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48458308A>C	uc001zwi.3	-						MYEF2_uc001zwj.3_Intron|MYEF2_uc001zwl.2_Intron	NM_016132	NP_057216			myelin expression factor 2						transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding			lung(2)|ovary(1)	3		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)														---	---	---	---
BNC1	646	broad.mit.edu	37	15	83926474	83926474	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83926474C>T	uc002bjt.1	-	5	2793	c.2705G>A	c.(2704-2706)GGG>GAG	p.G902E	BNC1_uc010uos.1_Missense_Mutation_p.G890E	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	902					epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
ABCA3	21	broad.mit.edu	37	16	2374457	2374457	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2374457G>A	uc002cpy.1	-	6	1107	c.395C>T	c.(394-396)GCC>GTC	p.A132V	ABCA3_uc010bsk.1_Missense_Mutation_p.A132V|ABCA3_uc010bsl.1_Missense_Mutation_p.A132V|ABCA3_uc002cpz.1_Missense_Mutation_p.A132V	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	132					response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)																---	---	---	---
THOC6	79228	broad.mit.edu	37	16	3076370	3076370	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3076370A>G	uc002ctb.2	+	6	663	c.367A>G	c.(367-369)AGC>GGC	p.S123G	HCFC1R1_uc002csx.1_5'Flank|HCFC1R1_uc002csy.1_5'Flank|HCFC1R1_uc002csz.1_5'Flank|THOC6_uc002ctd.2_Missense_Mutation_p.S123G|THOC6_uc002ctc.2_Missense_Mutation_p.S99G|THOC6_uc002cta.2_Missense_Mutation_p.S99G	NM_024339	NP_077315	Q86W42	THOC6_HUMAN	WD repeat domain 58 isoform 1	123					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	RNA binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
GGA2	23062	broad.mit.edu	37	16	23490226	23490226	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23490226C>G	uc002dlq.2	-	12	1212	c.1136G>C	c.(1135-1137)AGT>ACT	p.S379T	GGA2_uc010bxo.1_RNA	NM_015044	NP_055859	Q9UJY4	GGA2_HUMAN	ADP-ribosylation factor binding protein 2	379	Unstructured hinge.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|clathrin-coated vesicle|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0386)														---	---	---	---
ERN2	10595	broad.mit.edu	37	16	23706066	23706066	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23706066G>T	uc002dma.3	-	17	2396	c.2227C>A	c.(2227-2229)CTG>ATG	p.L743M	ERN2_uc010bxp.2_Missense_Mutation_p.L691M	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2	695	Protein kinase.|Cytoplasmic (Potential).				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)														---	---	---	---
ARHGAP17	55114	broad.mit.edu	37	16	24955194	24955194	+	Intron	SNP	A	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24955194A>C	uc002dnb.2	-						ARHGAP17_uc002dna.2_Intron|ARHGAP17_uc002dnc.2_Intron|ARHGAP17_uc010vcf.1_Intron	NM_001006634	NP_001006635			nadrin isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)														---	---	---	---
HIRIP3	8479	broad.mit.edu	37	16	30005309	30005309	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30005309G>T	uc002dve.2	-	4	1618	c.1157C>A	c.(1156-1158)TCT>TAT	p.S386Y	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|INO80E_uc002dvg.1_5'Flank|INO80E_uc002dvh.1_5'Flank|INO80E_uc002dvi.1_5'Flank|INO80E_uc002dvj.1_5'Flank|INO80E_uc002dvk.1_5'Flank|HIRIP3_uc002dvf.2_Intron	NM_003609	NP_003600	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3	386					chromatin assembly or disassembly	nucleus	protein binding			central_nervous_system(1)	1																		---	---	---	---
SRCAP	10847	broad.mit.edu	37	16	30724913	30724913	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30724913T>A	uc002dze.1	+	16	2759	c.2374T>A	c.(2374-2376)TTG>ATG	p.L792M	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.L649M|SRCAP_uc010bzz.1_Missense_Mutation_p.L362M	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	792	Helicase ATP-binding.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)															---	---	---	---
SRCAP	10847	broad.mit.edu	37	16	30724914	30724914	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30724914T>A	uc002dze.1	+	16	2760	c.2375T>A	c.(2374-2376)TTG>TAG	p.L792*	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Nonsense_Mutation_p.L649*|SRCAP_uc010bzz.1_Nonsense_Mutation_p.L362*	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	792	Helicase ATP-binding.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)															---	---	---	---
MBTPS1	8720	broad.mit.edu	37	16	84093007	84093007	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84093007C>G	uc002fhi.2	-	21	3233	c.2731G>C	c.(2731-2733)GTT>CTT	p.V911L	MBTPS1_uc002fhh.2_Missense_Mutation_p.V415L	NM_003791	NP_003782	Q14703	MBTP1_HUMAN	membrane-bound transcription factor site-1	911	Lumenal (Potential).				cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	T	T	rs28934578		TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578406C>T	uc002gim.2	-	5	718	c.524G>A	c.(523-525)CGC>CAC	p.R175H	TP53_uc002gig.1_Missense_Mutation_p.R175H|TP53_uc002gih.2_Missense_Mutation_p.R175H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R43H|TP53_uc010cng.1_Missense_Mutation_p.R43H|TP53_uc002gii.1_Missense_Mutation_p.R43H|TP53_uc010cnh.1_Missense_Mutation_p.R175H|TP53_uc010cni.1_Missense_Mutation_p.R175H|TP53_uc002gij.2_Missense_Mutation_p.R175H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R82H|TP53_uc002gio.2_Missense_Mutation_p.R43H|TP53_uc010vug.1_Missense_Mutation_p.R136H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	175	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R175H(729)|p.R175L(19)|p.R175C(12)|p.R175G(11)|p.0?(7)|p.R175P(5)|p.R175S(5)|p.R43H(5)|p.R82H(5)|p.R175R(4)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.R175fs*5(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R175fs*72(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(HCC1395_BREAST)|R175H(KLE_ENDOMETRIUM)|R175H(NCIH196_LUNG)|R175H(AU565_BREAST)|R175H(TYKNU_OVARY)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(SKUT1_SOFT_TISSUE)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(LS123_LARGE_INTESTINE)|R175H(SKBR3_BREAST)|R175H(RKN_OVARY)|R175H(HUCCT1_BILIARY_TRACT)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
CHD3	1107	broad.mit.edu	37	17	7796691	7796691	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7796691C>A	uc002gje.2	+	5	747	c.597C>A	c.(595-597)AAC>AAA	p.N199K	CHD3_uc002gjd.2_Missense_Mutation_p.N258K|CHD3_uc002gjf.2_Missense_Mutation_p.N199K|CHD3_uc002gjg.1_Missense_Mutation_p.N31K	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	199					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)																---	---	---	---
ZNF624	57547	broad.mit.edu	37	17	16526006	16526006	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16526006C>G	uc010cpi.1	-	6	2277	c.2194G>C	c.(2194-2196)GCA>CCA	p.A732P		NM_020787	NP_065838	Q9P2J8	ZN624_HUMAN	zinc finger protein 624	732	C2H2-type 17.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)														---	---	---	---
DSG1	1828	broad.mit.edu	37	18	28919897	28919897	+	Silent	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28919897C>T	uc002kwp.2	+	11	1808	c.1596C>T	c.(1594-1596)CCC>CCT	p.P532P		NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	532	Extracellular (Potential).				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)															---	---	---	---
SERPINB2	5055	broad.mit.edu	37	18	61564457	61564457	+	Intron	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61564457A>G	uc010xeu.1	+						SERPINB2_uc002ljo.2_Intron|SERPINB2_uc010dqh.2_Intron|SERPINB2_uc002ljp.1_Intron|SERPINB2_uc002ljq.1_Intron	NM_001143818	NP_001137290			serine (or cysteine) proteinase inhibitor, clade						anti-apoptosis|blood coagulation|fibrinolysis|regulation of proteolysis	extracellular space|Golgi apparatus|plasma membrane	serine-type endopeptidase inhibitor activity			lung(1)|skin(1)	2		Esophageal squamous(42;0.131)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)													---	---	---	---
ATP8B3	148229	broad.mit.edu	37	19	1802511	1802511	+	Silent	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1802511G>A	uc002ltw.2	-	11	1272	c.1038C>T	c.(1036-1038)ACC>ACT	p.T346T	ATP8B3_uc002ltv.2_Silent_p.T293T|ATP8B3_uc002ltx.2_RNA|ATP8B3_uc002lty.1_Silent_p.T94T|ATP8B3_uc002ltz.1_Silent_p.T293T	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3	346	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
VAV1	7409	broad.mit.edu	37	19	6821677	6821677	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6821677G>C	uc002mfu.1	+	3	463	c.366G>C	c.(364-366)CAG>CAC	p.Q122H	VAV1_uc010xjh.1_Missense_Mutation_p.Q122H|VAV1_uc010dva.1_Missense_Mutation_p.Q122H|VAV1_uc002mfv.1_Missense_Mutation_p.Q67H	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	122					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16																		---	---	---	---
ZNF628	89887	broad.mit.edu	37	19	55992892	55992892	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55992892G>A	uc002qld.2	+	3	885	c.320G>A	c.(319-321)CGT>CAT	p.R107H		NM_033113	NP_149104	Q5EBL2	ZN628_HUMAN	zinc finger protein 628	107	C2H2-type 3.					nucleus	DNA binding|zinc ion binding				0	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)														---	---	---	---
PHF20	51230	broad.mit.edu	37	20	34505405	34505405	+	Splice_Site	SNP	G	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34505405G>C	uc002xek.1	+	13	1937	c.1826_splice	c.e13-1	p.E609_splice		NM_016436	NP_057520			PHD finger protein 20						regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)																	---	---	---	---
DHX35	60625	broad.mit.edu	37	20	37631501	37631501	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37631501T>C	uc002xjh.2	+	10	853	c.842T>C	c.(841-843)CTT>CCT	p.L281P	DHX35_uc010zwa.1_Missense_Mutation_p.L126P|DHX35_uc010zwb.1_Missense_Mutation_p.L126P|DHX35_uc010zwc.1_Missense_Mutation_p.L250P	NM_021931	NP_068750	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	281	Helicase C-terminal.					catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)																---	---	---	---
C20orf108	116151	broad.mit.edu	37	20	54940282	54940282	+	Nonsense_Mutation	SNP	T	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54940282T>G	uc002xxc.2	+	2	405	c.326T>G	c.(325-327)TTA>TGA	p.L109*		NM_080821	NP_543011	Q96KR6	CT108_HUMAN	hypothetical protein LOC116151	109	DUF1279.|Helical; (Potential).					integral to membrane					0			Colorectal(105;0.202)															---	---	---	---
MX2	4600	broad.mit.edu	37	21	42749876	42749876	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42749876C>T	uc002yzf.1	+	3	514	c.410C>T	c.(409-411)GCA>GTA	p.A137V	MX2_uc011aer.1_RNA	NM_002463	NP_002454	P20592	MX2_HUMAN	myxovirus resistance protein 2	137					response to virus|type I interferon-mediated signaling pathway	cytoplasm|nucleus	GTP binding|GTPase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)																---	---	---	---
U2AF1	7307	broad.mit.edu	37	21	44524489	44524489	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44524489T>C	uc002zda.1	-	2	152	c.68A>G	c.(67-69)AAA>AGA	p.K23R	U2AF1_uc002zcy.1_5'UTR|U2AF1_uc002zcz.1_5'UTR|U2AF1_uc002zdb.1_Missense_Mutation_p.K23R|U2AF1_uc010gpi.1_Missense_Mutation_p.K23R|U2AF1_uc002zdc.1_Missense_Mutation_p.K23R	NM_001025203	NP_001020374	Q01081	U2AF1_HUMAN	U2 small nuclear RNA auxillary factor 1 isoform	23	C3H1-type 1.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	Cajal body|catalytic step 2 spliceosome|nuclear speck	nucleotide binding|RNA binding|zinc ion binding				0																		---	---	---	---
DIP2A	23181	broad.mit.edu	37	21	47965118	47965118	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47965118T>C	uc002zjo.2	+	19	2428	c.2245T>C	c.(2245-2247)TGC>CGC	p.C749R	DIP2A_uc011afy.1_Missense_Mutation_p.C685R|DIP2A_uc011afz.1_Missense_Mutation_p.C745R|DIP2A_uc002zjl.2_Missense_Mutation_p.C749R|DIP2A_uc002zjm.2_Missense_Mutation_p.C749R|DIP2A_uc010gql.2_Missense_Mutation_p.C706R|DIP2A_uc002zjn.2_Missense_Mutation_p.C749R|DIP2A_uc002zjp.1_Missense_Mutation_p.C494R|DIP2A_uc002zjq.2_Missense_Mutation_p.C141R	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a	749					multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)														---	---	---	---
UPB1	51733	broad.mit.edu	37	22	24921737	24921737	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24921737A>G	uc003aaf.2	+	10	1251	c.1130A>G	c.(1129-1131)TAC>TGC	p.Y377C	UPB1_uc003aae.2_Missense_Mutation_p.Y309C|UPB1_uc011ajt.1_Missense_Mutation_p.Y377C	NM_016327	NP_057411	Q9UBR1	BUP1_HUMAN	beta-ureidopropionase	377					pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol	beta-ureidopropionase activity|metal ion binding			ovary(2)	2	Colorectal(2;0.0339)															OREG0026412	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
CRYBB1	1414	broad.mit.edu	37	22	26995611	26995611	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26995611T>C	uc003acy.1	-	6	672	c.602A>G	c.(601-603)TAC>TGC	p.Y201C		NM_001887	NP_001878	P53674	CRBB1_HUMAN	crystallin, beta B1	201	Beta/gamma crystallin 'Greek key' 4.				visual perception		structural constituent of eye lens			ovary(1)	1																		---	---	---	---
APOBEC3F	200316	broad.mit.edu	37	22	39440131	39440131	+	Intron	SNP	G	A	A			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39440131G>A	uc003aww.2	+						APOBEC3F_uc003awv.2_Missense_Mutation_p.S72N|APOBEC3F_uc011aog.1_Intron	NM_145298	NP_660341			apolipoprotein B mRNA editing enzyme, catalytic						base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding				0	Melanoma(58;0.04)																	---	---	---	---
FAM9B	171483	broad.mit.edu	37	X	8998358	8998358	+	Silent	SNP	A	G	G			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8998358A>G	uc011mhu.1	-	4	314	c.225T>C	c.(223-225)ACT>ACC	p.T75T	FAM9B_uc011mhv.1_RNA|FAM9B_uc004csh.2_Intron	NM_205849	NP_995321	Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B	75						nucleus					0		Hepatocellular(5;0.219)																---	---	---	---
XIST	7503	broad.mit.edu	37	X	73065227	73065227	+	RNA	SNP	G	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73065227G>T	uc004ebm.1	-	1		c.7362C>A				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0																		---	---	---	---
PCDH11X	27328	broad.mit.edu	37	X	91132700	91132700	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91132700A>C	uc004efk.1	+	2	2306	c.1461A>C	c.(1459-1461)AAA>AAC	p.K487N	PCDH11X_uc004efl.1_Missense_Mutation_p.K487N|PCDH11X_uc004efo.1_Missense_Mutation_p.K487N|PCDH11X_uc010nmv.1_Missense_Mutation_p.K487N|PCDH11X_uc004efm.1_Missense_Mutation_p.K487N|PCDH11X_uc004efn.1_Missense_Mutation_p.K487N|PCDH11X_uc004efh.1_Missense_Mutation_p.K487N|PCDH11X_uc004efj.1_Missense_Mutation_p.K487N	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	487	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2																		---	---	---	---
GABRQ	55879	broad.mit.edu	37	X	151815585	151815585	+	Silent	SNP	C	T	T			TCGA-BR-4194-01A-02D-1126-08	TCGA-BR-4194-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151815585C>T	uc004ffp.1	+	4	503	c.483C>T	c.(481-483)CGC>CGT	p.R161R		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	161	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
