Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
GNB1	2782	broad.mit.edu	37	1	1806636	1806636	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1806636delT	uc001aif.2	-						GNB1_uc009vky.2_Intron	NM_002074	NP_002065			guanine nucleotide-binding protein, beta-1						cellular response to glucagon stimulus|energy reserve metabolic process|muscarinic acetylcholine receptor signaling pathway|platelet activation|Ras protein signal transduction|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|GTPase binding|signal transducer activity				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	2623748	2623749	+	IGR	INS	-	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2623748_2623749insG								MMEL1 (59267 upstream) : ACTRT2 (314297 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	2624143	2624144	+	IGR	INS	-	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2624143_2624144insC								MMEL1 (59662 upstream) : ACTRT2 (313902 downstream)																																			---	---	---	---
PRDM16	63976	broad.mit.edu	37	1	3097658	3097669	+	Intron	DEL	ACACGCAGTCTT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3097658_3097669delACACGCAGTCTT	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397			PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)				T	EVI1	MDS|AML								---	---	---	---
AJAP1	55966	broad.mit.edu	37	1	4813139	4813141	+	Intron	DEL	CTC	-	-	rs141619940		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4813139_4813141delCTC	uc001alm.1	+						AJAP1_uc001aln.2_Intron	NM_001042478	NP_001035943			adherens junction associated protein 1						cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	4897609	4897609	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4897609delT								AJAP1 (53759 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5571703	5571704	+	IGR	DEL	GA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5571703_5571704delGA								AJAP1 (727853 upstream) : NPHP4 (351166 downstream)																																			---	---	---	---
NPHP4	261734	broad.mit.edu	37	1	5930697	5930697	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5930697delA	uc001alq.1	-						NPHP4_uc001alr.1_5'Flank	NM_015102	NP_055917			nephroretinin						actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
ESPN	83715	broad.mit.edu	37	1	6500068	6500069	+	Intron	INS	-	A	A	rs139188385	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6500068_6500069insA	uc001amy.2	+							NM_031475	NP_113663			espin						sensory perception of sound	brush border|cytoplasm|filamentous actin|stereocilium	actin filament binding|SH3 domain binding				0	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7559238	7559239	+	Intron	INS	-	TGAG	TGAG	rs146786337	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7559238_7559239insTGAG	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7816185	7816185	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7816185delT	uc001aoi.2	+						CAMTA1_uc001aok.3_Intron|CAMTA1_uc001aoj.2_Intron|CAMTA1_uc009vmf.2_Intron	NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
UTS2	10911	broad.mit.edu	37	1	7906859	7906860	+	Intron	INS	-	AAGA	AAGA	rs141522407	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7906859_7906860insAAGA	uc001aoq.2	-							NM_006786	NP_006777			urotensin 2 isoform b preproprotein						muscle contraction|regulation of blood pressure|synaptic transmission	extracellular space	hormone activity				0	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)														---	---	---	---
RERE	473	broad.mit.edu	37	1	8532915	8532916	+	Intron	DEL	TT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8532915_8532916delTT	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc010nzx.1_Intron|RERE_uc001aph.1_Intron	NM_012102	NP_036234			atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)														---	---	---	---
KIF1B	23095	broad.mit.edu	37	1	10288422	10288422	+	Intron	DEL	A	-	-	rs71571897		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10288422delA	uc001aqx.3	+						KIF1B_uc001aqv.3_Intron|KIF1B_uc001aqw.3_Intron|KIF1B_uc009vmt.2_Intron	NM_015074	NP_055889			kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	10990336	10990338	+	IGR	DEL	GGC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10990336_10990338delGGC								CASZ1 (133629 upstream) : C1orf127 (16195 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	11440106	11440106	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11440106delC								UBIAD1 (91616 upstream) : PTCHD2 (99189 downstream)																																			---	---	---	---
PRAMEF11	440560	broad.mit.edu	37	1	12891097	12891097	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12891097delG	uc001auk.2	-							NM_001146344	NP_001139816			PRAME family member 11												0																		---	---	---	---
PRDM2	7799	broad.mit.edu	37	1	14147539	14147540	+	Intron	INS	-	G	G	rs143034853	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14147539_14147540insG	uc001avi.2	+						PRDM2_uc001avg.2_Intron|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron|PRDM2_uc001avl.1_RNA	NM_012231	NP_036363			retinoblastoma protein-binding zinc finger							Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	14290255	14290258	+	IGR	DEL	TGTG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14290255_14290258delTGTG								PRDM2 (138683 upstream) : KAZ (634955 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	16548352	16548355	+	IGR	DEL	GGAT	-	-	rs144038097		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16548352_16548355delGGAT								ARHGEF19 (9248 upstream) : C1orf89 (9828 downstream)																																			---	---	---	---
CROCCL1	84809	broad.mit.edu	37	1	16965449	16965449	+	Intron	DEL	A	-	-	rs141730973		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16965449delA	uc001azg.1	-						CROCCL1_uc001azi.1_Intron|uc001azj.1_Intron					Homo sapiens mRNA for FLJ00313 protein.												0																		---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17195763	17195763	+	Intron	DEL	A	-	-	rs68102505		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17195763delA	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17229298	17229303	+	Intron	DEL	ATAATA	-	-	rs77418498		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17229298_17229303delATAATA	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17229819	17229820	+	Intron	INS	-	A	A	rs147278844		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17229819_17229820insA	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17262523	17262523	+	Intron	DEL	C	-	-	rs71575803		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17262523delC	uc001azt.2	+						CROCC_uc009voy.1_Intron|CROCC_uc009voz.1_Intron	NM_014675	NP_055490			ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	17344356	17344356	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17344356delT								ATP13A2 (5933 upstream) : SDHB (871 downstream)																																			---	---	---	---
IGSF21	84966	broad.mit.edu	37	1	18453699	18453699	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18453699delC	uc001bau.1	+							NM_032880	NP_116269			immunoglobin superfamily, member 21 precursor							extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)														---	---	---	---
IGSF21	84966	broad.mit.edu	37	1	18616355	18616355	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18616355delA	uc001bau.1	+							NM_032880	NP_116269			immunoglobin superfamily, member 21 precursor							extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)														---	---	---	---
UBR4	23352	broad.mit.edu	37	1	19441689	19441692	+	Intron	DEL	ACAT	-	-	rs71577815		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19441689_19441692delACAT	uc001bbi.2	-						UBR4_uc001bbj.1_Intron	NM_020765	NP_065816			retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	20786033	20786034	+	IGR	INS	-	TCT	TCT	rs143595977	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20786033_20786034insTCT								VWA5B1 (104646 upstream) : CAMK2N1 (22851 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	21676454	21676454	+	IGR	DEL	T	-	-	rs5772944		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21676454delT								ECE1 (4420 upstream) : NBPF3 (90177 downstream)																																			---	---	---	---
RAP1GAP	5909	broad.mit.edu	37	1	21935885	21935885	+	Intron	DEL	A	-	-	rs34097078		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21935885delA	uc001bex.2	-						RAP1GAP_uc001bev.2_Intron|RAP1GAP_uc001bew.2_Intron|RAP1GAP_uc001bey.2_Intron	NM_002885	NP_002876			RAP1 GTPase activating protein isoform c						regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding			breast(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)														---	---	---	---
EPHB2	2048	broad.mit.edu	37	1	23050745	23050746	+	Intron	DEL	GC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23050745_23050746delGC	uc009vqj.1	+						EPHB2_uc001bge.2_Intron|EPHB2_uc001bgf.2_Intron|EPHB2_uc010odu.1_Intron	NM_017449	NP_059145			ephrin receptor EphB2 isoform 1 precursor						axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)										Hereditary_Prostate_Cancer				---	---	---	---
Unknown	0	broad.mit.edu	37	1	23304865	23304866	+	IGR	INS	-	A	A	rs35966732		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23304865_23304866insA								EPHB2 (63043 upstream) : KDM1A (41075 downstream)																																			---	---	---	---
ASAP3	55616	broad.mit.edu	37	1	23771987	23771987	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23771987delA	uc001bha.2	-						ASAP3_uc010odz.1_Intron|ASAP3_uc010oea.1_Intron|ASAP3_uc001bhc.1_Intron	NM_017707	NP_060177			ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	cytoplasm	ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
CATSPER4	378807	broad.mit.edu	37	1	26528181	26528182	+	Intron	INS	-	T	T	rs34161386		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26528181_26528182insT	uc010oez.1	+						CATSPER4_uc009vsf.2_Intron	NM_198137	NP_937770			cation channel, sperm associated 4						cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
WDTC1	23038	broad.mit.edu	37	1	27600312	27600313	+	Intron	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27600312_27600313delGT	uc009vst.2	+						WDTC1_uc001bno.2_Intron|WDTC1_uc001bnp.1_Intron	NM_015023	NP_055838			WD and tetratricopeptide repeats 1								protein binding			ovary(1)|central_nervous_system(1)	2		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)														---	---	---	---
WASF2	10163	broad.mit.edu	37	1	27743951	27743952	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27743951_27743952delAC	uc001bof.1	-						WASF2_uc010ofl.1_Intron	NM_006990	NP_008921			WAS protein family, member 2						actin cytoskeleton organization|G-protein signaling, coupled to cAMP nucleotide second messenger	actin cytoskeleton|lamellipodium	actin binding			skin(2)|ovary(1)	3		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)														---	---	---	---
C1orf38	9473	broad.mit.edu	37	1	28213033	28213033	+	3'UTR	DEL	G	-	-	rs66904929		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28213033delG	uc001bpc.3	+	6					C1orf38_uc001boz.2_3'UTR|C1orf38_uc001bpa.2_3'UTR|C1orf38_uc010ofn.1_3'UTR|C1orf38_uc010ofo.1_3'UTR	NM_001105556	NP_001099026			basement membrane-induced gene isoform 3						cell adhesion|inflammatory response					ovary(1)	1		Colorectal(325;3.46e-05)|all_lung(284;0.000129)|Lung NSC(340;0.000259)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;2.52e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	28610766	28610766	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28610766delT								SESN2 (1765 upstream) : MED18 (44747 downstream)																																			---	---	---	---
PTPRU	10076	broad.mit.edu	37	1	29619327	29619328	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29619327_29619328insT	uc001bru.2	+						PTPRU_uc001brv.2_Intron|PTPRU_uc001brw.2_Intron|PTPRU_uc009vtq.2_Intron|PTPRU_uc009vtr.2_Intron	NM_005704	NP_005695			protein tyrosine phosphatase, receptor type, U						canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	30992175	30992176	+	IGR	INS	-	ATA	ATA	rs148490964	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30992175_30992176insATA								None (None upstream) : MATN1 (191950 downstream)																																			---	---	---	---
TINAGL1	64129	broad.mit.edu	37	1	32042447	32042447	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32042447delC	uc001bta.2	+						TINAGL1_uc001bsz.2_Intron|TINAGL1_uc010ogi.1_Intron|TINAGL1_uc010ogj.1_Intron|TINAGL1_uc010ogk.1_5'Flank	NM_022164	NP_071447			tubulointerstitial nephritis antigen-like 1						endosome transport|immune response|proteolysis	extracellular region	cysteine-type endopeptidase activity|extracellular matrix structural constituent|polysaccharide binding|scavenger receptor activity				0		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	32361083	32361083	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32361083delA								SPOCD1 (79503 upstream) : PTP4A2 (12710 downstream)																																			---	---	---	---
LCK	3932	broad.mit.edu	37	1	32738451	32738452	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32738451_32738452delTG	uc001bux.2	+						LCK_uc001buy.2_5'Flank|LCK_uc001buz.2_5'Flank|LCK_uc010ohc.1_5'Flank|LCK_uc001bva.2_5'Flank	NM_005356	NP_005347			lymphocyte-specific protein tyrosine kinase						activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding			lung(3)|central_nervous_system(2)|ovary(1)	6		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)			T	TRB@	T-ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	1	35286850	35286851	+	IGR	INS	-	A	A	rs138569055		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35286850_35286851insA								GJA4 (25504 upstream) : C1orf212 (32273 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	35583843	35583843	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35583843delA								ZMYM1 (2389 upstream) : SFPQ (58139 downstream)																																			---	---	---	---
KIAA0319L	79932	broad.mit.edu	37	1	35918427	35918430	+	Intron	DEL	CAAA	-	-	rs34021272		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35918427_35918430delCAAA	uc001byx.2	-						KIAA0319L_uc001byw.2_Intron|KIAA0319L_uc010ohv.1_Intron	NM_024874	NP_079150			dyslexia susceptibility 2-like							cytoplasmic vesicle part|integral to membrane	protein binding			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
KIAA0319L	79932	broad.mit.edu	37	1	35997842	35997842	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35997842delA	uc001byx.2	-						KIAA0319L_uc010ohw.1_Intron|KIAA0319L_uc001byz.2_Intron|KIAA0319L_uc010ohx.1_Intron	NM_024874	NP_079150			dyslexia susceptibility 2-like							cytoplasmic vesicle part|integral to membrane	protein binding			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	36389915	36389915	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36389915delT	uc001bzm.1	+											Homo sapiens cDNA: FLJ22073 fis, clone HEP11868.																														---	---	---	---
EIF2C3	192669	broad.mit.edu	37	1	36408611	36408611	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36408611delT	uc001bzp.2	+						EIF2C3_uc001bzn.1_Intron|EIF2C3_uc001bzo.2_Intron|EIF2C3_uc001bzq.2_Intron	NM_024852	NP_079128			eukaryotic translation initiation factor 2C, 3						mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
GRIK3	2899	broad.mit.edu	37	1	37274753	37274754	+	Intron	INS	-	CCAT	CCAT	rs146616165	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37274753_37274754insCCAT	uc001caz.2	-						GRIK3_uc001cba.1_Intron	NM_000831	NP_000822			glutamate receptor, ionotropic, kainate 3						negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	37646403	37646403	+	IGR	DEL	T	-	-	rs78195844		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37646403delT								GRIK3 (146559 upstream) : ZC3H12A (293716 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	37692510	37692510	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37692510delC								GRIK3 (192666 upstream) : ZC3H12A (247609 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	37873696	37873696	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37873696delA								GRIK3 (373852 upstream) : ZC3H12A (66423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	38114379	38114380	+	IGR	INS	-	GCTGGGTCGGACTTTG	GCTGGGTCGGACTTTG	rs149163649	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38114379_38114380insGCTGGGTCGGACTTTG								RSPO1 (13888 upstream) : C1orf109 (32870 downstream)																																			---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39670940	39670941	+	Intron	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39670940_39670941delGT	uc010ois.1	+						MACF1_uc001cda.1_Intron|MACF1_uc010oit.1_Intron	NM_012090	NP_036222			microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	40297197	40297197	+	IGR	DEL	A	-	-	rs67783101		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40297197delA								BMP8B (42664 upstream) : TRIT1 (9511 downstream)																																			---	---	---	---
SCMH1	22955	broad.mit.edu	37	1	41651309	41651309	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41651309delT	uc001cgs.2	-						SCMH1_uc001cgr.2_Intron|SCMH1_uc001cgt.2_Intron|SCMH1_uc001cgq.2_Intron	NM_012236	NP_036368			sex comb on midleg 1 isoform 2						anatomical structure morphogenesis|gene silencing|multicellular organismal development|negative regulation of transcription, DNA-dependent		DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	41798727	41798727	+	IGR	DEL	A	-	-	rs66865202		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41798727delA								SCMH1 (90939 upstream) : EDN2 (145722 downstream)																																			---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	42372506	42372506	+	Intron	DEL	T	-	-	rs71784460		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42372506delT	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001chb.1_Intron	NM_024503	NP_078779			human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
GUCA2A	2980	broad.mit.edu	37	1	42632473	42632474	+	5'Flank	INS	-	GT	GT	rs140638678	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42632473_42632474insGT	uc001chd.1	-							NM_033553	NP_291031			guanylate cyclase activator 2A precursor						signal transduction	extracellular region	guanylate cyclase activator activity|hormone activity			pancreas(1)	1	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
EBNA1BP2	10969	broad.mit.edu	37	1	43728500	43728500	+	Intron	DEL	A	-	-	rs111450044		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43728500delA	uc001cio.2	-							NM_006824	NP_006815			EBNA1 binding protein 2 isoform 2						ribosome biogenesis	membrane fraction|nucleolus	protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)																---	---	---	---
KIAA0467	23334	broad.mit.edu	37	1	43910859	43910859	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43910859delA	uc001cjk.1	+						KIAA0467_uc001cjl.1_5'Flank	NM_015284	NP_056099			hypothetical protein LOC23334							peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)																---	---	---	---
RNF220	55182	broad.mit.edu	37	1	44935232	44935233	+	Intron	INS	-	ATTC	ATTC	rs140890335	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44935232_44935233insATTC	uc001clv.1	+						RNF220_uc001clw.1_Intron|RNF220_uc010okx.1_Intron|RNF220_uc010oky.1_Intron	NM_018150	NP_060620			ring finger protein 220						protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
KIAA0494	9813	broad.mit.edu	37	1	47129732	47129732	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47129732delT	uc010omh.1	-						ATPAF1_uc001cqg.2_Intron|ATPAF1_uc009vyk.2_Intron|ATPAF1_uc010omg.1_Intron|ATPAF1_uc001cqh.2_Intron|ATPAF1_uc001cqi.2_Intron	NM_014774	NP_055589			hypothetical protein LOC9813								calcium ion binding				0	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	48125702	48125703	+	IGR	INS	-	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48125702_48125703insG								FOXD2 (219340 upstream) : SKINTL (441684 downstream)																																			---	---	---	---
AGBL4	84871	broad.mit.edu	37	1	49243807	49243808	+	Intron	INS	-	CATC	CATC	rs71915216		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49243807_49243808insCATC	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron|BEND5_uc001crx.3_5'Flank|BEND5_uc001crw.3_5'Flank	NM_032785	NP_116174			ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---
AGBL4	84871	broad.mit.edu	37	1	50263435	50263436	+	Intron	INS	-	T	T	rs113661742		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50263435_50263436insT	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron	NM_032785	NP_116174			ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---
ZFYVE9	9372	broad.mit.edu	37	1	52757955	52757955	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52757955delA	uc001cto.2	+						ZFYVE9_uc001ctp.2_Intron	NM_004799	NP_004790			zinc finger, FYVE domain containing 9 isoform 3						endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8																		---	---	---	---
TMEM48	55706	broad.mit.edu	37	1	54250631	54250632	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54250631_54250632insA	uc001cvs.2	-						TMEM48_uc010onu.1_Intron|TMEM48_uc001cvt.2_Intron|TMEM48_uc009vzk.2_Intron|TMEM48_uc010onv.1_Intron	NM_018087	NP_060557			transmembrane protein 48						mRNA transport|nuclear pore complex assembly|nuclear pore distribution|protein transport|transmembrane transport	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore			ovary(1)|pancreas(1)	2																		---	---	---	---
YIPF1	54432	broad.mit.edu	37	1	54349908	54349908	+	Intron	DEL	A	-	-	rs141078021		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54349908delA	uc001cvu.2	-						YIPF1_uc001cvv.2_Intron|YIPF1_uc001cvw.2_Intron|YIPF1_uc001cvx.2_Intron|YIPF1_uc001cvy.2_Intron	NM_018982	NP_061855			Yip1 domain family, member 1							integral to membrane|transport vesicle				large_intestine(1)|ovary(1)	2																		---	---	---	---
AK3L1	205	broad.mit.edu	37	1	65620536	65620536	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65620536delT	uc001dby.2	+						AK3L1_uc009wan.2_Intron|AK3L1_uc001dbz.2_Intron|AK3L1_uc001dca.2_Intron	NM_203464	NP_982289			adenylate kinase 3-like 1 isoform 7							mitochondrial matrix	adenylate kinase activity|ATP binding|GTP binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	66239042	66239043	+	IGR	INS	-	A	A	rs56821280		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66239042_66239043insA								LEPR (136222 upstream) : PDE4B (19150 downstream)																																			---	---	---	---
SLC35D1	23169	broad.mit.edu	37	1	67487400	67487401	+	Intron	DEL	AG	-	-	rs72407410		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67487400_67487401delAG	uc001ddk.2	-						SLC35D1_uc010oph.1_Intron	NM_015139	NP_055954			solute carrier family 35 (UDP-glucuronic						chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)													---	---	---	---
C1orf141	400757	broad.mit.edu	37	1	67580177	67580177	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67580177delA	uc001ddl.1	-						C1orf141_uc001ddm.1_Intron|C1orf141_uc001ddn.1_Intron	NM_001013674	NP_001013696			hypothetical protein LOC400757											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	69191061	69191061	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:69191061delA								DEPDC1 (228262 upstream) : LRRC7 (841807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	69233607	69233608	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:69233607_69233608insT								DEPDC1 (270808 upstream) : LRRC7 (799260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	75326674	75326675	+	IGR	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75326674_75326675delAG								TYW3 (94316 upstream) : LHX8 (267444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	76533087	76533087	+	IGR	DEL	A	-	-	rs71588863		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76533087delA								ASB17 (134971 upstream) : ST6GALNAC3 (7302 downstream)																																			---	---	---	---
ST6GALNAC3	256435	broad.mit.edu	37	1	76567921	76567922	+	Intron	DEL	TG	-	-	rs140522082		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76567921_76567922delTG	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541			sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	77741270	77741270	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77741270delA								PIGK (56138 upstream) : AK5 (6472 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	79925785	79925786	+	IGR	INS	-	AG	AG	rs150651524	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79925785_79925786insAG								ELTD1 (453290 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	83312792	83312792	+	IGR	DEL	A	-	-	rs79504367		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:83312792delA								LPHN2 (854686 upstream) : None (None downstream)																																			---	---	---	---
MCOLN2	255231	broad.mit.edu	37	1	85448948	85448952	+	Intron	DEL	TTTTC	-	-	rs36220160		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85448948_85448952delTTTTC	uc001dkm.2	-						MCOLN2_uc001dkn.2_Intron	NM_153259	NP_694991			mucolipin 2							integral to membrane	ion channel activity			ovary(3)|upper_aerodigestive_tract(1)	4				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)														---	---	---	---
CLCA4	22802	broad.mit.edu	37	1	87027767	87027768	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87027767_87027768delAC	uc009wcs.2	+						CLCA4_uc009wct.2_Intron|CLCA4_uc009wcu.2_Intron	NM_012128	NP_036260			chloride channel accessory 4							apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity			ovary(2)	2		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)														---	---	---	---
CCBL2	56267	broad.mit.edu	37	1	89435339	89435339	+	Intron	DEL	T	-	-	rs76474607		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89435339delT	uc001dmp.2	-						CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_Intron	NM_001008661	NP_001008661			kynurenine aminotransferase III isoform 1						biosynthetic process|kynurenine metabolic process|tryptophan catabolic process		cysteine-S-conjugate beta-lyase activity|kynurenine-glyoxylate transaminase activity|kynurenine-oxoglutarate transaminase activity|pyridoxal phosphate binding			ovary(1)	1		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)													---	---	---	---
LRRC8D	55144	broad.mit.edu	37	1	90376737	90376737	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90376737delT	uc001dnm.2	+						LRRC8D_uc001dnn.2_Intron	NM_001134479	NP_001127951			leucine rich repeat containing 8 family, member							integral to membrane	protein binding			ovary(2)	2		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	96929628	96929629	+	IGR	DEL	TG	-	-	rs142982541		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:96929628_96929629delTG								None (None upstream) : PTBP2 (257546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	97430858	97430858	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97430858delA								PTBP2 (150259 upstream) : DPYD (112444 downstream)																																			---	---	---	---
LPPR5	163404	broad.mit.edu	37	1	99430267	99430267	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99430267delT	uc001dsb.2	-						LPPR5_uc001dsc.2_Intron	NM_001037317	NP_001032394			phosphatidic acid phosphatase type 2d isoform 1							integral to membrane	hydrolase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	99474094	99474094	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99474094delA	uc001dsd.1	+											Homo sapiens cDNA FLJ38225 fis, clone FCBBF2003528.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	99692250	99692253	+	IGR	DEL	ACAA	-	-	rs140404256	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99692250_99692253delACAA								LPPR5 (221801 upstream) : LPPR4 (37647 downstream)																																			---	---	---	---
LPPR4	9890	broad.mit.edu	37	1	99760006	99760007	+	Intron	INS	-	T	T	rs138571304	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99760006_99760007insT	uc001dse.2	+						LPPR4_uc010oue.1_Intron	NM_014839	NP_055654			plasticity related gene 1								phosphatidate phosphatase activity			ovary(3)	3		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	101760162	101760162	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101760162delT								S1PR1 (53086 upstream) : OLFM3 (507965 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	105301992	105301993	+	IGR	INS	-	T	T	rs5776754		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:105301992_105301993insT								None (None upstream) : None (None downstream)																																			---	---	---	---
VAV3	10451	broad.mit.edu	37	1	108329603	108329604	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108329603_108329604delAC	uc001dvk.1	-						VAV3_uc010ouw.1_Intron|VAV3_uc001dvl.1_Intron|VAV3_uc010oux.1_Intron	NM_006113	NP_006104			vav 3 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	111394739	111394740	+	IGR	INS	-	CA	CA	rs142065304	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111394739_111394740insCA								KCNA3 (177084 upstream) : CD53 (19081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	111402143	111402144	+	IGR	INS	-	G	G	rs147684370	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111402143_111402144insG								KCNA3 (184488 upstream) : CD53 (11677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	112659196	112659196	+	IGR	DEL	T	-	-	rs5777093		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112659196delT								KCND3 (127419 upstream) : CTTNBP2NL (279604 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	113399554	113399555	+	IGR	INS	-	T	T	rs137987158		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113399554_113399555insT								FAM19A3 (129700 upstream) : SLC16A1 (54917 downstream)																																			---	---	---	---
SYCP1	6847	broad.mit.edu	37	1	115501551	115501551	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115501551delA	uc001efr.2	+						SYCP1_uc010owt.1_Intron|SYCP1_uc001efq.2_Intron|SYCP1_uc009wgw.2_Intron	NM_003176	NP_003167			synaptonemal complex protein 1						cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
SLC22A15	55356	broad.mit.edu	37	1	116560322	116560322	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116560322delA	uc001egb.3	+						SLC22A15_uc001ega.2_Intron	NM_018420	NP_060890			solute carrier family 22, member 15						ion transport	integral to membrane	transmembrane transporter activity			large_intestine(2)	2	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	118141595	118141596	+	IGR	DEL	CA	-	-	rs56678130	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118141595_118141596delCA								MAN1A2 (73275 upstream) : FAM46C (7008 downstream)																																			---	---	---	---
SPAG17	200162	broad.mit.edu	37	1	118612609	118612610	+	Intron	DEL	AT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118612609_118612610delAT	uc001ehk.2	-							NM_206996	NP_996879			sperm associated antigen 17							cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)														---	---	---	---
SPAG17	200162	broad.mit.edu	37	1	118626406	118626407	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118626406_118626407insA	uc001ehk.2	-							NM_206996	NP_996879			sperm associated antigen 17							cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	119002953	119002954	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119002953_119002954insT								SPAG17 (275105 upstream) : TBX15 (422712 downstream)																																			---	---	---	---
TBX15	6913	broad.mit.edu	37	1	119453032	119453034	+	Intron	DEL	TTG	-	-	rs71774983		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119453032_119453034delTTG	uc001ehl.1	-							NM_152380	NP_689593			T-box 15							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)	2	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	120357474	120357474	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120357474delT								REG4 (3271 upstream) : NBPF7 (19915 downstream)																																			---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120540661	120540665	+	Intron	DEL	ACTGT	-	-	rs66549190		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120540661_120540665delACTGT	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719			notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120613820	120613820	+	5'Flank	DEL	A	-	-	rs67234157		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120613820delA	uc001eik.2	-						NOTCH2_uc001eil.2_5'Flank|NOTCH2_uc001eim.3_5'Flank	NM_024408	NP_077719			notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	1	121110279	121110280	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121110279_121110280insT	uc001eis.2	+							NM_001042758	NP_001036223			SLIT-ROBO Rho GTPase activating protein 2																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	121352613	121352613	+	IGR	DEL	A	-	-	rs111583359		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121352613delA								LOC647121 (38927 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142585978	142585979	+	IGR	DEL	AT	-	-	rs113516449		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142585978_142585979delAT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142600806	142600806	+	IGR	DEL	G	-	-	rs71210538		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142600806delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142610761	142610761	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142610761delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142638708	142638708	+	Intron	DEL	T	-	-	rs71204428		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142638708delT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143142454	143142456	+	Intron	DEL	TTG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143142454_143142456delTTG	uc001eiw.1	+						uc001ejf.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143198188	143198188	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143198188delT	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143425098	143425099	+	5'Flank	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143425098_143425099insA	hsa-mir-3118-3|MI0014133	-						uc001ejn.1_RNA																																			---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144852792	144852793	+	Intron	DEL	TT	-	-	rs72112087		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144852792_144852793delTT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145107771	145107774	+	Intron	DEL	AAAT	-	-	rs67910942		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145107771_145107774delAAAT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	146471242	146471243	+	IGR	DEL	TC	-	-	rs72144902		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146471242_146471243delTC								NBPF10 (47147 upstream) : LOC728989 (19652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	146476728	146476729	+	IGR	DEL	AT	-	-	rs67696815		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146476728_146476729delAT								NBPF10 (52633 upstream) : LOC728989 (14166 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	147390631	147390633	+	IGR	DEL	AAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147390631_147390633delAAC								GJA8 (9238 upstream) : GPR89B (9873 downstream)																																			---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	148209383	148209383	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148209383delT	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc009wkf.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	148848203	148848205	+	IGR	DEL	TCA	-	-	rs144912987		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148848203_148848205delTCA								NBPF16 (89892 upstream) : LOC645166 (80081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	148848888	148848889	+	IGR	INS	-	TCATTTCATTTCA	TCATTTCATTTCA	rs138372357	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148848888_148848889insTCATTTCATTTCA								NBPF16 (90577 upstream) : LOC645166 (79397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	148898510	148898510	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148898510delG	uc009wkv.1	+											Homo sapiens cDNA, FLJ17483.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	149067109	149067109	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149067109delC								LOC645166 (114055 upstream) : LOC388692 (212367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149224579	149224579	+	IGR	DEL	T	-	-	rs67263328		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149224579delT								LOC645166 (271525 upstream) : LOC388692 (54897 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149227975	149227976	+	5'Flank	INS	-	C	C	rs144607986	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149227975_149227976insC	uc010pbe.1	+											Homo sapiens cDNA clone IMAGE:4734071, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	149291856	149291857	+	IGR	DEL	AG	-	-	rs149025778		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149291856_149291857delAG								LOC388692 (114 upstream) : FCGR1C (77437 downstream)																																			---	---	---	---
LOC728855	728855	broad.mit.edu	37	1	149601954	149601954	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149601954delT	uc001esk.3	+						LOC728855_uc001esl.3_Intron|LOC728855_uc009wlc.2_Intron|LOC728855_uc009wld.2_Intron	NR_024510				Homo sapiens mRNA, chromosome 1 specific transcript KIAA0493.												0																		---	---	---	---
GABPB2	126626	broad.mit.edu	37	1	151073567	151073567	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151073567delA	uc001ewr.2	+						GABPB2_uc010pcp.1_Intron|GABPB2_uc001ews.2_Intron|GABPB2_uc001ewt.2_Intron	NM_144618	NP_653219			GA repeat binding protein, beta 2						positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	protein heterodimerization activity|transcription regulatory region DNA binding				0				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)														---	---	---	---
CGN	57530	broad.mit.edu	37	1	151499879	151499879	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151499879delG	uc009wmw.2	+							NM_020770	NP_065821			cingulin							myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	152169856	152169859	+	IGR	DEL	TCTT	-	-	rs138883689		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152169856_152169859delTCTT								RPTN (38152 upstream) : HRNR (14699 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	152952307	152952308	+	IGR	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152952307_152952308delTC								SPRR4 (7238 upstream) : SPRR1A (4249 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	153692341	153692341	+	IGR	DEL	A	-	-	rs143566368		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153692341delA								NPR1 (25874 upstream) : INTS3 (8208 downstream)																																			---	---	---	---
NUP210L	91181	broad.mit.edu	37	1	154017250	154017250	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154017250delA	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191			nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	154265991	154265992	+	IGR	INS	-	AT	AT	rs140076178	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154265991_154265992insAT								HAX1 (17642 upstream) : AQP10 (27600 downstream)																																			---	---	---	---
OR10J5	127385	broad.mit.edu	37	1	159507846	159507847	+	5'Flank	DEL	CA	-	-	rs72254952		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159507846_159507847delCA	uc010piw.1	-							NM_001004469	NP_001004469			olfactory receptor, family 10, subfamily J,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_hematologic(112;0.0429)																	---	---	---	---
ATF6	22926	broad.mit.edu	37	1	161774469	161774469	+	Intron	DEL	T	-	-	rs34697417		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161774469delT	uc001gbr.2	+						ATF6_uc001gbq.1_Intron	NM_007348	NP_031374			activating transcription factor 6						positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)															---	---	---	---
NOS1AP	9722	broad.mit.edu	37	1	162274570	162274571	+	Intron	INS	-	TG	TG	rs142219781	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162274570_162274571insTG	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512			nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	163539432	163539433	+	IGR	INS	-	T	T	rs77892005		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163539432_163539433insT								NUF2 (213879 upstream) : PBX1 (989369 downstream)																																			---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164773891	164773893	+	Intron	DEL	AGC	-	-	rs77778459		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164773891_164773893delAGC	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
UCK2	7371	broad.mit.edu	37	1	165812460	165812460	+	Intron	DEL	T	-	-	rs78283359		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165812460delT	uc001gdp.2	+						UCK2_uc010plb.1_Intron	NM_012474	NP_036606			uridine-cytidine kinase 2						pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|phosphotransferase activity, alcohol group as acceptor|uridine kinase activity			ovary(1)	1	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	166804811	166804812	+	IGR	INS	-	CTT	CTT	rs142378471	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166804811_166804812insCTT								FMO9P (210340 upstream) : POGK (3912 downstream)																																			---	---	---	---
POU2F1	5451	broad.mit.edu	37	1	167365924	167365925	+	Intron	DEL	AC	-	-	rs34119749		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167365924_167365925delAC	uc001gec.2	+						POU2F1_uc001ged.2_Intron|POU2F1_uc001gee.2_Intron|POU2F1_uc010plh.1_Intron|POU2F1_uc001gef.2_Intron|POU2F1_uc001geg.2_Intron|POU2F1_uc009wvg.1_5'Flank	NM_002697	NP_002688			POU class 2 homeobox 1						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	168712064	168712064	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168712064delA								DPT (13636 upstream) : MGC4473 (44115 downstream)																																			---	---	---	---
NME7	29922	broad.mit.edu	37	1	169207716	169207717	+	Intron	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169207716_169207717delCA	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron	NM_013330	NP_037462			nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)																	---	---	---	---
NME7	29922	broad.mit.edu	37	1	169321208	169321208	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169321208delT	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron|NME7_uc001gfv.1_Intron	NM_013330	NP_037462			nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	170055841	170055842	+	IGR	INS	-	TTCC	TTCC	rs71772416		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170055841_170055842insTTCC								KIFAP3 (11962 upstream) : METTL11B (59346 downstream)																																			---	---	---	---
TNFSF4	7292	broad.mit.edu	37	1	173165573	173165574	+	Intron	DEL	TC	-	-	rs72190735		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173165573_173165574delTC	uc001giw.2	-						TNFSF4_uc001giv.2_Intron	NM_003326	NP_003317			tumor necrosis factor (ligand) superfamily,						acute inflammatory response|cellular response to lipopolysaccharide|cellular response to prostaglandin E stimulus|chemokine (C-C motif) ligand 11 production|defense response to nematode|interleukin-4-dependent isotype switching to IgE isotypes|memory T cell activation|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of regulatory T cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T-helper 1 cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of alpha-beta T cell proliferation|positive regulation of B cell activation|positive regulation of immunoglobulin mediated immune response|positive regulation of immunoglobulin secretion|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-6 production|positive regulation of memory T cell differentiation|positive regulation of T cell cytokine production|positive regulation of T-helper 2 cell differentiation|positive regulation of type 2 immune response|response to virus|signal transduction|T-helper 2 cell activation	cell surface|extracellular space|integral to plasma membrane	cytokine activity			central_nervous_system(1)	1																		---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174341836	174341836	+	Intron	DEL	T	-	-	rs74128374	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174341836delT	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjy.2_Intron|RABGAP1L_uc001gjz.2_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174745638	174745641	+	Intron	DEL	CAAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174745638_174745641delCAAA	uc001gjx.2	+						RABGAP1L_uc001gkb.3_Intron|RABGAP1L_uc001gkc.3_Intron|RABGAP1L_uc001gkd.3_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
TNR	7143	broad.mit.edu	37	1	175552916	175552916	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175552916delC	uc009wwu.1	-						TNR_uc010pmz.1_Intron	NM_003285	NP_003276			tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)																	---	---	---	---
RFWD2	64326	broad.mit.edu	37	1	176114526	176114531	+	Intron	DEL	ATGCCT	-	-	rs139435728		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176114526_176114531delATGCCT	uc001gku.1	-						RFWD2_uc001gkv.1_Intron|RFWD2_uc001gkw.1_Intron|RFWD2_uc009wwv.2_Intron|RFWD2_uc001gkt.1_Intron	NM_022457	NP_071902			ring finger and WD repeat domain 2 isoform a						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	177851822	177851827	+	IGR	DEL	ACACAC	-	-	rs5778966		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177851822_177851827delACACAC								FAM5B (600265 upstream) : SEC16B (45662 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	178917226	178917227	+	IGR	INS	-	C	C	rs142096720	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178917226_178917227insC								RALGPS2 (27991 upstream) : FAM20B (77847 downstream)																																			---	---	---	---
ABL2	27	broad.mit.edu	37	1	179126842	179126843	+	Intron	INS	-	T	T	rs36042753		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179126842_179126843insT	uc001gmj.3	-						ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Intron|ABL2_uc009wxe.2_Intron	NM_007314	NP_009298			arg tyrosine kinase isoform b						axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)			T	ETV6	AML								---	---	---	---
STX6	10228	broad.mit.edu	37	1	180985357	180985362	+	Intron	DEL	ATCTTT	-	-	rs147005107		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180985357_180985362delATCTTT	uc010pnq.1	-						STX6_uc001goo.2_Intron|STX6_uc010pnr.1_Intron	NM_005819	NP_005810			syntaxin 6						Golgi vesicle transport|intracellular protein transport|vesicle fusion	clathrin-coated vesicle|early endosome|integral to membrane|perinuclear region of cytoplasm|plasma membrane|trans-Golgi network membrane	SNAP receptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	181093658	181093659	+	IGR	INS	-	TC	TC	rs114309731	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181093658_181093659insTC								IER5 (33681 upstream) : CACNA1E (359057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	181447780	181447780	+	IGR	DEL	T	-	-	rs67929326		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181447780delT								IER5 (387803 upstream) : CACNA1E (4936 downstream)																																			---	---	---	---
FAM129A	116496	broad.mit.edu	37	1	184850236	184850237	+	Intron	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184850236_184850237delCA	uc001gra.2	-						FAM129A_uc009wyh.1_Intron|FAM129A_uc009wyi.1_Intron	NM_052966	NP_443198			niban protein isoform 2						negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4																		---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	186048229	186048243	+	Intron	DEL	AGCAGCTCTCTCATC	-	-	rs139977156		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186048229_186048243delAGCAGCTCTCTCATC	uc001grq.1	+							NM_031935	NP_114141			hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	186439879	186439879	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186439879delA								PDC (9640 upstream) : PTGS2 (201066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	187133753	187133754	+	IGR	INS	-	AC	AC			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187133753_187133754insAC								PLA2G4A (175648 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	188302804	188302804	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188302804delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	188616202	188616202	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188616202delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	188620330	188620331	+	IGR	INS	-	T	T	rs138146467	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188620330_188620331insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	189160137	189160137	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189160137delT								None (None upstream) : FAM5C (906660 downstream)																																			---	---	---	---
FAM5C	339479	broad.mit.edu	37	1	190447833	190447834	+	5'Flank	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190447833_190447834delTC	uc010pot.1	-						FAM5C_uc001gse.1_5'Flank|uc001gsf.2_Intron					SubName: Full=cDNA FLJ53468, highly similar to Protein FAM5C;							extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	190712362	190712362	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190712362delT								FAM5C (265603 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	190766969	190766970	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190766969_190766970insA								FAM5C (320210 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191722860	191722860	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191722860delA								None (None upstream) : RGS18 (404732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191799309	191799310	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191799309_191799310insA								None (None upstream) : RGS18 (328282 downstream)																																			---	---	---	---
RGS18	64407	broad.mit.edu	37	1	192148067	192148068	+	Intron	INS	-	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192148067_192148068insG	uc001gsg.2	+							NM_130782	NP_570138			regulator of G-protein signalling 18						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)	3																		---	---	---	---
CDC73	79577	broad.mit.edu	37	1	193184722	193184723	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193184722_193184723insT	uc001gtb.2	+							NM_024529	NP_078805			parafibromin						cell cycle|histone H2B ubiquitination|histone monoubiquitination|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding			parathyroid(46)|ovary(1)|breast(1)|pancreas(1)	49														Hyperparathyroidism_Familial_Isolated|Hyperparathyroidism-Jaw_Tumor_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	1	193466212	193466213	+	IGR	INS	-	TT	TT	rs145028754	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193466212_193466213insTT								CDC73 (242272 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	194422305	194422305	+	IGR	DEL	T	-	-	rs66895762		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194422305delT								None (None upstream) : None (None downstream)																																			---	---	---	---
CRB1	23418	broad.mit.edu	37	1	197266634	197266634	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197266634delG	uc001gtz.2	+						CRB1_uc010poz.1_Intron|CRB1_uc001gty.1_Intron|CRB1_uc010ppa.1_Intron|CRB1_uc009wza.2_Intron|CRB1_uc010ppb.1_Intron	NM_201253	NP_957705			crumbs homolog 1 precursor						cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	198746970	198746973	+	IGR	DEL	ACAC	-	-	rs147033300		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198746970_198746973delACAC								PTPRC (20425 upstream) : MIR181B1 (81029 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200303949	200303949	+	IGR	DEL	A	-	-	rs35445793		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200303949delA								FAM58B (120306 upstream) : ZNF281 (71477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200346449	200346452	+	IGR	DEL	CACA	-	-	rs72353568		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200346449_200346452delCACA								FAM58B (162806 upstream) : ZNF281 (28974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200474691	200474694	+	IGR	DEL	AGGG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200474691_200474694delAGGG								ZNF281 (95525 upstream) : KIF14 (45931 downstream)																																			---	---	---	---
KIF21B	23046	broad.mit.edu	37	1	200976982	200976983	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200976982_200976983delAC	uc001gvs.1	-						KIF21B_uc001gvr.1_Intron|KIF21B_uc009wzl.1_Intron|KIF21B_uc010ppn.1_Intron|KIF21B_uc001gvt.1_5'Flank	NM_017596	NP_060066			kinesin family member 21B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6																		---	---	---	---
SYT2	127833	broad.mit.edu	37	1	202615484	202615484	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202615484delT	uc001gye.2	-						SYT2_uc010pqb.1_Intron|SYT2_uc009xaf.2_Intron	NM_001136504	NP_001129976			synaptotagmin II						neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)													---	---	---	---
MDM4	4194	broad.mit.edu	37	1	204490535	204490536	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204490535_204490536insT	uc001hba.2	+						MDM4_uc001hbd.1_Intron|MDM4_uc010pqw.1_Intron|MDM4_uc010pqx.1_Intron|MDM4_uc001hay.1_Intron|MDM4_uc001hbb.2_Intron|MDM4_uc010pqy.1_Intron|MDM4_uc001hbc.2_Intron	NM_002393	NP_002384			mouse double minute 4 homolog						apoptosis|cell proliferation|cellular response to hypoxia|G0 to G1 transition|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of protein catabolic process|negative regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization	nucleus	enzyme binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)					A		GBM|bladder|retinoblastoma								---	---	---	---
MDM4	4194	broad.mit.edu	37	1	204495958	204495958	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204495958delA	uc001hba.2	+						MDM4_uc001hbd.1_Intron|MDM4_uc010pqw.1_Intron|MDM4_uc010pqx.1_Intron|MDM4_uc001hay.1_Intron|MDM4_uc001hbb.2_Intron|MDM4_uc010pqy.1_Intron|MDM4_uc001hbc.2_Intron|MDM4_uc009xbe.1_Intron	NM_002393	NP_002384			mouse double minute 4 homolog						apoptosis|cell proliferation|cellular response to hypoxia|G0 to G1 transition|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of protein catabolic process|negative regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization	nucleus	enzyme binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)					A		GBM|bladder|retinoblastoma								---	---	---	---
MDM4	4194	broad.mit.edu	37	1	204521453	204521454	+	3'UTR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204521453_204521454insT	uc001hba.2	+	11					MDM4_uc001hbd.1_Intron|MDM4_uc001hbb.2_3'UTR|MDM4_uc010pqy.1_Intron|MDM4_uc001hbc.2_Intron|MDM4_uc009xbe.1_Intron	NM_002393	NP_002384			mouse double minute 4 homolog						apoptosis|cell proliferation|cellular response to hypoxia|G0 to G1 transition|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of protein catabolic process|negative regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization	nucleus	enzyme binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)					A		GBM|bladder|retinoblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	1	208610357	208610358	+	IGR	INS	-	A	A	rs143138299	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208610357_208610358insA								PLXNA2 (192692 upstream) : LOC642587 (991810 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	208736456	208736457	+	IGR	INS	-	TG	TG	rs148802529	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208736456_208736457insTG								PLXNA2 (318791 upstream) : LOC642587 (865711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	208819009	208819009	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208819009delT								PLXNA2 (401344 upstream) : LOC642587 (783159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	209258043	209258063	+	IGR	DEL	TCACATGTTGTGAAGCTACCT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209258043_209258063delTCACATGTTGTGAAGCTACCT								PLXNA2 (840378 upstream) : LOC642587 (344105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	209301783	209301788	+	IGR	DEL	CTCTCC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209301783_209301788delCTCTCC								PLXNA2 (884118 upstream) : LOC642587 (300380 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	209444030	209444031	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209444030_209444031insT								None (None upstream) : LOC642587 (158137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	210444472	210444473	+	IGR	INS	-	T	T	rs113813077		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210444472_210444473insT								SERTAD4 (28034 upstream) : HHAT (57133 downstream)																																			---	---	---	---
INTS7	25896	broad.mit.edu	37	1	212168873	212168873	+	Intron	DEL	T	-	-	rs149165638		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212168873delT	uc001hiw.1	-						INTS7_uc009xdb.1_Intron|INTS7_uc001hix.1_Intron|INTS7_uc001hiy.1_Intron|INTS7_uc010pta.1_Intron	NM_015434	NP_056249			integrator complex subunit 7						snRNA processing	integrator complex	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)														---	---	---	---
DTL	51514	broad.mit.edu	37	1	212265876	212265877	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212265876_212265877insA	uc009xdc.2	+						DTL_uc010ptb.1_Intron|DTL_uc001hiz.3_Intron	NM_016448	NP_057532			denticleless homolog						DNA replication|G2/M transition DNA damage checkpoint|protein monoubiquitination|protein polyubiquitination|response to UV|translesion synthesis|ubiquitin-dependent protein catabolic process	centrosome|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|nuclear membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	212849700	212849701	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212849700_212849701insA								FAM71A (49586 upstream) : BATF3 (10059 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	215633690	215633691	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215633690_215633691delTG								KCNK2 (223255 upstream) : KCTD3 (107044 downstream)																																			---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	217261393	217261393	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217261393delA	uc001hla.1	-						ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206594	NP_996317			estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---
GPATCH2	55105	broad.mit.edu	37	1	217763937	217763937	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217763937delT	uc001hlf.1	-							NM_018040	NP_060510			G patch domain containing 2							intracellular	nucleic acid binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	219659921	219659921	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219659921delT								LYPLAL1 (273715 upstream) : SLC30A10 (198848 downstream)																																			---	---	---	---
SLC30A10	55532	broad.mit.edu	37	1	220080278	220080279	+	Intron	INS	-	T	T	rs147232522	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220080278_220080279insT	uc001hlu.1	-											Synthetic construct DNA, clone: pF1KB7405, Homo sapiens SLC30A10 gene for solute carrier family 30, member 10, without stop codon, in Flexi system.						zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	222184701	222184702	+	IGR	DEL	AG	-	-	rs74147347		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222184701_222184702delAG								DUSP10 (269240 upstream) : HHIPL2 (510900 downstream)																																			---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225448054	225448054	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225448054delA	uc001how.2	+						DNAH14_uc001hox.2_Intron	NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
ENAH	55740	broad.mit.edu	37	1	225678268	225678269	+	3'UTR	INS	-	C	C	rs139202179	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225678268_225678269insC	uc001hpc.1	-	15					ENAH_uc001hpd.1_3'UTR|ENAH_uc001hpb.1_3'UTR	NM_001008493	NP_001008493			enabled homolog isoform a						axon guidance|intracellular transport|T cell receptor signaling pathway	cytosol|filopodium|focal adhesion|lamellipodium|synapse	actin binding|SH3 domain binding|WW domain binding			ovary(1)|skin(1)	2	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	227176165	227176167	+	IGR	DEL	CAG	-	-	rs10586162		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227176165_227176167delCAG								CABC1 (919 upstream) : CDC42BPA (1400 downstream)																																			---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227301566	227301566	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227301566delA	uc001hqr.2	-						CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
PRSS38	339501	broad.mit.edu	37	1	228031409	228031409	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228031409delA	uc001hrh.2	+							NM_183062	NP_898885			marapsin 2 precursor						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	228927028	228927029	+	IGR	INS	-	GTGT	GTGT	rs150900982	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228927028_228927029insGTGT								RHOU (44619 upstream) : RAB4A (479850 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	229500529	229500529	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229500529delT								C1orf96 (21841 upstream) : ACTA1 (66466 downstream)																																			---	---	---	---
GALNT2	2590	broad.mit.edu	37	1	230402736	230402737	+	Intron	DEL	AC	-	-	rs35956776		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230402736_230402737delAC	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron|GALNT2_uc001htu.2_Intron	NM_004481	NP_004472			polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	231147921	231147926	+	IGR	DEL	TCTCTT	-	-	rs71828585		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231147921_231147926delTCTCTT								ARV1 (11450 upstream) : FAM89A (6778 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	231199777	231199777	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231199777delA								FAM89A (23782 upstream) : TRIM67 (98897 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	232699893	232699902	+	IGR	DEL	TTCGTGTGTG	-	-	rs71788527		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232699893_232699902delTTCGTGTGTG								SIPA1L2 (48650 upstream) : KIAA1383 (240736 downstream)																																			---	---	---	---
PCNXL2	80003	broad.mit.edu	37	1	233185609	233185610	+	Intron	DEL	AC	-	-	rs112165148		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233185609_233185610delAC	uc001hvl.2	-						PCNXL2_uc001hvk.1_Intron|PCNXL2_uc001hvm.1_Intron	NM_014801	NP_055616			pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)																---	---	---	---
PCNXL2	80003	broad.mit.edu	37	1	233337947	233337948	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233337947_233337948insT	uc001hvl.2	-						PCNXL2_uc001hvm.1_5'Flank|PCNXL2_uc009xfu.2_Intron|PCNXL2_uc001hvp.1_Intron|PCNXL2_uc009xfv.1_Intron|PCNXL2_uc001hvq.1_Frame_Shift_Ins_p.K270fs	NM_014801	NP_055616			pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	234669636	234669636	+	5'Flank	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234669636delA	uc001hwe.2	-											Homo sapiens cDNA clone IMAGE:4816129.																														---	---	---	---
TBCE	6905	broad.mit.edu	37	1	235605324	235605324	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235605324delT	uc001hwz.1	+						TBCE_uc001hxa.1_Intron|TBCE_uc010pxr.1_Intron|TBCE_uc001hxb.1_Intron	NM_003193	NP_003184			beta-tubulin cofactor E						'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|nucleus|plasma membrane	chaperone binding				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	236529878	236529878	+	IGR	DEL	A	-	-	rs58267428		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236529878delA								ERO1LB (84539 upstream) : EDARADD (27802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	236530041	236530042	+	IGR	INS	-	TCTT	TCTT	rs146073425	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236530041_236530042insTCTT								ERO1LB (84702 upstream) : EDARADD (27638 downstream)																																			---	---	---	---
EDARADD	128178	broad.mit.edu	37	1	236603877	236603877	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236603877delT	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860			EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237553546	237553546	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237553546delT	uc001hyl.1	+							NM_001035	NP_001026			cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237578292	237578300	+	Intron	DEL	AGAACTCTT	-	-	rs71561872		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237578292_237578300delAGAACTCTT	uc001hyl.1	+							NM_001035	NP_001026			cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	238011021	238011021	+	IGR	DEL	A	-	-	rs112983000		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238011021delA								RYR2 (13733 upstream) : LOC100130331 (14454 downstream)																																			---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240401695	240401695	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240401695delA	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
PLD5	200150	broad.mit.edu	37	1	242395241	242395242	+	Intron	INS	-	A	A	rs425632		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242395241_242395242insA	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron					RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---
PLD5	200150	broad.mit.edu	37	1	242581489	242581492	+	Intron	DEL	ACAA	-	-	rs75420962		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242581489_242581492delACAA	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron					RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---
AKT3	10000	broad.mit.edu	37	1	243774652	243774652	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243774652delT	uc001iab.1	-						AKT3_uc001hzz.1_Intron	NM_005465	NP_005456			AKT3 kinase isoform 1						signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)															---	---	---	---
SMYD3	64754	broad.mit.edu	37	1	246337116	246337116	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246337116delT	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580			SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)														---	---	---	---
SMYD3	64754	broad.mit.edu	37	1	246360297	246360297	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246360297delA	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580			SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)														---	---	---	---
CNST	163882	broad.mit.edu	37	1	246784042	246784043	+	Intron	INS	-	CT	CT	rs141720742	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246784042_246784043insCT	uc001ibp.2	+						CNST_uc001ibo.3_Intron	NM_152609	NP_689822			hypothetical protein LOC163882 isoform 1						positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding				0																		---	---	---	---
SCCPDH	51097	broad.mit.edu	37	1	246914819	246914820	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246914819_246914820insT	uc001ibr.2	+							NM_016002	NP_057086			saccharopine dehydrogenase (putative)							midbody	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity			ovary(1)	1	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	247099758	247099759	+	IGR	INS	-	A	A	rs11454014		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247099758_247099759insA								AHCTF1 (5035 upstream) : ZNF695 (9095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	247427338	247427338	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247427338delG								VN1R5 (6892 upstream) : ZNF496 (36285 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	247508999	247508999	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247508999delT								ZNF496 (13837 upstream) : NLRP3 (70459 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	248608544	248608545	+	IGR	INS	-	AA	AA	rs5782478		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248608544_248608545insAA								OR2T1 (38140 upstream) : OR2T2 (7554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	249078877	249078878	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249078877_249078878insT								LOC646627 (175726 upstream) : SH3BP5L (25773 downstream)																																			---	---	---	---
SNTG2	54221	broad.mit.edu	37	2	1127930	1127931	+	Intron	INS	-	AC	AC	rs147286173	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1127930_1127931insAC	uc002qwq.2	+						SNTG2_uc002qwp.2_Intron|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841			syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)														---	---	---	---
SNTG2	54221	broad.mit.edu	37	2	1238563	1238564	+	Intron	INS	-	C	C	rs139227150	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1238563_1238564insC	uc002qwq.2	+						SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841			syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)														---	---	---	---
PXDN	7837	broad.mit.edu	37	2	1683307	1683308	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1683307_1683308delTG	uc002qxa.2	-						PXDN_uc002qxb.1_Intron|PXDN_uc002qxc.1_Intron	NM_012293	NP_036425			peroxidasin precursor						extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)														---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	2280746	2280747	+	Intron	INS	-	T	T	rs144087600	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2280746_2280747insT	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	5010694	5010701	+	IGR	DEL	ACACACAT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5010694_5010701delACACACAT								None (None upstream) : SOX11 (822098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5864877	5864878	+	IGR	INS	-	TGTG	TGTG	rs139857513	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5864877_5864878insTGTG								SOX11 (23361 upstream) : LOC150622 (207941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	6592063	6592063	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6592063delA								LOC400940 (463699 upstream) : CMPK2 (388440 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	8038194	8038195	+	IGR	INS	-	AAAG	AAAG			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8038194_8038195insAAAG								RNF144A (853887 upstream) : LOC339788 (24363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	8794995	8794996	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8794995_8794996insA								LOC339788 (678018 upstream) : ID2 (24344 downstream)																																			---	---	---	---
ASAP2	8853	broad.mit.edu	37	2	9446003	9446006	+	Intron	DEL	GTGG	-	-	rs111472084		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9446003_9446006delGTGG	uc002qzh.2	+						ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878			ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0																		---	---	---	---
GRHL1	29841	broad.mit.edu	37	2	10123333	10123334	+	Intron	INS	-	C	C	rs147348600	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10123333_10123334insC	uc002raa.2	+						GRHL1_uc002rab.2_Intron|GRHL1_uc002rad.2_Intron|GRHL1_uc010yjb.1_Intron	NM_198182	NP_937825			grainyhead-like 1						cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding			pancreas(1)|skin(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	12259546	12259546	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12259546delT	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	12995978	12995978	+	IGR	DEL	A	-	-	rs67507735		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12995978delA								TRIB2 (113122 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	15775434	15775435	+	IGR	INS	-	A	A	rs149449359	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15775434_15775435insA								DDX1 (4210 upstream) : MYCNOS (304585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16363765	16363765	+	IGR	DEL	T	-	-	rs66635926		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16363765delT								MYCN (276637 upstream) : FAM49A (370136 downstream)																																			---	---	---	---
SMC6	79677	broad.mit.edu	37	2	17902966	17902967	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17902966_17902967insT	uc002rco.2	-						SMC6_uc010exo.2_Intron|SMC6_uc002rcn.2_Intron|SMC6_uc002rcp.1_Intron|SMC6_uc002rcq.2_Intron|SMC6_uc002rcr.1_Intron	NM_001142286	NP_001135758			SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	18398368	18398369	+	IGR	INS	-	AA	AA	rs2345527	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18398368_18398369insAA								KCNS3 (284144 upstream) : NT5C1B (337622 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19715910	19715910	+	IGR	DEL	T	-	-	rs140642370		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19715910delT								OSR1 (157538 upstream) : TTC32 (380608 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19983890	19983891	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19983890_19983891delCA								OSR1 (425518 upstream) : TTC32 (112627 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	22450094	22450094	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22450094delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	22765902	22765902	+	IGR	DEL	A	-	-	rs112158556		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22765902delA								None (None upstream) : KLHL29 (989553 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23445630	23445631	+	IGR	INS	-	C	C	rs150031006	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23445630_23445631insC								None (None upstream) : KLHL29 (309824 downstream)																																			---	---	---	---
KLHL29	114818	broad.mit.edu	37	2	23850781	23850781	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23850781delT	uc002reg.2	+						KLHL29_uc002ref.2_Intron					RecName: Full=Kelch-like protein 29; AltName: Full=Kelch repeat and BTB domain-containing protein 9;											ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	24636037	24636037	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24636037delA								ITSN2 (52640 upstream) : NCOA1 (151142 downstream)																																			---	---	---	---
MAPRE3	22924	broad.mit.edu	37	2	27225287	27225288	+	Intron	INS	-	T	T	rs11372255		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27225287_27225288insT	uc002rhw.2	+						MAPRE3_uc002rhx.2_Intron	NM_012326	NP_036458			microtubule-associated protein, RP/EB family,						cell division|mitosis|positive regulation of transcription, DNA-dependent	cytoplasm|cytoplasmic microtubule|microtubule|midbody|perinuclear region of cytoplasm	microtubule binding|protein binding|small GTPase regulator activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
CAD	790	broad.mit.edu	37	2	27459886	27459886	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27459886delT	uc002rji.2	+						CAD_uc010eyw.2_Intron	NM_004341	NP_004332			carbamoylphosphate synthetase 2/aspartate						'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)													---	---	---	---
BRE	9577	broad.mit.edu	37	2	28167867	28167867	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28167867delT	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664			brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	28672564	28672565	+	IGR	INS	-	TGTC	TGTC	rs151093324	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28672564_28672565insTGTC								FOSL2 (35050 upstream) : PLB1 (46417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	28684317	28684322	+	IGR	DEL	CAGTAC	-	-	rs139949101		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28684317_28684322delCAGTAC								FOSL2 (46803 upstream) : PLB1 (34660 downstream)																																			---	---	---	---
FAM179A	165186	broad.mit.edu	37	2	29249099	29249100	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29249099_29249100insT	uc010ezl.2	+						FAM179A_uc010ymm.1_Intron|FAM179A_uc002rmr.3_Intron	NM_199280	NP_954974			hypothetical protein LOC165186								binding			ovary(3)|skin(1)	4																		---	---	---	---
ALK	238	broad.mit.edu	37	2	29725774	29725774	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29725774delA	uc002rmy.2	-							NM_004304	NP_004295			anaplastic lymphoma kinase precursor						protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				---	---	---	---
GALNT14	79623	broad.mit.edu	37	2	31139524	31139525	+	Intron	INS	-	TCTC	TCTC	rs147345527	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31139524_31139525insTCTC	uc002rnr.2	-						GALNT14_uc002rnq.2_Intron|GALNT14_uc002rns.2_Intron|GALNT14_uc010ymr.1_Intron	NM_024572	NP_078848			N-acetylgalactosaminyltransferase 14							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
GALNT14	79623	broad.mit.edu	37	2	31142070	31142071	+	Intron	INS	-	CTGGAGA	CTGGAGA	rs144351543	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31142070_31142071insCTGGAGA	uc002rnr.2	-						GALNT14_uc002rnq.2_Intron|GALNT14_uc002rns.2_Intron|GALNT14_uc010ymr.1_Intron	NM_024572	NP_078848			N-acetylgalactosaminyltransferase 14							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
GALNT14	79623	broad.mit.edu	37	2	31162867	31162869	+	Intron	DEL	AAA	-	-	rs111882918		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31162867_31162869delAAA	uc002rnr.2	-						GALNT14_uc002rnq.2_Intron|GALNT14_uc002rns.2_Intron|GALNT14_uc010ymr.1_Intron|GALNT14_uc010ezo.1_Intron|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848			N-acetylgalactosaminyltransferase 14							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
BIRC6	57448	broad.mit.edu	37	2	32817663	32817663	+	Intron	DEL	T	-	-	rs111294235		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32817663delT	uc010ezu.2	+							NM_016252	NP_057336			baculoviral IAP repeat-containing 6						anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33219037	33219042	+	Intron	DEL	GTGTGT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33219037_33219042delGTGTGT	uc002ros.2	+							NM_206943	NP_996826			latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33486637	33486637	+	Intron	DEL	T	-	-	rs11302409		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33486637delT	uc002ros.2	+						LTBP1_uc002rot.2_Intron|LTBP1_uc002rou.2_Intron|LTBP1_uc002rov.2_Intron|LTBP1_uc010ymz.1_Intron|LTBP1_uc010yna.1_Intron	NM_206943	NP_996826			latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33548696	33548697	+	Intron	INS	-	AAAC	AAAC	rs142587532	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33548696_33548697insAAAC	uc002ros.2	+						LTBP1_uc002rot.2_Intron|LTBP1_uc002rou.2_Intron|LTBP1_uc002rov.2_Intron|LTBP1_uc010ymz.1_Intron|LTBP1_uc010yna.1_Intron|LTBP1_uc010ynb.1_Intron	NM_206943	NP_996826			latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33612803	33612804	+	Intron	INS	-	T	T	rs112415551		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33612803_33612804insT	uc002ros.2	+						LTBP1_uc002rot.2_Intron|LTBP1_uc002rou.2_Intron|LTBP1_uc002rov.2_Intron|LTBP1_uc010ymz.1_Intron|LTBP1_uc010yna.1_Intron|LTBP1_uc010ynb.1_Intron	NM_206943	NP_996826			latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---
RASGRP3	25780	broad.mit.edu	37	2	33774407	33774408	+	Intron	DEL	AT	-	-	rs34329555		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33774407_33774408delAT	uc002rox.2	+						RASGRP3_uc010ync.1_Intron|RASGRP3_uc002roy.2_Intron	NM_170672	NP_733772			RAS guanyl releasing protein 3 (calcium and						MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)																	---	---	---	---
RASGRP3	25780	broad.mit.edu	37	2	33786136	33786136	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33786136delT	uc002rox.2	+						RASGRP3_uc010ync.1_Intron|RASGRP3_uc002roy.2_Intron	NM_170672	NP_733772			RAS guanyl releasing protein 3 (calcium and						MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	37986321	37986322	+	IGR	INS	-	AATA	AATA	rs146587638	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37986321_37986322insAATA								CDC42EP3 (86995 upstream) : FAM82A1 (166140 downstream)																																			---	---	---	---
GALM	130589	broad.mit.edu	37	2	38899172	38899173	+	Intron	INS	-	A	A	rs72795173	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38899172_38899173insA	uc002rqy.2	+							NM_138801	NP_620156			galactose mutarotase						hexose metabolic process	cytoplasm	aldose 1-epimerase activity|carbohydrate binding				0		all_hematologic(82;0.248)																---	---	---	---
SOS1	6654	broad.mit.edu	37	2	39299051	39299051	+	Intron	DEL	T	-	-	rs75838859		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39299051delT	uc002rrk.3	-						SOS1_uc010ynr.1_Intron	NM_005633	NP_005624			son of sevenless homolog 1						apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)												Noonan_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	2	39860180	39860180	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39860180delT								MAP4K3 (195961 upstream) : TMEM178 (32913 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	41719680	41719680	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41719680delG								SLC8A1 (980105 upstream) : PKDCC (555481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42249007	42249008	+	IGR	INS	-	TT	TT	rs149157994	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42249007_42249008insTT								None (None upstream) : PKDCC (26153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42258382	42258382	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42258382delA								None (None upstream) : PKDCC (16779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	43146676	43146677	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43146676_43146677delTG								HAAO (126925 upstream) : ZFP36L2 (302865 downstream)																																			---	---	---	---
SLC3A1	6519	broad.mit.edu	37	2	44537037	44537037	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44537037delT	uc002ruc.3	+						SLC3A1_uc002rtz.2_Intron|SLC3A1_uc002rua.2_Intron|SLC3A1_uc002rub.2_Intron|SLC3A1_uc002rud.3_Intron|SLC3A1_uc002rue.3_Intron	NM_000341	NP_000332			solute carrier family 3, member 1						carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)													---	---	---	---
C2orf34	79823	broad.mit.edu	37	2	44661366	44661366	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44661366delT	uc002rum.2	+						C2orf34_uc002rul.2_Intron	NM_024766	NP_079042			hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---
C2orf34	79823	broad.mit.edu	37	2	44697639	44697640	+	Intron	INS	-	AG	AG	rs143626312	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44697639_44697640insAG	uc002rum.2	+							NM_024766	NP_079042			hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---
C2orf34	79823	broad.mit.edu	37	2	44698595	44698597	+	Intron	DEL	TGG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44698595_44698597delTGG	uc002rum.2	+							NM_024766	NP_079042			hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---
SRBD1	55133	broad.mit.edu	37	2	45758683	45758684	+	Intron	INS	-	A	A	rs143294806	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45758683_45758684insA	uc002rus.2	-						SRBD1_uc010yoc.1_Intron	NM_018079	NP_060549			S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	47977130	47977131	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47977130_47977131insA								MSH2 (70622 upstream) : MSH6 (33090 downstream)																																			---	---	---	---
FSHR	2492	broad.mit.edu	37	2	49298943	49298943	+	Intron	DEL	G	-	-	rs79566924		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49298943delG	uc002rww.2	-						FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Intron|FSHR_uc010fbo.1_Intron	NM_000145	NP_000136			follicle stimulating hormone receptor isoform 1						female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)									Gonadal_Dysgenesis_46_XX				---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50829533	50829534	+	Intron	INS	-	T	T	rs145981048	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50829533_50829534insT	uc010fbq.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_001135659	NP_001129131			neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	51635122	51635123	+	IGR	INS	-	T	T	rs145967318	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51635122_51635123insT								NRXN1 (375448 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53337371	53337371	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53337371delT								None (None upstream) : ASB3 (559747 downstream)																																			---	---	---	---
ASB3	51130	broad.mit.edu	37	2	53928042	53928042	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53928042delA	uc002rxg.1	-						ASB3_uc002rxh.1_Intron|ASB3_uc002rxi.3_Intron|ASB3_uc002rxf.1_5'Flank	NM_016115	NP_057199			ankyrin repeat and SOCS box-containing protein 3						intracellular signal transduction					ovary(1)|kidney(1)	2			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)															---	---	---	---
SMEK2	57223	broad.mit.edu	37	2	55822875	55822875	+	Intron	DEL	A	-	-	rs142432483		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55822875delA	uc002rzc.2	-						SMEK2_uc002rzb.2_Intron|SMEK2_uc002rzd.2_Intron|SMEK2_uc002rza.2_Intron	NM_001122964	NP_001116436			SMEK homolog 2, suppressor of mek1 isoform 1							microtubule organizing center|nucleus	protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	58741846	58741846	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58741846delT								FANCL (273331 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	59295752	59295753	+	IGR	INS	-	G	G	rs148351845	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59295752_59295753insG								FANCL (827237 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	60221177	60221178	+	IGR	DEL	CT	-	-	rs72536086		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60221177_60221178delCT								None (None upstream) : BCL11A (457125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	61399297	61399298	+	IGR	INS	-	A	A	rs138456703	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61399297_61399298insA								C2orf74 (7333 upstream) : AHSA2 (5255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	64580768	64580769	+	IGR	INS	-	GAGGA	GAGGA	rs3082238		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64580768_64580769insGAGGA								PELI1 (209163 upstream) : HSPC159 (100558 downstream)																																			---	---	---	---
CEP68	23177	broad.mit.edu	37	2	65307268	65307268	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65307268delA	uc002sdl.3	+						CEP68_uc010yqb.1_Intron|CEP68_uc002sdk.3_Intron|CEP68_uc010yqc.1_Intron	NM_015147	NP_055962			centrosomal protein 68kDa						centrosome organization	centrosome				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	66189367	66189367	+	Intron	DEL	A	-	-	rs75967478		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66189367delA	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	67122317	67122318	+	IGR	INS	-	TGG	TGG	rs142800148	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67122317_67122318insTGG								MEIS1 (322427 upstream) : ETAA1 (502124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	67230641	67230643	+	IGR	DEL	TGC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67230641_67230643delTGC								MEIS1 (430751 upstream) : ETAA1 (393799 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	68299438	68299438	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68299438delT								C1D (9279 upstream) : WDR92 (50630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	69124149	69124150	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69124149_69124150insT								BMP10 (25500 upstream) : GKN2 (48215 downstream)																																			---	---	---	---
PAIP2B	400961	broad.mit.edu	37	2	71447630	71447633	+	Intron	DEL	AATT	-	-	rs71400992		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71447630_71447633delAATT	uc002shu.2	-							NM_020459	NP_065192			poly(A) binding protein interacting protein 2B						negative regulation of translational initiation		protein binding|translation repressor activity, nucleic acid binding				0																		---	---	---	---
ZNF638	27332	broad.mit.edu	37	2	71555992	71555993	+	5'Flank	DEL	AA	-	-	rs72016638		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71555992_71555993delAA	uc002shx.2	+						ZNF638_uc010fec.2_Intron|ZNF638_uc010yqw.1_Intron|ZNF638_uc002shw.2_5'Flank|ZNF638_uc002shy.2_5'Flank|ZNF638_uc002shz.2_5'Flank|ZNF638_uc002sia.2_5'Flank	NM_014497	NP_055312			zinc finger protein 638						RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4																		---	---	---	---
EXOC6B	23233	broad.mit.edu	37	2	72488335	72488335	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72488335delA	uc010fep.2	-							NM_015189	NP_056004			SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2																		---	---	---	---
ALMS1	7840	broad.mit.edu	37	2	73624514	73624514	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73624514delT	uc002sje.1	+						ALMS1_uc002sjf.1_Intron	NM_015120	NP_055935			Alstrom syndrome 1						G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9																		---	---	---	---
SLC4A5	57835	broad.mit.edu	37	2	74559831	74559832	+	Intron	DEL	TG	-	-	rs72030338		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74559831_74559832delTG	uc002skn.2	-						SLC4A5_uc002skl.2_Intron|SLC4A5_uc002sks.1_Intron	NM_133478	NP_597812			sodium bicarbonate transporter 4 isoform c							apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9																		---	---	---	---
POLE4	56655	broad.mit.edu	37	2	75184418	75184418	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75184418delT	uc002snf.2	+							NM_019896	NP_063949			DNA-directed DNA polymerase epsilon 4						histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex	DNA-directed DNA polymerase activity|protein binding|sequence-specific DNA binding				0																		---	---	---	---
TACR1	6869	broad.mit.edu	37	2	75410918	75410918	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75410918delC	uc002sng.2	-						TACR1_uc002snh.2_Intron	NM_001058	NP_001049			tachykinin receptor 1 isoform long						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|detection of abiotic stimulus|mechanosensory behavior	integral to plasma membrane	protein binding			ovary(1)	1					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	76755020	76755020	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76755020delT								C2orf3 (816909 upstream) : LRRTM4 (219838 downstream)																																			---	---	---	---
LRRTM4	80059	broad.mit.edu	37	2	77644737	77644737	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77644737delT	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217			leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)														---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80840191	80840192	+	Intron	INS	-	AAATG	AAATG	rs144647063	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80840191_80840192insAAATG	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron|CTNNA2_uc010ysj.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	81092110	81092110	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:81092110delT								CTNNA2 (216206 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	83330625	83330625	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83330625delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	84017851	84017851	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84017851delT								None (None upstream) : FUNDC2P2 (499955 downstream)																																			---	---	---	---
ELMOD3	84173	broad.mit.edu	37	2	85618139	85618147	+	3'UTR	DEL	CAGTGGAGC	-	-	rs73945729		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85618139_85618147delCAGTGGAGC	uc002spf.3	+	15					ELMOD3_uc002spg.3_3'UTR|ELMOD3_uc002sph.3_3'UTR|ELMOD3_uc010ysn.1_3'UTR|ELMOD3_uc010yso.1_RNA|ELMOD3_uc010ysp.1_RNA	NM_001135021	NP_001128493			ELMO/CED-12 domain containing 3 isoform b						phagocytosis	cytoskeleton				ovary(2)	2																		---	---	---	---
RGPD1	400966	broad.mit.edu	37	2	87143308	87143308	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87143308delA	uc010fgv.2	+						RMND5A_uc002srs.3_Intron|RGPD1_uc002ssb.2_5'Flank	NM_001024457	NP_001019628			RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87586774	87586778	+	Intron	DEL	GAGAT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87586774_87586778delGAGAT	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	89301139	89301139	+	Intron	DEL	C	-	-	rs111913624		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89301139delC	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	89424602	89424603	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89424602_89424603delTG	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	90473432	90473438	+	IGR	DEL	AGTGTGC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90473432_90473438delAGTGTGC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91665165	91665166	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91665165_91665166insA								None (None upstream) : LOC654342 (140026 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92104577	92104577	+	IGR	DEL	C	-	-	rs113913111		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92104577delC								GGT8P (134424 upstream) : FKSG73 (24582 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92116753	92116754	+	IGR	DEL	CA	-	-	rs150080836		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92116753_92116754delCA								GGT8P (146600 upstream) : FKSG73 (12405 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92255125	92255126	+	IGR	DEL	AT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92255125_92255126delAT								FKSG73 (124631 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	96603329	96603329	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96603329delC	uc002sva.1	-						uc010yug.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																														---	---	---	---
VWA3B	200403	broad.mit.edu	37	2	98734212	98734214	+	Intron	DEL	TTT	-	-	rs71960161		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98734212_98734214delTTT	uc002syo.2	+						VWA3B_uc010yvh.1_Intron|VWA3B_uc002syj.2_Intron|VWA3B_uc002syk.1_Intron|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Intron|VWA3B_uc002syn.1_Intron	NM_144992	NP_659429			von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6																		---	---	---	---
TSGA10	80705	broad.mit.edu	37	2	99676109	99676110	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99676109_99676110delAC	uc002szg.3	-						TSGA10_uc002szh.3_Intron|TSGA10_uc002szi.3_Intron|TSGA10_uc010fin.1_Intron	NM_182911	NP_878915			testis specific, 10						spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
EIF5B	9669	broad.mit.edu	37	2	100004899	100004900	+	Intron	INS	-	T	T	rs139309233	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100004899_100004900insT	uc002tab.2	+							NM_015904	NP_056988			eukaryotic translation initiation factor 5B						regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			ovary(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	101244117	101244118	+	IGR	DEL	AC	-	-	rs10546451		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101244117_101244118delAC								PDCL3 (50916 upstream) : NPAS2 (192495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	101275965	101275965	+	IGR	DEL	C	-	-	rs35754916		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101275965delC								PDCL3 (82764 upstream) : NPAS2 (160648 downstream)																																			---	---	---	---
IL1R1	3554	broad.mit.edu	37	2	102709299	102709300	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102709299_102709300insT	uc010fix.2	+							NM_000877	NP_000868			interleukin 1 receptor, type I precursor						innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity|platelet-derived growth factor receptor binding			skin(1)	1					Anakinra(DB00026)													---	---	---	---
IL1RL1	9173	broad.mit.edu	37	2	102949305	102949306	+	Intron	INS	-	A	A	rs145748540	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102949305_102949306insA	uc002tbu.1	+						IL1RL1_uc010ywa.1_Intron|IL18R1_uc002tbw.3_Intron	NM_016232	NP_057316			interleukin 1 receptor-like 1 isoform 1						innate immune response	integral to membrane	interleukin-1 receptor activity|receptor signaling protein activity			skin(2)|ovary(1)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	104142874	104142875	+	IGR	INS	-	AGG	AGG	rs141062467	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104142874_104142875insAGG								TMEM182 (708738 upstream) : LOC150568 (907930 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	104443440	104443441	+	IGR	INS	-	TGTGTT	TGTGTT	rs139569496	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104443440_104443441insTGTGTT								None (None upstream) : LOC150568 (607364 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105592681	105592681	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105592681delT								POU3F3 (119211 upstream) : MRPS9 (61802 downstream)																																			---	---	---	---
TGFBRAP1	9392	broad.mit.edu	37	2	105907074	105907077	+	Intron	DEL	GTGT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105907074_105907077delGTGT	uc002tcq.2	-						TGFBRAP1_uc010fjc.2_Intron|TGFBRAP1_uc002tcr.3_Intron	NM_004257	NP_004248			transforming growth factor, beta receptor						regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	106579443	106579443	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106579443delA								NCK2 (68717 upstream) : C2orf40 (102670 downstream)																																			---	---	---	---
EDAR	10913	broad.mit.edu	37	2	109573249	109573250	+	Intron	INS	-	G	G	rs77138317		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109573249_109573250insG	uc002teq.3	-						EDAR_uc010fjn.2_Intron|EDAR_uc010yws.1_Intron	NM_022336	NP_071731			ectodysplasin A receptor precursor						apoptosis|cell differentiation	integral to membrane	protein binding|transmembrane receptor activity			skin(1)	1																		---	---	---	---
SH3RF3	344558	broad.mit.edu	37	2	109961314	109961314	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109961314delC	uc010ywt.1	+							NM_001099289	NP_001092759			SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1																		---	---	---	---
LOC541471	541471	broad.mit.edu	37	2	112252633	112252633	+	RNA	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112252633delA	uc002the.2	-	1		c.60delT			LOC541471_uc010yxl.1_RNA|LOC541471_uc002thf.3_RNA					Homo sapiens hypothetical LOC541471, mRNA (cDNA clone IMAGE:3459303).												0																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	115272363	115272364	+	Intron	INS	-	T	T	rs145530478	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115272363_115272364insT	uc002tla.1	+						DPP10_uc002tlb.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	116279181	116279182	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116279181_116279182insT	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	116681664	116681665	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116681664_116681665insT								DPP10 (79728 upstream) : None (None downstream)																																			---	---	---	---
PTPN4	5775	broad.mit.edu	37	2	120708406	120708406	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120708406delA	uc002tmf.1	+						PTPN4_uc010flj.1_Intron|PTPN4_uc010yyr.1_Intron	NM_002830	NP_002821			protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity			ovary(2)	2					Alendronate(DB00630)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	122673962	122673963	+	IGR	INS	-	GT	GT	rs5833893		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122673962_122673963insGT								TSN (148536 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	124115808	124115808	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124115808delA								None (None upstream) : CNTNAP5 (667056 downstream)																																			---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125516033	125516034	+	Intron	DEL	TC	-	-	rs12711691	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125516033_125516034delTC	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129			contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125658098	125658098	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125658098delT	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129			contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	126169329	126169330	+	IGR	INS	-	A	A	rs143735951	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126169329_126169330insA								CNTNAP5 (496468 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126283338	126283339	+	IGR	INS	-	AAAA	AAAA	rs71392292		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126283338_126283339insAAAA								CNTNAP5 (610477 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129508365	129508365	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129508365delA								HS6ST1 (432194 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129613444	129613444	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129613444delC								HS6ST1 (537273 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129768547	129768548	+	IGR	INS	-	AG	AG	rs139281705	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129768547_129768548insAG								HS6ST1 (692376 upstream) : LOC389033 (911887 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	130146241	130146241	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130146241delA								None (None upstream) : LOC389033 (534194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	131009759	131009760	+	IGR	INS	-	CCG	CCG	rs138344915	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131009759_131009760insCCG								TUBA3E (53725 upstream) : CCDC115 (86056 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133018713	133018714	+	IGR	DEL	GG	-	-	rs144729406		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133018713_133018714delGG								NCRNA00164 (3171 upstream) : GPR39 (155433 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133076665	133076666	+	Intron	INS	-	T	T	rs146146156	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133076665_133076666insT	uc002ttk.1	+											Homo sapiens cDNA FLJ37280 fis, clone BRAMY2012881.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	133090381	133090381	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133090381delA								NCRNA00164 (74839 upstream) : GPR39 (83766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133107688	133107688	+	IGR	DEL	G	-	-	rs59503674		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133107688delG								NCRNA00164 (92146 upstream) : GPR39 (66459 downstream)																																			---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	134126667	134126667	+	Intron	DEL	A	-	-	rs11339279		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134126667delA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	134236345	134236352	+	Intron	DEL	AAATATGT	-	-	rs113186937		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134236345_134236352delAAATATGT	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
ZRANB3	84083	broad.mit.edu	37	2	136125165	136125165	+	Intron	DEL	T	-	-	rs55925313	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136125165delT	uc002tum.2	-						ZRANB3_uc002tuk.2_Intron|ZRANB3_uc002tul.2_Intron|ZRANB3_uc002tun.1_Intron	NM_032143	NP_115519			zinc finger, RAN-binding domain containing 3							intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)														---	---	---	---
R3HDM1	23518	broad.mit.edu	37	2	136412434	136412437	+	Intron	DEL	GTGT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136412434_136412437delGTGT	uc002tuo.2	+						R3HDM1_uc010fni.2_Intron|R3HDM1_uc002tup.2_Intron|R3HDM1_uc010zbh.1_Intron	NM_015361	NP_056176			R3H domain containing 1								nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)														---	---	---	---
DARS	1615	broad.mit.edu	37	2	136739244	136739245	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136739244_136739245insT	uc002tux.1	-						DARS_uc010fnj.1_Intron	NM_001349	NP_001340			aspartyl-tRNA synthetase						aspartyl-tRNA aminoacylation|protein complex assembly	cytosol|nuclear membrane|plasma membrane|soluble fraction	aminoacylase activity|aspartate-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	137253119	137253126	+	IGR	DEL	TCCCTCCC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137253119_137253126delTCCCTCCC								CXCR4 (377394 upstream) : THSD7B (269989 downstream)																																			---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	137668248	137668249	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137668248_137668249insT	uc010zbj.1	+											Homo sapiens mRNA for KIAA1679 protein, partial cds.											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
HNMT	3176	broad.mit.edu	37	2	138745581	138745581	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138745581delT	uc002tvc.2	+						HNMT_uc002tvf.2_Intron	NM_006895	NP_008826			histamine N-methyltransferase isoform 1						respiratory gaseous exchange	cytoplasm	histamine N-methyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	140015781	140015781	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140015781delT								NXPH2 (477970 upstream) : LRP1B (973215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	140481743	140481743	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140481743delA								NXPH2 (943932 upstream) : LRP1B (507253 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	140672857	140672857	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140672857delA								None (None upstream) : LRP1B (316139 downstream)																																			---	---	---	---
ARHGAP15	55843	broad.mit.edu	37	2	144487473	144487474	+	Intron	INS	-	T	T	rs149740011	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144487473_144487474insT	uc002tvm.3	+						ARHGAP15_uc002tvn.2_Intron	NM_018460	NP_060930			ARHGAP15						regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	147638700	147638700	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147638700delA								PABPC1P2 (290143 upstream) : ACVR2A (963386 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	148350229	148350230	+	IGR	INS	-	TA	TA			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148350229_148350230insTA								None (None upstream) : ACVR2A (251856 downstream)																																			---	---	---	---
MBD5	55777	broad.mit.edu	37	2	149224315	149224315	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149224315delC	uc002twm.3	+						MBD5_uc010zbs.1_Intron|MBD5_uc010fns.2_Intron|MBD5_uc002twn.1_5'Flank	NM_018328	NP_060798			methyl-CpG binding domain protein 5							chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)														---	---	---	---
KIF5C	3800	broad.mit.edu	37	2	149630757	149630757	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149630757delT	uc010zbu.1	+							NM_004522	NP_004513			kinesin family member 5C						microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	150897237	150897238	+	IGR	INS	-	T	T	rs148299670	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150897237_150897238insT								MMADHC (452907 upstream) : RND3 (427474 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	151585593	151585594	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151585593_151585594delAC								RND3 (241413 upstream) : RBM43 (519135 downstream)																																			---	---	---	---
ARL6IP6	151188	broad.mit.edu	37	2	153590108	153590108	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153590108delT	uc002tyn.2	+						ARL6IP6_uc002tym.2_Intron|ARL6IP6_uc002tyo.2_Intron	NM_152522	NP_689735			ADP-ribosylation-like factor 6 interacting							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	154033609	154033609	+	IGR	DEL	A	-	-	rs67752648		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154033609delA								ARL6IP6 (415842 upstream) : RPRM (300243 downstream)																																			---	---	---	---
TANC1	85461	broad.mit.edu	37	2	160034056	160034056	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160034056delT	uc002uag.2	+						TANC1_uc010fol.1_Intron|TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron|TANC1_uc002uai.1_Intron	NM_033394	NP_203752			tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	164178168	164178168	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164178168delA								KCNH7 (482928 upstream) : FIGN (285950 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	164817452	164817453	+	IGR	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164817452_164817453delAG								FIGN (224939 upstream) : GRB14 (531880 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	164843804	164843805	+	IGR	INS	-	ACAC	ACAC	rs149236709	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164843804_164843805insACAC								FIGN (251291 upstream) : GRB14 (505528 downstream)																																			---	---	---	---
SCN2A	6326	broad.mit.edu	37	2	166233210	166233211	+	Intron	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166233210_166233211delGT	uc002udc.2	+						SCN2A_uc002udd.2_Intron|SCN2A_uc002ude.2_Intron	NM_001040142	NP_001035232			sodium channel, voltage-gated, type II, alpha						myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)													---	---	---	---
TTC21B	79809	broad.mit.edu	37	2	166735191	166735193	+	Intron	DEL	TTT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166735191_166735193delTTT	uc002udk.2	-						TTC21B_uc002udj.1_Intron	NM_024753	NP_079029			tetratricopeptide repeat domain 21B							cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5																		---	---	---	---
C2orf77	129881	broad.mit.edu	37	2	170538995	170538996	+	Intron	INS	-	AC	AC	rs148346001	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170538995_170538996insAC	uc002ufe.2	-							NM_001085447	NP_001078916			hypothetical protein LOC129881												0																		---	---	---	---
MAP1D	254042	broad.mit.edu	37	2	172904577	172904578	+	Intron	INS	-	T	T	rs151301959		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172904577_172904578insT	uc002uhk.2	+						MAP1D_uc010zdw.1_Intron	NM_199227	NP_954697			methionine aminopeptidase 1D precursor						N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis	mitochondrion	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)															---	---	---	---
PDK1	5163	broad.mit.edu	37	2	173489717	173489717	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173489717delA	uc010zea.1	+							NM_002610				pyruvate dehydrogenase kinase 1 precursor						glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|small GTPase mediated signal transduction	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			lung(3)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.12)											Autosomal_Dominant_Polycystic_Kidney_Disease				---	---	---	---
Unknown	0	broad.mit.edu	37	2	174585658	174585659	+	IGR	DEL	CA	-	-	rs66488536		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174585658_174585659delCA								CDCA7 (351940 upstream) : SP3 (187600 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	177122327	177122327	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177122327delT								HOXD1 (66692 upstream) : MTX2 (11796 downstream)																																			---	---	---	---
AGPS	8540	broad.mit.edu	37	2	178366436	178366436	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178366436delC	uc002ull.2	+						AGPS_uc010zfb.1_Intron	NM_003659	NP_003650			alkyldihydroxyacetone phosphate synthase						ether lipid biosynthetic process	peroxisomal matrix|peroxisomal membrane|plasma membrane	alkylglycerone-phosphate synthase activity|flavin adenine dinucleotide binding|oxidoreductase activity			ovary(2)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)															---	---	---	---
PDE11A	50940	broad.mit.edu	37	2	178964008	178964008	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178964008delA	uc002ulr.2	-						PDE11A_uc002ult.1_Intron	NM_001077197	NP_001070665			phosphodiesterase 11A isoform 3						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)											Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				---	---	---	---
PRKRA	8575	broad.mit.edu	37	2	179299152	179299152	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179299152delT	uc002umf.2	-						PRKRA_uc002umc.2_Intron|PRKRA_uc002umd.2_Intron|PRKRA_uc002ume.2_Intron|PRKRA_uc002umg.2_Intron|PRKRA_uc002umh.1_5'Flank	NM_003690	NP_003681			protein kinase, interferon-inducible double						immune response|negative regulation of cell proliferation|production of siRNA involved in RNA interference|response to virus	perinuclear region of cytoplasm	double-stranded RNA binding|enzyme activator activity|protein homodimerization activity			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)															---	---	---	---
SESTD1	91404	broad.mit.edu	37	2	180083094	180083094	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180083094delA	uc002uni.3	-							NM_178123	NP_835224			SEC14 and spectrin domains 1						regulation of calcium ion transport via voltage-gated calcium channel activity		phosphatidic acid binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)															---	---	---	---
ZNF385B	151126	broad.mit.edu	37	2	180696220	180696220	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180696220delA	uc002unn.3	-							NM_152520	NP_689733			zinc finger protein 385B isoform 1							nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	181272643	181272644	+	IGR	INS	-	AC	AC	rs140699271	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181272643_181272644insAC								CWC22 (400803 upstream) : UBE2E3 (572468 downstream)																																			---	---	---	---
PPP1R1C	151242	broad.mit.edu	37	2	182934180	182934181	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182934180_182934181insT	uc002uoo.2	+						PPP1R1C_uc002uon.2_Intron|PPP1R1C_uc002uop.1_Intron|PPP1R1C_uc010frm.1_Intron|PPP1R1C_uc010frn.1_Intron	NM_001080545	NP_001074014			protein phosphatase 1, regulatory (inhibitor)						signal transduction	cytoplasm	protein phosphatase inhibitor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0628)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	184482516	184482521	+	IGR	DEL	TGTCTG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184482516_184482521delTGTCTG								NUP35 (456109 upstream) : ZNF804A (980572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	185805069	185805069	+	IGR	DEL	C	-	-	rs139678901	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185805069delC								ZNF804A (857 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	187811634	187811634	+	IGR	DEL	A	-	-	rs71396896		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187811634delA								ZSWIM2 (97737 upstream) : CALCRL (396217 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	188134678	188134678	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188134678delA								ZSWIM2 (420781 upstream) : CALCRL (73173 downstream)																																			---	---	---	---
COL5A2	1290	broad.mit.edu	37	2	190031057	190031057	+	Intron	DEL	T	-	-	rs75272179		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190031057delT	uc002uqk.2	-							NM_000393	NP_000384			alpha 2 type V collagen preproprotein						axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)															---	---	---	---
HIBCH	26275	broad.mit.edu	37	2	191169406	191169406	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191169406delA	uc002uru.2	-						HIBCH_uc002urv.2_Intron	NM_014362	NP_055177			3-hydroxyisobutyryl-Coenzyme A hydrolase isoform						branched chain family amino acid catabolic process	mitochondrial matrix	3-hydroxyisobutyryl-CoA hydrolase activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)															---	---	---	---
GLS	2744	broad.mit.edu	37	2	191766366	191766367	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191766366_191766367insA	uc002usf.2	+						GLS_uc002use.2_Intron	NM_014905	NP_055720			glutaminase precursor						cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)													---	---	---	---
MYO1B	4430	broad.mit.edu	37	2	192205947	192205948	+	Intron	INS	-	T	T	rs148754100	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192205947_192205948insT	uc010fsg.2	+						MYO1B_uc002usq.2_Intron|MYO1B_uc002usr.2_Intron|MYO1B_uc002uss.1_Intron	NM_001130158	NP_001123630			myosin IB isoform 1							myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	192620872	192620879	+	IGR	DEL	TCTCTCTC	-	-	rs139520765		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192620872_192620879delTCTCTCTC								OBFC2A (67625 upstream) : SDPR (78162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	195300031	195300031	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195300031delT								None (None upstream) : None (None downstream)																																			---	---	---	---
ANKRD44	91526	broad.mit.edu	37	2	197974452	197974452	+	Intron	DEL	G	-	-	rs10708281		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197974452delG	uc002uuc.2	-						ANKRD44_uc002utz.3_Intron|ANKRD44_uc002uua.1_Intron|ANKRD44_uc002uub.2_Intron|ANKRD44_uc010zgw.1_Intron	NM_153697	NP_710181			ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)															---	---	---	---
RFTN2	130132	broad.mit.edu	37	2	198463683	198463683	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198463683delT	uc002uuo.3	-							NM_144629	NP_653230			raftlin family member 2							plasma membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	201166460	201166461	+	IGR	INS	-	TT	TT	rs72542089		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201166460_201166461insTT								C2orf47 (337615 upstream) : SPATS2L (4143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	204672025	204672025	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204672025delA								CD28 (69469 upstream) : CTLA4 (60484 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	205189613	205189613	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205189613delA								ICOS (363317 upstream) : PARD3B (220903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	205357888	205357889	+	IGR	INS	-	GT	GT			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205357888_205357889insGT								ICOS (531592 upstream) : PARD3B (52627 downstream)																																			---	---	---	---
FAM119A	151194	broad.mit.edu	37	2	208482589	208482589	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208482589delA	uc002vcf.2	-						FAM119A_uc002vce.2_Intron|FAM119A_uc010fuk.1_Intron|FAM119A_uc002vcg.3_Intron	NM_145280	NP_660323			hypothetical protein LOC151194							integral to membrane	methyltransferase activity				0				LUSC - Lung squamous cell carcinoma(261;0.0705)|Epithelial(149;0.131)|Lung(261;0.135)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	209066928	209066928	+	IGR	DEL	A	-	-	rs78544156		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209066928delA								C2orf80 (12155 upstream) : IDH1 (34026 downstream)																																			---	---	---	---
PIKFYVE	200576	broad.mit.edu	37	2	209172297	209172298	+	Intron	DEL	TT	-	-	rs113792351		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209172297_209172298delTT	uc002vcz.2	+						PIKFYVE_uc010fun.1_Intron|PIKFYVE_uc002vcy.1_Intron	NM_015040	NP_055855			phosphatidylinositol-3-phosphate 5-kinase type						cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10																		---	---	---	---
ERBB4	2066	broad.mit.edu	37	2	212256040	212256040	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212256040delT	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron	NM_005235	NP_005226			v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)											TSP Lung(8;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	2	213820438	213820439	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213820438_213820439insA								ERBB4 (417086 upstream) : IKZF2 (43974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	214084045	214084045	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214084045delT								IKZF2 (67712 upstream) : SPAG16 (65071 downstream)																																			---	---	---	---
SPAG16	79582	broad.mit.edu	37	2	214678745	214678746	+	Intron	DEL	GA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214678745_214678746delGA	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808			sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)														---	---	---	---
SPAG16	79582	broad.mit.edu	37	2	215059968	215059968	+	Intron	DEL	A	-	-	rs36171946		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215059968delA	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808			sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)														---	---	---	---
VWC2L	402117	broad.mit.edu	37	2	215406008	215406009	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215406008_215406009insA	uc002vet.2	+						VWC2L_uc010zjl.1_Intron	NM_001080500	NP_001073969			von Willebrand factor C domain-containing							extracellular region					0																		---	---	---	---
ABCA12	26154	broad.mit.edu	37	2	215957249	215957249	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215957249delT	uc002vew.2	-						ABCA12_uc010zjn.1_Intron	NM_173076	NP_775099			ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	216223393	216223393	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216223393delA								ATIC (8916 upstream) : FN1 (1788 downstream)																																			---	---	---	---
TNS1	7145	broad.mit.edu	37	2	218844251	218844252	+	Intron	INS	-	AC	AC	rs141634918	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218844251_218844252insAC	uc010fvk.1	-						TNS1_uc002vgv.1_5'Flank	NM_022648	NP_072174			tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)														---	---	---	---
RUFY4	285180	broad.mit.edu	37	2	218942927	218942927	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218942927delT	uc002vgw.2	+						RUFY4_uc002vgy.1_Intron|RUFY4_uc010fvl.1_Intron	NM_198483	NP_940885			RUN and FYVE domain containing 4								metal ion binding			pancreas(1)	1		Renal(207;0.0915)		Epithelial(149;4.11e-06)|all cancers(144;0.000519)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)														---	---	---	---
ACCN4	55515	broad.mit.edu	37	2	220400160	220400163	+	Intron	DEL	TGTG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220400160_220400163delTGTG	uc002vma.2	+						ACCN4_uc002vlz.2_Intron|ACCN4_uc002vmb.2_Intron	NM_182847	NP_878267			amiloride-sensitive cation channel 4 isoform 2							integral to plasma membrane	sodium channel activity|sodium ion transmembrane transporter activity			ovary(2)	2		Renal(207;0.0183)		Epithelial(149;5.47e-10)|all cancers(144;9e-08)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.0086)|READ - Rectum adenocarcinoma(5;0.156)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	220934186	220934186	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220934186delT								SLC4A3 (427485 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	221801177	221801180	+	IGR	DEL	ACAC	-	-	rs142397101		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221801177_221801180delACAC								None (None upstream) : EPHA4 (481569 downstream)																																			---	---	---	---
EPHA4	2043	broad.mit.edu	37	2	222429296	222429297	+	Intron	INS	-	T	T	rs144228279	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222429296_222429297insT	uc002vmq.2	-						EPHA4_uc002vmr.2_Intron|EPHA4_uc010zlm.1_Intron|EPHA4_uc010zln.1_Intron	NM_004438	NP_004429			ephrin receptor EphA4 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	222467686	222467686	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222467686delT								EPHA4 (28764 upstream) : PAX3 (596921 downstream)																																			---	---	---	---
MOGAT1	116255	broad.mit.edu	37	2	223537981	223537981	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223537981delT	uc010fws.1	+							NM_058165	NP_477513			monoacylglycerol O-acyltransferase 1						glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			breast(1)	1		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;2.06e-07)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0105)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	225491727	225491728	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225491727_225491728delCA								CUL3 (41617 upstream) : DOCK10 (138079 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	225497703	225497703	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225497703delC								CUL3 (47593 upstream) : DOCK10 (132104 downstream)																																			---	---	---	---
COL4A4	1286	broad.mit.edu	37	2	227916907	227916908	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227916907_227916908insA	uc010zlt.1	-							NM_000092	NP_000083			alpha 4 type IV collagen precursor						axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	229638277	229638278	+	IGR	INS	-	G	G	rs143466491	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229638277_229638278insG								SPHKAP (591916 upstream) : PID1 (250412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	231016979	231016979	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231016979delG								FBXO36 (68963 upstream) : SP110 (16666 downstream)																																			---	---	---	---
SP140L	93349	broad.mit.edu	37	2	231227321	231227322	+	Intron	INS	-	AGCT	AGCT	rs138776393	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231227321_231227322insAGCT	uc010fxm.1	+						SP140L_uc010fxn.1_Intron	NM_138402	NP_612411			SP140 nuclear body protein-like							nucleus	DNA binding|metal ion binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	231423749	231423750	+	IGR	INS	-	CA	CA	rs143357053	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231423749_231423750insCA								SP100 (13432 upstream) : CAB39 (153807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	231744617	231744618	+	IGR	INS	-	T	T	rs112525130		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231744617_231744618insT								ITM2C (655 upstream) : GPR55 (27416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	232784798	232784799	+	IGR	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232784798_232784799delGT								MIR1471 (27790 upstream) : NPPC (5336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	235777149	235777150	+	IGR	INS	-	TGTGTGTG	TGTGTGTG	rs138986572	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235777149_235777150insTGTGTGTG								ARL4C (371456 upstream) : SH3BP4 (83478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	236253428	236253429	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236253428_236253429delCA								SH3BP4 (289072 upstream) : AGAP1 (149307 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	236316599	236316599	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236316599delA								SH3BP4 (352243 upstream) : AGAP1 (86137 downstream)																																			---	---	---	---
HDAC4	9759	broad.mit.edu	37	2	240225292	240225292	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240225292delT	uc002vyk.3	-						HDAC4_uc010fza.2_Intron|hsa-mir-4269|MI0015875_5'Flank	NM_006037	NP_006028			histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	241171247	241171248	+	IGR	INS	-	A	A	rs149960170	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241171247_241171248insA								OTOS (91174 upstream) : GPC1 (203867 downstream)																																			---	---	---	---
SNED1	25992	broad.mit.edu	37	2	241947862	241947862	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241947862delG	uc002wah.1	+							NM_001080437	NP_001073906			6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)														---	---	---	---
STK25	10494	broad.mit.edu	37	2	242435659	242435662	+	Intron	DEL	AAGG	-	-	rs33918796		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242435659_242435662delAAGG	uc002wbm.2	-						STK25_uc002wbk.2_Intron|STK25_uc002wbl.2_3'UTR|STK25_uc002wbn.2_Intron|STK25_uc002wbo.2_Intron|STK25_uc010zos.1_Intron|STK25_uc010zot.1_Intron|STK25_uc002wbp.2_Intron|STK25_uc010fzo.2_Intron|STK25_uc010zou.1_Intron|STK25_uc010zov.1_Intron	NM_006374	NP_006365			serine/threonine kinase 25						response to oxidative stress|signal transduction	Golgi apparatus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity				0		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	87751	87751	+	IGR	DEL	C	-	-	rs35693328		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87751delC								None (None upstream) : CHL1 (150899 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	647194	647195	+	Intron	INS	-	T	T	rs150385034	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:647194_647195insT	uc003boy.1	+											Homo sapiens cDNA FLJ44328 fis, clone TRACH3002871.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	6130839	6130840	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6130839_6130840insA								EDEM1 (869190 upstream) : GRM7 (771962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	6651004	6651005	+	Intron	INS	-	CTA	CTA	rs147704105	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6651004_6651005insCTA	uc003bqj.1	+											Homo sapiens clone P1 NTera2D1 teratocarcinoma mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	7834722	7834723	+	IGR	INS	-	A	A	rs150064935	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7834722_7834723insA								GRM7 (51504 upstream) : LMCD1 (708788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	7838965	7838974	+	IGR	DEL	TGTGTGTGTG	-	-	rs111910823		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7838965_7838974delTGTGTGTGTG								GRM7 (55747 upstream) : LMCD1 (704537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	8067662	8067662	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8067662delT								GRM7 (284444 upstream) : LMCD1 (475849 downstream)																																			---	---	---	---
SETD5	55209	broad.mit.edu	37	3	9488178	9488178	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9488178delT	uc003brt.2	+						SETD5_uc003brs.1_Intron|SETD5_uc003bru.2_Intron|SETD5_uc003brv.2_Intron|SETD5_uc010hck.2_Intron|SETD5_uc003brx.2_Intron	NM_001080517	NP_001073986			SET domain containing 5											ovary(2)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)														---	---	---	---
ATP2B2	491	broad.mit.edu	37	3	10696465	10696465	+	Intron	DEL	A	-	-	rs35200753		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10696465delA	uc003bvw.2	-							NM_001683	NP_001674			plasma membrane calcium ATPase 2 isoform 2						ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
SLC6A11	6538	broad.mit.edu	37	3	10924887	10924887	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10924887delA	uc003bvz.2	+							NM_014229	NP_055044			solute carrier family 6 (neurotransmitter						neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.229)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	12009086	12009089	+	IGR	DEL	TCTA	-	-	rs62756361		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12009086_12009089delTCTA								C3orf31 (120734 upstream) : SYN2 (36773 downstream)																																			---	---	---	---
PPARG	5468	broad.mit.edu	37	3	12383316	12383316	+	Intron	DEL	A	-	-	rs147932365		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12383316delA	uc003bwr.2	+						PPARG_uc003bws.2_Intron|PPARG_uc003bwu.2_Intron|PPARG_uc003bwv.2_Intron|PPARG_uc003bwq.1_Intron|PPARG_uc010hdz.1_Intron|PPARG_uc003bwt.1_Intron	NM_138712	NP_619726			peroxisome proliferative activated receptor						activation of caspase activity|cell fate commitment|cell maturation|cellular response to insulin stimulus|epithelial cell differentiation|glucose homeostasis|induction of apoptosis|innate immune response|lipid homeostasis|lipoprotein transport|long-chain fatty acid transport|low-density lipoprotein particle receptor biosynthetic process|monocyte differentiation|negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|placenta development|positive regulation of fat cell differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to lipid|response to low-density lipoprotein particle stimulus|white fat cell differentiation	cytosol|nucleoplasm	activating transcription factor binding|arachidonic acid binding|drug binding|enzyme binding|prostaglandin receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|kidney(1)	2					Atorvastatin(DB01076)|Icosapent(DB00159)|Pioglitazone(DB01132)|Rosiglitazone(DB00412)|Troglitazone(DB00197)			T	PAX8	follicular thyroid		Insulin resistance ; lipodystrophy|familial partial L;diabetes mellitus|insulin-resistantI|with acanthosis nigricans and hypertension						---	---	---	---
MKRN2	23609	broad.mit.edu	37	3	12622504	12622504	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12622504delT	uc003bxd.2	+						MKRN2_uc003bxe.2_Intron|MKRN2_uc011aus.1_Intron	NM_014160	NP_054879			makorin ring finger protein 2							intracellular	ligase activity|nucleic acid binding|zinc ion binding				0																		---	---	---	---
RAF1	5894	broad.mit.edu	37	3	12681946	12681946	+	Intron	DEL	G	-	-	rs66659845		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12681946delG	uc003bxf.3	-						RAF1_uc011auu.1_Intron	NM_002880	NP_002871			v-raf-1 murine leukemia viral oncogene homolog						activation of MAPKK activity|apoptosis|axon guidance|cell proliferation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of peptidyl-serine phosphorylation|Ras protein signal transduction|synaptic transmission	cytosol|mitochondrial outer membrane|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity		ESRP1/RAF1(4)|SRGAP3/RAF1(4)	central_nervous_system(4)|prostate(4)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|liver(1)|ovary(1)	14					Sorafenib(DB00398)			T	SRGAP3	pilocytic astrocytoma				Noonan_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	3	12717491	12717491	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12717491delA								RAF1 (11791 upstream) : TMEM40 (57901 downstream)																																			---	---	---	---
ANKRD28	23243	broad.mit.edu	37	3	15879402	15879402	+	Intron	DEL	A	-	-	rs150917481		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15879402delA	uc003caj.1	-						ANKRD28_uc003cak.1_Intron	NM_015199	NP_056014			ankyrin repeat domain 28							nucleoplasm	protein binding			breast(1)	1																		---	---	---	---
PLCL2	23228	broad.mit.edu	37	3	17028549	17028549	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17028549delT	uc011awc.1	+						PLCL2_uc010het.1_Intron|PLCL2_uc011awd.1_Intron	NM_001144382	NP_001137854			phospholipase C-like 2 isoform 1						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(2)|ovary(1)|lung(1)	4																		---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17308890	17308890	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17308890delG	uc003cbf.2	-						TBC1D5_uc010heu.2_Intron|TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron|TBC1D5_uc010hew.1_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17613658	17613659	+	Intron	DEL	CT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17613658_17613659delCT	uc003cbf.2	-						TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17741306	17741306	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17741306delA	uc003cbf.2	-						TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	20640355	20640355	+	IGR	DEL	T	-	-	rs35956699		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20640355delT								SGOL1 (412672 upstream) : VENTXP7 (806863 downstream)																																			---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	22182767	22182768	+	Intron	INS	-	A	A	rs139714134	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22182767_22182768insA	uc010hfb.1	-											Homo sapiens cDNA: FLJ22419 fis, clone HRC08593.							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	23726107	23726112	+	IGR	DEL	TGTTGT	-	-	rs111418072		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23726107_23726112delTGTTGT								UBE2E2 (93811 upstream) : UBE2E1 (121327 downstream)																																			---	---	---	---
THRB	7068	broad.mit.edu	37	3	24401393	24401394	+	Intron	INS	-	A	A	rs147319546	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24401393_24401394insA	uc003ccx.3	-						THRB_uc010hfe.2_Intron|THRB_uc003ccy.3_Intron|THRB_uc003ccz.3_Intron|THRB_uc003cdc.2_Intron|THRB_uc003cdd.2_Intron|THRB_uc003cde.1_Intron	NM_001128176	NP_001121648			thyroid hormone receptor, beta						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription corepressor activity|zinc ion binding			skin(2)|pancreas(1)	3					Levothyroxine(DB00451)|Liothyronine(DB00279)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	24855375	24855376	+	IGR	INS	-	T	T	rs113430791		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24855375_24855376insT								THRB (318922 upstream) : RARB (360447 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	25176386	25176386	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25176386delT								THRB (639933 upstream) : RARB (39437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	25939411	25939422	+	IGR	DEL	ACACACACACAC	-	-	rs5847377		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25939411_25939422delACACACACACAC								OXSM (103387 upstream) : LRRC3B (724878 downstream)																																			---	---	---	---
TGFBR2	7048	broad.mit.edu	37	3	30678556	30678556	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30678556delA	uc003ceo.2	+						TGFBR2_uc003cen.2_Intron	NM_003242	NP_003233			transforming growth factor, beta receptor II						activation of protein kinase activity|brain development|embryonic cranial skeleton morphogenesis|embryonic hemopoiesis|heart development|myeloid dendritic cell differentiation|palate development|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of B cell tolerance induction|positive regulation of mesenchymal cell proliferation|positive regulation of NK T cell differentiation|positive regulation of reactive oxygen species metabolic process|positive regulation of T cell tolerance induction|positive regulation of tolerance induction to self antigen|response to cholesterol|response to drug|transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|vasculogenesis	caveola|external side of plasma membrane	ATP binding|glycosaminoglycan binding|metal ion binding|protein binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type II|type I transforming growth factor beta receptor binding|type I transforming growth factor beta receptor binding|type III transforming growth factor beta receptor binding			pancreas(9)|large_intestine(6)|stomach(4)|lung(3)|ovary(3)|central_nervous_system(1)	26																		---	---	---	---
TRIM71	131405	broad.mit.edu	37	3	32896855	32896855	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32896855delT	uc003cff.2	+							NM_001039111	NP_001034200			tripartite motif-containing 71						multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
FBXL2	25827	broad.mit.edu	37	3	33342202	33342203	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33342202_33342203insT	uc003cfp.2	+						FBXL2_uc011axm.1_Intron|FBXL2_uc011axn.1_Intron|FBXL2_uc011axo.1_Intron|FBXL2_uc011axp.1_Intron|FBXL2_uc011axq.1_Intron|FBXL2_uc011axr.1_Intron|FBXL2_uc011axs.1_Intron	NM_012157	NP_036289			F-box and leucine-rich repeat protein 2						interspecies interaction between organisms|proteolysis	cytoplasm|membrane	protein binding|ubiquitin-protein ligase activity			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	34074736	34074737	+	IGR	INS	-	T	T	rs144420971		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34074736_34074737insT								PDCD6IP (163542 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	35984923	35984924	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35984923_35984924delAC								ARPP21 (148936 upstream) : STAC (437173 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	36611328	36611328	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36611328delT								STAC (21832 upstream) : DCLK3 (142585 downstream)																																			---	---	---	---
LRRFIP2	9209	broad.mit.edu	37	3	37126213	37126213	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37126213delA	uc003cgp.2	-						LRRFIP2_uc011ayf.1_Intron|LRRFIP2_uc003cgr.2_Intron|LRRFIP2_uc003cgs.3_Intron|LRRFIP2_uc003cgt.3_Intron	NM_006309	NP_006300			leucine rich repeat (in FLII) interacting						Wnt receptor signaling pathway		LRR domain binding			ovary(1)	1																		---	---	---	---
SCN11A	11280	broad.mit.edu	37	3	38948822	38948835	+	Intron	DEL	TGTGTGTGTGTGTA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38948822_38948835delTGTGTGTGTGTGTA	uc011ays.1	-							NM_014139	NP_054858			sodium channel, voltage-gated, type XI, alpha						response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)													---	---	---	---
MYRIP	25924	broad.mit.edu	37	3	40222599	40222599	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40222599delT	uc003cka.2	+						MYRIP_uc010hhu.2_Intron|MYRIP_uc010hhv.2_Intron|MYRIP_uc010hhw.2_Intron|MYRIP_uc011ayz.1_Intron|uc003ckb.2_Intron	NM_015460	NP_056275			myosin VIIA and Rab interacting protein						intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)														---	---	---	---
ZNF619	285267	broad.mit.edu	37	3	40524783	40524784	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40524783_40524784insT	uc011azb.1	+						ZNF619_uc010hhz.2_Intron|ZNF619_uc003ckj.2_Intron|ZNF619_uc011azc.1_Intron|ZNF619_uc011azd.1_Intron|ZNF619_uc011aza.1_Intron	NM_001145082	NP_001138554			zinc finger protein 619 isoform 1						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	40615080	40615081	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40615080_40615081insT								ZNF621 (34037 upstream) : CTNNB1 (621320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	42482355	42482355	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42482355delA								LYZL4 (30290 upstream) : VIPR1 (61749 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	42494363	42494363	+	IGR	DEL	T	-	-	rs35302324		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42494363delT								LYZL4 (42298 upstream) : VIPR1 (49741 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	43780740	43780740	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43780740delG								ABHD5 (16524 upstream) : MIR138-1 (374964 downstream)																																			---	---	---	---
SACM1L	22908	broad.mit.edu	37	3	45755732	45755733	+	Intron	DEL	TG	-	-	rs139094720	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45755732_45755733delTG	uc003cos.2	+						SACM1L_uc011bag.1_Intron|SACM1L_uc011bah.1_Intron	NM_014016	NP_054735			suppressor of actin 1							Golgi apparatus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)														---	---	---	---
FYCO1	79443	broad.mit.edu	37	3	46020350	46020351	+	Intron	INS	-	T	T	rs35365813		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46020350_46020351insT	uc003cpb.3	-						FYCO1_uc011bal.1_Intron	NM_024513	NP_078789			FYVE and coiled-coil domain containing 1						transport	integral to membrane	metal ion binding|protein binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)														---	---	---	---
SETD2	29072	broad.mit.edu	37	3	47180300	47180300	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47180300delC	uc003cqs.2	-						SETD2_uc003cqv.2_Intron	NM_014159	NP_054878			SET domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)				N|F|S|Mis		clear cell renal carcinoma								---	---	---	---
KLHL18	23276	broad.mit.edu	37	3	47352504	47352504	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47352504delT	uc003crd.2	+						KLHL18_uc003crc.2_Intron|KLHL18_uc011bav.1_Intron	NM_025010	NP_079286			kelch-like 18												0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)														---	---	---	---
MAP4	4134	broad.mit.edu	37	3	48026767	48026768	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48026767_48026768insA	uc003csb.2	-						MAP4_uc003csc.3_Intron|MAP4_uc011bbf.1_Intron|MAP4_uc003csf.3_Intron|MAP4_uc003csg.2_Intron	NM_002375	NP_002366			microtubule-associated protein 4 isoform 1						negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)														---	---	---	---
RBM6	10180	broad.mit.edu	37	3	50113407	50113407	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50113407delT	uc003cyc.2	+						RBM6_uc003cyd.2_Intron|RBM6_uc003cye.2_Intron|RBM6_uc011bdi.1_Intron|RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron	NM_005777	NP_005768			RNA binding motif protein 6						RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)														---	---	---	---
DOCK3	1795	broad.mit.edu	37	3	51209147	51209147	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51209147delA	uc011bds.1	+							NM_004947	NP_004938			dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	51702082	51702083	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51702082_51702083delTG								RAD54L2 (4472 upstream) : TEX264 (3139 downstream)																																			---	---	---	---
POC1A	25886	broad.mit.edu	37	3	52141753	52141753	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52141753delT	uc003dcu.2	-						POC1A_uc003dcv.2_Intron|POC1A_uc003dcw.2_Intron	NM_015426	NP_056241			WD repeat domain 51A isoform 1							centriole|microtubule basal body					0																		---	---	---	---
SFMBT1	51460	broad.mit.edu	37	3	53058137	53058137	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53058137delA	uc003dgf.2	-						SFMBT1_uc003dgg.2_Intron|SFMBT1_uc003dgh.2_Intron	NM_001005159	NP_001005159			Scm-like with four mbt domains 1						regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	53417699	53417703	+	IGR	DEL	AATTC	-	-	rs140711808		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53417699_53417703delAATTC								DCP1A (36062 upstream) : CACNA1D (111328 downstream)																																			---	---	---	---
CACNA1D	776	broad.mit.edu	37	3	53536496	53536496	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53536496delT	uc003dgv.3	+						CACNA1D_uc003dgu.3_Intron|CACNA1D_uc003dgy.3_Intron	NM_001128840	NP_001122312			calcium channel, voltage-dependent, L type,						axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)													---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54905806	54905807	+	Intron	INS	-	TTT	TTT	rs146585375	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54905806_54905807insTTT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	55056595	55056598	+	Intron	DEL	TTCC	-	-	rs72170562		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55056595_55056598delTTCC	uc003dhf.2	+						CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
ERC2	26059	broad.mit.edu	37	3	55977550	55977550	+	Intron	DEL	T	-	-	rs35782784		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55977550delT	uc003dhr.1	-						ERC2_uc003dhq.1_Intron|ERC2_uc003dht.1_Intron	NM_015576	NP_056391			cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	57242376	57242379	+	IGR	DEL	TTGA	-	-	rs72466742		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57242376_57242379delTTGA								HESX1 (8096 upstream) : APPL1 (19386 downstream)																																			---	---	---	---
DNAH12	201625	broad.mit.edu	37	3	57394482	57394482	+	Intron	DEL	C	-	-	rs10715726		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57394482delC	uc003dit.2	-							NM_178504	NP_848599			dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2																		---	---	---	---
DNAH12	201625	broad.mit.edu	37	3	57527259	57527260	+	Intron	INS	-	T	T	rs74676125		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57527259_57527260insT	uc003dit.2	-						DNAH12_uc003diu.2_Intron	NM_178504	NP_848599			dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2																		---	---	---	---
C3orf67	200844	broad.mit.edu	37	3	58758745	58758745	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58758745delT	uc003dkt.1	-						C3orf67_uc003dkr.1_Intron|C3orf67_uc003dks.1_Intron	NM_198463	NP_940865			hypothetical protein LOC200844												0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	59054948	59054949	+	IGR	INS	-	TGTGTG	TGTGTG	rs149142532	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59054948_59054949insTGTGTG								C3orf67 (19190 upstream) : FHIT (680089 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	59275767	59275767	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59275767delG								C3orf67 (240009 upstream) : FHIT (459271 downstream)																																			---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	61923613	61923613	+	Intron	DEL	T	-	-	rs113890122		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61923613delT	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron	NM_002841	NP_002832			protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	61951287	61951294	+	Intron	DEL	TCATTCAT	-	-	rs66774059		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61951287_61951294delTCATTCAT	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron	NM_002841	NP_002832			protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
CADPS	8618	broad.mit.edu	37	3	62539394	62539394	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62539394delG	uc003dll.2	-						CADPS_uc003dlk.1_Intron|CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707			Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	62868929	62868930	+	IGR	INS	-	T	T	rs138462039	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62868929_62868930insT								CADPS (7865 upstream) : LOC285401 (67203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	63216529	63216529	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63216529delT								LOC285401 (105794 upstream) : SYNPR (47385 downstream)																																			---	---	---	---
MAGI1	9223	broad.mit.edu	37	3	65516300	65516311	+	Intron	DEL	GTGTGTGTGTGT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65516300_65516311delGTGTGTGTGTGT	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc010hny.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229			membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)														---	---	---	---
SLC25A26	115286	broad.mit.edu	37	3	66295675	66295675	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66295675delA	uc011bfq.1	+						SLC25A26_uc011bfs.1_Intron|SLC25A26_uc011bft.1_Intron|SLC25A26_uc011bfr.1_Intron|SLC25A26_uc003dmt.2_Intron	NM_173471	NP_775742			solute carrier family 25, member 26 isoform a							integral to membrane|mitochondrial inner membrane|nucleus	S-adenosylmethionine transmembrane transporter activity			pancreas(1)	1		Lung NSC(201;0.00774)		BRCA - Breast invasive adenocarcinoma(55;0.00046)|KIRC - Kidney renal clear cell carcinoma(15;0.0515)|Kidney(15;0.0648)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	71815105	71815106	+	IGR	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71815105_71815106delAG								GPR27 (10778 upstream) : PROK2 (5701 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	74151183	74151184	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74151183_74151184insA								PDZRN3 (477111 upstream) : CNTN3 (160538 downstream)																																			---	---	---	---
CNTN3	5067	broad.mit.edu	37	3	74379507	74379507	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74379507delA	uc003dpm.1	-							NM_020872	NP_065923			contactin 3 precursor						cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	74753575	74753576	+	IGR	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74753575_74753576delTC								CNTN3 (183232 upstream) : FAM86D (717129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75275064	75275065	+	IGR	INS	-	A	A	rs148662216	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75275064_75275065insA								CNTN3 (704721 upstream) : FAM86D (195640 downstream)																																			---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77295478	77295479	+	Intron	INS	-	TGTG	TGTG	rs144038393	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77295478_77295479insTGTG	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933			roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77621650	77621650	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77621650delT	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933			roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	78059908	78059908	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78059908delT								ROBO2 (363247 upstream) : ROBO1 (586480 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	78563086	78563086	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78563086delA								ROBO2 (866425 upstream) : ROBO1 (83302 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	80931225	80931225	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80931225delC								None (None upstream) : GBE1 (607625 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	95849578	95849579	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95849578_95849579delCA								LOC255025 (954499 upstream) : EPHA6 (683846 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	96155054	96155055	+	IGR	INS	-	AGTT	AGTT	rs147792309	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96155054_96155055insAGTT								None (None upstream) : EPHA6 (378370 downstream)																																			---	---	---	---
ST3GAL6	10402	broad.mit.edu	37	3	98469889	98469889	+	Intron	DEL	T	-	-	rs34523669		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98469889delT	uc003dsz.2	+						ST3GAL6_uc003dsy.2_Intron|ST3GAL6_uc003dta.2_Intron|ST3GAL6_uc003dtb.2_Intron|ST3GAL6_uc003dtc.2_Intron|ST3GAL6_uc010hpd.2_Intron	NM_006100	NP_006091			alpha2,3-sialyltransferase VI						amino sugar metabolic process|glycolipid metabolic process|protein glycosylation|protein lipoylation	integral to Golgi membrane	sialyltransferase activity			ovary(1)	1																		---	---	---	---
DCBLD2	131566	broad.mit.edu	37	3	98557997	98557998	+	Intron	INS	-	TC	TC	rs71124003		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98557997_98557998insTC	uc003dtd.2	-						DCBLD2_uc003dte.2_Intron	NM_080927	NP_563615			discoidin, CUB and LCCL domain containing 2						cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
ABI3BP	25890	broad.mit.edu	37	3	100553624	100553624	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100553624delA	uc003dun.2	-						ABI3BP_uc003duo.2_Intron|ABI3BP_uc003duk.2_Intron|ABI3BP_uc003dul.2_Intron|ABI3BP_uc011bhd.1_Intron|ABI3BP_uc003dum.2_Intron	NM_015429	NP_056244			ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4																		---	---	---	---
SENP7	57337	broad.mit.edu	37	3	101146795	101146796	+	Intron	INS	-	T	T	rs150999630	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101146795_101146796insT	uc003dut.2	-						SENP7_uc003duu.2_Intron|SENP7_uc003duv.2_Intron|SENP7_uc003duw.2_Intron|SENP7_uc003dux.2_Intron	NM_020654	NP_065705			sentrin/SUMO-specific protease 7 isoform 1						proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5																		---	---	---	---
ZPLD1	131368	broad.mit.edu	37	3	102009301	102009301	+	Intron	DEL	T	-	-	rs143589919		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102009301delT	uc003dvs.1	+							NM_175056	NP_778226			zona pellucida-like domain containing 1							integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	102847935	102847936	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102847935_102847936insA								ZPLD1 (649250 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	103556304	103556305	+	IGR	DEL	AA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103556304_103556305delAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	104384658	104384658	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104384658delT								None (None upstream) : ALCAM (701055 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	104714687	104714688	+	IGR	DEL	TG	-	-	rs72454225		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104714687_104714688delTG								None (None upstream) : ALCAM (371025 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	105349044	105349045	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105349044_105349045insT								ALCAM (53301 upstream) : CBLB (28065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	105622786	105622786	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105622786delG								CBLB (34520 upstream) : LOC100302640 (932874 downstream)																																			---	---	---	---
DZIP3	9666	broad.mit.edu	37	3	108386207	108386207	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108386207delG	uc003dxd.2	+						DZIP3_uc003dxf.1_Intron|DZIP3_uc011bhm.1_Intron	NM_014648	NP_055463			DAZ interacting protein 3, zinc finger						protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
TRAT1	50852	broad.mit.edu	37	3	108571244	108571245	+	Intron	DEL	GC	-	-	rs149759656	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108571244_108571245delGC	uc003dxi.1	+						TRAT1_uc010hpx.1_Intron	NM_016388	NP_057472			T-cell receptor interacting molecule						cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1																		---	---	---	---
TRAT1	50852	broad.mit.edu	37	3	108571245	108571248	+	Intron	DEL	CACA	-	-	rs143212751		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108571245_108571248delCACA	uc003dxi.1	+						TRAT1_uc010hpx.1_Intron	NM_016388	NP_057472			T-cell receptor interacting molecule						cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1																		---	---	---	---
TMPRSS7	344805	broad.mit.edu	37	3	111774301	111774302	+	Intron	INS	-	ACAC	ACAC	rs142185504	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111774301_111774302insACAC	uc010hqb.2	+						TMPRSS7_uc011bhr.1_Intron	NM_001042575	NP_001036040			transmembrane protease, serine 7						proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2																		---	---	---	---
DRD3	1814	broad.mit.edu	37	3	113893595	113893595	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113893595delT	uc003ebd.2	-						DRD3_uc010hqn.1_Intron|DRD3_uc003ebb.1_Intron|DRD3_uc003ebc.1_Intron	NM_000796	NP_000787			dopamine receptor D3 isoform a						activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)													---	---	---	---
ZBTB20	26137	broad.mit.edu	37	3	114629153	114629154	+	Intron	DEL	CA	-	-	rs72315999		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114629153_114629154delCA	uc003ebm.2	-						ZBTB20_uc003ebn.2_Intron|ZBTB20_uc003ebp.2_Intron	NM_015642	NP_056457			zinc finger and BTB domain containing 20 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)														---	---	---	---
GAP43	2596	broad.mit.edu	37	3	115378466	115378469	+	Intron	DEL	AGAG	-	-	rs10560003		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115378466_115378469delAGAG	uc003ebq.2	+						GAP43_uc003ebr.2_Intron	NM_002045	NP_002036			growth associated protein 43 isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	116579333	116579333	+	IGR	DEL	G	-	-	rs113362470		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116579333delG								LOC285194 (143448 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	117110092	117110092	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117110092delT								LOC285194 (674207 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	118202070	118202071	+	IGR	INS	-	TG	TG	rs151007816	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118202070_118202071insTG								None (None upstream) : IGSF11 (417410 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	119979568	119979568	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119979568delA								GPR156 (16243 upstream) : LRRC58 (64008 downstream)																																			---	---	---	---
STXBP5L	9515	broad.mit.edu	37	3	120659192	120659192	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120659192delG	uc003eec.3	+						STXBP5L_uc011bji.1_Intron	NM_014980	NP_055795			syntaxin binding protein 5-like						exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)														---	---	---	---
DIRC2	84925	broad.mit.edu	37	3	122525555	122525556	+	Intron	INS	-	T	T	rs35035359		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122525555_122525556insT	uc003efw.3	+						DIRC2_uc010hrl.2_Intron|DIRC2_uc010hrm.2_Intron	NM_032839	NP_116228			disrupted in renal carcinoma 2						transport	integral to membrane					0				GBM - Glioblastoma multiforme(114;0.0614)														---	---	---	---
CHCHD6	84303	broad.mit.edu	37	3	126654862	126654862	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126654862delA	uc003ejf.1	+						CHCHD6_uc010hsj.1_Intron	NM_032343	NP_115719			coiled-coil-helix-coiled-coil-helix domain												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	126904167	126904168	+	IGR	INS	-	CT	CT	rs141361934	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126904167_126904168insCT								PLXNA1 (147939 upstream) : TPRA1 (387740 downstream)																																			---	---	---	---
ALG1L2	644974	broad.mit.edu	37	3	129805639	129805640	+	Intron	DEL	CT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129805639_129805640delCT	uc011bld.1	+						ALG1L2_uc010hth.2_Intron	NM_001136152	NP_001129624			asparagine-linked glycosylation 1-like 2						biosynthetic process		transferase activity, transferring glycosyl groups				0																		---	---	---	---
PIK3R4	30849	broad.mit.edu	37	3	130420354	130420354	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130420354delA	uc003enj.2	-							NM_014602	NP_055417			phosphoinositide-3-kinase, regulatory subunit 4						fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12																		---	---	---	---
ATP2C1	27032	broad.mit.edu	37	3	130663417	130663417	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130663417delT	uc003enl.2	+						ATP2C1_uc011blg.1_Intron|ATP2C1_uc011blh.1_Intron|ATP2C1_uc011bli.1_Intron|ATP2C1_uc003enk.2_Intron|ATP2C1_uc003enm.2_Intron|ATP2C1_uc003enn.2_Intron|ATP2C1_uc003eno.2_Intron|ATP2C1_uc003enp.2_Intron|ATP2C1_uc003enq.2_Intron|ATP2C1_uc003enr.2_Intron|ATP2C1_uc003ens.2_Intron|ATP2C1_uc003ent.2_Intron	NM_014382	NP_055197			calcium-transporting ATPase 2C1 isoform 1a						actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)									Hailey-Hailey_disease				---	---	---	---
CPNE4	131034	broad.mit.edu	37	3	131334736	131334739	+	Intron	DEL	CACA	-	-	rs67116836		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131334736_131334739delCACA	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720			copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
CPNE4	131034	broad.mit.edu	37	3	131648041	131648042	+	Intron	DEL	AA	-	-	rs141638232		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131648041_131648042delAA	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720			copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
TMEM108	66000	broad.mit.edu	37	3	133106995	133106995	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133106995delT	uc003eph.2	+						TMEM108_uc003epi.2_Intron|TMEM108_uc003epj.1_3'UTR|TMEM108_uc003epk.2_Intron|TMEM108_uc003epm.2_Intron	NM_023943	NP_076432			transmembrane protein 108 precursor							integral to membrane				ovary(2)|skin(2)	4																		---	---	---	---
BFSP2	8419	broad.mit.edu	37	3	133136368	133136369	+	Intron	INS	-	CCA	CCA	rs142660264	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133136368_133136369insCCA	uc003epn.1	+							NM_003571	NP_003562			phakinin						response to stimulus|visual perception	cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	133825711	133825711	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133825711delC								SLCO2A1 (76791 upstream) : RYK (50267 downstream)																																			---	---	---	---
CEP63	80254	broad.mit.edu	37	3	134285994	134285995	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134285994_134285995insA	uc003eqm.2	+							NM_001042384	NP_001035843			centrosomal protein 63 isoform d						cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	134412286	134412287	+	IGR	INS	-	A	A	rs138946614	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134412286_134412287insA								KY (41808 upstream) : EPHB1 (101973 downstream)																																			---	---	---	---
PPP2R3A	5523	broad.mit.edu	37	3	135730836	135730837	+	Intron	INS	-	ACAC	ACAC	rs145338609	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135730836_135730837insACAC	uc003eqv.1	+						PPP2R3A_uc011blz.1_Intron	NM_002718	NP_002709			protein phosphatase 2, regulatory subunit B'',						protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7																		---	---	---	---
MSL2	55167	broad.mit.edu	37	3	135867962	135867962	+	3'UTR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135867962delA	uc003eqx.1	-	2					MSL2_uc011bmb.1_3'UTR	NM_018133	NP_060603			ring finger protein 184 isoform 1						histone H4-K16 acetylation	MSL complex	zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	136930683	136930683	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136930683delT								IL20RB (200763 upstream) : SOX14 (552896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	137331267	137331267	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137331267delG								IL20RB (601347 upstream) : SOX14 (152312 downstream)																																			---	---	---	---
ARMC8	25852	broad.mit.edu	37	3	137910684	137910684	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137910684delT	uc003esa.1	+						ARMC8_uc003erw.2_Intron|ARMC8_uc003erx.2_Intron|ARMC8_uc003ery.2_Intron|ARMC8_uc003erz.2_Intron|ARMC8_uc011bmf.1_Intron|ARMC8_uc011bmg.1_Intron|ARMC8_uc011bmh.1_Intron|ARMC8_uc003esb.1_Intron	NM_015396	NP_056211			armadillo repeat containing 8 isoform 2								binding				0																		---	---	---	---
CEP70	80321	broad.mit.edu	37	3	138244614	138244614	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138244614delT	uc003esl.2	-						CEP70_uc011bmk.1_Intron|CEP70_uc011bml.1_Intron|CEP70_uc011bmm.1_Intron|CEP70_uc003esm.2_Intron	NM_024491	NP_077817			centrosomal protein 70 kDa						G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	139462407	139462408	+	IGR	INS	-	TG	TG	rs139748683	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139462407_139462408insTG								NMNAT3 (65567 upstream) : CLSTN2 (191619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	141977818	141977818	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141977818delA								GK5 (33390 upstream) : XRN1 (47633 downstream)																																			---	---	---	---
PCOLCE2	26577	broad.mit.edu	37	3	142583999	142583999	+	Intron	DEL	T	-	-	rs76577835		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142583999delT	uc003evd.2	-							NM_013363	NP_037495			procollagen C-endopeptidase enhancer 2							extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	144609990	144609991	+	IGR	DEL	TG	-	-	rs112260391		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144609990_144609991delTG								C3orf58 (898781 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145768825	145768825	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145768825delA								None (None upstream) : PLOD2 (18403 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145897783	145897783	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145897783delA								PLOD2 (18501 upstream) : PLSCR4 (12343 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	146289809	146289810	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146289809_146289810insA								PLSCR1 (27181 upstream) : PLSCR5 (4533 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	146995077	146995077	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146995077delA								PLSCR5 (671074 upstream) : ZIC4 (108760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	147003174	147003176	+	IGR	DEL	CTC	-	-	rs3079083		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147003174_147003176delCTC								PLSCR5 (679171 upstream) : ZIC4 (100661 downstream)																																			---	---	---	---
WWTR1	25937	broad.mit.edu	37	3	149265614	149265614	+	Intron	DEL	T	-	-	rs71865319		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149265614delT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron	NM_015472	NP_056287			WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)															---	---	---	---
CLRN1OS	116933	broad.mit.edu	37	3	150757691	150757692	+	Intron	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150757691_150757692delGT	uc011bny.1	+						CLRN1OS_uc003eyl.2_Intron					Homo sapiens usher critical region protein (UCRP) pseudogene mRNA, complete sequence.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	151203759	151203760	+	IGR	INS	-	G	G	rs141159163	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151203759_151203760insG								IGSF10 (27262 upstream) : AADACL2 (247944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	152700026	152700027	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152700026_152700027delAC								P2RY1 (144185 upstream) : RAP2B (180002 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	153577583	153577584	+	IGR	INS	-	AC	AC	rs142733495	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153577583_153577584insAC								C3orf79 (357100 upstream) : SGEF (261565 downstream)																																			---	---	---	---
PLCH1	23007	broad.mit.edu	37	3	155302441	155302442	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155302441_155302442insT	uc011bok.1	-						PLCH1_uc011boj.1_Intron|PLCH1_uc011bol.1_Intron	NM_001130960	NP_001124432			phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)															---	---	---	---
SCHIP1	29970	broad.mit.edu	37	3	158831883	158831883	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158831883delA	uc003fcq.1	+						IQCJ_uc003fco.2_Intron|IQCJ_uc010hvy.1_Intron|IQCJ_uc003fcp.1_Intron	NM_014575	NP_055390			schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	159840935	159840935	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159840935delA	uc003fcw.1	-											Homo sapiens cDNA FLJ39842 fis, clone SPLEN2014293.																														---	---	---	---
PPM1L	151742	broad.mit.edu	37	3	160485026	160485026	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160485026delT	uc003fdr.2	+							NM_139245	NP_640338			protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)															---	---	---	---
PPM1L	151742	broad.mit.edu	37	3	160635668	160635669	+	Intron	INS	-	TTG	TTG	rs145483333		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160635668_160635669insTTG	uc003fdr.2	+						PPM1L_uc003fds.2_Intron|PPM1L_uc003fdt.2_Intron|PPM1L_uc010hwf.2_Intron	NM_139245	NP_640338			protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	162745464	162745465	+	Intron	INS	-	T	T	rs149370155	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162745464_162745465insT	uc003feg.2	+											Homo sapiens, clone IMAGE:2905387, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	168305358	168305358	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168305358delC								MIR551B (35621 upstream) : C3orf50 (222226 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	169610125	169610125	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169610125delA								LRRC31 (22465 upstream) : SAMD7 (19357 downstream)																																			---	---	---	---
FNDC3B	64778	broad.mit.edu	37	3	171899035	171899036	+	Intron	INS	-	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171899035_171899036insG	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron|FNDC3B_uc003fhx.2_Intron	NM_022763	NP_073600			fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)														---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	174825302	174825303	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174825302_174825303delAC	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	175128389	175128390	+	Intron	INS	-	A	A	rs141887435	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175128389_175128390insA	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron|NAALADL2_uc010hwz.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	178725302	178725303	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178725302_178725303insA								KCNMB2 (163086 upstream) : ZMAT3 (16224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	179894197	179894199	+	IGR	DEL	TAC	-	-	rs146118672		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179894197_179894199delTAC								PEX5L (139680 upstream) : TTC14 (425719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	180082242	180082243	+	IGR	INS	-	CT	CT	rs139092914	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180082242_180082243insCT								PEX5L (327725 upstream) : TTC14 (237675 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	184028089	184028089	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184028089delT								PSMD2 (1249 upstream) : EIF4G1 (4267 downstream)																																			---	---	---	---
VPS8	23355	broad.mit.edu	37	3	184737937	184737938	+	Intron	INS	-	A	A	rs137958323	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184737937_184737938insA	uc003fpb.1	+						VPS8_uc010hyd.1_Intron|VPS8_uc010hye.1_Intron	NM_015303	NP_056118			vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)															---	---	---	---
SENP2	59343	broad.mit.edu	37	3	185307196	185307196	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185307196delT	uc003fpn.2	+						SENP2_uc011brv.1_Intron|SENP2_uc011brw.1_Intron	NM_021627	NP_067640			SUMO1/sentrin/SMT3 specific protease 2						mRNA transport|protein desumoylation|protein transport|proteolysis|regulation of Wnt receptor signaling pathway|transmembrane transport|Wnt receptor signaling pathway	cytoplasm|nuclear membrane|nuclear pore	protein binding|SUMO-specific protease activity				0	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	185741478	185741478	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185741478delT								TRA2B (85554 upstream) : ETV5 (22630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	185861065	185861065	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185861065delC								ETV5 (34164 upstream) : DGKG (3926 downstream)																																			---	---	---	---
DGKG	1608	broad.mit.edu	37	3	185879676	185879677	+	Intron	INS	-	TG	TG	rs145872642	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185879676_185879677insTG	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337			diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	186204287	186204287	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186204287delG	uc003fqd.1	-											Homo sapiens cDNA FLJ32735 fis, clone TESTI2001229.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	187590604	187590604	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187590604delC								BCL6 (127129 upstream) : LPP (281115 downstream)																																			---	---	---	---
LPP	4026	broad.mit.edu	37	3	188006888	188006888	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188006888delA	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
TP63	8626	broad.mit.edu	37	3	189478367	189478367	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189478367delT	uc003fry.2	+						TP63_uc003frx.2_Intron|TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron	NM_003722	NP_003713			tumor protein p63 isoform 1						anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)										Hay-Wells_syndrome	HNSCC(45;0.13)			---	---	---	---
TP63	8626	broad.mit.edu	37	3	189558282	189558285	+	Intron	DEL	AGAG	-	-	rs112623090		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189558282_189558285delAGAG	uc003fry.2	+						TP63_uc003frx.2_Intron|TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron|TP63_uc003fsa.2_Intron|TP63_uc003fsb.2_Intron|TP63_uc003fsc.2_Intron|TP63_uc003fsd.2_Intron|TP63_uc010hzd.1_Intron|TP63_uc003fse.1_Intron	NM_003722	NP_003713			tumor protein p63 isoform 1						anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)										Hay-Wells_syndrome	HNSCC(45;0.13)			---	---	---	---
FGF12	2257	broad.mit.edu	37	3	192293443	192293444	+	Intron	INS	-	T	T	rs142626385	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192293443_192293444insT	uc003fsy.2	-							NM_004113	NP_004104			fibroblast growth factor 12 isoform 2						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)														---	---	---	---
C3orf59	151963	broad.mit.edu	37	3	192576035	192576035	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192576035delA	uc011bsp.1	-							NM_178496	NP_848591			hypothetical protein LOC151963												0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)														---	---	---	---
ATP13A5	344905	broad.mit.edu	37	3	193057581	193057581	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193057581delT	uc011bsq.1	-							NM_198505	NP_940907			ATPase type 13A5						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)														---	---	---	---
ATP13A4	84239	broad.mit.edu	37	3	193247989	193247989	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193247989delT	uc003ftd.2	-						ATP13A4_uc003fte.1_Intron|ATP13A4_uc011bsr.1_Intron	NM_032279	NP_115655			ATPase type 13A4						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	193515333	193515333	+	IGR	DEL	A	-	-	rs146044229		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193515333delA								OPA1 (99734 upstream) : LOC100128023 (195551 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	193878879	193878880	+	IGR	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193878879_193878880delTC								HES1 (22483 upstream) : LOC100131551 (138544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	195443377	195443377	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195443377delA								MIR570 (17009 upstream) : MUC20 (4376 downstream)																																			---	---	---	---
MUC4	4585	broad.mit.edu	37	3	195479784	195479784	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195479784delC	uc011bto.1	-						MUC4_uc010hzq.2_Intron|MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron	NM_018406	NP_060876			mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---
TM4SF19	116211	broad.mit.edu	37	3	196059125	196059126	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196059125_196059126insA	uc003fwl.1	-						TM4SF19_uc003fwj.2_Intron|TM4SF19_uc010iad.1_Intron|TM4SF19_uc011btv.1_Intron	NM_138461	NP_612470			transmembrane 4 L six family member 19							integral to membrane					0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)														---	---	---	---
RNF168	165918	broad.mit.edu	37	3	196207688	196207689	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196207688_196207689insT	uc003fwq.2	-						RNF168_uc010iah.2_Intron	NM_152617	NP_689830			ring finger protein 168						double-strand break repair|histone H2A K63-linked ubiquitination|positive regulation of DNA repair|response to ionizing radiation	nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)														---	---	---	---
LRCH3	84859	broad.mit.edu	37	3	197551618	197551618	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197551618delT	uc011bul.1	+						LRCH3_uc003fyj.1_Intron|LRCH3_uc011bum.1_Intron|LRCH3_uc011bun.1_Intron	NM_032773	NP_116162			leucine-rich repeats and calponin homology (CH)							extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	197856302	197856303	+	IGR	DEL	CT	-	-	rs112505819		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197856302_197856303delCT								LOC348840 (48760 upstream) : FAM157A (22934 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49345	49345	+	IGR	DEL	T	-	-	rs56012841		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49345delT								None (None upstream) : ZNF595 (3882 downstream)																																			---	---	---	---
FAM53A	152877	broad.mit.edu	37	4	1662085	1662086	+	Intron	INS	-	A	A	rs142272973	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1662085_1662086insA	uc011bve.1	-						FAM53A_uc010ibw.2_Intron	NM_001013622	NP_001013644			dorsal neural-tube nuclear protein							nucleus					0		all_epithelial(65;0.206)|Breast(71;0.212)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)															---	---	---	---
ZFYVE28	57732	broad.mit.edu	37	4	2364731	2364735	+	Intron	DEL	TCCCC	-	-	rs72432529		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2364731_2364735delTCCCC	uc003gex.1	-						ZFYVE28_uc011bvk.1_Intron|ZFYVE28_uc011bvl.1_Intron|ZFYVE28_uc003gey.3_Intron|ZFYVE28_uc003gez.2_Intron	NM_020972	NP_066023			zinc finger, FYVE domain containing 28						negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			skin(2)|ovary(1)	3																		---	---	---	---
FAM193A	8603	broad.mit.edu	37	4	2708643	2708643	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2708643delT	uc010icl.2	+						FAM193A_uc010ick.2_Intron|FAM193A_uc003gfd.2_Intron|FAM193A_uc011bvm.1_Intron|FAM193A_uc011bvn.1_Intron|FAM193A_uc011bvo.1_Intron|FAM193A_uc010icm.2_Intron	NM_003704	NP_003695			hypothetical protein LOC8603											ovary(3)	3																		---	---	---	---
SH3BP2	6452	broad.mit.edu	37	4	2827203	2827204	+	Intron	DEL	GC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2827203_2827204delGC	uc003gfi.3	+						SH3BP2_uc011bvp.1_Intron|SH3BP2_uc003gfj.3_Intron|SH3BP2_uc003gfk.3_Intron|SH3BP2_uc003gfl.3_Intron|SH3BP2_uc003gfm.3_5'Flank	NM_001122681	NP_001116153			SH3-domain binding protein 2 isoform a						signal transduction		SH3 domain binding|SH3/SH2 adaptor activity			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)										Cherubism				---	---	---	---
Unknown	0	broad.mit.edu	37	4	3621168	3621168	+	IGR	DEL	G	-	-	rs11339032		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3621168delG								LRPAP1 (86944 upstream) : ADRA2C (146907 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	9023403	9023403	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9023403delT								LOC650293 (71277 upstream) : USP17 (336706 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	11236752	11236756	+	IGR	DEL	CCCTC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11236752_11236756delCCCTC								CLNK (550366 upstream) : MIR572 (133695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	12947403	12947404	+	IGR	INS	-	GAAG	GAAG			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12947403_12947404insGAAG								None (None upstream) : HSP90AB2P (387633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13984265	13984265	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13984265delT								BOD1L (354937 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	17465158	17465161	+	IGR	DEL	GATA	-	-	rs34631328		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17465158_17465161delGATA								LDB2 (564734 upstream) : QDPR (22859 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	18147044	18147044	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18147044delC								LCORL (123659 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	18541750	18541751	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18541750_18541751insT								LCORL (518365 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	18646121	18646122	+	IGR	DEL	GA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18646121_18646122delGA								LCORL (622736 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	18935840	18935841	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18935840_18935841delCA								LCORL (912455 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	23463189	23463189	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23463189delA								GBA3 (641998 upstream) : PPARGC1A (330456 downstream)																																			---	---	---	---
CCDC149	91050	broad.mit.edu	37	4	24977329	24977329	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24977329delA	uc011bxr.1	-						CCDC149_uc003gre.2_Intron	NM_173463	NP_775734			coiled-coil domain containing 149 isoform 1												0		Breast(46;0.173)																---	---	---	---
ANAPC4	29945	broad.mit.edu	37	4	25375911	25375912	+	5'Flank	INS	-	A	A	rs141128239	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25375911_25375912insA	uc003gro.2	+							NM_013367	NP_037499			anaphase-promoting complex subunit 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			ovary(2)|large_intestine(1)|pancreas(1)|skin(1)	5		Breast(46;0.0503)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	27117298	27117299	+	IGR	INS	-	T	T	rs71645510		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27117298_27117299insT								STIM2 (91490 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	27348583	27348583	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27348583delA								STIM2 (322775 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	29079986	29079987	+	IGR	INS	-	TATC	TATC	rs146520665	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29079986_29079987insTATC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	32301437	32301437	+	IGR	DEL	G	-	-	rs35335526		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32301437delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	32302366	32302366	+	IGR	DEL	G	-	-	rs34830769		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32302366delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	32663308	32663309	+	IGR	DEL	AC	-	-	rs72054677		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32663308_32663309delAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	33909229	33909230	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33909229_33909230insA	uc003gsn.2	-											Homo sapiens, clone IMAGE:5172449, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	35603101	35603102	+	IGR	DEL	CA	-	-	rs112437996		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:35603101_35603102delCA								None (None upstream) : ARAP2 (346742 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	35921437	35921437	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:35921437delC								None (None upstream) : ARAP2 (28407 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	35938939	35938940	+	IGR	INS	-	G	G	rs150710760	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:35938939_35938940insG								None (None upstream) : ARAP2 (10904 downstream)																																			---	---	---	---
ARAP2	116984	broad.mit.edu	37	4	36227041	36227041	+	Intron	DEL	G	-	-	rs34696423		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36227041delG	uc003gsq.1	-						ARAP2_uc003gsr.1_Intron	NM_015230	NP_056045			ArfGAP with RhoGAP domain, ankyrin repeat and PH						regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
KIAA1239	57495	broad.mit.edu	37	4	37283142	37283144	+	Intron	DEL	GGA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37283142_37283144delGGA	uc011bxz.1	+							NM_001144990	NP_001138462			hypothetical protein LOC57495												0																		---	---	---	---
N4BP2	55728	broad.mit.edu	37	4	40114324	40114324	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40114324delT	uc003guy.3	+						N4BP2_uc010ifq.2_Intron|N4BP2_uc010ifr.2_Intron	NM_018177	NP_060647			Nedd4 binding protein 2							cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	42248231	42248232	+	IGR	INS	-	T	T	rs111274584		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42248231_42248232insT								BEND4 (93336 upstream) : SHISA3 (151624 downstream)																																			---	---	---	---
ATP8A1	10396	broad.mit.edu	37	4	42542456	42542456	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42542456delA	uc003gwr.2	-						ATP8A1_uc003gws.2_Intron	NM_006095	NP_006086			ATPase, aminophospholipid transporter (APLT),						ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	44055426	44055426	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44055426delA								None (None upstream) : KCTD8 (120496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	48937318	48937319	+	IGR	DEL	TT	-	-	rs111596582		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48937318_48937319delTT								OCIAD2 (28503 upstream) : CWH43 (50946 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49113263	49113264	+	IGR	INS	-	GAATT	GAATT	rs79040505		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49113263_49113264insGAATT								CWH43 (49170 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49246088	49246088	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49246088delA								CWH43 (181995 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49561940	49561941	+	5'Flank	INS	-	GC	GC	rs142073933		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49561940_49561941insGC	uc011bzm.1	+						uc003gza.1_5'Flank					DQ582260																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	56240578	56240578	+	Intron	DEL	T	-	-	rs33948074		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56240578delT	uc003hav.1	-						uc003haw.1_Intron					Homo sapiens cDNA clone IMAGE:5295612.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	57391833	57391833	+	IGR	DEL	A	-	-	rs72002132		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57391833delA								ARL9 (1775 upstream) : HOPX (122321 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	59037161	59037161	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59037161delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	60287333	60287333	+	IGR	DEL	C	-	-	rs142390182		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:60287333delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	61548558	61548559	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61548558_61548559insA								None (None upstream) : LPHN3 (518415 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65599785	65599785	+	IGR	DEL	G	-	-	rs35734336		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65599785delG								TECRL (324607 upstream) : EPHA5 (585497 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	66890945	66890945	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66890945delA								EPHA5 (355292 upstream) : MIR1269 (251597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	67638721	67638721	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67638721delT								MIR1269 (496075 upstream) : CENPC1 (699268 downstream)																																			---	---	---	---
UGT2A3	79799	broad.mit.edu	37	4	69820412	69820412	+	5'Flank	DEL	T	-	-	rs74740056		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69820412delT	uc003hef.2	-						UGT2A3_uc010ihp.1_5'Flank	NM_024743	NP_079019			UDP glucuronosyltransferase 2 family,							integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	70087337	70087338	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70087337_70087338insA								UGT2B11 (6888 upstream) : UGT2B28 (58879 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	71209122	71209123	+	IGR	INS	-	TG	TG	rs144749435	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71209122_71209123insTG								C4orf35 (6290 upstream) : SMR3A (17370 downstream)																																			---	---	---	---
MUC7	4589	broad.mit.edu	37	4	71304149	71304150	+	Intron	INS	-	TTGTA	TTGTA	rs143947709	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71304149_71304150insTTGTA	uc011cat.1	+							NM_001145006	NP_001138478			mucin 7, secreted precursor							extracellular region	protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4			Lung(101;0.211)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	71944887	71944887	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71944887delG								DCK (48260 upstream) : SLC4A4 (108116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	73791066	73791066	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73791066delA								ADAMTS3 (356550 upstream) : COX18 (129350 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	74400230	74400230	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74400230delG								AFM (30513 upstream) : RASSF6 (38632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	79568004	79568004	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79568004delT	uc003hlf.2	+						uc003hlg.2_Intron|uc003hlh.2_Intron|uc003hli.2_Intron					Homo sapiens cDNA FLJ32651 fis, clone SYNOV2001581.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	82306402	82306403	+	IGR	INS	-	CT	CT			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82306402_82306403insCT								PRKG2 (170184 upstream) : RASGEF1B (41816 downstream)																																			---	---	---	---
COQ2	27235	broad.mit.edu	37	4	84186735	84186737	+	Intron	DEL	AAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84186735_84186737delAAC	uc003hog.2	-						COQ2_uc011ccp.1_Intron|COQ2_uc003hof.2_Intron	NM_015697	NP_056512			para-hydroxybenzoate-polyprenyltransferase,						glycerol metabolic process|isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrial membrane	4-hydroxybenzoate decaprenyltransferase activity|4-hydroxybenzoate nonaprenyltransferase activity			ovary(1)|central_nervous_system(1)	2		Hepatocellular(203;0.114)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	84715954	84715954	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84715954delT								AGPAT9 (188929 upstream) : NKX6-1 (698482 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	84856452	84856453	+	Intron	INS	-	TAG	TAG			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84856452_84856453insTAG	uc010ikd.1	-											Homo sapiens cDNA FLJ37966 fis, clone CTONG2009871.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	84856977	84856980	+	Intron	DEL	ACAC	-	-	rs72110978		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84856977_84856980delACAC	uc010ikd.1	-											Homo sapiens cDNA FLJ37966 fis, clone CTONG2009871.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	85294967	85294967	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85294967delT								AGPAT9 (767942 upstream) : NKX6-1 (119469 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	86118869	86118869	+	IGR	DEL	T	-	-	rs111356938		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86118869delT								C4orf12 (190701 upstream) : ARHGAP24 (277415 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	86334284	86334285	+	IGR	INS	-	A	A	rs111961970		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86334284_86334285insA								C4orf12 (406116 upstream) : ARHGAP24 (61999 downstream)																																			---	---	---	---
MAPK10	5602	broad.mit.edu	37	4	87227136	87227136	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87227136delT	uc003hpq.2	-						MAPK10_uc010ikg.2_Intron|MAPK10_uc003hpr.2_Intron|MAPK10_uc003hps.2_Intron|MAPK10_uc003hpt.2_Intron|MAPK10_uc003hpu.2_Intron|MAPK10_uc003hpv.2_Intron|MAPK10_uc010ikh.1_Intron	NM_138982	NP_620448			mitogen-activated protein kinase 10 isoform 2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|MAP kinase kinase activity|protein binding			stomach(1)|breast(1)|central_nervous_system(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)														---	---	---	---
AFF1	4299	broad.mit.edu	37	4	88009758	88009758	+	Intron	DEL	T	-	-	rs34480503		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88009758delT	uc003hqj.3	+						AFF1_uc003hqh.1_Intron|AFF1_uc011ccy.1_Intron|AFF1_uc011ccz.1_Intron|AFF1_uc003hqk.3_Intron|AFF1_uc011cda.1_Intron	NM_005935	NP_005926			myeloid/lymphoid or mixed-lineage leukemia							nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)														---	---	---	---
FAM13A	10144	broad.mit.edu	37	4	89879222	89879222	+	Intron	DEL	A	-	-	rs1585259	byFrequency;by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89879222delA	uc003hse.1	-						FAM13A_uc003hsf.1_Intron|FAM13A_uc003hsh.1_Intron	NM_014883	NP_055698			family with sequence similarity 13, member A1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2																		---	---	---	---
FAM190A	401145	broad.mit.edu	37	4	91659422	91659422	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91659422delA	uc003hsv.3	+						FAM190A_uc010ikv.2_Intron|FAM190A_uc003hsw.2_Intron|FAM190A_uc003hsx.2_Intron	NM_001145065	NP_001138537			KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2																		---	---	---	---
SMARCAD1	56916	broad.mit.edu	37	4	95203024	95203026	+	Intron	DEL	CAA	-	-	rs34933276		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95203024_95203026delCAA	uc003htc.3	+						SMARCAD1_uc003htb.3_Intron|SMARCAD1_uc003htd.3_Intron|SMARCAD1_uc010ila.2_Intron|SMARCAD1_uc011cdw.1_Intron	NM_020159	NP_064544			SWI/SNF-related, matrix-associated						chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity			skin(2)|ovary(1)|breast(1)	4				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)														---	---	---	---
PDLIM5	10611	broad.mit.edu	37	4	95583389	95583389	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95583389delC	uc003hti.2	+						PDLIM5_uc011cdx.1_Intron|PDLIM5_uc003hth.2_Intron|PDLIM5_uc003htj.2_Intron|PDLIM5_uc003htk.2_Intron|PDLIM5_uc011cdy.1_Intron|PDLIM5_uc003htl.2_Intron	NM_006457	NP_006448			PDZ and LIM domain 5 isoform a						regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	95635355	95635358	+	IGR	DEL	GTGT	-	-	rs71583603		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95635355_95635358delGTGT								PDLIM5 (45979 upstream) : BMPR1B (43770 downstream)																																			---	---	---	---
BMPR1B	658	broad.mit.edu	37	4	95720454	95720455	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95720454_95720455insT	uc003htm.3	+							NM_001203	NP_001194			bone morphogenetic protein receptor, type IB						BMP signaling pathway|cartilage condensation|eye development|limb morphogenesis|ovarian cumulus expansion|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	receptor complex	ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta receptor activity			lung(4)|skin(2)|stomach(1)|breast(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	96668647	96668647	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96668647delT								UNC5C (198485 upstream) : PDHA2 (92592 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	98166790	98166791	+	IGR	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98166790_98166791delGT								None (None upstream) : C4orf37 (313243 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	98424654	98424655	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98424654_98424655insT								None (None upstream) : C4orf37 (55379 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	98451650	98451651	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98451650_98451651delTG								None (None upstream) : C4orf37 (28383 downstream)																																			---	---	---	---
C4orf37	285555	broad.mit.edu	37	4	98972294	98972295	+	Intron	INS	-	C	C	rs149376451	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98972294_98972295insC	uc003htt.1	-							NM_174952	NP_777612			hypothetical protein LOC285555												0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	99694650	99694652	+	IGR	DEL	GAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99694650_99694652delGAA								TSPAN5 (114923 upstream) : EIF4E (104955 downstream)																																			---	---	---	---
ADH5	128	broad.mit.edu	37	4	100009952	100009953	+	5'Flank	INS	-	G	G	rs145470085	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100009952_100009953insG	uc003hui.2	-						ADH5_uc003huk.1_5'Flank|uc003hum.1_5'Flank|uc003hul.1_5'Flank	NM_000671	NP_000662			class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)													---	---	---	---
DAPP1	27071	broad.mit.edu	37	4	100768572	100768573	+	Intron	INS	-	C	C	rs141553127	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100768572_100768573insC	uc003hvf.3	+						DAPP1_uc011cek.1_Intron|DAPP1_uc010ilh.2_Intron	NM_014395	NP_055210			dual adaptor of phosphotyrosine and						signal transduction	cytoplasm|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein tyrosine phosphatase activity				0				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)														---	---	---	---
DDIT4L	115265	broad.mit.edu	37	4	101109759	101109759	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101109759delA	uc003hvq.2	-							NM_145244	NP_660287			DNA-damage-inducible transcript 4-like						negative regulation of signal transduction	cytoplasm				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;5.75e-09)														---	---	---	---
BANK1	55024	broad.mit.edu	37	4	102978543	102978544	+	Intron	INS	-	G	G	rs137887725	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102978543_102978544insG	uc003hvy.3	+						BANK1_uc003hvx.3_Intron|BANK1_uc010ill.2_Intron|BANK1_uc003hvz.3_Intron	NM_017935	NP_060405			B-cell scaffold protein with ankyrin repeats 1						B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)														---	---	---	---
CENPE	1062	broad.mit.edu	37	4	104100706	104100706	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104100706delA	uc003hxb.1	-						CENPE_uc003hxc.1_Intron	NM_001813	NP_001804			centromere protein E						blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	104171422	104171423	+	IGR	INS	-	T	T	rs59217939		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104171422_104171423insT								CENPE (51856 upstream) : TACR3 (339202 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	105508262	105508264	+	Intron	DEL	ATA	-	-	rs149788090		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105508262_105508264delATA	uc003hxh.1	+											Homo sapiens cDNA FLJ37242 fis, clone BRAMY2004335.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	105785112	105785112	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105785112delT								CXXC4 (369054 upstream) : TET2 (282831 downstream)																																			---	---	---	---
DKK2	27123	broad.mit.edu	37	4	107992105	107992105	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107992105delT	uc010ilw.1	-											Homo sapiens dickkopf-2 mRNA, complete cds.						multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space				ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)														---	---	---	---
LEF1	51176	broad.mit.edu	37	4	109003587	109003588	+	Intron	INS	-	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109003587_109003588insC	uc003hyt.1	-						LEF1_uc011cfj.1_Intron|LEF1_uc011cfk.1_Intron|LEF1_uc003hyu.1_Intron|LEF1_uc003hyv.1_Intron|LEF1_uc010imb.1_Intron|LEF1_uc003hyw.1_5'Flank	NM_016269	NP_057353			lymphoid enhancer-binding factor 1 isoform 1						canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding			large_intestine(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000224)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	109349922	109349923	+	IGR	DEL	AA	-	-	rs35420102		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109349922_109349923delAA								LEF1 (260344 upstream) : LOC285456 (109423 downstream)																																			---	---	---	---
LOC285456	285456	broad.mit.edu	37	4	109512998	109512999	+	Intron	DEL	AG	-	-	rs113337521	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109512998_109512999delAG	uc011cfl.1	-						LOC285456_uc003hyy.2_Intron					SubName: Full=cDNA FLJ57077;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	111854484	111854485	+	IGR	INS	-	T	T	rs34573452		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111854484_111854485insT								MIR297 (72681 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	112273388	112273393	+	IGR	DEL	ACAACA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112273388_112273393delACAACA								MIR297 (491585 upstream) : C4orf32 (793160 downstream)																																			---	---	---	---
C4orf21	55345	broad.mit.edu	37	4	113533126	113533127	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113533126_113533127insT	uc003iau.2	-						C4orf21_uc003iaw.2_Intron	NM_018392	NP_060862			prematurely terminated mRNA decay factor-like							integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)														---	---	---	---
CAMK2D	817	broad.mit.edu	37	4	114661543	114661544	+	Intron	INS	-	A	A	rs147228205	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114661543_114661544insA	uc003ibi.2	-						CAMK2D_uc003ibj.2_Intron|CAMK2D_uc003ibk.2_Intron|CAMK2D_uc003ibo.3_Intron|CAMK2D_uc003ibm.2_Intron|CAMK2D_uc003ibn.2_Intron|CAMK2D_uc003ibl.2_Intron	NM_001221	NP_001212			calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|regulation of cell growth|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)	1		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	116807190	116807191	+	IGR	INS	-	G	G	rs146925838	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116807190_116807191insG								NDST4 (772158 upstream) : MIR1973 (413690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	117027841	117027841	+	IGR	DEL	A	-	-	rs67045825		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117027841delA								NDST4 (992809 upstream) : MIR1973 (193040 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	118737132	118737133	+	IGR	INS	-	G	G	rs143147846	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118737132_118737133insG								TRAM1L1 (730396 upstream) : NDST3 (217640 downstream)																																			---	---	---	---
NDST3	9348	broad.mit.edu	37	4	119104102	119104105	+	Intron	DEL	AGAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119104102_119104105delAGAC	uc003ibx.2	+						NDST3_uc011cgf.1_Intron	NM_004784	NP_004775			N-deacetylase/N-sulfotransferase (heparan							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	120268616	120268617	+	IGR	INS	-	T	T	rs71595365		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120268616_120268617insT								FABP2 (25300 upstream) : PDE5A (146935 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	121108561	121108561	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121108561delA								MAD2L1 (120548 upstream) : PRDM5 (507369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	121447395	121447396	+	IGR	DEL	TT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121447395_121447396delTT								MAD2L1 (459382 upstream) : PRDM5 (168534 downstream)																																			---	---	---	---
FGF2	2247	broad.mit.edu	37	4	123754335	123754336	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123754335_123754336delTG	uc003iev.1	+							NM_002006	NP_001997			fibroblast growth factor 2						activation of MAPK activity|branching involved in ureteric bud morphogenesis|cell migration involved in sprouting angiogenesis|chemotaxis|chondroblast differentiation|embryonic morphogenesis|fibroblast growth factor receptor signaling pathway|inositol phosphate biosynthetic process|insulin receptor signaling pathway|negative regulation of blood vessel endothelial cell migration|negative regulation of cell death|organ morphogenesis|phosphatidylinositol biosynthetic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of cardiac muscle cell proliferation|positive regulation of cell division|positive regulation of cell fate specification|positive regulation of ERK1 and ERK2 cascade|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of phospholipase C activity|Ras protein signal transduction|release of sequestered calcium ion into cytosol|wound healing	extracellular space	fibroblast growth factor receptor binding|growth factor activity|heparin binding|ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|lung(1)|central_nervous_system(1)	3					Pentosan Polysulfate(DB00686)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	125045814	125045815	+	IGR	INS	-	TG	TG	rs141344817	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125045814_125045815insTG								LOC285419 (194296 upstream) : ANKRD50 (539653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	127085403	127085404	+	IGR	INS	-	T	T	rs71858969		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:127085403_127085404insT								MIR2054 (656941 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	127825112	127825112	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:127825112delC								None (None upstream) : INTU (729008 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	128362732	128362733	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128362732_128362733delCA								None (None upstream) : INTU (191387 downstream)																																			---	---	---	---
PHF17	79960	broad.mit.edu	37	4	129769667	129769667	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129769667delT	uc003igk.2	+						PHF17_uc003igj.2_Intron|PHF17_uc003igl.2_Intron|PHF17_uc011cgy.1_Intron|PHF17_uc003igm.2_Intron	NM_199320	NP_955352			PHD finger protein 17 long isoform						apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	133097806	133097806	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133097806delG								None (None upstream) : PCDH10 (972664 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	135334498	135334503	+	IGR	DEL	ACACAC	-	-	rs67506301		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:135334498_135334503delACACAC								PABPC4L (211595 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	136673277	136673278	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:136673277_136673278delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	138882361	138882361	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138882361delG								PCDH18 (428713 upstream) : SLC7A11 (202887 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	139786778	139786781	+	IGR	DEL	GGAA	-	-	rs112477691		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139786778_139786781delGGAA								SLC7A11 (623275 upstream) : CCRN4L (150162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	141526407	141526409	+	IGR	DEL	TTG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141526407_141526409delTTG								UCP1 (36448 upstream) : TBC1D9 (15528 downstream)																																			---	---	---	---
INPP4B	8821	broad.mit.edu	37	4	143685636	143685636	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143685636delA	uc003iix.3	-						INPP4B_uc003iiw.3_Intron	NM_003866	NP_003857			inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	144694751	144694752	+	IGR	DEL	TG	-	-	rs13113883	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144694751_144694752delTG								LOC441046 (205438 upstream) : GYPE (97268 downstream)																																			---	---	---	---
TTC29	83894	broad.mit.edu	37	4	147734074	147734074	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147734074delT	uc003ikw.3	-						TTC29_uc010ipc.2_Intron|TTC29_uc003ikx.3_Intron|TTC29_uc010ipd.1_Intron	NM_031956	NP_114162			tetratricopeptide repeat domain 29								binding				0	all_hematologic(180;0.151)																	---	---	---	---
LRBA	987	broad.mit.edu	37	4	151187668	151187669	+	Intron	INS	-	CTC	CTC	rs144280897	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151187668_151187669insCTC	uc010ipj.2	-						LRBA_uc010ipi.2_Intron|LRBA_uc003ils.3_Intron|LRBA_uc003ilt.3_Intron|LRBA_uc003ilu.3_Intron|LRBA_uc003ilr.3_Intron	NM_006726	NP_006717			LPS-responsive vesicle trafficking, beach and							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	153489181	153489182	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153489181_153489182delCA								FBXW7 (32838 upstream) : TMEM154 (58089 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	154339574	154339576	+	IGR	DEL	TGT	-	-	rs35212360		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154339574_154339576delTGT								MND1 (3331 upstream) : KIAA0922 (47922 downstream)																																			---	---	---	---
SFRP2	6423	broad.mit.edu	37	4	154703557	154703557	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154703557delC	uc003inv.1	-							NM_003013	NP_003004			secreted frizzled-related protein 2 precursor						brain development|cardiac left ventricle morphogenesis|cell-cell signaling|dermatome development|hemopoietic stem cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell growth|negative regulation of cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|outflow tract morphogenesis|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell adhesion mediated by integrin|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of fat cell differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of stem cell division|sclerotome development	cytoplasm|extracellular matrix|extracellular space|plasma membrane	fibronectin binding|integrin binding|PDZ domain binding|receptor agonist activity|Wnt receptor activity|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.093)	Renal(120;0.117)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	155082884	155082884	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155082884delT								SFRP2 (372656 upstream) : DCHS2 (72643 downstream)																																			---	---	---	---
DCHS2	54798	broad.mit.edu	37	4	155287807	155287808	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155287807_155287808delAC	uc003inw.2	-						DCHS2_uc003inx.2_Intron	NM_017639	NP_060109			dachsous 2 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	158407218	158407219	+	IGR	INS	-	T	T	rs71587407		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158407218_158407219insT								GRIA2 (119994 upstream) : LOC340017 (86423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	158502338	158502339	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158502338_158502339insT								LOC340017 (5043 upstream) : FAM198B (543394 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	161053795	161053796	+	IGR	DEL	AC	-	-	rs111605297		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161053795_161053796delAC								RAPGEF2 (772496 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	161132292	161132292	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161132292delA								RAPGEF2 (850993 upstream) : None (None downstream)																																			---	---	---	---
FSTL5	56884	broad.mit.edu	37	4	162728349	162728352	+	Intron	DEL	ACAC	-	-	rs34322532		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162728349_162728352delACAC	uc003iqh.2	-						FSTL5_uc003iqi.2_Intron|FSTL5_uc010iqv.2_Intron	NM_020116	NP_064501			follistatin-like 5 isoform a							extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)														---	---	---	---
FSTL5	56884	broad.mit.edu	37	4	162791531	162791534	+	Intron	DEL	GAGC	-	-	rs2033405	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162791531_162791534delGAGC	uc003iqh.2	-						FSTL5_uc003iqi.2_Intron|FSTL5_uc010iqv.2_Intron	NM_020116	NP_064501			follistatin-like 5 isoform a							extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)														---	---	---	---
FSTL5	56884	broad.mit.edu	37	4	162809230	162809231	+	Intron	INS	-	CAG	CAG	rs143337796	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162809230_162809231insCAG	uc003iqh.2	-						FSTL5_uc003iqi.2_Intron|FSTL5_uc010iqv.2_Intron	NM_020116	NP_064501			follistatin-like 5 isoform a							extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	163107047	163107048	+	IGR	INS	-	GT	GT	rs143158645	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:163107047_163107048insGT								FSTL5 (21861 upstream) : NAF1 (940812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	163205851	163205852	+	IGR	DEL	AG	-	-	rs78467259		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:163205851_163205852delAG								FSTL5 (120665 upstream) : NAF1 (842008 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	163830699	163830699	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:163830699delA								FSTL5 (745513 upstream) : NAF1 (217161 downstream)																																			---	---	---	---
MARCH1	55016	broad.mit.edu	37	4	164606360	164606360	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164606360delT	uc003iqs.1	-							NM_017923	NP_060393			membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	165401142	165401143	+	IGR	INS	-	TG	TG	rs150497151	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165401142_165401143insTG								MARCH1 (95940 upstream) : TRIM61 (474457 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	167088389	167088390	+	IGR	INS	-	AAAGA	AAAGA	rs147730946	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167088389_167088390insAAAGA								TLL1 (63396 upstream) : SPOCK3 (566146 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	168497170	168497172	+	IGR	DEL	AGG	-	-	rs79351880		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168497170_168497172delAGG								SPOCK3 (341429 upstream) : ANXA10 (516535 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	168741275	168741276	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168741275_168741276delTG								SPOCK3 (585534 upstream) : ANXA10 (272431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	168838765	168838767	+	IGR	DEL	AAT	-	-	rs36023935		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168838765_168838767delAAT								SPOCK3 (683024 upstream) : ANXA10 (174940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	169118250	169118251	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169118250_169118251insA								ANXA10 (9359 upstream) : DDX60 (19192 downstream)																																			---	---	---	---
DDX60	55601	broad.mit.edu	37	4	169237942	169237943	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169237942_169237943insA	uc003irp.2	-							NM_017631	NP_060101			DEAD (Asp-Glu-Ala-Asp) box polypeptide 60								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	171583994	171583995	+	IGR	DEL	AC	-	-	rs140960488		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:171583994_171583995delAC								AADAT (572622 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	172473982	172473982	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:172473982delT								None (None upstream) : GALNTL6 (260593 downstream)																																			---	---	---	---
GALNTL6	442117	broad.mit.edu	37	4	173114708	173114709	+	Intron	DEL	AA	-	-	rs140585356		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173114708_173114709delAA	uc003isv.2	+							NM_001034845	NP_001030017			N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
GALNTL6	442117	broad.mit.edu	37	4	173334807	173334807	+	Intron	DEL	T	-	-	rs112895495		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173334807delT	uc003isv.2	+							NM_001034845	NP_001030017			N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
KIAA1712	80817	broad.mit.edu	37	4	175250493	175250494	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175250493_175250494delAC	uc010iro.2	+						KIAA1712_uc003its.2_Intron	NM_001145314	NP_001138786			HBV PreS1-transactivated protein 3 isoform b							centrosome|midbody|spindle pole					0		Prostate(90;0.00276)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;4.06e-18)|Epithelial(43;1.18e-15)|OV - Ovarian serous cystadenocarcinoma(60;4.65e-09)|GBM - Glioblastoma multiforme(59;0.00098)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0949)														---	---	---	---
GLRA3	8001	broad.mit.edu	37	4	175728839	175728839	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175728839delC	uc003ity.1	-						GLRA3_uc003itz.1_Intron	NM_006529	NP_006520			glycine receptor, alpha 3 isoform a						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(3)	3		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	178194871	178194872	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178194871_178194872insT								VEGFC (480976 upstream) : NEIL3 (36119 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	178635220	178635221	+	IGR	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178635220_178635221delAG								AGA (271629 upstream) : LOC285501 (14686 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	181631578	181631578	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181631578delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	184542594	184542595	+	IGR	INS	-	TGTTTCTA	TGTTTCTA	rs149766491	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184542594_184542595insTGTTTCTA								ING2 (110345 upstream) : RWDD4A (18194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	184550347	184550348	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184550347_184550348insA								ING2 (118098 upstream) : RWDD4A (10441 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	187705764	187705764	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187705764delC								FAT1 (57914 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	189220910	189220911	+	IGR	DEL	GT	-	-	rs71596835		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189220910_189220911delGT								TRIML1 (152261 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	189530541	189530541	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189530541delA								TRIML1 (461892 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	189867602	189867602	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189867602delA								TRIML1 (798953 upstream) : FRG1 (994372 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190594434	190594437	+	IGR	DEL	CAGT	-	-	rs34446406		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190594434_190594437delCAGT								None (None upstream) : FRG1 (267537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190638661	190638662	+	IGR	INS	-	ACTGCTTATAT	ACTGCTTATAT	rs140670824		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190638661_190638662insACTGCTTATAT								None (None upstream) : FRG1 (223312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190655231	190655232	+	IGR	INS	-	TG	TG	rs146772532		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190655231_190655232insTG								None (None upstream) : FRG1 (206742 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190794881	190794881	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190794881delT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	190894272	190894273	+	IGR	DEL	AT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190894272_190894273delAT								FRG1 (9914 upstream) : TUBB4Q (9406 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	191037516	191037517	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:191037516_191037517insT								LOC653545 (27340 upstream) : None (None downstream)																																			---	---	---	---
AHRR	57491	broad.mit.edu	37	5	318642	318643	+	Intron	INS	-	GAGA	GAGA	rs111901421		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:318642_318643insGAGA	uc003jav.2	+						AHRR_uc003jaw.2_Intron|AHRR_uc010isy.2_Intron	NM_020731	NP_065782			arylhydrocarbon receptor repressor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	1192427	1192428	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1192427_1192428insA								SLC12A7 (80255 upstream) : SLC6A19 (9282 downstream)																																			---	---	---	---
IRX4	50805	broad.mit.edu	37	5	1884990	1884990	+	5'Flank	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1884990delG	uc003jcz.2	-						IRX4_uc011cmf.1_5'Flank	NM_016358	NP_057442			iroquois homeobox 4						heart development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(108;0.242)														---	---	---	---
ADAMTS16	170690	broad.mit.edu	37	5	5305581	5305581	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5305581delC	uc003jdl.2	+							NM_139056	NP_620687			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	6021526	6021526	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6021526delC								KIAA0947 (531189 upstream) : FLJ33360 (289028 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	7073991	7073991	+	IGR	DEL	C	-	-	rs113749966		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7073991delC								PAPD7 (316830 upstream) : ADCY2 (322352 downstream)																																			---	---	---	---
SEMA5A	9037	broad.mit.edu	37	5	9404809	9404809	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9404809delT	uc003jek.2	-							NM_003966	NP_003957			semaphorin 5A precursor						cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
LOC285692	285692	broad.mit.edu	37	5	9704476	9704476	+	Intron	DEL	A	-	-	rs5865850		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9704476delA	uc010itq.1	-						LOC285692_uc003jen.2_Intron					Homo sapiens clone TEE10 Cri-du-chat region mRNA.												0																		---	---	---	---
DAP	1611	broad.mit.edu	37	5	10739900	10739901	+	Intron	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10739900_10739901delCA	uc003jez.3	-						DAP_uc011cmw.1_Intron	NM_004394	NP_004385			death-associated protein						activation of caspase activity|cellular response to amino acid starvation|induction of apoptosis by extracellular signals|negative regulation of autophagy|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent		death domain binding				0		Ovarian(839;1.34e-05)|Breast(839;0.0634)|Lung NSC(810;0.0804)																---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11009995	11009996	+	Intron	INS	-	ATG	ATG	rs150847313	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11009995_11009996insATG	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11196907	11196908	+	Intron	INS	-	G	G	rs142294939	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11196907_11196908insG	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	12452281	12452282	+	IGR	DEL	GA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12452281_12452282delGA								CTNND2 (548171 upstream) : None (None downstream)																																			---	---	---	---
MARCH11	441061	broad.mit.edu	37	5	16095591	16095592	+	Intron	INS	-	AGGG	AGGG	rs142167340	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16095591_16095592insAGGG	uc003jfo.2	-							NM_001102562	NP_001096032			membrane-associated ring finger (C3HC4) 11							cytoplasmic vesicle membrane|integral to membrane	ligase activity|zinc ion binding				0																		---	---	---	---
MARCH11	441061	broad.mit.edu	37	5	16119474	16119475	+	Intron	INS	-	A	A	rs61583487	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16119474_16119475insA	uc003jfo.2	-							NM_001102562	NP_001096032			membrane-associated ring finger (C3HC4) 11							cytoplasmic vesicle membrane|integral to membrane	ligase activity|zinc ion binding				0																		---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21551804	21551804	+	Intron	DEL	A	-	-	rs5866509		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21551804delA	uc003jgh.3	+							NR_027026				Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
CDH12	1010	broad.mit.edu	37	5	22575506	22575506	+	Intron	DEL	T	-	-	rs35495576		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22575506delT	uc003jgk.2	-							NM_004061	NP_004052			cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
CDH12	1010	broad.mit.edu	37	5	22762040	22762041	+	Intron	DEL	AC	-	-	rs72287585		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22762040_22762041delAC	uc003jgk.2	-							NM_004061	NP_004052			cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	25350786	25350787	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25350786_25350787insT								CDH10 (705875 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	29431016	29431017	+	IGR	INS	-	A	A	rs139696005	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29431016_29431017insA								None (None upstream) : None (None downstream)																																			---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	31643935	31643935	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31643935delT	uc003jhl.2	+							NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	31908813	31908823	+	Intron	DEL	AGCCCCTTGCA	-	-	rs139814389		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31908813_31908823delAGCCCCTTGCA	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
ADAMTS12	81792	broad.mit.edu	37	5	33585144	33585147	+	Intron	DEL	ATCC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33585144_33585147delATCC	uc003jia.1	-						ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9															HNSCC(64;0.19)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	35888447	35888447	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35888447delT								IL7R (11526 upstream) : CAPSL (15951 downstream)																																			---	---	---	---
SLC1A3	6507	broad.mit.edu	37	5	36668413	36668413	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36668413delT	uc003jkj.3	+						SLC1A3_uc011cox.1_Intron|SLC1A3_uc010iuy.2_Intron	NM_004172	NP_004163			solute carrier family 1 (glial high affinity						D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	37916056	37916057	+	IGR	INS	-	C	C	rs34377318		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37916056_37916057insC								GDNF (76274 upstream) : EGFLAM (342476 downstream)																																			---	---	---	---
FYB	2533	broad.mit.edu	37	5	39147554	39147555	+	Intron	INS	-	TGTG	TGTG	rs149862403	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39147554_39147555insTGTG	uc003jls.2	-						FYB_uc003jlt.2_Intron|FYB_uc003jlu.2_Intron|FYB_uc011cpl.1_Intron	NM_199335	NP_955367			FYN binding protein (FYB-120/130) isoform 2						cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding			ovary(2)	2	all_lung(31;0.000343)		Epithelial(62;0.235)															---	---	---	---
C9	735	broad.mit.edu	37	5	39345452	39345452	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39345452delA	uc003jlv.3	-							NM_001737	NP_001728			complement component 9 precursor						complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex					0	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)															---	---	---	---
DAB2	1601	broad.mit.edu	37	5	39374452	39374455	+	Intron	DEL	AGAG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39374452_39374455delAGAG	uc003jlx.2	-						DAB2_uc003jlw.2_Intron	NM_001343	NP_001334			disabled homolog 2						cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding			kidney(2)|skin(1)	3	all_lung(31;0.000197)		Epithelial(62;0.137)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	40510996	40510997	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40510996_40510997insT								None (None upstream) : PTGER4 (169035 downstream)																																			---	---	---	---
GHR	2690	broad.mit.edu	37	5	42585874	42585875	+	Intron	INS	-	A	A	rs148783269	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42585874_42585875insA	uc003jmt.2	+						GHR_uc011cpq.1_Intron	NM_000163	NP_000154			growth hormone receptor precursor						2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	42896457	42896457	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42896457delA								SEPP1 (70459 upstream) : C5orf39 (142726 downstream)																																			---	---	---	---
PAIP1	10605	broad.mit.edu	37	5	43555285	43555285	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43555285delG	uc003job.2	-						PAIP1_uc003joa.2_Intron|PAIP1_uc010ivp.2_Intron|PAIP1_uc010ivo.2_Intron|PAIP1_uc003joc.2_Intron	NM_006451	NP_006442			poly(A) binding protein interacting protein 1						mRNA stabilization|nuclear-transcribed mRNA poly(A) tail shortening|translational initiation	cytosol	protein binding|RNA binding|translation activator activity			ovary(1)	1	Lung NSC(6;2.07e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	49440225	49440225	+	IGR	DEL	A	-	-	rs150430340		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49440225delA								None (None upstream) : EMB (251808 downstream)																																			---	---	---	---
PARP8	79668	broad.mit.edu	37	5	49984867	49984868	+	Intron	DEL	TT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49984867_49984868delTT	uc003jon.3	+						PARP8_uc011cpz.1_Intron|PARP8_uc003joo.2_Intron|PARP8_uc003jop.2_Intron	NM_024615	NP_078891			poly (ADP-ribose) polymerase family, member 8							intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	50612694	50612697	+	IGR	DEL	TGTT	-	-	rs71614306		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50612694_50612697delTGTT								PARP8 (474525 upstream) : ISL1 (66261 downstream)																																			---	---	---	---
ITGA2	3673	broad.mit.edu	37	5	52323910	52323911	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52323910_52323911insA	uc003joy.2	+						ITGA2_uc011cqa.1_Intron|ITGA2_uc011cqb.1_Intron|ITGA2_uc011cqc.1_Intron|ITGA2_uc011cqd.1_Intron|ITGA2_uc011cqe.1_Intron	NM_002203	NP_002194			integrin alpha 2 precursor						axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity			lung(1)	1		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)																---	---	---	---
ARL15	54622	broad.mit.edu	37	5	53512465	53512466	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53512465_53512466delAC	uc003jpg.1	-						ARL15_uc010ivs.1_Intron	NM_019087	NP_061960			ADP-ribosylation factor-like 15								GTP binding			ovary(1)	1		Lung NSC(810;0.000779)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	56988907	56988908	+	IGR	INS	-	A	A	rs72589733	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56988907_56988908insA								ACTBL2 (210271 upstream) : PLK2 (760904 downstream)																																			---	---	---	---
RAB3C	115827	broad.mit.edu	37	5	58107193	58107194	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58107193_58107194delTG	uc003jrp.2	+							NM_138453	NP_612462			RAB3C, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			ovary(1)|central_nervous_system(1)	2		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)														---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58748355	58748355	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58748355delA	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	59664604	59664605	+	Intron	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59664604_59664605delTC	uc003jsb.2	-						PDE4D_uc010iwj.1_Intron	NM_006203	NP_006194			phosphodiesterase 4D isoform 2						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	59861760	59861761	+	IGR	INS	-	A	A	rs73759342		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59861760_59861761insA								PART1 (18276 upstream) : DEPDC1B (30979 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	61008060	61008063	+	IGR	DEL	CGCA	-	-	rs137900821		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61008060_61008063delCGCA								FLJ37543 (5698 upstream) : KIF2A (593926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	61027538	61027540	+	IGR	DEL	GGG	-	-	rs148388505		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61027538_61027540delGGG								FLJ37543 (25176 upstream) : KIF2A (574449 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	61945017	61945020	+	IGR	DEL	ACAC	-	-	rs71938614		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61945017_61945020delACAC								IPO11 (20602 upstream) : ISCA1P1 (126182 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	62030215	62030215	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:62030215delC								IPO11 (105800 upstream) : ISCA1P1 (40987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	63985694	63985694	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63985694delT								RGS7BP (77575 upstream) : SFRS12IP1 (28286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	64314929	64314929	+	IGR	DEL	T	-	-	rs11355407		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64314929delT								CWC27 (339 upstream) : ADAMTS6 (129635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	71868669	71868670	+	IGR	INS	-	TG	TG			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71868669_71868670insTG								ZNF366 (65420 upstream) : TNPO1 (243748 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	72389759	72389759	+	IGR	DEL	T	-	-	rs11286361		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72389759delT								FCHO2 (3411 upstream) : TMEM171 (26629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	74436087	74436092	+	IGR	DEL	GGAAGG	-	-	rs56007035		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74436087_74436092delGGAAGG								GCNT4 (109363 upstream) : ANKRD31 (6970 downstream)																																			---	---	---	---
SV2C	22987	broad.mit.edu	37	5	75565699	75565699	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75565699delT	uc003kei.1	+							NM_014979	NP_055794			synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	76830156	76830157	+	IGR	INS	-	G	G	rs141739342	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76830156_76830157insG								WDR41 (41824 upstream) : OTP (94381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	76841052	76841052	+	IGR	DEL	A	-	-	rs34064893		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76841052delA								WDR41 (52720 upstream) : OTP (83486 downstream)																																			---	---	---	---
ARSB	411	broad.mit.edu	37	5	78081390	78081390	+	Intron	DEL	T	-	-	rs149057364		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78081390delT	uc003kfq.2	-							NM_000046	NP_000037			arylsulfatase B isoform 1 precursor						lysosomal transport|lysosome organization	lysosome	arylsulfatase activity|metal ion binding|N-acetylgalactosamine-4-sulfatase activity			upper_aerodigestive_tract(1)	1		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	78642287	78642292	+	IGR	DEL	CAACAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78642287_78642292delCAACAA								JMY (19251 upstream) : HOMER1 (27495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	79185645	79185646	+	IGR	INS	-	CC	CC	rs150830149	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79185645_79185646insCC								CMYA5 (89597 upstream) : MTX3 (86895 downstream)																																			---	---	---	---
SSBP2	23635	broad.mit.edu	37	5	80949817	80949818	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80949817_80949818insT	uc003kho.2	-						SSBP2_uc003khn.2_Intron|SSBP2_uc003khp.2_Intron|SSBP2_uc011ctp.1_Intron|SSBP2_uc011ctq.1_Intron|SSBP2_uc011ctr.1_Intron	NM_012446	NP_036578			single-stranded DNA binding protein 2						regulation of transcription, DNA-dependent	cytoplasm|nucleus	single-stranded DNA binding		SSBP2/JAK2(4)	haematopoietic_and_lymphoid_tissue(4)|skin(1)	5		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)														---	---	---	---
XRCC4	7518	broad.mit.edu	37	5	82553164	82553164	+	Intron	DEL	A	-	-	rs140919047		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82553164delA	uc003kib.2	+						XRCC4_uc003kia.1_Intron|XRCC4_uc003kid.2_Intron|XRCC4_uc003kic.2_Intron|XRCC4_uc003kie.2_Intron|XRCC4_uc003kif.1_Intron|XRCC4_uc003kig.2_Intron	NM_022406	NP_071801			X-ray repair cross complementing protein 4						DNA ligation involved in DNA repair|double-strand break repair via nonhomologous end joining|initiation of viral infection|positive regulation of ligase activity|provirus integration|response to X-ray	cytosol|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|nucleoplasm	DNA binding|protein C-terminus binding			skin(3)	3		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)									NHEJ					---	---	---	---
EDIL3	10085	broad.mit.edu	37	5	83243189	83243192	+	Intron	DEL	TGTG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83243189_83243192delTGTG	uc003kio.1	-						EDIL3_uc003kip.1_Intron	NM_005711	NP_005702			EGF-like repeats and discoidin I-like						cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)														---	---	---	---
EDIL3	10085	broad.mit.edu	37	5	83357990	83357991	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83357990_83357991insA	uc003kio.1	-						EDIL3_uc003kip.1_Intron|EDIL3_uc011ctt.1_Intron	NM_005711	NP_005702			EGF-like repeats and discoidin I-like						cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)														---	---	---	---
EDIL3	10085	broad.mit.edu	37	5	83512317	83512318	+	Intron	INS	-	AA	AA	rs146058797	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83512317_83512318insAA	uc003kio.1	-						EDIL3_uc003kip.1_Intron	NM_005711	NP_005702			EGF-like repeats and discoidin I-like						cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	84361819	84361819	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84361819delT								EDIL3 (681208 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	85219937	85219938	+	IGR	INS	-	AAC	AAC			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85219937_85219938insAAC								None (None upstream) : NBPF22P (358324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	85607076	85607077	+	IGR	DEL	AA	-	-	rs34407221		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85607076_85607077delAA								NBPF22P (13714 upstream) : COX7C (306707 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	86199237	86199238	+	IGR	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86199237_86199238delTC								COX7C (282656 upstream) : RASA1 (364913 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	87220997	87220997	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87220997delA								CCNH (512161 upstream) : TMEM161B (270027 downstream)																																			---	---	---	---
MEF2C	4208	broad.mit.edu	37	5	88078282	88078282	+	Intron	DEL	A	-	-	rs34338734		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88078282delA	uc003kjj.2	-						MEF2C_uc003kji.2_Intron|MEF2C_uc003kjk.2_Intron|MEF2C_uc003kjm.2_Intron|MEF2C_uc003kjl.2_Intron	NM_002397	NP_002388			myocyte enhancer factor 2C isoform 1						apoptosis|B cell proliferation|innate immune response|learning or memory|muscle cell differentiation|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|neuron development|positive regulation of muscle cell differentiation|positive regulation of survival gene product expression|positive regulation of transcription from RNA polymerase II promoter|regulation of germinal center formation|regulation of megakaryocyte differentiation|regulation of synaptic activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nuclear speck	activating transcription factor binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			lung(3)|breast(2)|ovary(1)|large_intestine(1)	7		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)											HNSCC(66;0.2)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	88773920	88773920	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88773920delA								MEF2C (574051 upstream) : CETN3 (915611 downstream)																																			---	---	---	---
GPR98	84059	broad.mit.edu	37	5	89897055	89897055	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89897055delA	uc003kju.2	+						GPR98_uc003kjt.2_Intron	NM_032119	NP_115495			G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	92701682	92701683	+	IGR	INS	-	A	A	rs139686777	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92701682_92701683insA								None (None upstream) : FLJ42709 (43382 downstream)																																			---	---	---	---
C5orf36	285600	broad.mit.edu	37	5	93796655	93796655	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93796655delT	uc011cuk.1	-							NM_001145678	NP_001139150			hypothetical protein LOC285600 isoform 1												0		all_cancers(142;2.12e-08)|all_epithelial(76;5.95e-11)|all_lung(232;0.000996)|Lung NSC(167;0.0108)|Ovarian(174;0.0218)|Colorectal(57;0.0329)|Breast(839;0.214)|Lung SC(612;0.236)		all cancers(79;3.96e-19)														---	---	---	---
MCTP1	79772	broad.mit.edu	37	5	94222578	94222579	+	Intron	DEL	GT	-	-	rs141189125	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94222578_94222579delGT	uc003kkx.2	-						MCTP1_uc003kkv.2_Intron|MCTP1_uc003kkw.2_Intron|MCTP1_uc003kkz.2_Intron|MCTP1_uc003kku.2_Intron	NM_024717	NP_078993			multiple C2 domains, transmembrane 1 isoform L						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)														---	---	---	---
ELL2	22936	broad.mit.edu	37	5	95234666	95234667	+	Intron	INS	-	AAAC	AAAC	rs143997177	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95234666_95234667insAAAC	uc003klr.3	-							NM_012081	NP_036213			elongation factor, RNA polymerase II, 2						regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)														---	---	---	---
LIX1	167410	broad.mit.edu	37	5	96477320	96477321	+	Intron	INS	-	T	T	rs150281218	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96477320_96477321insT	uc003kmy.3	-							NM_153234	NP_694966			limb expression 1											ovary(1)	1		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	100329556	100329557	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:100329556_100329557delAC								ST8SIA4 (90569 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	101369899	101369900	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101369899_101369900delTG								None (None upstream) : SLCO4C1 (199794 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	101968307	101968307	+	IGR	DEL	T	-	-	rs148533321		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101968307delT								SLCO6A1 (133587 upstream) : PAM (233220 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	102585964	102585965	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102585964_102585965insT								PPIP5K2 (47057 upstream) : C5orf30 (8477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	102826197	102826208	+	IGR	DEL	TCCCTTCCTCCC	-	-	rs117479832	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102826197_102826208delTCCCTTCCTCCC								C5orf30 (211836 upstream) : NUDT12 (58349 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	103041025	103041026	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103041025_103041026delTG								NUDT12 (142535 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	104002455	104002458	+	IGR	DEL	ATAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:104002455_104002458delATAC								None (None upstream) : RAB9BP1 (432717 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	104623694	104623694	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:104623694delT								RAB9BP1 (187896 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	106242341	106242344	+	IGR	DEL	AGAT	-	-	rs10589859		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106242341_106242344delAGAT								None (None upstream) : EFNA5 (470247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	106364858	106364858	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106364858delT								None (None upstream) : EFNA5 (347733 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	106430637	106430637	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106430637delG								None (None upstream) : EFNA5 (281954 downstream)																																			---	---	---	---
EFNA5	1946	broad.mit.edu	37	5	106938533	106938536	+	Intron	DEL	AAAG	-	-	rs66797038		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106938533_106938536delAAAG	uc003kol.2	-						EFNA5_uc010jbr.1_Intron	NM_001962	NP_001953			ephrin-A5 precursor						cell-cell signaling	anchored to plasma membrane|caveola|extracellular space	ephrin receptor binding				0		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)														---	---	---	---
FBXL17	64839	broad.mit.edu	37	5	107352468	107352471	+	Intron	DEL	TTTC	-	-	rs113717815		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107352468_107352471delTTTC	uc011cvc.1	-						FBXL17_uc003kon.3_Intron	NM_001163315	NP_001156787			F-box and leucine-rich repeat protein 17												0		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	113449370	113449370	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113449370delT								YTHDC2 (518391 upstream) : KCNN2 (248646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	116643317	116643317	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116643317delT								SEMA6A (732766 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	116693278	116693281	+	IGR	DEL	ACAT	-	-	rs139521184		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116693278_116693281delACAT								SEMA6A (782727 upstream) : None (None downstream)																																			---	---	---	---
TNFAIP8	25816	broad.mit.edu	37	5	118686694	118686695	+	Intron	DEL	TG	-	-	rs35932616		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118686694_118686695delTG	uc011cwf.1	+						TNFAIP8_uc003ksf.1_Intron|TNFAIP8_uc003ksg.2_Intron	NM_001077654	NP_001071122			tumor necrosis factor, alpha-induced protein 8						anti-apoptosis|apoptosis|negative regulation of anti-apoptosis	cytoplasm	caspase inhibitor activity|protein binding			ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	120325554	120325555	+	IGR	INS	-	A	A	rs36110515		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120325554_120325555insA								PRR16 (302592 upstream) : FTMT (862095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	121547499	121547499	+	IGR	DEL	A	-	-	rs113136044		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121547499delA								ZNF474 (58242 upstream) : SNCAIP (99887 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	122822177	122822177	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122822177delG								CEP120 (62925 upstream) : CSNK1G3 (25616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	123536638	123536639	+	IGR	INS	-	TG	TG	rs144322236	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123536638_123536639insTG								CSNK1G3 (584176 upstream) : ZNF608 (435971 downstream)																																			---	---	---	---
FLJ33630	644873	broad.mit.edu	37	5	127306480	127306480	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127306480delC	uc003kun.2	-						FLJ33630_uc003kuo.2_Intron|FLJ33630_uc003kup.1_Intron|FLJ33630_uc003kuq.1_Intron					Homo sapiens full length insert cDNA clone ZD74E10.												0																		---	---	---	---
FBN2	2201	broad.mit.edu	37	5	127849718	127849719	+	Intron	DEL	TG	-	-	rs58093837	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127849718_127849719delTG	uc003kuu.2	-						FBN2_uc003kuv.2_Intron|FBN2_uc003kuw.3_Intron|FBN2_uc003kux.1_Intron	NM_001999	NP_001990			fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	127980064	127980065	+	IGR	DEL	AC	-	-	rs34273754		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127980064_127980065delAC								FBN2 (106148 upstream) : SLC27A6 (321145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	128144465	128144465	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128144465delT								FBN2 (270549 upstream) : SLC27A6 (156745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	128394612	128394612	+	IGR	DEL	A	-	-	rs78108273		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128394612delA								SLC27A6 (25278 upstream) : ISOC1 (35830 downstream)																																			---	---	---	---
RAPGEF6	51735	broad.mit.edu	37	5	130850114	130850115	+	Intron	INS	-	T	T	rs139027726	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130850114_130850115insT	uc003kvn.1	-						RAPGEF6_uc003kvp.1_Intron|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Intron|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvr.2_Intron|RAPGEF6_uc011cxe.1_Intron|RAPGEF6_uc010jdk.2_Intron	NM_016340	NP_057424			PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)														---	---	---	---
ACSL6	23305	broad.mit.edu	37	5	131195973	131195974	+	Intron	INS	-	TT	TT			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131195973_131195974insTT	uc003kvv.1	-							NM_015256				acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
CCNI2	645121	broad.mit.edu	37	5	132081141	132081141	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132081141delT	uc003kxq.1	+						CCNI2_uc011cxg.1_5'Flank|CCNI2_uc011cxh.1_5'Flank	NM_001039780	NP_001034869			cyclin I family, member 2						regulation of cyclin-dependent protein kinase activity		protein kinase binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	133064390	133064391	+	IGR	INS	-	C	C	rs151081403	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133064390_133064391insC								FSTL4 (116167 upstream) : C5orf15 (226808 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	133076625	133076628	+	IGR	DEL	TGGA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133076625_133076628delTGGA								FSTL4 (128402 upstream) : C5orf15 (214571 downstream)																																			---	---	---	---
CXCL14	9547	broad.mit.edu	37	5	134909400	134909401	+	Intron	DEL	GT	-	-	rs140419480		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134909400_134909401delGT	uc003lay.2	-							NM_004887	NP_004878			small inducible cytokine B14 precursor						cell-cell signaling|chemotaxis|immune response|signal transduction	extracellular space|Golgi apparatus	chemokine activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
TRPC7	57113	broad.mit.edu	37	5	135557844	135557845	+	Intron	INS	-	A	A	rs144176756	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135557844_135557845insA	uc003lbn.1	-						TRPC7_uc010jef.1_Intron|TRPC7_uc010jeg.1_Intron|TRPC7_uc010jeh.1_Intron|TRPC7_uc010jei.1_Intron|TRPC7_uc010jej.1_Intron	NM_020389	NP_065122			transient receptor potential cation channel,						axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
SPOCK1	6695	broad.mit.edu	37	5	136348121	136348122	+	Intron	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136348121_136348122delCA	uc003lbo.2	-						SPOCK1_uc003lbp.2_Intron	NM_004598	NP_004589			sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
KLHL3	26249	broad.mit.edu	37	5	137007563	137007563	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137007563delG	uc010jek.2	-						KLHL3_uc011cyc.1_Intron|KLHL3_uc003lbr.3_Intron|KLHL3_uc011cyd.1_Intron|KLHL3_uc010jel.1_Intron|KLHL3_uc010jem.1_Intron|KLHL3_uc010jen.1_RNA|KLHL3_uc003lbs.1_Intron	NM_017415	NP_059111			kelch-like 3							cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)														---	---	---	---
HSPA9	3313	broad.mit.edu	37	5	137896597	137896598	+	Intron	INS	-	T	T	rs111382273		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137896597_137896598insT	uc003ldf.2	-						HSPA9_uc011cyw.1_Intron	NM_004134	NP_004125			heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	139467234	139467235	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139467234_139467235insT								NRG2 (44355 upstream) : PURA (26473 downstream)																																			---	---	---	---
PFDN1	5201	broad.mit.edu	37	5	139647338	139647339	+	Intron	INS	-	A	A	rs142506002	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139647338_139647339insA	uc003lff.1	-						C5orf32_uc010jfi.2_Intron|PFDN1_uc003lfe.1_Intron|PFDN1_uc003lfg.1_Intron	NM_002622	NP_002613			prefoldin subunit 1						'de novo' posttranslational protein folding|cell cycle	prefoldin complex	sequence-specific DNA binding transcription factor activity|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	139687072	139687073	+	IGR	INS	-	TT	TT	rs13174826		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139687072_139687073insTT								PFDN1 (4383 upstream) : HBEGF (25356 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	140123184	140123184	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140123184delT								VTRNA1-3 (17353 upstream) : PCDHA1 (42692 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	141183673	141183674	+	IGR	DEL	TC	-	-	rs111520417		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141183673_141183674delTC								ARAP3 (121873 upstream) : PCDH1 (49009 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	141815729	141815730	+	IGR	INS	-	T	T	rs144050225		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141815729_141815730insT								SPRY4 (111109 upstream) : FGF1 (156014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	147310544	147310545	+	IGR	INS	-	TGGT	TGGT	rs138493843	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147310544_147310545insTGGT								C5orf46 (24443 upstream) : SPINK5 (132990 downstream)																																			---	---	---	---
CSNK1A1	1452	broad.mit.edu	37	5	148930077	148930077	+	Intron	DEL	A	-	-	rs11478467		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148930077delA	uc003lqx.1	-						CSNK1A1_uc011dcc.1_5'Flank|CSNK1A1_uc003lqv.1_5'Flank|CSNK1A1_uc003lqw.1_Intron|CSNK1A1_uc003lqy.1_Intron|CSNK1A1_uc010jha.1_Intron	NM_001892	NP_001883			casein kinase 1, alpha 1 isoform 2						cell division|mitosis|Wnt receptor signaling pathway	centrosome|condensed chromosome kinetochore|cytosol|nuclear speck	ATP binding|protein binding|protein binding|protein serine/threonine kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)														---	---	---	---
ARHGEF37	389337	broad.mit.edu	37	5	149004212	149004213	+	Intron	INS	-	TGTAA	TGTAA	rs141340561	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149004212_149004213insTGTAA	uc003lra.1	+							NM_001001669	NP_001001669			hypothetical protein LOC389337						regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0																		---	---	---	---
CAMK2A	815	broad.mit.edu	37	5	149647438	149647438	+	Intron	DEL	T	-	-	rs76918998		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149647438delT	uc003lru.2	-						CAMK2A_uc003lrt.2_Intron|CAMK2A_uc010jhe.2_Intron	NM_171825	NP_741960			calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|positive regulation of NF-kappaB transcription factor activity|synaptic transmission	cell junction|cytosol|endocytic vesicle membrane|nucleoplasm|presynaptic membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)	1		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
GM2A	2760	broad.mit.edu	37	5	150765434	150765434	+	Intron	DEL	T	-	-	rs35106856		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150765434delT	uc011dcs.1	+							NM_000405				GM2 ganglioside activator precursor							lysosome|nucleolus	sphingolipid activator protein activity				0		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	152700999	152701000	+	IGR	DEL	TG	-	-	rs145688374		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152700999_152701000delTG								NMUR2 (916159 upstream) : GRIA1 (168175 downstream)																																			---	---	---	---
GALNT10	55568	broad.mit.edu	37	5	153632109	153632110	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153632109_153632110insT	uc003lvh.2	+						GALNT10_uc003lvg.1_Intron|GALNT10_uc010jic.2_Intron	NM_198321	NP_938080			GalNAc transferase 10 isoform a							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)															---	---	---	---
SGCD	6444	broad.mit.edu	37	5	155225016	155225016	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155225016delT	uc003lwa.1	+							NM_172244	NP_758447			delta-sarcoglycan isoform 2						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
C1QTNF2	114898	broad.mit.edu	37	5	159778463	159778463	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159778463delA	uc003lyd.2	-							NM_031908	NP_114114			C1q and tumor necrosis factor related protein 2							collagen				skin(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
ATP10B	23120	broad.mit.edu	37	5	160258685	160258686	+	Intron	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160258685_160258686delCA	uc003lym.1	-						ATP10B_uc003lyp.2_Intron|ATP10B_uc011deg.1_Intron	NM_025153	NP_079429			ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	165985897	165985897	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165985897delT								None (None upstream) : ODZ2 (725946 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	166230066	166230066	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166230066delA								None (None upstream) : ODZ2 (481777 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	166502204	166502205	+	IGR	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166502204_166502205delAG								None (None upstream) : ODZ2 (209638 downstream)																																			---	---	---	---
ODZ2	57451	broad.mit.edu	37	5	167310398	167310399	+	Intron	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167310398_167310399delCA	uc010jjd.2	+						ODZ2_uc003lzq.2_Intron|ODZ2_uc003lzr.3_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	168909403	168909404	+	IGR	INS	-	A	A	rs146525466	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168909403_168909404insA								SLIT3 (181270 upstream) : CCDC99 (101234 downstream)																																			---	---	---	---
LCP2	3937	broad.mit.edu	37	5	169711461	169711461	+	Intron	DEL	T	-	-	rs150092779		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169711461delT	uc003man.1	-						LCP2_uc011det.1_Intron	NM_005565	NP_005556			lymphocyte cytosolic protein 2						immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)														---	---	---	---
LOC257358	257358	broad.mit.edu	37	5	169758108	169758109	+	5'Flank	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169758108_169758109insA	uc011deu.1	+							NR_026945				Homo sapiens cDNA FLJ36406 fis, clone THYMU2010059.												0																		---	---	---	---
RANBP17	64901	broad.mit.edu	37	5	170668489	170668489	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170668489delA	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc003mbd.2_Intron|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048			RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)					T	TRD@	ALL								---	---	---	---
C5orf41	153222	broad.mit.edu	37	5	172482382	172482383	+	5'Flank	INS	-	CA	CA	rs138765470	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172482382_172482383insCA	uc003mch.2	+						C5orf41_uc003mcg.2_5'Flank|C5orf41_uc003mcf.2_5'Flank|C5orf41_uc011dfd.1_5'Flank	NM_153607	NP_705835			luman-recruiting factor								protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Renal(175;0.000159)|Lung NSC(126;0.00223)|all_lung(126;0.00391)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	174273371	174273376	+	IGR	DEL	AGAAAG	-	-	rs10557223		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174273371_174273376delAGAAAG								MSX2 (115470 upstream) : DRD1 (594300 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174659247	174659248	+	IGR	INS	-	AGAAGG	AGAAGG	rs140434638		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174659247_174659248insAGAAGG								MSX2 (501346 upstream) : DRD1 (208428 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174972466	174972466	+	IGR	DEL	A	-	-	rs72087574		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174972466delA								SFXN1 (16845 upstream) : HRH2 (112574 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	175317859	175317860	+	IGR	INS	-	AGTT	AGTT	rs138019216	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175317859_175317860insAGTT								CPLX2 (6836 upstream) : THOC3 (68676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	175352948	175352948	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175352948delA								CPLX2 (41925 upstream) : THOC3 (33588 downstream)																																			---	---	---	---
NSD1	64324	broad.mit.edu	37	5	176593545	176593546	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176593545_176593546insA	uc003mfr.3	+						NSD1_uc003mft.3_Intron|NSD1_uc003mfs.1_Intron|NSD1_uc011dfx.1_Intron|NSD1_uc003mfp.2_Intron	NM_022455	NP_071900			nuclear receptor binding SET domain protein 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)				T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			---	---	---	---
FAM193B	54540	broad.mit.edu	37	5	176953534	176953534	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176953534delA	uc003mhs.3	-						FAM193B_uc003mhr.2_5'Flank|FAM193B_uc003mht.2_Intron|FAM193B_uc003mhu.2_Intron|FAM193B_uc003mhv.2_Intron|FAM193B_uc003mhw.2_Intron	NM_019057	NP_061930			hypothetical protein LOC54540												0																		---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	177981182	177981183	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177981182_177981183insT	uc003mje.2	-							NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
ADAMTS2	9509	broad.mit.edu	37	5	178697517	178697518	+	Intron	INS	-	AC	AC	rs143275640	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178697517_178697518insAC	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)														---	---	---	---
RNF130	55819	broad.mit.edu	37	5	179442619	179442619	+	Intron	DEL	G	-	-	rs66616765		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179442619delG	uc003mll.1	-						RNF130_uc003mlm.1_Intron|MIR340_hsa-mir-340|MI0000802_5'Flank|uc003mln.2_5'Flank	NM_018434	NP_060904			ring finger protein 130 precursor						apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
RNF130	55819	broad.mit.edu	37	5	179474009	179474010	+	Intron	DEL	TC	-	-	rs35328290		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179474009_179474010delTC	uc003mll.1	-						RNF130_uc003mlm.1_Intron	NM_018434	NP_060904			ring finger protein 130 precursor						apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
CNOT6	57472	broad.mit.edu	37	5	179953227	179953228	+	Intron	DEL	GA	-	-	rs142090081		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179953227_179953228delGA	uc003mlx.2	+						CNOT6_uc010jld.2_Intron|CNOT6_uc010jle.2_Intron	NM_015455	NP_056270			CCR4-NOT transcription complex, subunit 6						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	exonuclease activity|metal ion binding|protein binding|RNA binding				0	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)														---	---	---	---
CNOT6	57472	broad.mit.edu	37	5	179985620	179985621	+	Intron	INS	-	CT	CT	rs142658066	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179985620_179985621insCT	uc003mlx.2	+						CNOT6_uc010jld.2_Intron|CNOT6_uc010jle.2_Intron	NM_015455	NP_056270			CCR4-NOT transcription complex, subunit 6						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	exonuclease activity|metal ion binding|protein binding|RNA binding				0	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	367580	367583	+	IGR	DEL	CAGA	-	-	rs76709322		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:367580_367583delCAGA								DUSP22 (16227 upstream) : IRF4 (24169 downstream)																																			---	---	---	---
LOC285768	285768	broad.mit.edu	37	6	1069297	1069298	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1069297_1069298delTG	uc011dhp.1	-						LOC285768_uc010jnf.1_Intron|LOC285768_uc003mtj.2_Intron	NR_027115				Homo sapiens cDNA clone IMAGE:5272115.												0																		---	---	---	---
GMDS	2762	broad.mit.edu	37	6	1772218	1772219	+	Intron	INS	-	TGTAA	TGTAA	rs144564060	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1772218_1772219insTGTAA	uc003mtq.2	-							NM_001500	NP_001491			GDP-mannose 4,6-dehydratase						'de novo' GDP-L-fucose biosynthetic process|GDP-mannose metabolic process|leukocyte cell-cell adhesion		coenzyme binding|GDP-mannose 4,6-dehydratase activity			central_nervous_system(1)	1	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)														---	---	---	---
GMDS	2762	broad.mit.edu	37	6	1927592	1927592	+	Intron	DEL	T	-	-	rs67316164		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1927592delT	uc003mtq.2	-							NM_001500	NP_001491			GDP-mannose 4,6-dehydratase						'de novo' GDP-L-fucose biosynthetic process|GDP-mannose metabolic process|leukocyte cell-cell adhesion		coenzyme binding|GDP-mannose 4,6-dehydratase activity			central_nervous_system(1)	1	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	2488157	2488157	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2488157delG								GMDS (242311 upstream) : C6orf195 (134815 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	2493539	2493540	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2493539_2493540delCA								GMDS (247693 upstream) : C6orf195 (129432 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	2594992	2594992	+	IGR	DEL	C	-	-	rs142152856		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2594992delC								GMDS (349146 upstream) : C6orf195 (27980 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	3464688	3464688	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3464688delT								SLC22A23 (7895 upstream) : C6orf145 (258148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	4012211	4012211	+	IGR	DEL	C	-	-	rs34944898		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4012211delC								FAM50B (160661 upstream) : PRPF4B (9358 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	5834403	5834403	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5834403delA								FARS2 (62587 upstream) : NRN1 (163832 downstream)																																			---	---	---	---
LOC285780	285780	broad.mit.edu	37	6	6438908	6438909	+	RNA	INS	-	A	A	rs145254963	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6438908_6438909insA	uc003mww.3	-	4		c.418_419insT			LOC285780_uc003mwx.2_RNA	NR_026970				Homo sapiens cDNA FLJ33708 fis, clone BRAWH2007862.												0																		---	---	---	---
LOC285780	285780	broad.mit.edu	37	6	6569326	6569327	+	Intron	DEL	TT	-	-	rs67526548		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6569326_6569327delTT	uc003mww.3	-						LOC285780_uc003mwx.2_Intron	NR_026970				Homo sapiens cDNA FLJ33708 fis, clone BRAWH2007862.												0																		---	---	---	---
RREB1	6239	broad.mit.edu	37	6	7153646	7153647	+	Intron	INS	-	AC	AC	rs141148858	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7153646_7153647insAC	uc003mxc.2	+						RREB1_uc010jnw.2_Intron|RREB1_uc003mxb.2_Intron|RREB1_uc010jnx.2_Intron|RREB1_uc003mxd.2_Intron	NM_001003698	NP_001003698			ras responsive element binding protein 1 isoform						multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)																---	---	---	---
SSR1	6745	broad.mit.edu	37	6	7291203	7291204	+	Intron	INS	-	AG	AG	rs145220807	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7291203_7291204insAG	uc003mxf.3	-						SSR1_uc003mxg.3_Intron|SSR1_uc010jny.2_Intron	NM_003144	NP_003135			signal sequence receptor, alpha precursor						cotranslational protein targeting to membrane|positive regulation of cell proliferation	endoplasmic reticulum membrane|integral to membrane	signal sequence binding				0	Ovarian(93;0.0398)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	9258293	9258293	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9258293delA								HULC (604216 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	9846443	9846444	+	Intron	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9846443_9846444delAG	uc003myg.1	-						uc010jog.1_Intron|uc003myh.1_Intron|uc003myi.2_Intron|uc003myj.1_Intron|uc003myk.1_Intron|uc010joh.1_Intron|uc003myl.1_Intron|uc003mym.1_Intron					Homo sapiens clone 958LR MRDS1 protein (MRDS1) mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	10073384	10073387	+	Intron	DEL	CACG	-	-	rs149591061		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10073384_10073387delCACG	uc010joj.1	-						uc003myp.1_Intron					Homo sapiens clone 958LR MRDS1 protein (MRDS1) mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	10348113	10348113	+	IGR	DEL	A	-	-	rs78141925		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10348113delA								None (None upstream) : TFAP2A (48804 downstream)																																			---	---	---	---
GCNT2	2651	broad.mit.edu	37	6	10539873	10539874	+	Intron	DEL	GA	-	-	rs56389157		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10539873_10539874delGA	uc010joo.2	+						GCNT2_uc010jol.2_Intron|GCNT2_uc010jom.2_Intron|GCNT2_uc010jop.2_Intron|GCNT2_uc003mza.2_Intron|GCNT2_uc003mzc.3_Intron	NM_145649	NP_663624			glucosaminyl (N-acetyl) transferase 2,							Golgi membrane|integral to membrane	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)	2	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)														---	---	---	---
NEDD9	4739	broad.mit.edu	37	6	11242965	11242966	+	Intron	INS	-	GGTG	GGTG	rs148733902	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11242965_11242966insGGTG	uc010joz.2	-						NEDD9_uc003mzw.3_Intron	NM_001142393	NP_001135865			neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)															---	---	---	---
PHACTR1	221692	broad.mit.edu	37	6	13010093	13010095	+	Intron	DEL	CCA	-	-	rs66779477		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13010093_13010095delCCA	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210			phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	14396154	14396154	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14396154delA								CD83 (259008 upstream) : JARID2 (849580 downstream)																																			---	---	---	---
JARID2	3720	broad.mit.edu	37	6	15302648	15302649	+	Intron	INS	-	A	A	rs149565432	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15302648_15302649insA	uc003nbj.2	+						JARID2_uc011diu.1_Intron|JARID2_uc011div.1_Intron	NM_004973	NP_004964			jumonji, AT rich interactive domain 2 protein						central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	16179149	16179150	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16179149_16179150insT								MYLIP (30673 upstream) : GMPR (59661 downstream)																																			---	---	---	---
GMPR	2766	broad.mit.edu	37	6	16293248	16293249	+	Intron	DEL	TC	-	-	rs111615731		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16293248_16293249delTC	uc003nbs.2	+							NM_006877	NP_006868			guanosine monophosphate reductase						nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage|response to cold	cytosol	GMP reductase activity|metal ion binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	16967614	16967615	+	IGR	INS	-	G	G	rs144051998	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16967614_16967615insG								ATXN1 (205893 upstream) : RBM24 (314194 downstream)																																			---	---	---	---
CAP2	10486	broad.mit.edu	37	6	17499289	17499290	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17499289_17499290insA	uc003ncb.2	+						CAP2_uc010jpk.1_Intron|CAP2_uc011dja.1_Intron|CAP2_uc011djb.1_Intron|CAP2_uc011djc.1_Intron|CAP2_uc011djd.1_Intron	NM_006366	NP_006357			adenylyl cyclase-associated protein 2						activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)															---	---	---	---
KIF13A	63971	broad.mit.edu	37	6	17907785	17907785	+	Intron	DEL	A	-	-	rs111706430		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17907785delA	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron	NM_022113	NP_071396			kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	18128213	18128213	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18128213delG								NHLRC1 (5362 upstream) : TPMT (333 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	18376329	18376329	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18376329delG								DEK (111530 upstream) : RNF144B (11265 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	18832719	18832719	+	IGR	DEL	A	-	-	rs67444346		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18832719delA								MIR548A1 (260608 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	20048455	20048455	+	IGR	DEL	A	-	-	rs34963433		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20048455delA								ID4 (207541 upstream) : MBOAT1 (52480 downstream)																																			---	---	---	---
MBOAT1	154141	broad.mit.edu	37	6	20130580	20130582	+	Intron	DEL	TTG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20130580_20130582delTTG	uc003ncx.1	-						MBOAT1_uc011dji.1_Intron	NM_001080480	NP_001073949			membrane bound O-acyltransferase domain						phospholipid biosynthetic process	integral to membrane	acyltransferase activity				0	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	21331971	21331972	+	IGR	INS	-	A	A	rs148710820	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21331971_21331972insA								CDKAL1 (99339 upstream) : SOX4 (262000 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	21648358	21648359	+	IGR	INS	-	TTTG	TTTG	rs147056419	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21648358_21648359insTTTG								SOX4 (49511 upstream) : FLJ22536 (16644 downstream)																																			---	---	---	---
FLJ22536	401237	broad.mit.edu	37	6	21893932	21893934	+	Intron	DEL	AGT	-	-	rs35895784		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21893932_21893934delAGT	uc010jpp.1	+						FLJ22536_uc003ndj.2_Intron|FLJ22536_uc011djk.1_Intron|FLJ22536_uc011djj.1_Intron|FLJ22536_uc003ndk.1_Intron					Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	23024768	23024768	+	IGR	DEL	T	-	-	rs34308670		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23024768delT								HDGFL1 (454019 upstream) : None (None downstream)																																			---	---	---	---
DCDC2	51473	broad.mit.edu	37	6	24340950	24340950	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24340950delA	uc003ndx.2	-						DCDC2_uc003ndy.2_Intron	NM_016356	NP_057440			doublecortin domain containing 2						cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)																---	---	---	---
FAM65B	9750	broad.mit.edu	37	6	24895667	24895667	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24895667delA	uc003neo.1	-						FAM65B_uc011djs.1_Intron|FAM65B_uc011dju.1_Intron	NM_014722	NP_055537			hypothetical protein LOC9750 isoform 1						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1																		---	---	---	---
LRRC16A	55604	broad.mit.edu	37	6	25410831	25410832	+	Intron	INS	-	AC	AC	rs10639167		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25410831_25410832insAC	uc011djw.1	+						LRRC16A_uc010jpx.2_Intron|LRRC16A_uc010jpy.2_Intron	NM_017640	NP_060110			leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	27745585	27745593	+	IGR	DEL	AACAACAAC	-	-	rs67434342		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27745585_27745593delAACAACAAC								ZNF184 (304688 upstream) : HIST1H2BL (29665 downstream)																																			---	---	---	---
GABBR1	2550	broad.mit.edu	37	6	29603575	29603575	+	5'Flank	DEL	T	-	-	rs34958519		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29603575delT	uc003nmt.3	-						GABBR1_uc003nmu.3_5'Flank|GABBR1_uc011dlr.1_5'Flank	NM_001470	NP_001461			gamma-aminobutyric acid (GABA) B receptor 1						gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)													---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29927896	29927896	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29927896delC	uc011dmb.1	+							NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29959057	29959058	+	Intron	INS	-	G	G	rs138083356	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29959057_29959058insG	uc011dmb.1	+							NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	30368813	30368814	+	IGR	INS	-	A	A	rs139081425	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30368813_30368814insA								TRIM39 (54181 upstream) : HLA-E (88457 downstream)																																			---	---	---	---
C6orf134	79969	broad.mit.edu	37	6	30607917	30607917	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30607917delA	uc003nqu.2	+						C6orf134_uc003nqr.3_Intron|C6orf134_uc003rdc.2_Intron|C6orf134_uc003nqs.3_Intron|C6orf134_uc003rdd.2_Intron|C6orf134_uc003nqt.2_Intron|C6orf134_uc011dmm.1_Intron|C6orf134_uc003nqv.2_Intron	NM_024909	NP_079185			hypothetical protein LOC79969 isoform 2								tubulin N-acetyltransferase activity				0																		---	---	---	---
C6orf136	221545	broad.mit.edu	37	6	30618163	30618164	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30618163_30618164insA	uc003nqw.3	+						C6orf136_uc003nqx.3_Intron|C6orf136_uc011dmn.1_Intron	NM_001109938	NP_001103408			hypothetical protein LOC221545 isoform 1												0																		---	---	---	---
HLA-DRB5	3127	broad.mit.edu	37	6	32496821	32496822	+	Intron	INS	-	A	A	rs139852896	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32496821_32496822insA	uc003obj.2	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB5_uc003obk.3_Intron	NM_002125	NP_002116			major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0																		---	---	---	---
ANKS1A	23294	broad.mit.edu	37	6	34989050	34989050	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34989050delT	uc003ojx.3	+						ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Intron|ANKS1A_uc010jvp.1_Intron	NM_015245	NP_056060			ankyrin repeat and sterile alpha motif domain							cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
PPARD	5467	broad.mit.edu	37	6	35355803	35355803	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35355803delT	uc003okm.2	+						PPARD_uc003okl.2_Intron|PPARD_uc003okn.2_Intron|PPARD_uc011dtb.1_Intron|PPARD_uc011dtc.1_Intron|uc011dtd.1_5'Flank	NM_006238	NP_006229			peroxisome proliferative activated receptor,						apoptosis|axon ensheathment|cholesterol metabolic process|decidualization|embryo implantation|fatty acid beta-oxidation|fatty acid transport|generation of precursor metabolites and energy|glucose metabolic process|glucose transport|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fat cell differentiation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|linoleic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1					Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)													---	---	---	---
TULP1	7287	broad.mit.edu	37	6	35468952	35468953	+	Intron	INS	-	CA	CA			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35468952_35468953insCA	uc003okv.3	-						TULP1_uc003okw.3_Intron	NM_003322	NP_003313			tubby like protein 1						dendrite development|eye photoreceptor cell development|phagocytosis|photoreceptor cell maintenance|positive regulation of phagocytosis	cell junction|cytoplasm|extracellular region|photoreceptor inner segment|photoreceptor outer segment|synapse	actin filament binding|phosphatidylinositol-4,5-bisphosphate binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
MAPK14	1432	broad.mit.edu	37	6	36017998	36018001	+	Intron	DEL	AGAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36017998_36018001delAGAC	uc003olp.2	+						MAPK14_uc011dth.1_Intron|MAPK14_uc003olo.2_Intron|MAPK14_uc003olq.2_Intron|MAPK14_uc003olr.2_Intron|MAPK14_uc011dti.1_Intron	NM_001315	NP_001306			mitogen-activated protein kinase 14 isoform 1						activation of MAPK activity|cellular component movement|cellular response to ionizing radiation|chemotaxis|innate immune response|mRNA metabolic process|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of muscle cell differentiation|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|signal transduction in response to DNA damage|stress-activated MAPK cascade|stress-induced premature senescence|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|MAP kinase kinase activity|protein binding			ovary(2)|stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
C6orf89	221477	broad.mit.edu	37	6	36895005	36895005	+	3'UTR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36895005delA	uc003omx.2	+	9					C6orf89_uc003omv.2_3'UTR|C6orf89_uc003omw.2_3'UTR|C6orf89_uc011dtr.1_3'UTR|C6orf89_uc003omy.2_3'UTR	NM_152734	NP_689947			hypothetical protein LOC221477							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	37040390	37040405	+	IGR	DEL	GGAAGGAAGGAAGGAA	-	-	rs71696088		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37040390_37040405delGGAAGGAAGGAAGGAA								FGD2 (43545 upstream) : PIM1 (97517 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37152393	37152394	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37152393_37152394insT								PIM1 (9191 upstream) : TMEM217 (27561 downstream)																																			---	---	---	---
ZFAND3	60685	broad.mit.edu	37	6	37796432	37796433	+	Intron	INS	-	T	T	rs141719320	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37796432_37796433insT	uc003onx.2	+							NM_021943	NP_068762			zinc finger, AN1-type domain 3								DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38964464	38964464	+	Intron	DEL	G	-	-	rs35115389		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38964464delG	uc003ooe.1	+							NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
CAPN11	11131	broad.mit.edu	37	6	44147040	44147040	+	Intron	DEL	T	-	-	rs112784503		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44147040delT	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989			calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
CAPN11	11131	broad.mit.edu	37	6	44149989	44149990	+	Intron	INS	-	CA	CA	rs139468500	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44149989_44149990insCA	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989			calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
RUNX2	860	broad.mit.edu	37	6	45452929	45452930	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45452929_45452930insT	uc011dvx.1	+						RUNX2_uc011dvy.1_Intron|RUNX2_uc003oxt.2_Intron	NM_001024630	NP_001019801			runt-related transcription factor 2 isoform a						negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3																		---	---	---	---
CD2AP	23607	broad.mit.edu	37	6	47577250	47577250	+	Intron	DEL	A	-	-	rs141520082		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47577250delA	uc003oyw.2	+							NM_012120	NP_036252			CD2-associated protein						cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)															---	---	---	---
GPR111	222611	broad.mit.edu	37	6	47629417	47629418	+	Intron	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47629417_47629418delAG	uc010jzj.1	+						GPR111_uc010jzk.1_Intron|GPR111_uc003oyy.2_Intron	NM_153839	NP_722581			G-protein coupled receptor 111						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	48120378	48120378	+	IGR	DEL	G	-	-	rs146444847		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48120378delG								C6orf138 (41435 upstream) : None (None downstream)																																			---	---	---	---
RHAG	6005	broad.mit.edu	37	6	49589698	49589699	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49589698_49589699insT	uc003ozk.3	-						RHAG_uc010jzl.2_Intron|RHAG_uc010jzm.2_Intron	NM_000324	NP_000315			Rh-associated glycoprotein						carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	52466691	52466691	+	IGR	DEL	A	-	-	rs111560547		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52466691delA								TRAM2 (24829 upstream) : LOC730101 (62508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	52470813	52470814	+	IGR	INS	-	T	T	rs34400856		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52470813_52470814insT								TRAM2 (28951 upstream) : LOC730101 (58385 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	53444916	53444916	+	Intron	DEL	T	-	-	rs34477485		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53444916delT	uc003pby.1	-						uc003pbz.1_Intron|uc003pca.1_Intron					Homo sapiens cDNA FLJ43138 fis, clone CTONG3007244.																														---	---	---	---
C6orf142	90523	broad.mit.edu	37	6	53947226	53947226	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53947226delT	uc003pcg.3	+						C6orf142_uc003pcf.2_Intron|C6orf142_uc003pch.3_5'Flank	NM_138569	NP_612636			hypothetical protein LOC90523							nuclear envelope|PML body	protein binding				0	Lung NSC(77;0.0317)																	---	---	---	---
DST	667	broad.mit.edu	37	6	56809953	56809953	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56809953delT	uc003pdf.2	-							NM_001144769	NP_001138241			dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)															---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57214567	57214571	+	Intron	DEL	TTTTT	-	-	rs35096698		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57214567_57214571delTTTTT	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57254538	57254539	+	Intron	DEL	TT	-	-	rs3031229		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57254538_57254539delTT	uc003pdx.2	+						hsa-mir-548u|MI0014168_5'Flank	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57308617	57308618	+	Intron	INS	-	A	A	rs146159570	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57308617_57308618insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57313203	57313204	+	Intron	INS	-	A	A	rs147384684	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57313203_57313204insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57360174	57360175	+	Intron	DEL	TG	-	-	rs145904207		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57360174_57360175delTG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57362938	57362939	+	Intron	INS	-	CATCTGC	CATCTGC	rs144736456	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57362938_57362939insCATCTGC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57471290	57471290	+	Intron	DEL	T	-	-	rs66482961		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57471290delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57486293	57486294	+	Intron	INS	-	A	A	rs112919139		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57486293_57486294insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57515828	57515828	+	IGR	DEL	C	-	-	rs11292500		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57515828delC								PRIM2 (2453 upstream) : GUSBL2 (730331 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57526548	57526549	+	IGR	INS	-	C	C	rs112692590		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57526548_57526549insC								PRIM2 (13173 upstream) : GUSBL2 (719610 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57531917	57531917	+	IGR	DEL	C	-	-	rs149927103		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57531917delC								PRIM2 (18542 upstream) : GUSBL2 (714242 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57531985	57531986	+	IGR	INS	-	ACA	ACA	rs142123826	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57531985_57531986insACA								PRIM2 (18610 upstream) : GUSBL2 (714173 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57542931	57542931	+	IGR	DEL	G	-	-	rs112793267		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57542931delG								PRIM2 (29556 upstream) : GUSBL2 (703228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57544661	57544664	+	IGR	DEL	AGGG	-	-	rs75928337		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57544661_57544664delAGGG								PRIM2 (31286 upstream) : GUSBL2 (701495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57549946	57549947	+	IGR	INS	-	A	A	rs146058318	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57549946_57549947insA								PRIM2 (36571 upstream) : GUSBL2 (696212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57598259	57598260	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57598259_57598260insT								PRIM2 (84884 upstream) : GUSBL2 (647899 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57605171	57605172	+	IGR	INS	-	TTT	TTT	rs150529857	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57605171_57605172insTTT								PRIM2 (91796 upstream) : GUSBL2 (640987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	58431421	58431422	+	IGR	INS	-	T	T	rs139381951	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58431421_58431422insT								GUSBL2 (143697 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	63589463	63589463	+	IGR	DEL	G	-	-	rs76977046		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63589463delG								KHDRBS2 (593363 upstream) : LGSN (396394 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	63979192	63979192	+	IGR	DEL	A	-	-	rs34661095		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63979192delA								KHDRBS2 (983092 upstream) : LGSN (6665 downstream)																																			---	---	---	---
EYS	346007	broad.mit.edu	37	6	64535413	64535413	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64535413delG	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	65664167	65664167	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65664167delA	uc011dxu.1	-							NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	68681460	68681461	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:68681460_68681461insT								None (None upstream) : BAI3 (664171 downstream)																																			---	---	---	---
BAI3	577	broad.mit.edu	37	6	69560467	69560467	+	Intron	DEL	T	-	-	rs74582214		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69560467delT	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695			brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
BAI3	577	broad.mit.edu	37	6	69700635	69700635	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69700635delT	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695			brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
COL9A1	1297	broad.mit.edu	37	6	71013889	71013889	+	5'Flank	DEL	A	-	-	rs11313766		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71013889delA	uc003pfg.3	-							NM_001851	NP_001842			alpha 1 type IX collagen isoform 1 precursor						axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4																		---	---	---	---
MTO1	25821	broad.mit.edu	37	6	74192512	74192512	+	Intron	DEL	C	-	-	rs35121302		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74192512delC	uc003pgy.3	+						MTO1_uc010kav.2_Intron|MTO1_uc003pgz.3_Intron|MTO1_uc003pha.3_Intron|MTO1_uc003phb.3_Intron	NM_133645	NP_598400			mitochondrial translation optimization 1 homolog						tRNA processing	mitochondrion	flavin adenine dinucleotide binding			ovary(3)|skin(2)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	74604636	74604636	+	IGR	DEL	T	-	-	rs71908474		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74604636delT								CD109 (66596 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	74657616	74657616	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74657616delT								CD109 (119576 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	74796235	74796235	+	Intron	DEL	A	-	-	rs71542258		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74796235delA	uc003phr.2	+											Homo sapiens full length insert cDNA clone ZD50H02.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	75165471	75165471	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75165471delA	uc003phr.2	+											Homo sapiens full length insert cDNA clone ZD50H02.																														---	---	---	---
MYO6	4646	broad.mit.edu	37	6	76604305	76604306	+	Intron	DEL	AT	-	-	rs144458852		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76604305_76604306delAT	uc003pih.1	+						MYO6_uc003pig.1_Intron|MYO6_uc003pii.1_Intron|MYO6_uc003pij.1_5'UTR	NM_004999	NP_004990			myosin VI						actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)														---	---	---	---
BCKDHB	594	broad.mit.edu	37	6	81020603	81020612	+	Intron	DEL	TGTATGTCTT	-	-	rs141454616		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81020603_81020612delTGTATGTCTT	uc003pjd.2	+						BCKDHB_uc003pje.2_Intron	NM_000056	NP_000047			branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	81208371	81208376	+	IGR	DEL	TAAGGA	-	-	rs66842582		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81208371_81208376delTAAGGA								BCKDHB (152384 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	82127028	82127029	+	IGR	INS	-	A	A	rs151212797	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82127028_82127029insA								None (None upstream) : FAM46A (328419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	83513094	83513094	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83513094delC								TPBG (436480 upstream) : UBE2CBP (89092 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	84684417	84684418	+	IGR	DEL	AA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84684417_84684418delAA								CYB5R4 (14273 upstream) : MRAP2 (59002 downstream)																																			---	---	---	---
KIAA1009	22832	broad.mit.edu	37	6	84934408	84934408	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84934408delA	uc010kbp.2	-						KIAA1009_uc003pkj.3_Intron|KIAA1009_uc003pkk.2_Intron	NM_014895	NP_055710			KIAA1009 protein						cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding			ovary(1)	1		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	86440733	86440733	+	IGR	DEL	T	-	-	rs76449098		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86440733delT								SNHG5 (52282 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	87111821	87111822	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87111821_87111822insT								SNHG5 (723370 upstream) : HTR1E (535202 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	87367476	87367477	+	IGR	DEL	AA	-	-	rs67722232		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87367476_87367477delAA								SNHG5 (979025 upstream) : HTR1E (279547 downstream)																																			---	---	---	---
RARS2	57038	broad.mit.edu	37	6	88232504	88232504	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88232504delT	uc003pme.2	-						RARS2_uc003pmb.2_Intron|RARS2_uc003pmc.2_Intron|RARS2_uc003pmd.2_Intron|RARS2_uc003pmf.2_Intron	NM_020320	NP_064716			arginyl-tRNA synthetase 2, mitochondrial						arginyl-tRNA aminoacylation	mitochondrial matrix	arginine-tRNA ligase activity|ATP binding|protein binding			ovary(2)|central_nervous_system(1)	3		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	88560550	88560550	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88560550delG	uc003pmm.2	+											Homo sapiens mRNA sequence.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	88986964	88986965	+	IGR	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88986964_88986965delTC								CNR1 (111197 upstream) : RNGTT (333024 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	89089408	89089408	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89089408delT								CNR1 (213641 upstream) : RNGTT (230581 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	90127908	90127908	+	IGR	DEL	A	-	-	rs9451221		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90127908delA								RRAGD (5913 upstream) : ANKRD6 (14989 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	92796451	92796451	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92796451delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	92958497	92958497	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92958497delA								None (None upstream) : EPHA7 (991245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	93414648	93414648	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93414648delA								None (None upstream) : EPHA7 (535094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	93612103	93612104	+	IGR	INS	-	T	T	rs112146821		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93612103_93612104insT								None (None upstream) : EPHA7 (337638 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	93637148	93637149	+	IGR	INS	-	AC	AC	rs148197665	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93637148_93637149insAC								None (None upstream) : EPHA7 (312593 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	93789387	93789387	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93789387delA								None (None upstream) : EPHA7 (160355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	94410749	94410749	+	IGR	DEL	A	-	-	rs1994591	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:94410749delA								EPHA7 (281449 upstream) : TSG1 (6052 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	99586011	99586011	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99586011delA								FBXL4 (190162 upstream) : C6orf168 (134783 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	103723197	103723200	+	IGR	DEL	TTAA	-	-	rs71748924		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:103723197_103723200delTTAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	104987884	104987884	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104987884delA								None (None upstream) : HACE1 (188084 downstream)																																			---	---	---	---
PDSS2	57107	broad.mit.edu	37	6	107610577	107610577	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107610577delA	uc003prt.2	-						PDSS2_uc011eak.1_Intron|PDSS2_uc011eal.1_Intron|PDSS2_uc003pru.2_Intron|PDSS2_uc003prv.2_Intron	NM_020381	NP_065114			prenyl diphosphate synthase, subunit 2						isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	protein heterodimerization activity			ovary(2)	2	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)														---	---	---	---
PPIL6	285755	broad.mit.edu	37	6	109714425	109714425	+	Intron	DEL	T	-	-	rs68007009		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109714425delT	uc003ptg.3	-						PPIL6_uc010kdo.2_Intron|PPIL6_uc010kdp.2_Intron	NM_173672	NP_775943			peptidylprolyl isomerase-like 6 isoform 1						protein folding		peptidyl-prolyl cis-trans isomerase activity				0		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.00684)|BRCA - Breast invasive adenocarcinoma(108;0.00889)|all cancers(137;0.0106)|OV - Ovarian serous cystadenocarcinoma(136;0.0259)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	110165339	110165340	+	IGR	INS	-	A	A	rs75944666		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110165339_110165340insA								FIG4 (18705 upstream) : GPR6 (134169 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	113329389	113329390	+	IGR	INS	-	AC	AC	rs142209362	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113329389_113329390insAC								RFPL4B (656891 upstream) : MARCKS (849137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	113674597	113674598	+	IGR	INS	-	T	T	rs149558924		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113674597_113674598insT								None (None upstream) : MARCKS (503929 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	114213447	114213447	+	IGR	DEL	A	-	-	rs148016785		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114213447delA								MARCKS (28797 upstream) : FLJ34503 (12104 downstream)																																			---	---	---	---
HS3ST5	222537	broad.mit.edu	37	6	114431848	114431848	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114431848delG	uc003pwh.3	-						uc003pwf.2_Intron	NM_153612	NP_705840			heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)														---	---	---	---
SLC35F1	222553	broad.mit.edu	37	6	118460135	118460136	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118460135_118460136delAC	uc003pxx.3	+							NM_001029858	NP_001025029			solute carrier family 35, member F1						transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)														---	---	---	---
MAN1A1	4121	broad.mit.edu	37	6	119519548	119519548	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119519548delC	uc003pym.1	-							NM_005907	NP_005898			mannosidase, alpha, class 1A, member 1						post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum|ER-Golgi intermediate compartment|Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	119767812	119767813	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119767812_119767813insA								MAN1A1 (96886 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	119815441	119815441	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119815441delT	uc003pyn.1	-											Homo sapiens cDNA FLJ39782 fis, clone SPLEN2002175.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	122150180	122150181	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122150180_122150181insA								GJA1 (379308 upstream) : HSF2 (570515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122704497	122704497	+	IGR	DEL	T	-	-	rs149394935		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122704497delT								GJA1 (933625 upstream) : HSF2 (16199 downstream)																																			---	---	---	---
PKIB	5570	broad.mit.edu	37	6	122972302	122972302	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122972302delA	uc003pyz.2	+						PKIB_uc003pza.2_Intron|PKIB_uc003pzb.2_Intron|PKIB_uc003pzc.2_5'Flank	NM_181794	NP_861459			cAMP-dependent protein kinase inhibitor beta								cAMP-dependent protein kinase inhibitor activity				0				GBM - Glioblastoma multiforme(226;0.164)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	123198799	123198803	+	IGR	DEL	ACTTA	-	-	rs10542935		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123198799_123198803delACTTA								SMPDL3A (67937 upstream) : CLVS2 (118779 downstream)																																			---	---	---	---
CLVS2	134829	broad.mit.edu	37	6	123335481	123335481	+	Intron	DEL	T	-	-	rs66534024		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123335481delT	uc003pzi.1	+							NM_001010852	NP_001010852			retinaldehyde binding protein 1-like 2						lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	123530391	123530392	+	IGR	DEL	TG	-	-	rs72168903		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123530391_123530392delTG								CLVS2 (145328 upstream) : TRDN (7091 downstream)																																			---	---	---	---
TRDN	10345	broad.mit.edu	37	6	123840872	123840873	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123840872_123840873insA	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|TRDN_uc010ken.2_Intron	NM_006073	NP_006064			triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124301850	124301851	+	Intron	DEL	AA	-	-	rs35695851		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124301850_124301851delAA	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010kep.1_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124404937	124404938	+	Intron	INS	-	C	C	rs150016995	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124404937_124404938insC	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010kep.1_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	125159272	125159272	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125159272delT								NKAIN2 (12488 upstream) : STL (70122 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	125838422	125838422	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125838422delT								HDDC2 (215140 upstream) : HEY2 (230358 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	126371845	126371845	+	IGR	DEL	A	-	-	rs71956018		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126371845delA								TRMT11 (11427 upstream) : CENPW (289408 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	127949929	127949929	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127949929delA								C6orf58 (36971 upstream) : THEMIS (79417 downstream)																																			---	---	---	---
ARHGAP18	93663	broad.mit.edu	37	6	129918875	129918876	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129918875_129918876insA	uc003qbr.2	-						ARHGAP18_uc011ebw.1_Intron	NM_033515	NP_277050			Rho GTPase activating protein 18						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			ovary(2)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	130092376	130092376	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130092376delT								ARHGAP18 (61006 upstream) : C6orf191 (60015 downstream)																																			---	---	---	---
L3MBTL3	84456	broad.mit.edu	37	6	130389708	130389708	+	Intron	DEL	A	-	-	rs67334159		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130389708delA	uc003qbt.2	+						L3MBTL3_uc003qbu.2_Intron	NM_032438	NP_115814			l(3)mbt-like 3 isoform a						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)														---	---	---	---
EPB41L2	2037	broad.mit.edu	37	6	131290358	131290358	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131290358delA	uc003qch.2	-						EPB41L2_uc003qcg.1_Intron|EPB41L2_uc011eby.1_Intron|EPB41L2_uc003qci.2_Intron|EPB41L2_uc010kfk.2_Intron|EPB41L2_uc010kfl.1_Intron	NM_001431	NP_001422			erythrocyte membrane protein band 4.1-like 2						cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	132738363	132738364	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132738363_132738364insA								MOXD1 (15699 upstream) : STX7 (40299 downstream)																																			---	---	---	---
SGK1	6446	broad.mit.edu	37	6	134526567	134526567	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134526567delA	uc003qeo.3	-							NM_001143676	NP_001137148			serum/glucocorticoid regulated kinase 1 isoform						apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)														---	---	---	---
ALDH8A1	64577	broad.mit.edu	37	6	135272080	135272081	+	5'Flank	INS	-	AT	AT	rs143804018	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135272080_135272081insAT	uc003qew.2	-						ALDH8A1_uc003qex.2_5'Flank|ALDH8A1_uc010kgh.2_5'Flank|ALDH8A1_uc011ecx.1_5'Flank	NM_022568	NP_072090			aldehyde dehydrogenase 8A1 isoform 1						retinal metabolic process	cytoplasm	retinal dehydrogenase activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)														---	---	---	---
C6orf217	100131814	broad.mit.edu	37	6	135843223	135843223	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135843223delT	uc003qgn.2	+						C6orf217_uc003qgo.2_Intron|C6orf217_uc010kgo.2_Intron|C6orf217_uc003qgm.2_Intron					Homo sapiens cDNA clone IMAGE:4795512.												0																		---	---	---	---
PDE7B	27115	broad.mit.edu	37	6	136391284	136391285	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136391284_136391285insA	uc003qgp.2	+						uc003qgq.1_Intron|PDE7B_uc003qgr.2_Intron|uc003qgs.1_Intron	NM_018945	NP_061818			phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)													---	---	---	---
MAP3K5	4217	broad.mit.edu	37	6	136931278	136931278	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136931278delT	uc003qhc.2	-						MAP3K5_uc011edj.1_Intron|MAP3K5_uc011edk.1_Intron	NM_005923	NP_005914			mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	140010446	140010447	+	IGR	INS	-	TTC	TTC	rs10627506		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140010446_140010447insTTC								CITED2 (314661 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	140239746	140239747	+	IGR	DEL	AC	-	-	rs143547946		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140239746_140239747delAC								CITED2 (543961 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	142795068	142795069	+	IGR	INS	-	T	T	rs71792718		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142795068_142795069insT								GPR126 (27667 upstream) : LOC153910 (52523 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	143007197	143007197	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143007197delA								LOC153910 (48171 upstream) : HIVEP2 (65408 downstream)																																			---	---	---	---
UTRN	7402	broad.mit.edu	37	6	144726654	144726655	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144726654_144726655insT	uc003qkt.2	+						UTRN_uc010khq.1_Intron	NM_007124	NP_009055			utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	147973096	147973097	+	IGR	INS	-	C	C	rs150696819	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147973096_147973097insC								SAMD5 (81939 upstream) : SASH1 (690632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	148560672	148560672	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148560672delG								SAMD5 (669515 upstream) : SASH1 (103057 downstream)																																			---	---	---	---
UST	10090	broad.mit.edu	37	6	149291390	149291390	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149291390delT	uc003qmg.2	+							NM_005715	NP_005706			uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)														---	---	---	---
PCMT1	5110	broad.mit.edu	37	6	150082394	150082397	+	Intron	DEL	TGTG	-	-	rs111695260		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150082394_150082397delTGTG	uc003qne.2	+						PCMT1_uc003qna.2_Intron|PCMT1_uc003qnb.2_Intron|PCMT1_uc011eeg.1_Intron|PCMT1_uc003qnc.2_Intron|PCMT1_uc003qnd.2_Intron|PCMT1_uc003qnf.2_Intron	NM_005389	NP_005380			protein-L-isoaspartate (D-aspartate)											ovary(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)														---	---	---	---
C6orf97	80129	broad.mit.edu	37	6	151881058	151881059	+	Intron	INS	-	T	T	rs140863181	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151881058_151881059insT	uc003qol.2	+							NM_025059	NP_079335			hypothetical protein LOC80129												0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)														---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152311379	152311380	+	Intron	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152311379_152311380delGT	uc003qom.3	+						ESR1_uc010kin.2_Intron|ESR1_uc010kio.2_Intron|ESR1_uc010kip.2_Intron|ESR1_uc003qon.3_Intron|ESR1_uc003qoo.3_Intron|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron|ESR1_uc010kis.2_Intron|ESR1_uc011eex.1_Intron|ESR1_uc010kit.1_Intron|ESR1_uc011eey.1_Intron	NM_001122742	NP_001116214			estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
TIAM2	26230	broad.mit.edu	37	6	155174524	155174525	+	Intron	INS	-	T	T	rs111252952		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155174524_155174525insT	uc003qqb.2	+						hsa-mir-1273c|MI0014171_RNA	NM_012454	NP_036586			T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	155781328	155781328	+	IGR	DEL	C	-	-	rs11366794		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155781328delC								NOX3 (4291 upstream) : MIR1202 (486603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	156529974	156529975	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156529974_156529975insT								MIR1202 (261961 upstream) : ARID1B (569111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	156843638	156843639	+	IGR	DEL	TC	-	-	rs34046758		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156843638_156843639delTC								MIR1202 (575625 upstream) : ARID1B (255447 downstream)																																			---	---	---	---
ZDHHC14	79683	broad.mit.edu	37	6	157843259	157843259	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157843259delG	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron	NM_024630	NP_078906			zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)														---	---	---	---
ZDHHC14	79683	broad.mit.edu	37	6	157910606	157910606	+	Intron	DEL	G	-	-	rs77314590		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157910606delG	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron	NM_024630	NP_078906			zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)														---	---	---	---
SYNJ2	8871	broad.mit.edu	37	6	158425931	158425932	+	Intron	INS	-	CACGT	CACGT	rs141219205	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158425931_158425932insCACGT	uc003qqx.1	+						SYNJ2_uc011efm.1_Intron|SYNJ2_uc003qqw.1_Intron	NM_003898	NP_003889			synaptojanin 2								nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	161217216	161217216	+	IGR	DEL	C	-	-	rs5881372		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161217216delC								PLG (42871 upstream) : MAP3K4 (195606 downstream)																																			---	---	---	---
MAP3K4	4216	broad.mit.edu	37	6	161533236	161533237	+	Intron	DEL	TT	-	-	rs71708999		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161533236_161533237delTT	uc003qtn.2	+						MAP3K4_uc003qto.2_Intron|MAP3K4_uc011efz.1_Intron|MAP3K4_uc011ega.1_Intron|MAP3K4_uc003qtp.2_Intron|MAP3K4_uc003qtq.2_Intron	NM_005922	NP_005913			mitogen-activated protein kinase kinase kinase 4						activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)														---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162690035	162690036	+	Intron	INS	-	AAAC	AAAC	rs112843332		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162690035_162690036insAAAC	uc003qtx.3	-						PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
PACRG	135138	broad.mit.edu	37	6	163296190	163296191	+	Intron	INS	-	AC	AC	rs148005641	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163296190_163296191insAC	uc003qua.2	+						PACRG_uc003qub.2_Intron|PACRG_uc003quc.2_Intron	NM_152410	NP_689623			parkin co-regulated gene protein isoform 1												0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	164150097	164150097	+	Intron	DEL	A	-	-	rs67914288		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164150097delA	uc003quk.1	+											Homo sapiens cDNA FLJ35795 fis, clone TESTI2005827.																														---	---	---	---
PDE10A	10846	broad.mit.edu	37	6	165885156	165885156	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165885156delT	uc003qun.2	-						PDE10A_uc011egj.1_Intron|PDE10A_uc011egk.1_Intron|PDE10A_uc003quo.2_Intron	NM_006661	NP_006652			phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	166087819	166087819	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166087819delA								PDE10A (12235 upstream) : C6orf176 (249717 downstream)																																			---	---	---	---
C6orf176	90632	broad.mit.edu	37	6	166372170	166372173	+	Intron	DEL	GAAA	-	-	rs34684198		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166372170_166372173delGAAA	uc011egl.1	-						uc003qup.1_Intron|C6orf176_uc003quq.3_Intron|C6orf176_uc003qur.2_Intron	NR_026861				Homo sapiens cDNA FLJ76352 complete cds.												0																		---	---	---	---
SFT2D1	113402	broad.mit.edu	37	6	166757175	166757175	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166757175delT	uc003qux.2	-						uc003quy.1_Intron	NM_145169	NP_660152			SFT2 domain containing 1						protein transport|vesicle-mediated transport	integral to membrane				central_nervous_system(1)	1		Breast(66;0.000148)|Prostate(117;0.109)|Ovarian(120;0.199)		OV - Ovarian serous cystadenocarcinoma(33;2.63e-19)|BRCA - Breast invasive adenocarcinoma(81;4.92e-06)|GBM - Glioblastoma multiforme(31;4.58e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	167920877	167920878	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167920877_167920878insT								TCP10 (122879 upstream) : C6orf123 (264343 downstream)																																			---	---	---	---
MLLT4	4301	broad.mit.edu	37	6	168297307	168297307	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168297307delA	uc003qwd.2	+						MLLT4_uc003qwb.1_Intron|MLLT4_uc003qwc.1_Intron|MLLT4_uc003qwf.2_Intron	NM_001040001	NP_001035090			myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)				T	MLL	AL								---	---	---	---
Unknown	0	broad.mit.edu	37	6	168564290	168564290	+	IGR	DEL	C	-	-	rs61443121		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168564290delC								FRMD1 (84451 upstream) : DACT2 (143296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	169537886	169537887	+	IGR	INS	-	A	A	rs145874755	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169537886_169537887insA								SMOC2 (469215 upstream) : THBS2 (77989 downstream)																																			---	---	---	---
WDR27	253769	broad.mit.edu	37	6	170079169	170079172	+	Intron	DEL	AACT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170079169_170079172delAACT	uc003qwx.2	-						WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron|WDR27_uc011egw.1_Intron|WDR27_uc010kkx.2_Intron					RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	170206672	170206673	+	IGR	INS	-	AG	AG	rs138625123	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170206672_170206673insAG								C6orf208 (3703 upstream) : LOC154449 (356749 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	170263866	170263867	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170263866_170263867delCA								C6orf208 (60897 upstream) : LOC154449 (299555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	170421464	170421467	+	IGR	DEL	TGTG	-	-	rs5881851		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170421464_170421467delTGTG								C6orf208 (218495 upstream) : LOC154449 (141955 downstream)																																			---	---	---	---
PRKAR1B	5575	broad.mit.edu	37	7	696939	696940	+	Intron	INS	-	GGAT	GGAT	rs34846168		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:696939_696940insGGAT	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron	NM_002735	NP_002726			protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)														---	---	---	---
SUN1	23353	broad.mit.edu	37	7	858507	858508	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:858507_858508insT	uc011jvp.1	+						SUN1_uc010ksa.1_Intron|SUN1_uc003sje.1_Intron|SUN1_uc003sjf.2_Intron|SUN1_uc011jvq.1_Intron	NM_001130965	NP_001124437			unc-84 homolog A isoform a						cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding				0																		---	---	---	---
GET4	51608	broad.mit.edu	37	7	916840	916841	+	Intron	DEL	CT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:916840_916841delCT	uc003sjl.1	+						GET4_uc003sjj.1_Intron	NM_015949	NP_057033			hypothetical protein LOC51608						tail-anchored membrane protein insertion into ER membrane|transport	BAT3 complex	protein binding				0																		---	---	---	---
ADAP1	11033	broad.mit.edu	37	7	945534	945534	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:945534delA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860			centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	1323122	1323123	+	IGR	INS	-	TT	TT	rs139796883	by1000genomes;byFrequency	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1323122_1323123insTT								UNCX (46510 upstream) : MICALL2 (150873 downstream)																																			---	---	---	---
MICALL2	79778	broad.mit.edu	37	7	1479181	1479182	+	Intron	DEL	CA	-	-	rs145092400		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1479181_1479182delCA	uc003skj.3	-						MICALL2_uc003skh.3_5'Flank|MICALL2_uc003ski.3_Intron	NM_182924	NP_891554			MICAL-like 2 isoform 1							cytoplasm|cytoskeleton	zinc ion binding			central_nervous_system(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	1551300	1551300	+	IGR	DEL	C	-	-	rs74462139		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1551300delC								INTS1 (7282 upstream) : MAFK (19068 downstream)																																			---	---	---	---
CARD11	84433	broad.mit.edu	37	7	2999620	2999621	+	Intron	INS	-	A	A	rs112609753		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2999620_2999621insA	uc003smv.2	-							NM_032415	NP_115791			caspase recruitment domain family, member 11						positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)				Mis		DLBCL								---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3395415	3395415	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3395415delT	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3547820	3547821	+	Intron	INS	-	T	T	rs146289177	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3547820_3547821insT	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
SDK1	221935	broad.mit.edu	37	7	4152391	4152391	+	Intron	DEL	T	-	-	rs71885549		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4152391delT	uc003smx.2	+						SDK1_uc010kso.2_Intron	NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	4430811	4430811	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4430811delA								SDK1 (122182 upstream) : FOXK1 (252577 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	5187446	5187446	+	IGR	DEL	C	-	-	rs11349473		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5187446delC								LOC389458 (74593 upstream) : WIPI2 (42389 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	5846034	5846034	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5846034delG								RNF216 (24742 upstream) : ZNF815 (16757 downstream)																																			---	---	---	---
RPA3	6119	broad.mit.edu	37	7	7687070	7687070	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7687070delA	uc003sri.2	-							NM_002947	NP_002938			replication protein A3, 14kDa						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	cytoplasm|DNA replication factor A complex|nucleoplasm	protein binding|single-stranded DNA binding			large_intestine(1)	1		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.202)									Direct_reversal_of_damage|NER					---	---	---	---
GLCCI1	113263	broad.mit.edu	37	7	8011955	8011956	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8011955_8011956delTG	uc003srk.2	+							NM_138426	NP_612435			glucocorticoid induced transcript 1												0		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)														---	---	---	---
ICA1	3382	broad.mit.edu	37	7	8297385	8297385	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8297385delA	uc003srm.2	-						ICA1_uc003srn.3_Intron|ICA1_uc003srp.3_Intron|ICA1_uc010kts.2_Intron|ICA1_uc003srq.2_Intron|ICA1_uc003srr.2_Intron|ICA1_uc003sro.3_Intron|ICA1_uc003srs.1_Intron	NM_022307	NP_071682			islet cell autoantigen 1						neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)														---	---	---	---
NXPH1	30010	broad.mit.edu	37	7	8576324	8576326	+	Intron	DEL	AGA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8576324_8576326delAGA	uc003srv.2	+						NXPH1_uc011jxh.1_Intron	NM_152745	NP_689958			neurexophilin 1 precursor							extracellular region				ovary(1)|central_nervous_system(1)	2		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	9631931	9631931	+	IGR	DEL	A	-	-	rs34394651		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9631931delA								NXPH1 (839339 upstream) : PER4 (41969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	9956408	9956409	+	IGR	INS	-	ATTT	ATTT	rs148831348	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9956408_9956409insATTT								PER4 (280961 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	10912445	10912445	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10912445delA								None (None upstream) : NDUFA4 (60370 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	11330235	11330235	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11330235delT	uc003ssb.2	+											Homo sapiens cDNA clone IMAGE:4830466.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	14122765	14122765	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14122765delG								ETV1 (91715 upstream) : DGKB (61910 downstream)																																			---	---	---	---
ISPD	729920	broad.mit.edu	37	7	16456306	16456307	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16456306_16456307insA	uc010ktx.2	-						ISPD_uc010kty.2_Intron	NM_001101426	NP_001094896			notch1-induced protein isoform a						isoprenoid biosynthetic process		nucleotidyltransferase activity			ovary(1)	1															Multiple Myeloma(15;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	17545203	17545203	+	IGR	DEL	T	-	-	rs5882608		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17545203delT								AHR (159428 upstream) : SNX13 (285183 downstream)																																			---	---	---	---
HDAC9	9734	broad.mit.edu	37	7	18828910	18828911	+	Intron	DEL	CA	-	-	rs72173579	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18828910_18828911delCA	uc003suh.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc011jyd.1_Intron|HDAC9_uc003sui.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc003sua.1_Intron	NM_058176	NP_478056			histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	19385413	19385414	+	IGR	INS	-	T	T	rs149139333	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19385413_19385414insT								FERD3L (200369 upstream) : TWISTNB (349671 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	20312079	20312080	+	IGR	INS	-	CAT	CAT	rs148090859	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20312079_20312080insCAT								MACC1 (55066 upstream) : ITGB8 (58245 downstream)																																			---	---	---	---
ITGB8	3696	broad.mit.edu	37	7	20399972	20399972	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20399972delT	uc003suu.2	+						ITGB8_uc011jyh.1_Intron|ITGB8_uc003sut.2_Intron	NM_002214	NP_002205			integrin, beta 8 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3																		---	---	---	---
ABCB5	340273	broad.mit.edu	37	7	20759566	20759567	+	Intron	DEL	AC	-	-	rs148593014		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20759566_20759567delAC	uc003suw.3	+						ABCB5_uc010kuh.2_Intron|ABCB5_uc003sux.1_5'Flank	NM_178559	NP_848654			ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6																		---	---	---	---
DNAH11	8701	broad.mit.edu	37	7	21710486	21710487	+	Intron	DEL	GT	-	-	rs112066783		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21710486_21710487delGT	uc003svc.2	+							NM_003777	NP_003768			dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15														Kartagener_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	7	22921330	22921330	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22921330delT								SNORD93 (25026 upstream) : FAM126A (59557 downstream)																																			---	---	---	---
FAM126A	84668	broad.mit.edu	37	7	23056119	23056120	+	5'Flank	DEL	CA	-	-	rs71552217		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23056119_23056120delCA	uc003svm.3	-						FAM126A_uc003svn.3_5'Flank|FAM126A_uc011jyr.1_5'Flank	NM_032581	NP_115970			family with sequence similarity 126, member A							cytoplasm|membrane	signal transducer activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	23126182	23126182	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23126182delG								FAM126A (72412 upstream) : KLHL7 (19171 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	23334503	23334503	+	IGR	DEL	A	-	-	rs78930112		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23334503delA								GPNMB (19775 upstream) : C7orf30 (4437 downstream)																																			---	---	---	---
IGF2BP3	10643	broad.mit.edu	37	7	23486820	23486821	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23486820_23486821delAC	uc003swg.2	-						IGF2BP3_uc003swh.1_Intron	NM_006547	NP_006538			insulin-like growth factor 2 mRNA binding						anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			ovary(2)	2																		---	---	---	---
C7orf46	340277	broad.mit.edu	37	7	23721408	23721408	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23721408delT	uc003swo.3	+						C7orf46_uc003swq.3_Intron|C7orf46_uc003swr.3_Intron|C7orf46_uc003swp.3_Intron|C7orf46_uc010kup.2_Intron	NM_199136	NP_954587			hypothetical protein LOC340277 isoform 1												0																		---	---	---	---
OSBPL3	26031	broad.mit.edu	37	7	24893980	24893980	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24893980delT	uc003sxf.2	-						OSBPL3_uc003sxd.2_Intron|OSBPL3_uc003sxe.2_Intron|OSBPL3_uc003sxg.2_Intron|OSBPL3_uc003sxh.2_Intron|OSBPL3_uc003sxi.2_Intron|OSBPL3_uc003sxj.1_Intron|OSBPL3_uc003sxk.1_Intron	NM_015550	NP_056365			oxysterol-binding protein-like protein 3 isoform						lipid transport		lipid binding|protein binding			skin(1)	1																		---	---	---	---
CBX3	11335	broad.mit.edu	37	7	26252201	26252206	+	3'UTR	DEL	TTTGTG	-	-	rs56362406		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26252201_26252206delTTTGTG	uc003sxt.2	+	6					CBX3_uc003sxu.2_3'UTR|CBX3_uc003sxv.2_3'UTR	NM_007276	NP_009207			chromobox homolog 3						chromatin remodeling|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed chromosome, centromeric region|nuclear centromeric heterochromatin|nuclear euchromatin|nuclear inner membrane|spindle	enzyme binding|protein domain specific binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	26324970	26324971	+	IGR	INS	-	A	A	rs147523879	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26324970_26324971insA								CBX3 (71996 upstream) : SNX10 (6544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	27051427	27051428	+	IGR	INS	-	A	A	rs35727142		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27051427_27051428insA								SKAP2 (16569 upstream) : HOXA1 (81188 downstream)																																			---	---	---	---
HOXA6	3203	broad.mit.edu	37	7	27186634	27186635	+	Intron	DEL	CT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27186634_27186635delCT	uc003syo.1	-						uc003syp.1_5'Flank	NM_024014	NP_076919			homeobox A6							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2																OREG0003741	type=REGULATORY REGION|Gene=AK091933|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
CHN2	1124	broad.mit.edu	37	7	29443287	29443287	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29443287delA	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron	NM_004067	NP_004058			beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2																		---	---	---	---
CHN2	1124	broad.mit.edu	37	7	29551551	29551552	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29551551_29551552insT	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron|CHN2_uc010kvg.2_Intron|CHN2_uc010kvh.2_Intron|CHN2_uc010kvi.2_Intron|CHN2_uc010kve.2_Intron|CHN2_uc003taa.2_Intron|CHN2_uc010kvf.2_Intron|CHN2_uc010kvj.2_Intron|CHN2_uc010kvk.2_Intron|CHN2_uc010kvl.2_Intron|CHN2_uc010kvm.2_Intron|CHN2_uc011jzv.1_Intron	NM_004067	NP_004058			beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	31442879	31442879	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31442879delT								NEUROD6 (62341 upstream) : CCDC129 (110806 downstream)																																			---	---	---	---
BBS9	27241	broad.mit.edu	37	7	33364213	33364213	+	Intron	DEL	T	-	-	rs34915663		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33364213delT	uc003tdn.1	+						BBS9_uc003tdo.1_Intron|BBS9_uc003tdp.1_Intron|BBS9_uc003tdq.1_Intron|BBS9_uc010kwn.1_Intron|BBS9_uc011kao.1_Intron	NM_198428	NP_940820			parathyroid hormone-responsive B1 isoform 2						fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)											Bardet-Biedl_syndrome				---	---	---	---
AAA1	404744	broad.mit.edu	37	7	34443520	34443520	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34443520delG	uc010kwo.1	-						AAA1_uc010kwp.1_Intron|AAA1_uc003tdz.2_Intron|AAA1_uc010kwq.1_Intron					Homo sapiens AAA1 variant IA mRNA, complete cds; alternatively spliced.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	36073501	36073501	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36073501delC								SEPT7 (128586 upstream) : EEPD1 (119335 downstream)																																			---	---	---	---
AOAH	313	broad.mit.edu	37	7	36561286	36561286	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36561286delT	uc003tfh.3	-						AOAH_uc010kxf.2_Intron|AOAH_uc011kba.1_Intron	NM_001637	NP_001628			acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	36834220	36834231	+	IGR	DEL	AAACAAACAAAC	-	-	rs6150081		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36834220_36834231delAAACAAACAAAC								AOAH (70067 upstream) : ELMO1 (59730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	37741109	37741109	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37741109delA	uc003tfl.2	+											Homo sapiens, clone IMAGE:3881224, mRNA.																														---	---	---	---
AMPH	273	broad.mit.edu	37	7	38438121	38438123	+	Intron	DEL	AGA	-	-	rs149666399		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38438121_38438123delAGA	uc003tgu.2	-						AMPH_uc003tgv.2_Intron|AMPH_uc003tgt.2_Intron|AMPH_uc003tgw.1_Intron|AMPH_uc010kxl.1_Intron	NM_001635	NP_001626			amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5																		---	---	---	---
RALA	5898	broad.mit.edu	37	7	39735018	39735018	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39735018delT	uc003thd.2	+							NM_005402	NP_005393			ras related v-ral simian leukemia viral oncogene						actin cytoskeleton reorganization|cell cycle|chemotaxis|cytokinesis|exocytosis|interspecies interaction between organisms|membrane raft localization|nerve growth factor receptor signaling pathway|positive regulation of filopodium assembly|Ras protein signal transduction|regulation of exocytosis	cell surface|cleavage furrow|cytosol|midbody|plasma membrane	Edg-2 lysophosphatidic acid receptor binding|GTP binding|GTPase activity			lung(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	39978412	39978434	+	IGR	DEL	ATGTCTCTACTGAAAATACAAAA	-	-	rs72201325		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39978412_39978434delATGTCTCTACTGAAAATACAAAA								LOC349114 (144191 upstream) : CDK13 (11525 downstream)																																			---	---	---	---
CDK13	8621	broad.mit.edu	37	7	40046535	40046537	+	Intron	DEL	TTC	-	-	rs10541628		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40046535_40046537delTTC	uc003thh.3	+						CDK13_uc003thi.3_Intron|CDK13_uc011kbf.1_Intron	NM_003718	NP_003709			cell division cycle 2-like 5 isoform 1						alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	40902620	40902620	+	IGR	DEL	T	-	-	rs75020927		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40902620delT								C7orf10 (2263 upstream) : INHBA (825983 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	42574199	42574200	+	IGR	INS	-	A	A	rs143382530	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42574199_42574200insA								GLI3 (297581 upstream) : C7orf25 (374674 downstream)																																			---	---	---	---
C7orf25	79020	broad.mit.edu	37	7	42952764	42952764	+	5'Flank	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42952764delC	uc003thw.2	-						C7orf25_uc010kxq.2_5'Flank|C7orf25_uc003thx.3_5'Flank|C7orf25_uc010kxr.2_Intron	NM_024054	NP_076959			hypothetical protein LOC79020 b											skin(1)	1																		---	---	---	---
C7orf25	79020	broad.mit.edu	37	7	42954806	42954806	+	Intron	DEL	T	-	-	rs75293812		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42954806delT	uc010kxr.2	-							NM_001099858	NP_001093328			hypothetical protein LOC79020 a											skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	45883430	45883431	+	IGR	INS	-	CAAAA	CAAAA	rs147269901	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45883430_45883431insCAAAA								SEPT7P2 (74813 upstream) : IGFBP1 (44528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	46177066	46177069	+	IGR	DEL	TAGA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46177066_46177069delTAGA								IGFBP3 (216195 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	46740124	46740125	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46740124_46740125insA								IGFBP3 (779253 upstream) : TNS3 (574628 downstream)																																			---	---	---	---
C7orf57	136288	broad.mit.edu	37	7	48077346	48077347	+	Intron	INS	-	TGTGTGTGTG	TGTGTGTGTG	rs145857485	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48077346_48077347insTGTGTGTGTG	uc003toh.3	+						C7orf57_uc003toi.3_Intron	NM_001100159	NP_001093629			hypothetical protein LOC136288											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	48195252	48195252	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48195252delA								UPP1 (46923 upstream) : ABCA13 (15805 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	48718594	48718594	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48718594delA								ABCA13 (31503 upstream) : CDC14C (245563 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51600968	51600968	+	IGR	DEL	T	-	-	rs142850398		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51600968delT								COBL (216453 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52466029	52466030	+	IGR	INS	-	T	T	rs147067669	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52466029_52466030insT								None (None upstream) : POM121L12 (637319 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52627233	52627234	+	IGR	DEL	GT	-	-	rs62445134	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52627233_52627234delGT								None (None upstream) : POM121L12 (476115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53970333	53970336	+	IGR	DEL	CAAA	-	-	rs111730641		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53970333_53970336delCAAA								POM121L12 (865716 upstream) : HPVC1 (298581 downstream)																																			---	---	---	---
VOPP1	81552	broad.mit.edu	37	7	55548597	55548598	+	Intron	INS	-	A	A	rs144253161	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55548597_55548598insA	uc003tqs.2	-						VOPP1_uc003tqq.2_Intron|VOPP1_uc010kzh.2_Intron|VOPP1_uc010kzi.2_Intron|VOPP1_uc011kcr.1_Intron	NM_030796	NP_110423			EGFR-coamplified and overexpressed protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic vesicle membrane|endosome|integral to organelle membrane	signal transducer activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	56603689	56603689	+	RNA	DEL	A	-	-	rs35527313		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56603689delA	uc003tsi.1	-	2		c.975delT								Homo sapiens cDNA clone IMAGE:5266012.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	56703070	56703071	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56703070_56703071insT								DKFZp434L192 (138093 upstream) : ZNF479 (484257 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57185563	57185564	+	IGR	INS	-	A	A	rs139214507	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57185563_57185564insA								DKFZp434L192 (620586 upstream) : ZNF479 (1764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57623556	57623557	+	IGR	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57623556_57623557delAG								ZNF716 (90291 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57626666	57626667	+	IGR	INS	-	CT	CT	rs148667050	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57626666_57626667insCT								ZNF716 (93401 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57636038	57636040	+	IGR	DEL	CTT	-	-	rs76032099		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57636038_57636040delCTT								ZNF716 (102773 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57638851	57638852	+	IGR	INS	-	CT	CT	rs141862684	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57638851_57638852insCT								ZNF716 (105586 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57644166	57644166	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57644166delT								ZNF716 (110901 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57695761	57695764	+	5'Flank	DEL	ATAT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57695761_57695764delATAT	uc003tso.1	+											Homo sapiens macronuclear mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	57772533	57772534	+	IGR	INS	-	A	A	rs146155395	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57772533_57772534insA								ZNF716 (239268 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57982942	57982942	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57982942delT								ZNF716 (449677 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57989291	57989291	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57989291delA								ZNF716 (456026 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	58048171	58048171	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:58048171delG								ZNF716 (514906 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61866347	61866347	+	IGR	DEL	T	-	-	rs111371066		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61866347delT								None (None upstream) : LOC643955 (885325 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61901876	61901876	+	IGR	DEL	C	-	-	rs112154530		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61901876delC								None (None upstream) : LOC643955 (849796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62149377	62149377	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62149377delT								None (None upstream) : LOC643955 (602295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63169174	63169174	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63169174delT								LOC100287704 (357023 upstream) : ZNF727 (336647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63266625	63266625	+	IGR	DEL	T	-	-	rs11352731		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63266625delT								LOC100287704 (454474 upstream) : ZNF727 (239196 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64520974	64520975	+	Intron	DEL	GT	-	-	rs72077267		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64520974_64520975delGT	uc003ttt.1	+						uc010kzt.1_Intron					Homo sapiens cDNA clone IMAGE:4215179, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	64565242	64565243	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64565242_64565243insT								ZNF117 (98121 upstream) : INTS4L1 (36360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67001483	67001483	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67001483delT								STAG3L4 (214971 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67112647	67112647	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67112647delT								STAG3L4 (326135 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67179239	67179239	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67179239delT								STAG3L4 (392727 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67284852	67284853	+	IGR	INS	-	G	G	rs139663537	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67284852_67284853insG								STAG3L4 (498340 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67685753	67685754	+	IGR	INS	-	A	A	rs73145583	by1000genomes;by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67685753_67685754insA								STAG3L4 (899241 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68216377	68216378	+	IGR	INS	-	TGTA	TGTA	rs141190516	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68216377_68216378insTGTA								None (None upstream) : AUTS2 (847527 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68243854	68243855	+	IGR	INS	-	T	T	rs35850643		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68243854_68243855insT								None (None upstream) : AUTS2 (820050 downstream)																																			---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69792064	69792064	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69792064delT	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	70426482	70426483	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70426482_70426483insT								AUTS2 (168598 upstream) : WBSCR17 (171306 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	70500410	70500410	+	IGR	DEL	T	-	-	rs11303674		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70500410delT								AUTS2 (242526 upstream) : WBSCR17 (97379 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	70578862	70578862	+	IGR	DEL	A	-	-	rs144460785		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70578862delA								AUTS2 (320978 upstream) : WBSCR17 (18927 downstream)																																			---	---	---	---
WBSCR17	64409	broad.mit.edu	37	7	70648876	70648877	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70648876_70648877insA	uc003tvy.2	+							NM_022479	NP_071924			UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)																---	---	---	---
WBSCR17	64409	broad.mit.edu	37	7	71054559	71054559	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71054559delA	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924			UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	71195531	71195531	+	IGR	DEL	A	-	-	rs34896284		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71195531delA								WBSCR17 (16948 upstream) : CALN1 (48946 downstream)																																			---	---	---	---
CALN1	83698	broad.mit.edu	37	7	71298563	71298563	+	Intron	DEL	A	-	-	rs66818847		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71298563delA	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440			calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)																---	---	---	---
CALN1	83698	broad.mit.edu	37	7	71397484	71397484	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71397484delT	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440			calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	73050036	73050039	+	IGR	DEL	CCAT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73050036_73050039delCCAT								MLXIPL (11166 upstream) : VPS37D (32135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	73058544	73058544	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73058544delT								MLXIPL (19674 upstream) : VPS37D (23630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	73681291	73681292	+	IGR	DEL	TG	-	-	rs111645563		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73681291_73681292delTG								RFC2 (12553 upstream) : CLIP2 (22513 downstream)																																			---	---	---	---
GTF2I	2969	broad.mit.edu	37	7	74110329	74110329	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74110329delT	uc003uau.2	+						GTF2I_uc003uat.2_Intron|GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron	NM_032999	NP_127492			general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
GTF2IRD2B	389524	broad.mit.edu	37	7	74549356	74549356	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74549356delT	uc003ubt.2	+						GTF2IRD2B_uc011kfl.1_Intron|GTF2IRD2B_uc010lcd.2_Intron|GTF2IRD2B_uc003ubu.2_Intron	NM_001003795	NP_001003795			GTF2I repeat domain containing 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
HIP1	3092	broad.mit.edu	37	7	75312763	75312764	+	Intron	INS	-	GA	GA	rs61430470		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75312763_75312764insGA	uc003uds.1	-							NM_005338	NP_005329			huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8								T	PDGFRB	CMML								---	---	---	---
HIP1	3092	broad.mit.edu	37	7	75324234	75324235	+	Intron	INS	-	TGAAATTT	TGAAATTT	rs142100660	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75324234_75324235insTGAAATTT	uc003uds.1	-							NM_005338	NP_005329			huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8								T	PDGFRB	CMML								---	---	---	---
Unknown	0	broad.mit.edu	37	7	75540107	75540107	+	IGR	DEL	T	-	-	rs113643209		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75540107delT								RHBDD2 (21863 upstream) : POR (4313 downstream)																																			---	---	---	---
SRRM3	222183	broad.mit.edu	37	7	75863513	75863514	+	Intron	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75863513_75863514delGT	uc010ldi.2	+							NM_001110199	NP_001103669			serine/arginine repetitive matrix 3												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	79099606	79099606	+	IGR	DEL	C	-	-	rs66522153		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79099606delC								MAGI2 (16716 upstream) : GNAI1 (664534 downstream)																																			---	---	---	---
GNAI1	2770	broad.mit.edu	37	7	79773239	79773240	+	Intron	INS	-	GT	GT	rs77482403		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79773239_79773240insGT	uc003uhb.1	+						GNAI1_uc011kgt.1_Intron	NM_002069	NP_002060			guanine nucleotide binding protein (G protein),						cell cycle|cell division|inhibition of adenylate cyclase activity by G-protein signaling pathway|platelet activation|synaptic transmission	centrosome|heterotrimeric G-protein complex|midbody|nucleus	G-protein beta/gamma-subunit complex binding|GTP binding|metabotropic serotonin receptor binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
GNAI1	2770	broad.mit.edu	37	7	79803772	79803772	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79803772delT	uc003uhb.1	+						GNAI1_uc011kgt.1_Intron	NM_002069	NP_002060			guanine nucleotide binding protein (G protein),						cell cycle|cell division|inhibition of adenylate cyclase activity by G-protein signaling pathway|platelet activation|synaptic transmission	centrosome|heterotrimeric G-protein complex|midbody|nucleus	G-protein beta/gamma-subunit complex binding|GTP binding|metabotropic serotonin receptor binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	79855202	79855203	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79855202_79855203delCA								GNAI1 (6477 upstream) : CD36 (143688 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	80761149	80761150	+	IGR	INS	-	G	G	rs141005716	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80761149_80761150insG								SEMA3C (209474 upstream) : HGF (570295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	82884491	82884491	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82884491delT								PCLO (92294 upstream) : SEMA3E (108731 downstream)																																			---	---	---	---
SEMA3E	9723	broad.mit.edu	37	7	83096373	83096374	+	Intron	INS	-	TT	TT	rs59059670		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83096373_83096374insTT	uc003uhy.1	-							NM_012431	NP_036563			semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	84563939	84563940	+	IGR	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84563939_84563940delAG								SEMA3A (739722 upstream) : SEMA3D (60934 downstream)																																			---	---	---	---
SEMA3D	223117	broad.mit.edu	37	7	84682160	84682160	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84682160delA	uc003uic.2	-						SEMA3D_uc010led.2_Intron|SEMA3D_uc010lee.1_Intron	NM_152754	NP_689967			semaphorin 3D precursor						cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	85331297	85331297	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85331297delG								SEMA3D (515126 upstream) : GRM3 (941933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85646700	85646701	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85646700_85646701insT								SEMA3D (830529 upstream) : GRM3 (626529 downstream)																																			---	---	---	---
KIAA1324L	222223	broad.mit.edu	37	7	86536850	86536850	+	Intron	DEL	A	-	-	rs72283133		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86536850delA	uc011kha.1	-						KIAA1324L_uc003uif.1_Intron|KIAA1324L_uc011kgz.1_Intron|KIAA1324L_uc003uie.2_Intron	NM_001142749	NP_001136221			hypothetical protein LOC222223 isoform 1							integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	88363630	88363631	+	IGR	INS	-	A	A	rs145496230	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88363630_88363631insA								STEAP4 (427421 upstream) : ZNF804B (25122 downstream)																																			---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88411417	88411418	+	Intron	DEL	GT	-	-	rs146369984		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88411417_88411418delGT	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88439983	88439983	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88439983delA	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88565416	88565416	+	Intron	DEL	T	-	-	rs111880138		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88565416delT	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88878344	88878344	+	Intron	DEL	A	-	-	rs140051524		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88878344delA	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	89188926	89188929	+	IGR	DEL	AAAG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89188926_89188929delAAAG								ZNF804B (222582 upstream) : DPY19L2P4 (559785 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	89645555	89645562	+	IGR	DEL	ACTAAATC	-	-	rs144750360		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89645555_89645562delACTAAATC								ZNF804B (679211 upstream) : DPY19L2P4 (103152 downstream)																																			---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90525042	90525043	+	Intron	INS	-	T	T	rs67744176		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90525042_90525043insT	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
AKAP9	10142	broad.mit.edu	37	7	91692400	91692401	+	Intron	INS	-	A	A	rs148063345	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91692400_91692401insA	uc003ulg.2	+						AKAP9_uc003ulf.2_Intron|AKAP9_uc003uli.2_Intron	NM_005751	NP_005742			A-kinase anchor protein 9 isoform 2						G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)					T	BRAF	papillary thyroid								---	---	---	---
LOC401387	401387	broad.mit.edu	37	7	91786851	91786852	+	Intron	INS	-	TCCT	TCCT	rs147911310	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91786851_91786852insTCCT	uc011khp.1	-						CYP51A1_uc003uln.3_Intron|uc003ulo.1_Intron|LOC401387_uc011kho.1_Intron	NM_001161528	NP_001155000			leucine-rich repeat and death domain-containing						signal transduction						0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	94520862	94520863	+	IGR	INS	-	AA	AA			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94520862_94520863insAA								PEG10 (221858 upstream) : PPP1R9A (16086 downstream)																																			---	---	---	---
DYNC1I1	1780	broad.mit.edu	37	7	95608637	95608637	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95608637delT	uc003uoc.3	+						DYNC1I1_uc003uod.3_Intron|DYNC1I1_uc003uob.2_Intron|DYNC1I1_uc003uoe.3_Intron|DYNC1I1_uc010lfl.2_Intron	NM_004411	NP_004402			dynein, cytoplasmic 1, intermediate chain 1						vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	97654857	97654858	+	IGR	DEL	AA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97654857_97654858delAA								OCM2 (35441 upstream) : LMTK2 (81339 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	98278602	98278602	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98278602delT								NPTX2 (19421 upstream) : TMEM130 (165510 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	98758421	98758421	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98758421delT								SMURF1 (16698 upstream) : KPNA7 (12776 downstream)																																			---	---	---	---
CYP3A5	1577	broad.mit.edu	37	7	99299559	99299560	+	Intron	DEL	TT	-	-	rs150787084		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99299559_99299560delTT	uc003urs.2	-						ZNF498_uc003urn.2_Intron|CYP3A5_uc010lgg.2_Intron					SubName: Full=Cytochrome P450; Flags: Fragment;						alkaloid catabolic process|drug catabolic process|oxidative demethylation|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				Alfentanil(DB00802)|Clopidogrel(DB00758)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Indinavir(DB00224)|Irinotecan(DB00762)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Mephenytoin(DB00532)|Midazolam(DB00683)|Mifepristone(DB00834)|Phenytoin(DB00252)|Quinine(DB00468)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Troleandomycin(DB01361)|Verapamil(DB00661)|Vincristine(DB00541)													---	---	---	---
TAF6	6878	broad.mit.edu	37	7	99715974	99715975	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99715974_99715975insA	uc003uti.2	-						TAF6_uc003utk.2_Intron|TAF6_uc011kji.1_Intron|TAF6_uc003utj.2_Intron|TAF6_uc003utl.2_Intron|TAF6_uc003utm.2_Intron|TAF6_uc003utn.1_Intron|CNPY4_uc003uto.2_5'Flank	NM_139315	NP_647476			TBP-associated factor 6 isoform alpha						negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	99738356	99738356	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99738356delG								MBLAC1 (12237 upstream) : C7orf59 (8174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	100108344	100108344	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100108344delA								C7orf51 (15922 upstream) : AGFG2 (28490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	100547835	100547836	+	5'Flank	INS	-	T	T	rs146275646		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100547835_100547836insT	uc003uxk.1	+						uc003uxl.1_5'Flank					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	100936148	100936150	+	IGR	DEL	TTT	-	-	rs148558136		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100936148_100936150delTTT								FIS1 (40555 upstream) : RABL5 (20499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	101285588	101285588	+	IGR	DEL	C	-	-	rs1625402		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101285588delC								MYL10 (13012 upstream) : CUX1 (173704 downstream)																																			---	---	---	---
CUX1	1523	broad.mit.edu	37	7	101501046	101501047	+	Intron	INS	-	T	T	rs143688782	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101501046_101501047insT	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530			cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
RASA4	10156	broad.mit.edu	37	7	102360356	102360356	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102360356delG	uc011kld.1	-											Homo sapiens mRNA for KIAA0538 protein, partial cds.						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0																		---	---	---	---
FBXL13	222235	broad.mit.edu	37	7	102492001	102492002	+	Intron	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102492001_102492002delTC	uc003vaq.2	-						FBXL13_uc010liq.1_Intron|FBXL13_uc010lir.1_Intron|FBXL13_uc003var.2_Intron|FBXL13_uc003vas.2_Intron	NM_145032	NP_659469			F-box and leucine-rich repeat protein 13 isoform												0																		---	---	---	---
RELN	5649	broad.mit.edu	37	7	103546120	103546139	+	Intron	DEL	CACAGGAGTGAAGATGACTT	-	-	rs11271845		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103546120_103546139delCACAGGAGTGAAGATGACTT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036			reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	104079141	104079141	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104079141delA	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351			lipoma HMGIC fusion partner-like 3							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	104631191	104631191	+	IGR	DEL	A	-	-	rs35296737		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104631191delA								LOC723809 (64099 upstream) : LOC100216545 (19798 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	105803181	105803181	+	IGR	DEL	T	-	-	rs67648635		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105803181delT								SYPL1 (50124 upstream) : NAMPT (85553 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	105814883	105814884	+	IGR	INS	-	T	T	rs59042160		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105814883_105814884insT								SYPL1 (61826 upstream) : NAMPT (73850 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	106074607	106074610	+	IGR	DEL	TGTG	-	-	rs143875514		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106074607_106074610delTGTG								NAMPT (148969 upstream) : FLJ36031 (224540 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	106237503	106237504	+	Intron	INS	-	A	A	rs142764560	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106237503_106237504insA	uc003vds.2	-											Homo sapiens full length insert cDNA clone ZC44D09.																														---	---	---	---
COG5	10466	broad.mit.edu	37	7	106971913	106971913	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106971913delA	uc003ved.2	-						COG5_uc003vec.2_Intron|COG5_uc003vee.2_Intron	NM_181733	NP_859422			component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4																		---	---	---	---
SLC26A3	1811	broad.mit.edu	37	7	107431242	107431245	+	Intron	DEL	TGTT	-	-	rs10573821		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107431242_107431245delTGTT	uc003ver.2	-						SLC26A3_uc003ves.2_Intron	NM_000111	NP_000102			solute carrier family 26, member 3						excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	108517702	108517703	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108517702_108517703insT								DNAJB9 (302410 upstream) : C7orf66 (6337 downstream)																																			---	---	---	---
IMMP2L	83943	broad.mit.edu	37	7	111125942	111125942	+	Intron	DEL	A	-	-	rs113659389		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111125942delA	uc003vfq.1	-						IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron	NM_032549	NP_115938			IMP2 inner mitochondrial membrane protease-like						protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	113154576	113154577	+	IGR	INS	-	TT	TT			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113154576_113154577insTT								LOC401397 (395939 upstream) : PPP1R3A (362305 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	114355075	114355076	+	IGR	INS	-	T	T	rs149906209	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114355075_114355076insT								FOXP2 (23983 upstream) : MDFIC (207133 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	114383362	114383362	+	IGR	DEL	T	-	-	rs113290142		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114383362delT								FOXP2 (52270 upstream) : MDFIC (178847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	116441824	116441824	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116441824delA								MET (3385 upstream) : CAPZA2 (9300 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	117820176	117820176	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117820176delT								CTTNBP2 (306615 upstream) : NAA38 (3910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	118938355	118938356	+	IGR	DEL	TT	-	-	rs62477148		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118938355_118938356delTT								None (None upstream) : KCND2 (975366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	121154196	121154198	+	IGR	DEL	GTT	-	-	rs147865464		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121154196_121154198delGTT								FAM3C (117774 upstream) : PTPRZ1 (358961 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	122962993	122962998	+	IGR	DEL	GAGTGT	-	-	rs139209126		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122962993_122962998delGAGTGT								SLC13A1 (122968 upstream) : IQUB (129240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	125702690	125702691	+	IGR	INS	-	T	T	rs150635864	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125702690_125702691insT								None (None upstream) : GRM8 (375961 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	127750727	127750728	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127750727_127750728delTG								SND1 (18069 upstream) : MIR129-1 (97197 downstream)																																			---	---	---	---
KCP	375616	broad.mit.edu	37	7	128513855	128513855	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128513855delT	uc003vob.1	-											Homo sapiens cDNA FLJ33365 fis, clone BRACE2005460, moderately similar to Xenopus laevis mRNA for Kielin.							extracellular region				central_nervous_system(1)	1																		---	---	---	---
KCP	375616	broad.mit.edu	37	7	128546961	128546962	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128546961_128546962insT	uc011kor.1	-						KCP_uc011kos.1_Intron	NM_001135914	NP_001129386			cysteine rich BMP regulator 2 isoform 1							extracellular region				central_nervous_system(1)	1																		---	---	---	---
NRF1	4899	broad.mit.edu	37	7	129305451	129305452	+	Intron	INS	-	TTG	TTG			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129305451_129305452insTTG	uc003voz.2	+						NRF1_uc003vpa.2_Intron|NRF1_uc011kpa.1_Intron|NRF1_uc003vpb.2_Intron	NM_005011	NP_005002			nuclear respiratory factor 1						generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1																		---	---	---	---
UBE2H	7328	broad.mit.edu	37	7	129543583	129543587	+	Intron	DEL	AAAAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129543583_129543587delAAAAC	uc003vpf.1	-						UBE2H_uc003vpg.1_Intron	NM_003344	NP_003335			ubiquitin-conjugating enzyme E2H isoform 1						protein K11-linked ubiquitination|protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin-protein ligase activity			skin(1)	1	Melanoma(18;0.0435)																	---	---	---	---
COPG2	26958	broad.mit.edu	37	7	130292958	130292958	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130292958delT	uc003vqh.1	-							NM_012133	NP_036265			coatomer protein complex, subunit gamma 2						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)																	---	---	---	---
TSGA13	114960	broad.mit.edu	37	7	130357306	130357306	+	Intron	DEL	T	-	-	rs71960059		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130357306delT	uc003vqi.2	-						TSGA13_uc003vqj.2_Intron	NM_052933	NP_443165			testis specific, 13											ovary(2)	2	Melanoma(18;0.0435)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	130532169	130532170	+	IGR	INS	-	A	A	rs77246189		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130532169_130532170insA								KLF14 (113309 upstream) : MIR29A (29336 downstream)																																			---	---	---	---
MKLN1	4289	broad.mit.edu	37	7	130859945	130859948	+	Intron	DEL	AGAT	-	-	rs72403035	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130859945_130859948delAGAT	uc011kpl.1	+							NM_001145354	NP_001138826			muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)																	---	---	---	---
MKLN1	4289	broad.mit.edu	37	7	130985897	130985897	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130985897delA	uc011kpl.1	+							NM_001145354	NP_001138826			muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	131734966	131734966	+	IGR	DEL	A	-	-	rs142641255		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131734966delA								PODXL (493590 upstream) : PLXNA4 (73126 downstream)																																			---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133646394	133646394	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133646394delT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron|EXOC4_uc011kpq.1_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
SLC35B4	84912	broad.mit.edu	37	7	133995298	133995299	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133995298_133995299insT	uc003vrn.2	-						SLC35B4_uc010lmk.2_Intron|SLC35B4_uc010lml.1_5'Flank|SLC35B4_uc003vro.3_Intron	NM_032826	NP_116215			solute carrier family 35, member B4							Golgi membrane|integral to membrane	UDP-N-acetylglucosamine transmembrane transporter activity|UDP-xylose transmembrane transporter activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	134958292	134958292	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134958292delT								STRA8 (15050 upstream) : CNOT4 (88261 downstream)																																			---	---	---	---
CNOT4	4850	broad.mit.edu	37	7	135181379	135181380	+	Intron	INS	-	CT	CT	rs139318916	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135181379_135181380insCT	uc003vsv.1	-						CNOT4_uc003vss.2_Intron|CNOT4_uc011kpz.1_Intron|CNOT4_uc003vst.2_Intron|CNOT4_uc003vsu.1_Intron	NM_001008225	NP_001008226			CCR4-NOT transcription complex, subunit 4						nuclear-transcribed mRNA poly(A) tail shortening|protein autoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	nucleotide binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	135204057	135204057	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135204057delA								CNOT4 (9206 upstream) : NUP205 (38605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	135767819	135767820	+	IGR	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135767819_135767820delTC								LUZP6 (105615 upstream) : CHRM2 (785579 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	136769178	136769178	+	Intron	DEL	G	-	-	rs112247361		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136769178delG	uc003vtp.1	-											Homo sapiens clone N1 NTera2D1 teratocarcinoma mRNA.																														---	---	---	---
DGKI	9162	broad.mit.edu	37	7	137408813	137408814	+	Intron	DEL	AG	-	-	rs34250953		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137408813_137408814delAG	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708			diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
KIAA1549	57670	broad.mit.edu	37	7	138655690	138655691	+	Intron	INS	-	A	A	rs137878290	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138655690_138655691insA	uc011kql.1	-						KIAA1549_uc011kqj.1_Intron	NM_020910	NP_065961			hypothetical protein LOC57670 isoform 1							integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230								O	BRAF	pilocytic astrocytoma								---	---	---	---
ZC3HAV1	56829	broad.mit.edu	37	7	138787475	138787476	+	Intron	DEL	AC	-	-	rs113108708		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138787475_138787476delAC	uc003vun.2	-						ZC3HAV1_uc003vup.2_Intron	NM_020119	NP_064504			zinc finger antiviral protein isoform 1						response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
HIPK2	28996	broad.mit.edu	37	7	139357219	139357219	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139357219delT	uc003vvf.3	-						HIPK2_uc003vvd.3_Intron	NM_022740	NP_073577			homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)																	---	---	---	---
TBXAS1	6916	broad.mit.edu	37	7	139694566	139694567	+	Intron	INS	-	AA	AA			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139694566_139694567insAA	uc011kqv.1	+						TBXAS1_uc003vvh.2_Intron|TBXAS1_uc010lne.2_Intron|TBXAS1_uc011kqu.1_Intron|TBXAS1_uc003vvi.2_Intron|TBXAS1_uc003vvj.2_Intron|TBXAS1_uc011kqw.1_Intron	NM_001130966	NP_001124438			thromboxane A synthase 1, platelet isoform						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	139766617	139766617	+	IGR	DEL	A	-	-	rs71520069		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139766617delA								PARP12 (3096 upstream) : JHDM1D (17931 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	141479343	141479344	+	IGR	DEL	TT	-	-	rs3840580		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141479343_141479344delTT								TAS2R4 (155 upstream) : TAS2R5 (10673 downstream)																																			---	---	---	---
MGAM	8972	broad.mit.edu	37	7	141800985	141800985	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141800985delT	uc003vwy.2	+							NM_004668	NP_004659			maltase-glucoamylase						polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)													---	---	---	---
LOC93432	93432	broad.mit.edu	37	7	141835636	141835637	+	Intron	INS	-	T	T	rs145391878	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141835636_141835637insT	uc003vwz.2	+							NR_003715				RecName: Full=Putative maltase-glucoamylase-like protein LOC93432;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	145722255	145722256	+	IGR	DEL	CT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145722255_145722256delCT								None (None upstream) : CNTNAP2 (91197 downstream)																																			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147283442	147283444	+	Intron	DEL	AGG	-	-	rs79448720		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147283442_147283444delAGG	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147489463	147489464	+	Intron	INS	-	ACTAACCT	ACTAACCT	rs141762351	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147489463_147489464insACTAACCT	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	148250454	148250454	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148250454delT								CNTNAP2 (132368 upstream) : C7orf33 (37203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	148279247	148279248	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148279247_148279248insT								CNTNAP2 (161161 upstream) : C7orf33 (8409 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	148350947	148350947	+	IGR	DEL	A	-	-	rs7805572	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148350947delA								C7orf33 (37996 upstream) : CUL1 (44059 downstream)																																			---	---	---	---
PRKAG2	51422	broad.mit.edu	37	7	151400603	151400604	+	Intron	INS	-	T	T	rs151148344	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151400603_151400604insT	uc003wkk.2	-						PRKAG2_uc011kvl.1_Intron|PRKAG2_uc003wkj.2_Intron|PRKAG2_uc010lqe.1_Intron|PRKAG2_uc003wkm.1_Intron	NM_016203	NP_057287			AMP-activated protein kinase gamma2 subunit						ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)														---	---	---	---
PRKAG2	51422	broad.mit.edu	37	7	151531593	151531594	+	Intron	INS	-	A	A	rs146658971	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151531593_151531594insA	uc003wkk.2	-						PRKAG2_uc010lqe.1_Intron|PRKAG2_uc003wkm.1_Intron	NM_016203	NP_057287			AMP-activated protein kinase gamma2 subunit						ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)														---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152110157	152110157	+	Intron	DEL	A	-	-	rs11335639		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152110157delA	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	7	153116120	153116120	+	IGR	DEL	T	-	-	rs77470863		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153116120delT								ACTR3B (563657 upstream) : DPP6 (468299 downstream)																																			---	---	---	---
DPP6	1804	broad.mit.edu	37	7	153790249	153790250	+	Intron	DEL	CA	-	-	rs113157285		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153790249_153790250delCA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154139570	154139585	+	Intron	DEL	AAATGAAGATGAAGGG	-	-	rs71888884		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154139570_154139585delAAATGAAGATGAAGGG	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron|DPP6_uc010lqh.1_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154499778	154499779	+	Intron	INS	-	AG	AG			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154499778_154499779insAG	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	155120549	155120550	+	IGR	INS	-	CT	CT			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155120549_155120550insCT								INSIG1 (18607 upstream) : EN2 (130274 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155727564	155727566	+	IGR	DEL	TCC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155727564_155727566delTCC								SHH (122597 upstream) : C7orf4 (605619 downstream)																																			---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157790504	157790518	+	Intron	DEL	GGGAGATGAGTGCAC	-	-	rs59328428		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157790504_157790518delGGGAGATGAGTGCAC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157907875	157907876	+	Intron	INS	-	AAC	AAC			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157907875_157907876insAAC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	158123774	158123774	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158123774delA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	158134977	158134977	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158134977delA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	158791192	158791192	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158791192delT								WDR60 (52310 upstream) : LOC154822 (9853 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	542283	542283	+	IGR	DEL	C	-	-	rs5888808		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:542283delC								C8orf42 (46952 upstream) : ERICH1 (22466 downstream)																																	OREG0018497	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ERICH1	157697	broad.mit.edu	37	8	620331	620334	+	Intron	DEL	TCTT	-	-	rs34867521		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:620331_620334delTCTT	uc003wph.2	-						ERICH1_uc011kwh.1_Intron|ERICH1_uc003wpe.1_Intron|ERICH1_uc003wpi.2_Intron	NM_207332	NP_997215			glutamate-rich 1											large_intestine(2)	2		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)														---	---	---	---
ERICH1	157697	broad.mit.edu	37	8	636945	636946	+	Intron	INS	-	G	G	rs139259528	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:636945_636946insG	uc003wph.2	-						ERICH1_uc011kwh.1_Intron|ERICH1_uc003wpe.1_Intron	NM_207332	NP_997215			glutamate-rich 1											large_intestine(2)	2		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	1114201	1114202	+	IGR	INS	-	CC	CC	rs151304506		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1114201_1114202insCC								ERICH1 (432975 upstream) : DLGAP2 (335367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	1139725	1139726	+	IGR	DEL	GA	-	-	rs147010060		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1139725_1139726delGA								ERICH1 (458499 upstream) : DLGAP2 (309843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	1401579	1401579	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1401579delA								ERICH1 (720353 upstream) : DLGAP2 (47990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	1403559	1403559	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1403559delG								ERICH1 (722333 upstream) : DLGAP2 (46010 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2208114	2208121	+	IGR	DEL	AGAGAGAG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2208114_2208121delAGAGAGAG								MYOM2 (114735 upstream) : CSMD1 (584755 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2379656	2379656	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2379656delG								MYOM2 (286277 upstream) : CSMD1 (413220 downstream)																																			---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3984604	3984605	+	Intron	INS	-	T	T	rs144742516	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3984604_3984605insT	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	4442621	4442621	+	Intron	DEL	A	-	-	rs148008422		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4442621delA	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	6760665	6760666	+	IGR	DEL	AG	-	-	rs66960080		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6760665_6760666delAG								DEFB1 (25136 upstream) : DEFA6 (21555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	6899492	6899494	+	IGR	DEL	CCT	-	-	rs147157252		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6899492_6899494delCCT								DEFA1B (61878 upstream) : DEFA5 (13335 downstream)																																			---	---	---	---
LOC349196	349196	broad.mit.edu	37	8	7196263	7196264	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7196263_7196264delAC	uc010lrk.1	-						uc011kwo.1_Intron					Homo sapiens cDNA FLJ37516 fis, clone BRCAN2000832.												0																		---	---	---	---
ERI1	90459	broad.mit.edu	37	8	8858427	8858428	+	5'Flank	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8858427_8858428delTC	uc011kwu.1	+						ERI1_uc003wsk.2_5'Flank	NM_153332	NP_699163			three prime histone mRNA exonuclease 1						gene silencing by RNA|rRNA 3'-end processing	cytoplasm|histone pre-mRNA 3'end processing complex|nucleolus	3'-5' exonuclease activity|histone pre-mRNA stem-loop binding|metal ion binding|ribosome binding|rRNA binding				0					Adenosine monophosphate(DB00131)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	9140815	9140817	+	IGR	DEL	TTC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9140815_9140817delTTC								PPP1R3B (131731 upstream) : TNKS (272628 downstream)																																			---	---	---	---
TNKS	8658	broad.mit.edu	37	8	9452637	9452638	+	Intron	DEL	TT	-	-	rs112775955		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9452637_9452638delTT	uc003wss.2	+						TNKS_uc011kwv.1_Intron|TNKS_uc011kww.1_Intron	NM_003747	NP_003738			tankyrase, TRF1-interacting ankyrin-related						mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)														---	---	---	---
TNKS	8658	broad.mit.edu	37	8	9526935	9526936	+	Intron	DEL	AA	-	-	rs5889296		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9526935_9526936delAA	uc003wss.2	+						TNKS_uc011kwv.1_Intron|TNKS_uc011kww.1_Intron	NM_003747	NP_003738			tankyrase, TRF1-interacting ankyrin-related						mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)														---	---	---	---
XKR6	286046	broad.mit.edu	37	8	10899744	10899744	+	Intron	DEL	T	-	-	rs112524909		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10899744delT	uc003wtk.1	-							NM_173683	NP_775954			XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)														---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12238179	12238180	+	Intron	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12238179_12238180delGT	uc011kxp.1	+						uc003wvm.1_Intron|FAM66A_uc010lsi.2_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12242222	12242223	+	Intron	INS	-	ATGT	ATGT	rs142921609	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12242222_12242223insATGT	uc011kxp.1	+						uc003wvm.1_Intron|FAM66A_uc010lsi.2_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12389848	12389849	+	Intron	INS	-	T	T	rs144471162		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12389848_12389849insT	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
DLC1	10395	broad.mit.edu	37	8	13032338	13032338	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13032338delT	uc003wwm.2	-						DLC1_uc003wwl.1_Intron	NM_182643	NP_872584			deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
DLC1	10395	broad.mit.edu	37	8	13038641	13038641	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13038641delC	uc003wwm.2	-						DLC1_uc003wwl.1_Intron	NM_182643	NP_872584			deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	13955115	13955115	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13955115delC	uc003wwq.2	-						SGCZ_uc010lss.2_Intron	NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	14850144	14850145	+	Intron	INS	-	C	C	rs142655521	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14850144_14850145insC	uc003wwq.2	-							NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
TUSC3	7991	broad.mit.edu	37	8	15556361	15556361	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15556361delT	uc003wwt.2	+						TUSC3_uc003wwr.2_Intron|TUSC3_uc003wws.2_Intron|TUSC3_uc003wwu.2_Intron|TUSC3_uc003wwv.2_Intron|TUSC3_uc003www.2_Intron|TUSC3_uc003wwx.2_Intron|TUSC3_uc003wwy.2_Intron	NM_006765	NP_006756			tumor suppressor candidate 3 isoform a						cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	16067649	16067649	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16067649delG								MSR1 (17349 upstream) : FGF20 (782685 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	16314239	16314250	+	IGR	DEL	AGGGAGGAAGGG	-	-	rs34234178		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16314239_16314250delAGGGAGGAAGGG								MSR1 (263939 upstream) : FGF20 (536084 downstream)																																			---	---	---	---
PDGFRL	5157	broad.mit.edu	37	8	17486889	17486890	+	Intron	INS	-	CAG	CAG	rs150833310	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17486889_17486890insCAG	uc003wxr.2	+							NM_006207	NP_006198			platelet-derived growth factor receptor-like							extracellular region	platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity				0				Colorectal(111;0.0752)														---	---	---	---
PSD3	23362	broad.mit.edu	37	8	18436244	18436245	+	Intron	INS	-	A	A	rs67557349		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18436244_18436245insA	uc003wza.2	-						PSD3_uc003wyx.3_Intron|PSD3_uc003wyy.2_Intron|PSD3_uc003wyz.2_Intron	NM_015310	NP_056125			ADP-ribosylation factor guanine nucleotide						regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)														---	---	---	---
PSD3	23362	broad.mit.edu	37	8	18676014	18676015	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18676014_18676015insA	uc003wza.2	-							NM_015310	NP_056125			ADP-ribosylation factor guanine nucleotide						regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	20157844	20157845	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20157844_20157845insT								LZTS1 (45041 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	20479472	20479473	+	IGR	DEL	CA	-	-	rs113769337		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20479472_20479473delCA								LZTS1 (366669 upstream) : None (None downstream)																																			---	---	---	---
DOK2	9046	broad.mit.edu	37	8	21676856	21676856	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21676856delA	uc003wzx.1	-							NM_003974	NP_003965			docking protein 2						blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)														---	---	---	---
DOK2	9046	broad.mit.edu	37	8	21682676	21682676	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21682676delT	uc003wzx.1	-							NM_003974	NP_003965			docking protein 2						blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	22215935	22215935	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22215935delA								PIWIL2 (2351 upstream) : SLC39A14 (8827 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	22789819	22789819	+	IGR	DEL	G	-	-	rs67777709		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22789819delG								PEBP4 (4398 upstream) : RHOBTB2 (55111 downstream)																																			---	---	---	---
LOXL2	4017	broad.mit.edu	37	8	23222086	23222096	+	Intron	DEL	CGCCTGTAATC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23222086_23222096delCGCCTGTAATC	uc003xdh.1	-						uc003xdj.2_RNA	NM_002318	NP_002309			lysyl oxidase-like 2 precursor						aging|cell adhesion|protein modification process	extracellular space|membrane	copper ion binding|electron carrier activity|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor|scavenger receptor activity			breast(2)|ovary(1)	3		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	23984525	23984526	+	IGR	DEL	AA	-	-	rs77729698		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23984525_23984526delAA								STC1 (272205 upstream) : ADAM28 (167054 downstream)																																			---	---	---	---
ADAM7	8756	broad.mit.edu	37	8	24364267	24364268	+	Intron	DEL	CA	-	-	rs71549838		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24364267_24364268delCA	uc003xeb.2	+						ADAM7_uc003xec.2_Intron	NM_003817	NP_003808			a disintegrin and metalloproteinase domain 7						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)														---	---	---	---
EBF2	64641	broad.mit.edu	37	8	25865313	25865314	+	Intron	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25865313_25865314delCA	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron	NM_022659	NP_073150			early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	29559957	29559958	+	IGR	INS	-	CTTCAGAGGGTG	CTTCAGAGGGTG	rs145760860	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29559957_29559958insCTTCAGAGGGTG								DUSP4 (351772 upstream) : C8orf75 (18820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	29618086	29618086	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29618086delA	uc003xho.2	+						uc003xhp.2_Intron					Homo sapiens, clone IMAGE:4861097, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	29755299	29755299	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29755299delC								C8orf75 (149674 upstream) : LOC286135 (23730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	30228442	30228443	+	IGR	DEL	AC	-	-	rs112948312		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30228442_30228443delAC								DCTN6 (187383 upstream) : RBPMS (13501 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	33444215	33444216	+	IGR	INS	-	T	T	rs10087065	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33444215_33444216insT								RNF122 (19572 upstream) : DUSP26 (4640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	34268659	34268660	+	IGR	DEL	GA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34268659_34268660delGA								DUSP26 (811220 upstream) : UNC5D (824315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	34518926	34518926	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34518926delG								None (None upstream) : UNC5D (574049 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	36475208	36475208	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36475208delG								UNC5D (823028 upstream) : KCNU1 (166634 downstream)																																			---	---	---	---
ADAM32	203102	broad.mit.edu	37	8	38974409	38974410	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38974409_38974410insT	uc003xmt.3	+						ADAM32_uc011lch.1_Intron|ADAM32_uc003xmu.3_Intron	NM_145004	NP_659441			a disintegrin and metalloprotease domain 32						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	40910707	40910707	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40910707delC								ZMAT4 (155364 upstream) : SFRP1 (208772 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	43645955	43645956	+	IGR	INS	-	AAG	AAG	rs148802840	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43645955_43645956insAAG								POTEA (427627 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	46845702	46845702	+	IGR	DEL	T	-	-	rs62497882	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:46845702delT								None (None upstream) : BEYLA (906806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	48917472	48917472	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48917472delT								MCM4 (27404 upstream) : UBE2V2 (3523 downstream)																																			---	---	---	---
SNTG1	54212	broad.mit.edu	37	8	50998597	50998598	+	Intron	INS	-	A	A	rs140814595	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50998597_50998598insA	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron	NM_018967	NP_061840			syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	52027533	52027534	+	IGR	INS	-	T	T	rs150706359	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52027533_52027534insT								SNTG1 (322106 upstream) : PXDNL (204610 downstream)																																			---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52354139	52354140	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52354139_52354140insA	uc003xqu.3	-							NM_144651	NP_653252			peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
PCMTD1	115294	broad.mit.edu	37	8	52802426	52802429	+	Intron	DEL	GTGT	-	-	rs141345293		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52802426_52802429delGTGT	uc003xqx.3	-						PCMTD1_uc003xqw.3_Intron|PCMTD1_uc011ldn.1_Intron|PCMTD1_uc010lya.2_Intron	NM_052937	NP_443169			protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	54201790	54201790	+	IGR	DEL	A	-	-	rs112202972		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54201790delA								OPRK1 (37596 upstream) : ATP6V1H (426326 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	54247272	54247272	+	IGR	DEL	T	-	-	rs60911092		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54247272delT								OPRK1 (83078 upstream) : ATP6V1H (380844 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	55510429	55510430	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55510429_55510430insT								SOX17 (136974 upstream) : RP1 (18197 downstream)																																			---	---	---	---
XKR4	114786	broad.mit.edu	37	8	56120193	56120208	+	Intron	DEL	CGCGCACACACACACA	-	-	rs55856528		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56120193_56120208delCGCGCACACACACACA	uc003xsf.2	+							NM_052898	NP_443130			XK, Kell blood group complex subunit-related							integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)															---	---	---	---
XKR4	114786	broad.mit.edu	37	8	56133282	56133282	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56133282delT	uc003xsf.2	+							NM_052898	NP_443130			XK, Kell blood group complex subunit-related							integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	57745396	57745396	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57745396delC								PENK (386114 upstream) : IMPAD1 (125095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	58861892	58861895	+	IGR	DEL	AAAG	-	-	rs72660356	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58861892_58861895delAAAG								C8orf71 (664604 upstream) : FAM110B (45218 downstream)																																			---	---	---	---
FAM110B	90362	broad.mit.edu	37	8	58970765	58970765	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58970765delT	uc003xtj.1	+							NM_147189	NP_671722			hypothetical protein LOC90362							microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	59461996	59461996	+	IGR	DEL	A	-	-	rs35637234		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59461996delA								CYP7A1 (49276 upstream) : SDCBP (3732 downstream)																																			---	---	---	---
CA8	767	broad.mit.edu	37	8	61189919	61189919	+	Intron	DEL	T	-	-	rs113659462		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61189919delT	uc003xtz.1	-						CA8_uc003xua.1_Intron|CA8_uc003xub.2_Intron	NM_004056	NP_004047			carbonic anhydrase VIII						one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	61892106	61892107	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61892106_61892107insT								CHD7 (112643 upstream) : CLVS1 (308418 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	61910494	61910495	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61910494_61910495delTG								CHD7 (131031 upstream) : CLVS1 (290030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	62149848	62149848	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62149848delA								CHD7 (370385 upstream) : CLVS1 (50677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	63016405	63016405	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63016405delA								ASPH (389206 upstream) : NKAIN3 (145096 downstream)																																			---	---	---	---
NKAIN3	286183	broad.mit.edu	37	8	63537344	63537344	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63537344delT	uc010lyq.1	+							NM_173688	NP_775959			Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	64441671	64441671	+	IGR	DEL	C	-	-	rs67671341		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64441671delC								YTHDF3 (316326 upstream) : MIR124-2 (850035 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	66919020	66919020	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66919020delA								PDE7A (165265 upstream) : DNAJC5B (14771 downstream)																																			---	---	---	---
CSPP1	79848	broad.mit.edu	37	8	68009928	68009928	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68009928delT	uc003xxi.2	+						CSPP1_uc003xxg.1_Intron|CSPP1_uc003xxh.1_Intron|CSPP1_uc003xxj.2_Intron|CSPP1_uc003xxk.2_Intron	NM_001077204	NP_001070672			centrosome spindle pole associated protein 1							centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)															---	---	---	---
PREX2	80243	broad.mit.edu	37	8	68920674	68920676	+	Intron	DEL	AGA	-	-	rs68110557		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68920674_68920676delAGA	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146			DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
XKR9	389668	broad.mit.edu	37	8	71637723	71637723	+	Intron	DEL	A	-	-	rs34227400		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71637723delA	uc003xyq.2	+						XKR9_uc010lze.2_Intron|XKR9_uc010lzd.2_Intron	NM_001011720	NP_001011720			XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	71654542	71654542	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71654542delT								XKR9 (6366 upstream) : EYA1 (455128 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	71963762	71963767	+	IGR	DEL	GGGTGT	-	-	rs71968481		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71963762_71963767delGGGTGT								XKR9 (315586 upstream) : EYA1 (145903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	72838978	72838979	+	Intron	INS	-	A	A	rs150960702	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72838978_72838979insA	uc011lff.1	+						uc003xyy.2_Intron					Homo sapiens cDNA FLJ41321 fis, clone BRAMY2045299.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	72861290	72861290	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72861290delC	uc011lff.1	+						uc003xyy.2_Intron					Homo sapiens cDNA FLJ41321 fis, clone BRAMY2045299.																														---	---	---	---
KCNB2	9312	broad.mit.edu	37	8	73638115	73638115	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73638115delA	uc003xzb.2	+							NM_004770	NP_004761			potassium voltage-gated channel, Shab-related						regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)															---	---	---	---
UBE2W	55284	broad.mit.edu	37	8	74766296	74766296	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74766296delA	uc003xzv.2	-						UBE2W_uc003xzt.2_Intron|UBE2W_uc003xzu.2_Intron|UBE2W_uc003xzw.2_Intron	NM_018299	NP_060769			ubiquitin-conjugating enzyme E2W (putative)						protein K11-linked ubiquitination|protein monoubiquitination		ATP binding|protein binding|ubiquitin-protein ligase activity				0	Breast(64;0.0311)		Epithelial(68;0.0235)|all cancers(69;0.0687)|BRCA - Breast invasive adenocarcinoma(89;0.069)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	75135989	75135989	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75135989delT								LY96 (194684 upstream) : JPH1 (10952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	75340463	75340468	+	IGR	DEL	AACAAC	-	-	rs112829936		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75340463_75340468delAACAAC								GDAP1 (61130 upstream) : MIR2052 (277460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	76504665	76504665	+	IGR	DEL	T	-	-	rs34967194		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76504665delT								HNF4G (25606 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	76572564	76572565	+	IGR	INS	-	TTT	TTT	rs143958907	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76572564_76572565insTTT								HNF4G (93505 upstream) : LOC100192378 (950550 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	76768896	76768896	+	IGR	DEL	C	-	-	rs5892521		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76768896delC								HNF4G (289837 upstream) : LOC100192378 (754219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	76773189	76773190	+	IGR	INS	-	AT	AT			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76773189_76773190insAT								HNF4G (294130 upstream) : LOC100192378 (749925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78433153	78433153	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78433153delC								PEX2 (520629 upstream) : PKIA (995183 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	79342435	79342436	+	IGR	DEL	TC	-	-	rs72470330		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79342435_79342436delTC								None (None upstream) : PKIA (85900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81272340	81272341	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81272340_81272341delTG								TPD52 (188504 upstream) : ZBTB10 (125513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	83525259	83525260	+	IGR	INS	-	T	T	rs144450519	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83525259_83525260insT								SNX16 (770738 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	83555616	83555617	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83555616_83555617delAC								SNX16 (801095 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	83679951	83679952	+	IGR	INS	-	A	A	rs141363312	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83679951_83679952insA								SNX16 (925430 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84002091	84002091	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84002091delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84076849	84076850	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84076849_84076850delCA								None (None upstream) : None (None downstream)																																			---	---	---	---
RALYL	138046	broad.mit.edu	37	8	85096324	85096324	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85096324delT	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_5'UTR|RALYL_uc010lzy.2_5'UTR|RALYL_uc003yct.3_5'Flank	NM_001100392	NP_001093862			RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
WWP1	11059	broad.mit.edu	37	8	87437328	87437329	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87437328_87437329delTG	uc003ydt.2	+						WWP1_uc010mai.2_Intron	NM_007013	NP_008944			WW domain containing E3 ubiquitin protein ligase						central nervous system development|entry of virus into host cell|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|signal transduction	cytoplasm|nucleus|plasma membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			lung(1)|liver(1)	2																		---	---	---	---
CNBD1	168975	broad.mit.edu	37	8	88034758	88034758	+	Intron	DEL	A	-	-	rs35849781		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88034758delA	uc003ydy.2	+							NM_173538	NP_775809			cyclic nucleotide binding domain containing 1											ovary(3)	3																		---	---	---	---
CNBD1	168975	broad.mit.edu	37	8	88282585	88282585	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88282585delA	uc003ydy.2	+							NM_173538	NP_775809			cyclic nucleotide binding domain containing 1											ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	89596250	89596251	+	IGR	INS	-	TTG	TTG	rs150932299	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89596250_89596251insTTG								MMP16 (256533 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	90166661	90166662	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90166661_90166662insT								MMP16 (826944 upstream) : RIPK2 (603313 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	90289955	90289956	+	IGR	DEL	TC	-	-	rs111378054		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90289955_90289956delTC								MMP16 (950238 upstream) : RIPK2 (480019 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	96576747	96576749	+	IGR	DEL	AAG	-	-	rs111795045		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96576747_96576749delAAG								C8orf37 (295310 upstream) : GDF6 (577811 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	97061318	97061319	+	IGR	INS	-	A	A	rs138808629	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97061318_97061319insA								C8orf37 (779881 upstream) : GDF6 (93241 downstream)																																			---	---	---	---
NIPAL2	79815	broad.mit.edu	37	8	99301743	99301743	+	Intron	DEL	T	-	-	rs113377962		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99301743delT	uc003yil.1	-						NIPAL2_uc003yim.1_Intron	NM_024759	NP_079035			NIPA-like domain containing 2							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	102014916	102014916	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102014916delA								YWHAZ (49293 upstream) : ZNF706 (194352 downstream)																																			---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106764107	106764107	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106764107delT	uc003ymd.2	+						ZFPM2_uc011lhs.1_Intron	NM_012082	NP_036214			zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106801318	106801318	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106801318delT	uc003ymd.2	+						ZFPM2_uc011lhs.1_Intron	NM_012082	NP_036214			zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	108679076	108679076	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108679076delT								ANGPT1 (168822 upstream) : RSPO2 (232469 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	109350864	109350864	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109350864delC								EIF3E (89905 upstream) : TTC35 (104989 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	112984477	112984478	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:112984477_112984478insT								None (None upstream) : CSMD3 (250683 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	115809969	115809970	+	IGR	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:115809969_115809970delTC								None (None upstream) : TRPS1 (610755 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116098959	116098960	+	IGR	INS	-	T	T	rs5894237		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116098959_116098960insT								None (None upstream) : TRPS1 (321765 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	117004710	117004710	+	IGR	DEL	A	-	-	rs111862307		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117004710delA								TRPS1 (323482 upstream) : EIF3H (652346 downstream)																																			---	---	---	---
EXT1	2131	broad.mit.edu	37	8	119042480	119042480	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119042480delA	uc003yok.1	-							NM_000127	NP_000118			exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)					Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	8	120180137	120180137	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120180137delG								COLEC10 (60942 upstream) : MAL2 (40473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	120198894	120198894	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120198894delA								COLEC10 (79699 upstream) : MAL2 (21716 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	122058382	122058385	+	IGR	DEL	TTTG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122058382_122058385delTTTG								SNTB1 (234073 upstream) : HAS2 (566886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	122133580	122133582	+	IGR	DEL	TAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122133580_122133582delTAA								SNTB1 (309271 upstream) : HAS2 (491689 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	123486229	123486230	+	IGR	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123486229_123486230delTC								HAS2AS (829296 upstream) : ZHX2 (307671 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	125298711	125298712	+	IGR	INS	-	TCTC	TCTC	rs141379773	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125298711_125298712insTCTC								FER1L6 (166410 upstream) : TMEM65 (24449 downstream)																																			---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125646013	125646013	+	Intron	DEL	A	-	-	rs113893066		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125646013delA	uc003yrk.2	-						MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566			metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
KIAA0196	9897	broad.mit.edu	37	8	126040350	126040350	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126040350delC	uc003yrt.2	-						KIAA0196_uc011lir.1_Intron	NM_014846	NP_055661			strumpellin						cell death	WASH complex				ovary(2)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	127087920	127087928	+	IGR	DEL	CCTGCTTCC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127087920_127087928delCCTGCTTCC								TRIB1 (637278 upstream) : FAM84B (476759 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	127983224	127983224	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127983224delA								FAM84B (412758 upstream) : LOC727677 (318838 downstream)																																			---	---	---	---
PVT1	5820	broad.mit.edu	37	8	128969035	128969036	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128969035_128969036insT	uc010mdq.2	+						PVT1_uc003ysl.2_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0																		---	---	---	---
ASAP1	50807	broad.mit.edu	37	8	131408975	131408975	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131408975delA	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952			development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	131769764	131769764	+	IGR	DEL	G	-	-	rs77193874		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131769764delG								ASAP1 (355548 upstream) : ADCY8 (22784 downstream)																																			---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133409196	133409197	+	Intron	INS	-	GT	GT	rs2721904	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133409196_133409197insGT	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	134813097	134813100	+	IGR	DEL	TGTA	-	-	rs10610183		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134813097_134813100delTGTA								ST3GAL1 (228914 upstream) : ZFAT (676933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	136074097	136074097	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136074097delG								MIR30D (256909 upstream) : LOC286094 (172277 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	137391039	137391042	+	IGR	DEL	TAGC	-	-	rs34296118		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137391039_137391042delTAGC								KHDRBS3 (731193 upstream) : None (None downstream)																																			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139711879	139711880	+	Intron	INS	-	T	T	rs141616848	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139711879_139711880insT	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139895982	139895983	+	Intron	INS	-	GTAA	GTAA	rs141232555	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139895982_139895983insGTAA	uc003yvd.2	-							NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	139942832	139942832	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139942832delA								COL22A1 (16596 upstream) : KCNK9 (670250 downstream)																																			---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141429541	141429542	+	Intron	INS	-	AAC	AAC	rs58809382		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141429541_141429542insAAC	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	141661090	141661091	+	IGR	INS	-	AC	AC	rs142600510	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141661090_141661091insAC								EIF2C2 (15445 upstream) : PTK2 (7411 downstream)																																			---	---	---	---
PTK2	5747	broad.mit.edu	37	8	141980988	141980989	+	Intron	INS	-	A	A	rs111788818		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141980988_141980989insA	uc003yvu.2	-						PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560			PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)															---	---	---	---
HEATR7A	727957	broad.mit.edu	37	8	145273912	145273913	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145273912_145273913insT	uc003zbk.3	+						HEATR7A_uc011lla.1_Intron|HEATR7A_uc010mft.2_Intron	NM_032450	NP_115826			HEAT repeat containing 7A isoform 1								binding				0																		---	---	---	---
KANK1	23189	broad.mit.edu	37	9	713812	713813	+	Intron	INS	-	A	A	rs142399753	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:713812_713813insA	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgs.1_Intron	NM_015158	NP_055973			KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)														---	---	---	---
DMRT3	58524	broad.mit.edu	37	9	983125	983126	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:983125_983126insT	uc003zgw.1	+							NM_021240	NP_067063			doublesex and mab-3 related transcription factor						cell differentiation|multicellular organismal development|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(2)|central_nervous_system(1)	3		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	1915098	1915099	+	IGR	INS	-	A	A	rs141599611	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1915098_1915099insA								DMRT2 (857545 upstream) : SMARCA2 (100243 downstream)																																			---	---	---	---
GLIS3	169792	broad.mit.edu	37	9	3867721	3867734	+	Intron	DEL	GTGTGTGTGCGTGC	-	-	rs149046995	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3867721_3867734delGTGTGTGTGCGTGC	uc003zhw.1	-						GLIS3_uc003zhx.1_Intron|GLIS3_uc010mhf.1_Intron|GLIS3_uc003zhv.1_Intron|GLIS3_uc003zhy.1_Intron	NM_152629	NP_689842			GLIS family zinc finger 3 isoform b						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	4373292	4373292	+	IGR	DEL	A	-	-	rs75899561		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4373292delA								GLIS3 (73257 upstream) : SLC1A1 (117152 downstream)																																			---	---	---	---
AK3	50808	broad.mit.edu	37	9	4713946	4713947	+	Intron	DEL	AC	-	-	rs76074285		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4713946_4713947delAC	uc003ziq.1	-						AK3_uc003zip.1_Intron|AK3_uc011lma.1_Intron|AK3_uc003zir.1_Intron	NM_016282	NP_057366			adenylate kinase 3						blood coagulation	mitochondrial matrix	ATP binding|GTP binding|nucleoside triphosphate adenylate kinase activity			ovary(2)	2	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)														---	---	---	---
PDCD1LG2	80380	broad.mit.edu	37	9	5549008	5549008	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5549008delA	uc003zjg.3	+						C9orf46_uc003zjd.2_Intron|PDCD1LG2_uc011lmc.1_Intron|PDCD1LG2_uc011lmd.1_Intron|PDCD1LG2_uc010mhp.1_Intron|PDCD1LG2_uc010mho.1_Intron	NM_025239	NP_079515			programmed cell death 1 ligand 2 precursor						immune response|T cell costimulation	endomembrane system|extracellular region|integral to membrane|plasma membrane	receptor activity				0	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000767)|Lung(218;0.112)														---	---	---	---
ERMP1	79956	broad.mit.edu	37	9	5817855	5817856	+	Intron	INS	-	A	A	rs113017625		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5817855_5817856insA	uc003zjm.1	-						ERMP1_uc011lme.1_Intron|ERMP1_uc010mhs.1_Intron|ERMP1_uc003zjn.1_Intron	NM_024896	NP_079172			aminopeptidase Fxna						proteolysis	endoplasmic reticulum membrane|integral to membrane	metal ion binding|metallopeptidase activity			ovary(1)	1		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)														---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	6739634	6739634	+	Intron	DEL	T	-	-	rs113877960		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6739634delT	uc010mhu.2	+							NM_001146696	NP_001140168			jumonji domain containing 2C isoform 4						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	7542261	7542262	+	IGR	INS	-	G	G	rs148461807	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7542261_7542262insG								KDM4C (366614 upstream) : C9orf123 (254231 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	7909269	7909269	+	IGR	DEL	G	-	-	rs143170504		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7909269delG								C9orf123 (109470 upstream) : PTPRD (404978 downstream)																																			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8875624	8875628	+	Intron	DEL	ATAAG	-	-	rs140880192		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8875624_8875628delATAAG	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	9732352	9732352	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9732352delA	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	9	12365178	12365179	+	IGR	INS	-	GT	GT	rs147097576	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12365178_12365179insGT								None (None upstream) : TYRP1 (328207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	12873867	12873868	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12873867_12873868insT								C9orf150 (50809 upstream) : MPDZ (231841 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13857388	13857389	+	IGR	INS	-	A	A	rs139800396	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13857388_13857389insA								MPDZ (577825 upstream) : NFIB (224459 downstream)																																			---	---	---	---
NFIB	4781	broad.mit.edu	37	9	14220988	14220988	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14220988delG	uc003zle.2	-						NFIB_uc003zlf.2_Intron|NFIB_uc011lmo.1_Intron	NM_005596	NP_005587			nuclear factor I/B						anterior commissure morphogenesis|chondrocyte differentiation|Clara cell differentiation|commissural neuron axon guidance|DNA replication|glial cell differentiation|lung ciliated cell differentiation|negative regulation of DNA binding|negative regulation of epithelial cell proliferation involved in lung morphogenesis|negative regulation of mesenchymal cell proliferation involved in lung development|positive regulation of transcription from RNA polymerase II promoter|principal sensory nucleus of trigeminal nerve development|Type I pneumocyte differentiation|Type II pneumocyte differentiation	cerebellar mossy fiber|nucleolus|nucleus	RNA polymerase II transcription corepressor activity|sequence-specific DNA binding RNA polymerase II transcription factor activity				0				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)				T	MYB|HGMA2	adenoid cystic carcinoma|lipoma								---	---	---	---
Unknown	0	broad.mit.edu	37	9	14451873	14451874	+	IGR	INS	-	T	T	rs113480153		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14451873_14451874insT								NFIB (137928 upstream) : ZDHHC21 (103607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	16217259	16217260	+	RNA	DEL	TG	-	-	rs112856396		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16217259_16217260delTG	uc003zmh.1	+	1		c.454_455delTG								Homo sapiens cDNA FLJ36669 fis, clone UTERU2004015.																														---	---	---	---
BNC2	54796	broad.mit.edu	37	9	16472617	16472617	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16472617delA	uc003zml.2	-						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc003zmq.1_Intron|BNC2_uc003zmr.1_Intron|BNC2_uc003zmp.1_Intron|BNC2_uc010mij.1_Intron|BNC2_uc011lmv.1_Intron|BNC2_uc003zmo.1_Intron	NM_017637	NP_060107			basonuclin 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)														---	---	---	---
BNC2	54796	broad.mit.edu	37	9	16850807	16850808	+	Intron	INS	-	A	A	rs112228518		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16850807_16850808insA	uc003zml.2	-						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc003zmq.1_Intron|BNC2_uc003zmr.1_Intron|BNC2_uc003zmp.1_Intron|BNC2_uc010mij.1_Intron|BNC2_uc003zmu.1_Intron|BNC2_uc010mim.1_Intron|BNC2_uc010min.1_Intron	NM_017637	NP_060107			basonuclin 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)														---	---	---	---
BNC2	54796	broad.mit.edu	37	9	16869221	16869222	+	Intron	INS	-	AAAAT	AAAAT	rs148563834	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16869221_16869222insAAAAT	uc003zml.2	-						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc003zmq.1_Intron|BNC2_uc003zmr.1_Intron|BNC2_uc003zmp.1_Intron|BNC2_uc010mij.1_Intron|BNC2_uc003zmu.1_5'Flank|BNC2_uc010mim.1_5'Flank|BNC2_uc010min.1_5'Flank	NM_017637	NP_060107			basonuclin 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)														---	---	---	---
FAM154A	158297	broad.mit.edu	37	9	18989128	18989128	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18989128delA	uc003zni.1	-						FAM154A_uc010mip.1_Intron	NM_153707	NP_714918			hypothetical protein LOC158297											pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.53e-16)														---	---	---	---
HAUS6	54801	broad.mit.edu	37	9	19078117	19078117	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19078117delA	uc003znk.2	-						HAUS6_uc011lmz.1_Intron|HAUS6_uc003znl.1_Intron|HAUS6_uc003znm.1_Intron	NM_017645	NP_060115			HAUS augmin-like complex, subunit 6						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2																		---	---	---	---
ACER2	340485	broad.mit.edu	37	9	19442835	19442836	+	Intron	INS	-	T	T	rs113229012		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19442835_19442836insT	uc003zny.1	+						ACER2_uc003znx.1_Intron|ACER2_uc003znz.1_Intron	NM_001010887	NP_001010887			alkaline ceramidase 2						ceramide metabolic process|negative regulation of cell adhesion mediated by integrin|negative regulation of cell-matrix adhesion|negative regulation of protein glycosylation in Golgi|positive regulation of cell proliferation|response to retinoic acid|sphingosine biosynthetic process	integral to Golgi membrane	ceramidase activity			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2																		---	---	---	---
KIAA1797	54914	broad.mit.edu	37	9	20686996	20686997	+	Intron	DEL	TT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20686996_20686997delTT	uc003zog.1	+							NM_017794	NP_060264			hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	21564566	21564566	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21564566delA								LOC554202 (4734 upstream) : MTAP (238069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	21579019	21579020	+	IGR	INS	-	TGTG	TGTG	rs138908942	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21579019_21579020insTGTG								LOC554202 (19187 upstream) : MTAP (223615 downstream)																																			---	---	---	---
CDKN2BAS	100048912	broad.mit.edu	37	9	22080398	22080398	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22080398delA	uc003zpm.2	+							NR_003529				Homo sapiens hypothetical methylthioadenosine phosphorylase fusion protein mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	22837905	22837905	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22837905delT								DMRTA1 (385433 upstream) : ELAVL2 (852200 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	22912584	22912585	+	IGR	INS	-	GT	GT	rs144885407	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22912584_22912585insGT								DMRTA1 (460112 upstream) : ELAVL2 (777520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	23333096	23333097	+	IGR	DEL	AT	-	-	rs10540355		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23333096_23333097delAT								DMRTA1 (880624 upstream) : ELAVL2 (357008 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	23432983	23432984	+	IGR	INS	-	C	C	rs148993971	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23432983_23432984insC								DMRTA1 (980511 upstream) : ELAVL2 (257121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	24977721	24977722	+	IGR	INS	-	AC	AC	rs150203877	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:24977721_24977722insAC								None (None upstream) : TUSC1 (698672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	25215623	25215623	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25215623delC								None (None upstream) : TUSC1 (460771 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	25468122	25468122	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25468122delT								None (None upstream) : TUSC1 (208272 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	25585299	25585299	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25585299delA								None (None upstream) : TUSC1 (91095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	25913050	25913050	+	IGR	DEL	A	-	-	rs67461699		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25913050delA								TUSC1 (234194 upstream) : C9orf82 (927634 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	26653646	26653647	+	IGR	INS	-	GAT	GAT	rs138507152	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26653646_26653647insGAT								TUSC1 (974790 upstream) : C9orf82 (187037 downstream)																																			---	---	---	---
LINGO2	158038	broad.mit.edu	37	9	28006314	28006335	+	Intron	DEL	AAATCCTTACCTAAGATTAAAA	-	-	rs143123849	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28006314_28006335delAAATCCTTACCTAAGATTAAAA	uc003zqu.1	-						LINGO2_uc010mjf.1_Intron|LINGO2_uc003zqv.1_Intron	NM_152570	NP_689783			leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)														---	---	---	---
LINGO2	158038	broad.mit.edu	37	9	28180829	28180832	+	Intron	DEL	ACAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28180829_28180832delACAC	uc003zqu.1	-						LINGO2_uc010mjf.1_Intron|LINGO2_uc003zqv.1_Intron	NM_152570	NP_689783			leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	29480206	29480207	+	IGR	INS	-	TG	TG	rs150907504	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29480206_29480207insTG								MIR873 (591253 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	31440961	31440961	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31440961delC								None (None upstream) : ACO1 (943640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	31560985	31560985	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31560985delA								None (None upstream) : ACO1 (823616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	31922999	31923000	+	IGR	INS	-	AA	AA	rs144645814	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31922999_31923000insAA								None (None upstream) : ACO1 (461601 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32001369	32001375	+	IGR	DEL	AGAGATG	-	-	rs72451082		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32001369_32001375delAGAGATG								None (None upstream) : ACO1 (383226 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32725485	32725496	+	IGR	DEL	ACACACACACAC	-	-	rs72262321		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32725485_32725496delACACACACACAC								TAF1L (89818 upstream) : TMEM215 (58001 downstream)																																			---	---	---	---
CNTFR	1271	broad.mit.edu	37	9	34569407	34569407	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34569407delA	uc003zup.1	-						CNTFR_uc003zuq.1_Intron|LOC415056_uc003zut.2_Intron|LOC415056_uc003zur.2_Intron|LOC415056_uc003zus.2_Intron	NM_147164	NP_671693			ciliary neurotrophic factor receptor						nervous system development	anchored to membrane|extrinsic to membrane|plasma membrane	ciliary neurotrophic factor receptor activity|receptor binding			ovary(3)|central_nervous_system(1)|skin(1)	5	all_epithelial(49;0.0899)		STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.00494)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	34921175	34921175	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34921175delT								C9orf144 (82592 upstream) : KIAA1045 (36346 downstream)																																			---	---	---	---
RECK	8434	broad.mit.edu	37	9	36111955	36111956	+	Intron	INS	-	A	A	rs76255170		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36111955_36111956insA	uc003zyv.2	+						RECK_uc003zyw.2_Intron|RECK_uc003zyx.2_Intron	NM_021111	NP_066934			RECK protein precursor							anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)															---	---	---	---
ZCCHC7	84186	broad.mit.edu	37	9	37221519	37221519	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37221519delT	uc003zzq.2	+						ZCCHC7_uc011lqh.1_Intron|ZCCHC7_uc011lqi.1_Intron|ZCCHC7_uc010mlt.2_Intron	NM_032226	NP_115602			zinc finger, CCHC domain containing 7								nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(29;0.0137)														---	---	---	---
SHB	6461	broad.mit.edu	37	9	38071345	38071360	+	5'Flank	DEL	GTGTGAGAGAGAGAGA	-	-	rs10616039		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38071345_38071360delGTGTGAGAGAGAGAGA	uc004aax.2	-							NM_003028	NP_003019			Src homology 2 domain containing adaptor protein						angiogenesis|apoptosis|cell differentiation|signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity			central_nervous_system(2)|skin(1)	3		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	38428721	38428723	+	IGR	DEL	TCT	-	-	rs67092164		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38428721_38428723delTCT								IGFBPL1 (4277 upstream) : C9orf122 (192362 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	43756053	43756055	+	Intron	DEL	TAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43756053_43756055delTAC	uc004acz.1	+											Homo sapiens cDNA FLJ30083 fis, clone BGGI12001097, weakly similar to Homo sapiens contactin associated protein (Caspr) mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	46874241	46874242	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:46874241_46874242delTG								KGFLP1 (125856 upstream) : None (None downstream)																																			---	---	---	---
LOC442421	442421	broad.mit.edu	37	9	66494029	66494030	+	5'Flank	INS	-	TG	TG	rs144564486	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66494029_66494030insTG	uc004aed.1	+											Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	66853842	66853843	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66853842_66853843insA								LOC442421 (350815 upstream) : AQP7P1 (400424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68303879	68303880	+	IGR	DEL	AA	-	-	rs113954448		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68303879_68303880delAA								FAM27B (509690 upstream) : MIR1299 (698359 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68369487	68369487	+	IGR	DEL	C	-	-	rs11476376		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68369487delC								FAM27B (575298 upstream) : MIR1299 (632752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68390794	68390794	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68390794delT								FAM27B (596605 upstream) : MIR1299 (611445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68427592	68427593	+	IGR	INS	-	AC	AC	rs139250107		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68427592_68427593insAC								FAM27B (633403 upstream) : MIR1299 (574646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68504491	68504492	+	IGR	INS	-	A	A	rs145184985		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68504491_68504492insA								FAM27B (710302 upstream) : MIR1299 (497747 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69001402	69001403	+	IGR	INS	-	T	T	rs142560516		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69001402_69001403insT								None (None upstream) : MIR1299 (836 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69333513	69333514	+	IGR	INS	-	AAGAAC	AAGAAC			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69333513_69333514insAAGAAC								CBWD6 (70920 upstream) : ANKRD20A4 (48467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	72865735	72865735	+	Intron	DEL	T	-	-	rs67336146		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72865735delT	uc004ahq.1	-											Homo sapiens cDNA FLJ42142 fis, clone TESTI2045155.																														---	---	---	---
SMC5	23137	broad.mit.edu	37	9	72963935	72963935	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72963935delT	uc004ahr.2	+						SMC5_uc011lry.1_Intron	NM_015110	NP_055925			SMC5 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	73353140	73353140	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73353140delA	uc004aid.2	-						TRPM3_uc004ahu.2_Intron|TRPM3_uc004ahv.2_Intron|TRPM3_uc004ahw.2_Intron|TRPM3_uc004ahx.2_Intron|TRPM3_uc004ahy.2_Intron|TRPM3_uc004ahz.2_Intron|TRPM3_uc004aia.2_Intron|TRPM3_uc004aib.2_Intron|TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron	NM_001007471	NP_001007472			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	73753044	73753045	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73753044_73753045insA	uc004aii.2	-							NM_206948	NP_996831			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	73891111	73891112	+	Intron	INS	-	A	A	rs10429473	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73891111_73891112insA	uc004aii.2	-							NM_206948	NP_996831			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
TMC1	117531	broad.mit.edu	37	9	75430881	75430881	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75430881delA	uc004aiz.1	+						TMC1_uc010moz.1_Intron|TMC1_uc004aja.1_Intron|TMC1_uc004ajb.1_Intron|TMC1_uc004ajc.1_Intron|TMC1_uc010mpa.1_Intron	NM_138691	NP_619636			transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	76323980	76323980	+	IGR	DEL	T	-	-	rs112359930		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:76323980delT								ANXA1 (538673 upstream) : RORB (788272 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	76864502	76864502	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:76864502delT								None (None upstream) : RORB (247750 downstream)																																			---	---	---	---
PCSK5	5125	broad.mit.edu	37	9	78552330	78552330	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78552330delG	uc004ajz.2	+						PCSK5_uc004ajy.2_Intron|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191			proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3																		---	---	---	---
PRUNE2	158471	broad.mit.edu	37	9	79329262	79329262	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79329262delT	uc010mpk.2	-							NM_015225	NP_056040			prune homolog 2						apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	81407783	81407784	+	IGR	INS	-	A	A	rs138790728	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81407783_81407784insA								PSAT1 (462776 upstream) : TLE4 (779094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	82868000	82868001	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82868000_82868001insT								TLE4 (526343 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83928998	83928999	+	IGR	INS	-	ACTT	ACTT	rs144452103	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83928998_83928999insACTT								None (None upstream) : TLE1 (269601 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	84032445	84032445	+	IGR	DEL	T	-	-	rs113272472		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84032445delT								None (None upstream) : TLE1 (166155 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	84349783	84349784	+	Intron	INS	-	A	A	rs139099256	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84349783_84349784insA	uc004amc.2	+						uc004amd.2_Intron					Homo sapiens cDNA clone IMAGE:4813482.																														---	---	---	---
FRMD3	257019	broad.mit.edu	37	9	86071352	86071353	+	Intron	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86071352_86071353delAG	uc004ams.1	-						FRMD3_uc004amr.1_Intron	NM_174938	NP_777598			FERM domain containing 3							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SLC28A3	64078	broad.mit.edu	37	9	86943071	86943072	+	Intron	INS	-	AC	AC	rs147285114	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86943071_86943072insAC	uc010mpz.2	-						SLC28A3_uc011lsy.1_Intron|SLC28A3_uc004anu.1_Intron|SLC28A3_uc010mqb.2_Intron	NM_022127	NP_071410			concentrative Na+-nucleoside cotransporter						nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4																		---	---	---	---
SLC28A3	64078	broad.mit.edu	37	9	86969777	86969778	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86969777_86969778insA	uc004anu.1	-							NM_022127	NP_071410			concentrative Na+-nucleoside cotransporter						nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4																		---	---	---	---
SLC28A3	64078	broad.mit.edu	37	9	86984126	86984127	+	5'Flank	INS	-	A	A	rs78982535		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86984126_86984127insA	uc004anu.1	-							NM_022127	NP_071410			concentrative Na+-nucleoside cotransporter						nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4																		---	---	---	---
AGTPBP1	23287	broad.mit.edu	37	9	88298471	88298471	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88298471delT	uc011ltd.1	-						AGTPBP1_uc011ltc.1_5'Flank|AGTPBP1_uc010mqc.2_Intron|AGTPBP1_uc011lte.1_Intron	NM_015239	NP_056054			ATP/GTP binding protein 1						C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	89885456	89885457	+	IGR	INS	-	GT	GT	rs11141728		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89885456_89885457insGT								C9orf170 (110815 upstream) : DAPK1 (227201 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	90625635	90625637	+	IGR	DEL	TTT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90625635_90625637delTTT								CDK20 (35968 upstream) : SPIN1 (377203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91273833	91273834	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91273833_91273834insT								LOC286238 (6758 upstream) : C9orf47 (331944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91536181	91536182	+	IGR	DEL	AC	-	-	rs112115574		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91536181_91536182delAC								LOC286238 (269106 upstream) : C9orf47 (69596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91537583	91537584	+	IGR	INS	-	AT	AT	rs139902630	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91537583_91537584insAT								LOC286238 (270508 upstream) : C9orf47 (68194 downstream)																																			---	---	---	---
SEMA4D	10507	broad.mit.edu	37	9	92046951	92046952	+	Intron	INS	-	C	C	rs140235337	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92046951_92046952insC	uc004aqo.1	-						SEMA4D_uc011ltm.1_Intron|SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqp.1_Intron	NM_006378	NP_006369			semaphorin 4D isoform 1						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
LOC100129066	100129066	broad.mit.edu	37	9	92327095	92327098	+	Intron	DEL	ACAT	-	-	rs56082126		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92327095_92327098delACAT	uc004aqs.2	+							NR_024280				Homo sapiens cDNA FLJ42342 fis, clone UTERU2000794.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	93513767	93513768	+	IGR	INS	-	T	T	rs137945403	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93513767_93513768insT								DIRAS2 (108659 upstream) : SYK (50244 downstream)																																			---	---	---	---
AUH	549	broad.mit.edu	37	9	94056416	94056416	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94056416delC	uc004arf.3	-						AUH_uc004arg.3_Intron	NM_001698	NP_001689			AU RNA binding protein/enoyl-Coenzyme A						branched chain family amino acid catabolic process|mRNA catabolic process	mitochondrial matrix	enoyl-CoA hydratase activity|methylglutaconyl-CoA hydratase activity|mRNA 3'-UTR binding				0																		---	---	---	---
PTCH1	5727	broad.mit.edu	37	9	98272284	98272285	+	5'Flank	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98272284_98272285insA	uc004avk.3	-						PTCH1_uc010mro.2_5'Flank|PTCH1_uc010mrp.2_5'Flank|PTCH1_uc010mrq.2_5'Flank|PTCH1_uc004avl.3_5'Flank|PTCH1_uc010mrr.2_Intron|PTCH1_uc004avm.3_Intron|PTCH1_uc004avo.2_Intron|PTCH1_uc010mrv.1_Intron|PTCH1_uc010mrw.1_Intron	NM_000264	NP_000255			patched isoform L						embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity			skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)												Basal_Cell_Nevus_syndrome				---	---	---	---
C9orf130	100128782	broad.mit.edu	37	9	98579573	98579574	+	Intron	INS	-	CTTT	CTTT	rs147145247	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98579573_98579574insCTTT	uc004avp.3	-							NR_023390				Homo sapiens cDNA FLJ34818 fis, clone NT2NE2008077.												0																		---	---	---	---
C9orf102	375748	broad.mit.edu	37	9	98650468	98650468	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98650468delT	uc004avt.3	+						C9orf102_uc010mrx.1_Intron|C9orf102_uc011lum.1_Intron|C9orf102_uc010mry.1_Intron|C9orf102_uc010mrz.2_Intron	NM_001010895	NP_001010895			RAD26L hypothetical protein						DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding				0		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
Unknown	0	broad.mit.edu	37	9	100544948	100544948	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100544948delA								XPA (85257 upstream) : FOXE1 (70589 downstream)																																			---	---	---	---
GABBR2	9568	broad.mit.edu	37	9	101062311	101062312	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101062311_101062312insT	uc004ays.2	-							NM_005458	NP_005449			G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	101476242	101476243	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101476242_101476243insA								GABBR2 (5067 upstream) : ANKS6 (18049 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	102120634	102120634	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102120634delC	uc004azi.1	-						uc004azj.1_Intron|uc004azk.1_Intron|uc004azl.1_Intron|uc004azm.1_Intron|uc004azn.1_Intron|uc004azo.1_Intron|uc004azp.1_Intron|uc010msr.1_Intron|uc004azq.1_Intron					DQ673934																														---	---	---	---
LPPR1	54886	broad.mit.edu	37	9	103961565	103961565	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103961565delA	uc004bbb.2	+						LPPR1_uc011lvi.1_Intron|LPPR1_uc004bbc.2_Intron	NM_207299	NP_997182			plasticity related gene 3							integral to membrane	catalytic activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	105992495	105992495	+	Intron	DEL	T	-	-	rs34271180		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105992495delT	uc004bbt.2	-											Homo sapiens cDNA clone IMAGE:5266449.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	107146112	107146112	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107146112delA								SMC2 (242419 upstream) : OR13F1 (120432 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	108978501	108978502	+	Intron	INS	-	TG	TG	rs145909392	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108978501_108978502insTG	uc004bcw.2	+											Homo sapiens, clone IMAGE:5538960, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	109570050	109570051	+	IGR	INS	-	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109570050_109570051insC								None (None upstream) : ZNF462 (55327 downstream)																																			---	---	---	---
ZNF462	58499	broad.mit.edu	37	9	109694520	109694521	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109694520_109694521delTG	uc004bcz.2	+						ZNF462_uc010mto.2_Intron|ZNF462_uc004bda.2_Intron|ZNF462_uc011lvz.1_5'Flank	NM_021224	NP_067047			zinc finger protein 462						transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	110105944	110105944	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110105944delT								RAD23B (11475 upstream) : KLF4 (141191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	110418216	110418216	+	IGR	DEL	A	-	-	rs10978967	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110418216delA								KLF4 (166169 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	111603524	111603524	+	IGR	DEL	T	-	-	rs112173631		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111603524delT								None (None upstream) : ACTL7B (13347 downstream)																																			---	---	---	---
C9orf5	23731	broad.mit.edu	37	9	111883254	111883254	+	5'Flank	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111883254delA	uc004bdt.3	-						C9orf5_uc004bdr.3_5'Flank	NM_032012	NP_114401			hypothetical protein LOC23731							integral to membrane				central_nervous_system(1)	1		Myeloproliferative disorder(63;0.204)		OV - Ovarian serous cystadenocarcinoma(323;3.08e-05)|STAD - Stomach adenocarcinoma(157;0.0823)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	112307241	112307241	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112307241delC								PTPN3 (46648 upstream) : PALM2 (95831 downstream)																																			---	---	---	---
PALM2	114299	broad.mit.edu	37	9	112526615	112526615	+	Intron	DEL	A	-	-	rs146036261		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112526615delA	uc004beg.2	+						PALM2_uc004bef.2_Intron	NM_001037293	NP_001032370			paralemmin 2 isoform b						regulation of cell shape	plasma membrane				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	113345249	113345250	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113345249_113345250insA								SVEP1 (3089 upstream) : MUSK (85837 downstream)																																			---	---	---	---
KIAA0368	23392	broad.mit.edu	37	9	114127568	114127569	+	Intron	INS	-	ATC	ATC	rs143492409	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114127568_114127569insATC	uc004bfe.1	-							NM_001080398	NP_001073867			KIAA0368 protein												0																		---	---	---	---
ZNF883	169834	broad.mit.edu	37	9	115765861	115765861	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115765861delA	uc011lwy.1	-							NM_001101338	NP_001094808			hypothetical protein LOC169834						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
FKBP15	23307	broad.mit.edu	37	9	116003617	116003617	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116003617delT	uc010muu.1	-						SLC31A1_uc004bgu.2_Intron|SLC31A1_uc004bgv.3_Intron	NM_015258	NP_056073			FK506 binding protein 15, 133kDa						endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	116431293	116431300	+	IGR	DEL	CTCTCTCT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116431293_116431300delCTCTCTCT								RGS3 (71276 upstream) : ZNF618 (207262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	118732272	118732272	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118732272delA								C9orf27 (44895 upstream) : PAPPA (183799 downstream)																																			---	---	---	---
PAPPA	5069	broad.mit.edu	37	9	119106460	119106461	+	Intron	INS	-	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119106460_119106461insG	uc004bjn.2	+						PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572			pregnancy-associated plasma protein A						cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	121198240	121198241	+	IGR	DEL	TT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121198240_121198241delTT								TLR4 (718476 upstream) : DBC1 (730667 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	121642354	121642355	+	IGR	DEL	AA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121642354_121642355delAA								None (None upstream) : DBC1 (286553 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	122405918	122405921	+	IGR	DEL	TGTT	-	-	rs34367454		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122405918_122405921delTGTT								DBC1 (274179 upstream) : MIR147 (601336 downstream)																																			---	---	---	---
TTLL11	158135	broad.mit.edu	37	9	124659669	124659669	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124659669delG	uc011lyl.1	-						TTLL11_uc004blr.2_Intron|uc004bls.1_Intron	NM_001139442	NP_001132914			tubulin tyrosine ligase-like family, member 11						protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0																		---	---	---	---
TTLL11	158135	broad.mit.edu	37	9	124679833	124679836	+	Intron	DEL	AAAG	-	-	rs59118421		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124679833_124679836delAAAG	uc011lyl.1	-						TTLL11_uc004blr.2_Intron|uc004bls.1_Intron	NM_001139442	NP_001132914			tubulin tyrosine ligase-like family, member 11						protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0																		---	---	---	---
PTGS1	5742	broad.mit.edu	37	9	125152240	125152240	+	Intron	DEL	A	-	-	rs10306173	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125152240delA	uc004bmg.1	+						PTGS1_uc011lys.1_Intron|PTGS1_uc010mwb.1_Intron|PTGS1_uc004bmf.1_Intron|PTGS1_uc004bmh.1_Intron|PTGS1_uc011lyt.1_Intron	NM_000962	NP_000953			prostaglandin-endoperoxide synthase 1 isoform 1						cyclooxygenase pathway|hormone biosynthetic process|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum membrane|Golgi apparatus|microsome|plasma membrane	heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity			ovary(1)|skin(1)	2					Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dipyrone(DB04817)|Etodolac(DB00749)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Mesalazine(DB00244)|Minoxidil(DB00350)|Nabumetone(DB00461)|Naproxen(DB00788)|Phenacetin(DB03783)|Piroxicam(DB00554)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Tolmetin(DB00500)													---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126647323	126647324	+	Intron	DEL	CA	-	-	rs112559172		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126647323_126647324delCA	uc004bnz.1	-						DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	126928098	126928101	+	IGR	DEL	AACA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126928098_126928101delAACA								LHX2 (132656 upstream) : NEK6 (91785 downstream)																																			---	---	---	---
PSMB7	5695	broad.mit.edu	37	9	127176890	127176891	+	Intron	INS	-	A	A	rs11418169		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127176890_127176891insA	uc004boj.2	-						PSMB7_uc010mwm.2_Intron	NM_002799	NP_002790			proteasome beta 7 subunit proprotein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0																		---	---	---	---
NR6A1	2649	broad.mit.edu	37	9	127474886	127474887	+	Intron	INS	-	A	A	rs5900623		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127474886_127474887insA	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591			nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
MAPKAP1	79109	broad.mit.edu	37	9	128264234	128264234	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128264234delC	uc004bpv.2	-						MAPKAP1_uc011lzt.1_Intron|MAPKAP1_uc010mwz.2_Intron|MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron	NM_001006617	NP_001006618			mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4																		---	---	---	---
LRSAM1	90678	broad.mit.edu	37	9	130253286	130253287	+	Intron	INS	-	A	A	rs72544370	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130253286_130253287insA	uc004brb.1	+						LRSAM1_uc010mxk.1_Intron|LRSAM1_uc004brc.1_Intron|LRSAM1_uc004brd.1_Intron|LRSAM1_uc004bre.1_Intron	NM_001005373	NP_001005373			leucine rich repeat and sterile alpha motif						negative regulation of endocytosis|non-lytic virus budding|protein autoubiquitination|protein catabolic process|protein polyubiquitination|protein transport|ubiquitin-dependent endocytosis	cytoplasm|extracellular region|membrane part	hormone activity|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
ZER1	10444	broad.mit.edu	37	9	131521452	131521452	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131521452delT	uc004bwa.1	-							NM_006336	NP_006327			zyg-11 homolog B (C. elegans)-like						ATP hydrolysis coupled proton transport|regulation of ubiquitin-protein ligase activity	Cul2-RING ubiquitin ligase complex|vacuolar proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism|ubiquitin-protein ligase activity			ovary(1)	1																		---	---	---	---
TBC1D13	54662	broad.mit.edu	37	9	131548499	131548500	+	5'Flank	INS	-	A	A	rs138335776	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131548499_131548500insA	uc010myj.2	+						TBC1D13_uc010myk.2_5'Flank|TBC1D13_uc010myl.2_5'Flank	NM_018201	NP_060671			TBC1 domain family, member 13							intracellular	Rab GTPase activator activity				0																		---	---	---	---
NCS1	23413	broad.mit.edu	37	9	132986840	132986841	+	Intron	INS	-	AA	AA	rs111868250		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132986840_132986841insAA	uc004bzi.2	+						NCS1_uc010myz.1_Intron	NM_014286	NP_055101			frequenin homolog isoform 1						negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	133405445	133405445	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133405445delT								ASS1 (28785 upstream) : LOC100272217 (47294 downstream)																																			---	---	---	---
FUBP3	8939	broad.mit.edu	37	9	133496714	133496714	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133496714delA	uc004bzr.1	+						FUBP3_uc010mzd.1_Intron|FUBP3_uc004bzs.1_Intron	NM_003934	NP_003925			far upstream element (FUSE) binding protein 3						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000279)														---	---	---	---
ABL1	25	broad.mit.edu	37	9	133686001	133686002	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133686001_133686002insA	uc004bzv.2	+							NM_007313	NP_009297			c-abl oncogene 1, receptor tyrosine kinase						actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	9	134440622	134440623	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134440622_134440623insT								UCK1 (33960 upstream) : RAPGEF1 (11535 downstream)																																			---	---	---	---
MED27	9442	broad.mit.edu	37	9	134737155	134737166	+	Intron	DEL	TTTTTTTTTTTT	-	-	rs71883749		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134737155_134737166delTTTTTTTTTTTT	uc004cbe.1	-						MED27_uc004cbf.1_Intron	NM_004269	NP_004260			mediator complex subunit 27						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleolus|transcription factor complex	protein binding|transcription coactivator activity			skin(1)	1		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)														---	---	---	---
NTNG2	84628	broad.mit.edu	37	9	135089082	135089082	+	Intron	DEL	T	-	-	rs34653212		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135089082delT	uc004cbh.2	+							NM_032536	NP_115925			netrin G2 precursor						axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)														---	---	---	---
C9orf96	169436	broad.mit.edu	37	9	136250363	136250363	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136250363delT	uc004cdk.2	+						C9orf96_uc004cdl.2_Intron	NM_153710	NP_714921			hypothetical protein LOC169436								ATP binding|protein kinase activity			stomach(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	136360637	136360638	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136360637_136360638delTG								SLC2A6 (16361 upstream) : TMEM8C (19121 downstream)																																			---	---	---	---
OLFM1	10439	broad.mit.edu	37	9	137983743	137983744	+	Intron	INS	-	CA	CA	rs138683501	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137983743_137983744insCA	uc010nar.2	+						OLFM1_uc004cfl.3_Intron|OLFM1_uc004cfk.3_Intron|OLFM1_uc004cfm.3_Intron	NM_014279	NP_055094			olfactomedin related ER localized protein						nervous system development	endoplasmic reticulum lumen	protein binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	138088587	138088588	+	IGR	INS	-	T	T	rs143935393	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138088587_138088588insT								OLFM1 (75556 upstream) : KIAA0649 (283060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	138404263	138404263	+	IGR	DEL	C	-	-	rs112803527		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138404263delC								MRPS2 (7745 upstream) : LCN1 (9023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	138410252	138410252	+	IGR	DEL	G	-	-	rs77601714		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138410252delG								MRPS2 (13734 upstream) : LCN1 (3034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	138482197	138482200	+	IGR	DEL	ATGA	-	-	rs143042198		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138482197_138482200delATGA								PAEP (23575 upstream) : GLT6D1 (33302 downstream)																																			---	---	---	---
EHMT1	79813	broad.mit.edu	37	9	140615465	140615476	+	Intron	DEL	GCGTCCTCGCCA	-	-	rs71387860	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140615465_140615476delGCGTCCTCGCCA	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033			euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)														---	---	---	---
CACNA1B	774	broad.mit.edu	37	9	140854037	140854037	+	Intron	DEL	A	-	-	rs72473027		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140854037delA	uc004cog.2	+						CACNA1B_uc011mfd.1_Intron	NM_000718	NP_000709			calcium channel, voltage-dependent, N type,						membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	137979	137979	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:137979delG								TUBB8 (42475 upstream) : ZMYND11 (42445 downstream)																																			---	---	---	---
WDR37	22884	broad.mit.edu	37	10	1153857	1153858	+	Intron	DEL	AT	-	-	rs149479963		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1153857_1153858delAT	uc001igf.1	+						WDR37_uc009xhm.1_Intron|WDR37_uc009xhn.1_Intron|WDR37_uc001igg.1_Intron	NM_014023	NP_054742			WD repeat domain 37												0		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	2097578	2097579	+	IGR	INS	-	T	T	rs150503909	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2097578_2097579insT								ADARB2 (317860 upstream) : None (None downstream)																																			---	---	---	---
ANKRD16	54522	broad.mit.edu	37	10	5928229	5928230	+	Intron	INS	-	TC	TC	rs147648093	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5928229_5928230insTC	uc010qat.1	-						ANKRD16_uc009xie.2_Intron|ANKRD16_uc009xif.2_Intron|ANKRD16_uc001iiq.2_Intron	NM_019046	NP_061919			ankyrin repeat domain 16 isoform a												0																		---	---	---	---
SFMBT2	57713	broad.mit.edu	37	10	7314279	7314279	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7314279delA	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051			Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	7740507	7740507	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7740507delT								ITIH5 (31573 upstream) : ITIH2 (4729 downstream)																																			---	---	---	---
TAF3	83860	broad.mit.edu	37	10	7978834	7978835	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7978834_7978835insT	uc010qbd.1	+							NM_031923	NP_114129			RNA polymerase II transcription factor TAFII140						maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	9284791	9284791	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9284791delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	9694269	9694269	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9694269delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	11939100	11939100	+	5'Flank	DEL	T	-	-	rs56298492		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11939100delT	uc001iky.1	-											Homo sapiens cDNA FLJ32141 fis, clone PLACE5000067.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	17312334	17312335	+	IGR	INS	-	T	T	rs112007902		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17312334_17312335insT								VIM (32742 upstream) : ST8SIA6 (50342 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	19743657	19743658	+	IGR	INS	-	CG	CG	rs58443737		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19743657_19743658insCG								ARL5B (776717 upstream) : PLXDC2 (361714 downstream)																																			---	---	---	---
DNAJC1	64215	broad.mit.edu	37	10	22060433	22060434	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22060433_22060434insT	uc001irc.2	-						DNAJC1_uc001ird.2_Intron	NM_022365	NP_071760			DnaJ (Hsp40) homolog, subfamily C, member 1						negative regulation of proteolysis|regulation of protein secretion|regulation of transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	ATPase activator activity|DNA binding|heat shock protein binding|unfolded protein binding			lung(1)	1		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	23652100	23652101	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23652100_23652101insA								C10orf67 (18328 upstream) : OTUD1 (76097 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	25071560	25071561	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25071560_25071561insT								ARHGAP21 (58963 upstream) : PRTFDC1 (65993 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	26153016	26153016	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26153016delA								GPR158 (261861 upstream) : MYO3A (69986 downstream)																																			---	---	---	---
MYO3A	53904	broad.mit.edu	37	10	26471618	26471619	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26471618_26471619insA	uc001isn.2	+						MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129			myosin IIIA						protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	26683236	26683237	+	IGR	INS	-	GAAG	GAAG	rs150877575	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26683236_26683237insGAAG								GAD2 (89745 upstream) : APBB1IP (44029 downstream)																																			---	---	---	---
PDSS1	23590	broad.mit.edu	37	10	26992272	26992273	+	Intron	DEL	TA	-	-	rs138742646		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26992272_26992273delTA	uc001isv.2	+						PDSS1_uc001isw.2_Intron	NM_014317	NP_055132			prenyl diphosphate synthase, subunit 1						isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	metal ion binding|protein heterodimerization activity				0																		---	---	---	---
PDSS1	23590	broad.mit.edu	37	10	26995939	26995940	+	Intron	DEL	GT	-	-	rs150591798		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26995939_26995940delGT	uc001isv.2	+						PDSS1_uc001isw.2_Intron	NM_014317	NP_055132			prenyl diphosphate synthase, subunit 1						isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	metal ion binding|protein heterodimerization activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	27656455	27656455	+	IGR	DEL	T	-	-	rs138639943		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27656455delT								LOC387646 (115220 upstream) : PTCHD3 (30662 downstream)																																			---	---	---	---
MPP7	143098	broad.mit.edu	37	10	28511129	28511129	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28511129delA	uc001iua.1	-						MPP7_uc009xkz.1_Intron|MPP7_uc001iub.1_Intron|MPP7_uc009xla.2_Intron|MPP7_uc010qdv.1_Intron	NM_173496	NP_775767			palmitoylated membrane protein 7						establishment of cell polarity|positive regulation of protein complex assembly|protein localization to adherens junction|tight junction assembly	MPP7-DLG1-LIN7 complex|tight junction	protein complex scaffold|protein domain specific binding|protein heterodimerization activity|signaling adaptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	28635928	28635928	+	IGR	DEL	G	-	-	rs113868621		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28635928delG								MPP7 (43933 upstream) : WAC (185499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	28765561	28765562	+	IGR	INS	-	T	T	rs113451733		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28765561_28765562insT								MPP7 (173566 upstream) : WAC (55865 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	29461796	29461796	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29461796delT								BAMBI (489928 upstream) : LYZL1 (116194 downstream)																																			---	---	---	---
KIAA1462	57608	broad.mit.edu	37	10	30305328	30305331	+	3'UTR	DEL	AGGG	-	-	rs11292871	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30305328_30305331delAGGG	uc001iux.2	-	3					KIAA1462_uc001iuw.1_5'Flank|KIAA1462_uc001iuy.2_3'UTR|KIAA1462_uc001iuz.2_3'UTR	NM_020848	NP_065899			hypothetical protein LOC57608											ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	32681968	32681968	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32681968delT								EPC1 (14301 upstream) : CCDC7 (53073 downstream)																																			---	---	---	---
PARD3	56288	broad.mit.edu	37	10	35056529	35056532	+	Intron	DEL	TGTT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35056529_35056532delTGTT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565			partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	35115406	35115407	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35115406_35115407delAC								PARD3 (11483 upstream) : CUL2 (183401 downstream)																																			---	---	---	---
CCNY	219771	broad.mit.edu	37	10	35534763	35534764	+	5'Flank	INS	-	A	A	rs148151312	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35534763_35534764insA	uc001iyu.3	+							NM_181698	NP_859049			cyclin Y isoform 2						cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0																		---	---	---	---
CCNY	219771	broad.mit.edu	37	10	35563692	35563693	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35563692_35563693insT	uc001iyu.3	+						CCNY_uc001iyv.3_Intron	NM_181698	NP_859049			cyclin Y isoform 2						cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	36414367	36414367	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36414367delA								FZD8 (484005 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38235886	38235889	+	IGR	DEL	TTAT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38235886_38235889delTTAT								ZNF248 (88874 upstream) : ZNF25 (2906 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38562296	38562297	+	IGR	INS	-	CC	CC			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38562296_38562297insCC								LOC100129055 (59024 upstream) : HSD17B7P2 (83011 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38874740	38874741	+	IGR	INS	-	A	A	rs142944407		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38874740_38874741insA								LOC399744 (133660 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38878064	38878064	+	IGR	DEL	T	-	-	rs113921581		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38878064delT								LOC399744 (136984 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42657140	42657140	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42657140delT								None (None upstream) : LOC441666 (170175 downstream)																																			---	---	---	---
BMS1	9790	broad.mit.edu	37	10	43328704	43328705	+	3'UTR	INS	-	A	A	rs147817749	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43328704_43328705insA	uc001jaj.2	+	23						NM_014753	NP_055568			BMS1-like, ribosome assembly protein						ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	44225355	44225356	+	IGR	INS	-	GAA	GAA	rs145388101	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44225355_44225356insGAA								ZNF32 (81029 upstream) : HNRNPA3P1 (57504 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	46984519	46984520	+	IGR	INS	-	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46984519_46984520insC								SYT15 (13918 upstream) : GPRIN2 (9026 downstream)																																			---	---	---	---
ANXA8L2	244	broad.mit.edu	37	10	47745922	47745922	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47745922delT	uc001jem.2	+						ANXA8L2_uc009xnh.1_5'Flank|ANXA8L2_uc010qgb.1_5'Flank|ANXA8L2_uc001jen.2_5'Flank|ANXA8L2_uc001jeo.1_5'Flank	NM_001630	NP_001621			annexin A8L2								calcium ion binding|calcium-dependent phospholipid binding			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	49877122	49877125	+	IGR	DEL	GTGA	-	-	rs147602308		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49877122_49877125delGTGA								ARHGAP22 (12812 upstream) : WDFY4 (15796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	50917991	50917992	+	IGR	INS	-	TG	TG	rs147584592	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50917991_50917992insTG								C10orf53 (1035 upstream) : OGDHL (24696 downstream)																																			---	---	---	---
PARG	8505	broad.mit.edu	37	10	51365763	51365763	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51365763delT	uc001jif.2	-						PARG_uc001jih.2_Intron|PARG_uc001jig.2_Intron|PARG_uc010qgv.1_Intron|PARG_uc009xoi.2_Intron|PARG_uc010qgw.1_Intron|PARG_uc009xoj.2_Intron|PARG_uc010qgx.1_Intron|AGAP8_uc001jik.2_Intron|PARG_uc010qgz.1_Intron	NM_003631	NP_003622			poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)														---	---	---	---
A1CF	29974	broad.mit.edu	37	10	52628894	52628894	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52628894delA	uc001jjj.2	-						A1CF_uc001jji.2_Intron|A1CF_uc001jjh.2_Intron|A1CF_uc010qho.1_Intron|A1CF_uc009xov.2_Intron|A1CF_uc001jjk.1_Intron	NM_138932	NP_620310			apobec-1 complementation factor isoform 2						cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1																		---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53167072	53167073	+	Intron	INS	-	TA	TA	rs149471637	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53167072_53167073insTA	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	54418878	54418879	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54418878_54418879delTG								DKK1 (341462 upstream) : MBL2 (106262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	55000882	55000883	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55000882_55000883delAC								MBL2 (469422 upstream) : PCDH15 (561652 downstream)																																			---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	57298716	57298716	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57298716delT	uc001jjv.1	-							NM_001142770	NP_001136242			protocadherin 15 isoform CD2-2 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
Unknown	0	broad.mit.edu	37	10	57990660	57990661	+	IGR	DEL	AA	-	-	rs35889375		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57990660_57990661delAA								PCDH15 (602958 upstream) : ZWINT (126538 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58396656	58396656	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58396656delT								ZWINT (275622 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58908431	58908431	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58908431delA								ZWINT (787397 upstream) : None (None downstream)																																			---	---	---	---
CCDC6	8030	broad.mit.edu	37	10	61592903	61592903	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61592903delA	uc001jks.3	-							NM_005436	NP_005427			coiled-coil domain containing 6							cytoplasm|cytoskeleton	SH3 domain binding|structural constituent of cytoskeleton			ovary(3)|breast(1)	4				Kidney(211;0.0597)														---	---	---	---
ANK3	288	broad.mit.edu	37	10	62138641	62138642	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62138641_62138642insA	uc001jky.2	-						ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron	NM_020987	NP_066267			ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19																		---	---	---	---
CDK1	983	broad.mit.edu	37	10	62539146	62539146	+	Intron	DEL	T	-	-	rs113107747		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62539146delT	uc001jld.2	+						CDK1_uc010qii.1_Intron|CDK1_uc001jle.2_Intron|CDK1_uc001jlf.2_Intron|CDK1_uc001jlg.2_5'Flank	NM_001786	NP_001777			cell division cycle 2 isoform 1						activation of MAPK activity|activation of MAPKK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|axon guidance|cell division|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|mitosis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein localization to kinetochore|Ras protein signal transduction|regulation of transcription involved in G1/S phase of mitotic cell cycle|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|midbody|nucleoplasm|spindle microtubule	ATP binding|cyclin-dependent protein kinase activity|RNA polymerase II carboxy-terminal domain kinase activity			ovary(1)	1																		---	---	---	---
ZNF365	22891	broad.mit.edu	37	10	64141249	64141249	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64141249delT	uc001jmc.2	+						ZNF365_uc001jly.3_Intron|ZNF365_uc001jmb.3_Intron|ZNF365_uc001jlz.3_Intron|ZNF365_uc001jma.3_Intron	NM_199451	NP_955523			zinc finger protein 365 isoform C											ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	65412731	65412732	+	IGR	INS	-	ACAC	ACAC			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65412731_65412732insACAC								REEP3 (30760 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	66371858	66371858	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66371858delA								REEP3 (989887 upstream) : ANXA2P3 (213427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	67520993	67520993	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67520993delG								ANXA2P3 (934359 upstream) : CTNNA3 (158732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	67537735	67537736	+	IGR	DEL	AC	-	-	rs144365878		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67537735_67537736delAC								ANXA2P3 (951101 upstream) : CTNNA3 (141989 downstream)																																			---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68120482	68120485	+	Intron	DEL	CTTT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68120482_68120485delCTTT	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68214389	68214389	+	Intron	DEL	A	-	-	rs35229070		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68214389delA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68259564	68259565	+	Intron	INS	-	T	T	rs34040723		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68259564_68259565insT	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68884201	68884202	+	Intron	INS	-	A	A	rs151267060	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68884201_68884202insA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68952831	68952831	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68952831delA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|CTNNA3_uc001jna.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	69145595	69145595	+	Intron	DEL	A	-	-	rs78081822		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69145595delA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|CTNNA3_uc001jna.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	69295574	69295575	+	Intron	INS	-	AAA	AAA	rs148002126	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69295574_69295575insAAA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|CTNNA3_uc001jna.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
HKDC1	80201	broad.mit.edu	37	10	71012730	71012731	+	Intron	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71012730_71012731delGT	uc001jpf.3	+						HKDC1_uc010qje.1_Intron	NM_025130	NP_079406			hexokinase domain containing 1						glycolysis	mitochondrion|nucleus	ATP binding|hexokinase activity			ovary(4)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	71356704	71356704	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71356704delT								NEUROG3 (23582 upstream) : C10orf35 (33299 downstream)																																			---	---	---	---
CDH23	64072	broad.mit.edu	37	10	73284855	73284856	+	Intron	INS	-	GGT	GGT	rs150085641	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73284855_73284856insGGT	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc001jrv.2_Intron|CDH23_uc009xql.2_Intron	NM_022124	NP_071407			cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11																		---	---	---	---
CCDC109A	90550	broad.mit.edu	37	10	74617000	74617000	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74617000delC	uc001jtc.2	+						CCDC109A_uc009xqp.1_Intron|CCDC109A_uc009xqq.1_Intron|CCDC109A_uc010qjy.1_Intron|CCDC109A_uc009xqr.2_Intron|CCDC109A_uc001jtd.2_Intron	NM_138357	NP_612366			coiled-coil domain containing 109A						elevation of mitochondrial calcium ion concentration|mitochondrial calcium ion transport|protein complex oligomerization	integral to membrane|mitochondrial inner membrane	protein binding				0	Prostate(51;0.0198)																	---	---	---	---
P4HA1	5033	broad.mit.edu	37	10	74813674	74813675	+	Intron	INS	-	T	T	rs112306423		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74813674_74813675insT	uc010qka.1	-						P4HA1_uc001jtg.2_Intron|P4HA1_uc001jth.2_Intron|P4HA1_uc010qkb.1_Intron|P4HA1_uc001jti.2_Intron	NM_001142595	NP_001136067			prolyl 4-hydroxylase, alpha I subunit isoform 2							endoplasmic reticulum lumen|mitochondrion	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity			ovary(1)	1	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)													---	---	---	---
PPP3CB	5532	broad.mit.edu	37	10	75214480	75214481	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75214480_75214481insA	uc001jue.2	-						PPP3CB_uc001juf.2_Intron|PPP3CB_uc001jug.2_Intron|PPP3CB_uc001jui.2_Intron|PPP3CB_uc001juh.2_Intron|PPP3CB_uc010qkj.1_Intron	NM_021132	NP_066955			protein phosphatase 3, catalytic subunit, beta											skin(1)	1	Prostate(51;0.0119)																	---	---	---	---
VCL	7414	broad.mit.edu	37	10	75878915	75878916	+	3'UTR	INS	-	TA	TA	rs140231791	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75878915_75878916insTA	uc001jwd.2	+	22					VCL_uc009xrr.2_3'UTR|VCL_uc001jwe.2_3'UTR|VCL_uc010qkz.1_3'UTR	NM_014000	NP_054706			vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)																	---	---	---	---
ADK	132	broad.mit.edu	37	10	76170119	76170120	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76170119_76170120insT	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_Intron|ADK_uc010qlc.1_Intron	NM_006721	NP_006712			adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	77404747	77404747	+	IGR	DEL	T	-	-	rs67257151		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77404747delT								MIR606 (92436 upstream) : C10orf11 (137772 downstream)																																			---	---	---	---
DYDC1	143241	broad.mit.edu	37	10	82114852	82114853	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82114852_82114853insA	uc001kbx.2	-						DYDC1_uc001kby.1_Intron|DYDC1_uc009xsr.1_Intron|DYDC2_uc001kbz.1_Intron|DYDC2_uc001kca.1_Intron|DYDC2_uc001kcb.1_5'Flank	NM_138812	NP_620167			DPY30 domain containing 1												0			Colorectal(32;0.229)															---	---	---	---
SH2D4B	387694	broad.mit.edu	37	10	82348756	82348757	+	Intron	INS	-	TTT	TTT	rs72407297		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82348756_82348757insTTT	uc001kck.1	+						SH2D4B_uc001kcl.1_Intron	NM_207372	NP_997255			SH2 domain containing 4B isoform 1												0			Colorectal(32;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	85286117	85286132	+	IGR	DEL	GGGAGCTCATGCTAGG	-	-	rs111901135		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85286117_85286132delGGGAGCTCATGCTAGG								NRG3 (539182 upstream) : GHITM (613053 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	87061342	87061343	+	IGR	INS	-	GT	GT	rs138786611	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87061342_87061343insGT								FAM190B (783066 upstream) : GRID1 (297969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	87110893	87110893	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87110893delT								FAM190B (832617 upstream) : GRID1 (248419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	88179722	88179723	+	IGR	INS	-	G	G	rs141013462	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88179722_88179723insG								GRID1 (53472 upstream) : WAPAL (15291 downstream)																																			---	---	---	---
WAPAL	23063	broad.mit.edu	37	10	88244260	88244261	+	Intron	DEL	GC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88244260_88244261delGC	uc001kdo.2	-						WAPAL_uc001kdn.2_Intron|WAPAL_uc009xsw.2_Intron	NM_015045	NP_055860			wings apart-like homolog						cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	89616687	89616688	+	IGR	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89616687_89616688delGT								CFLP1 (11322 upstream) : KILLIN (2231 downstream)																																			---	---	---	---
RNLS	55328	broad.mit.edu	37	10	90319419	90319420	+	Intron	INS	-	TCATTCAT	TCATTCAT	rs148058049	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90319419_90319420insTCATTCAT	uc001kfe.2	-						RNLS_uc010qms.1_Intron|RNLS_uc001kfd.2_Intron	NM_001031709	NP_001026879			renalase isoform 1							extracellular region	oxidoreductase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	90782567	90782576	+	IGR	DEL	AGAGGATGAT	-	-	rs72369186		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90782567_90782576delAGAGGATGAT								FAS (7026 upstream) : CH25H (183120 downstream)																																			---	---	---	---
PCGF5	84333	broad.mit.edu	37	10	92926597	92926598	+	Intron	DEL	TA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92926597_92926598delTA	uc001khh.2	+						PCGF5_uc001khg.2_Intron	NM_032373	NP_115749			polycomb group ring finger 5						regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|PcG protein complex	zinc ion binding			lung(1)	1																		---	---	---	---
LOC100188947	100188947	broad.mit.edu	37	10	93075275	93075275	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93075275delA	uc010qnl.1	-							NR_024467				Homo sapiens, clone IMAGE:6063621, mRNA.												0																		---	---	---	---
CPEB3	22849	broad.mit.edu	37	10	93836592	93836595	+	Intron	DEL	GAAA	-	-	rs111227026		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93836592_93836595delGAAA	uc001khw.1	-						CPEB3_uc001khu.1_Intron|CPEB3_uc001khv.1_Intron|CPEB3_uc010qnn.1_Intron	NM_014912	NP_055727			cytoplasmic polyadenylation element binding								nucleotide binding|RNA binding				0		Colorectal(252;0.0869)																---	---	---	---
IDE	3416	broad.mit.edu	37	10	94233382	94233382	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94233382delA	uc001kia.2	-						IDE_uc010qnp.1_Intron|IDE_uc001khz.2_Intron	NM_004969	NP_004960			insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	94483873	94483873	+	IGR	DEL	A	-	-	rs111930008		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94483873delA								HHEX (28467 upstream) : EXOC6 (107062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	99568144	99568147	+	IGR	DEL	CTCT	-	-	rs151000829		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99568144_99568147delCTCT								SFRP5 (36388 upstream) : GOLGA7B (41849 downstream)																																			---	---	---	---
C10orf26	54838	broad.mit.edu	37	10	104508014	104508015	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104508014_104508015insA	uc001kwf.3	+						C10orf26_uc009xxg.1_Intron	NM_001083913	NP_001077382			hypothetical protein LOC54838 isoform 1							integral to membrane				central_nervous_system(1)	1		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;6.14e-09)|all cancers(201;1.66e-07)|BRCA - Breast invasive adenocarcinoma(275;0.224)														---	---	---	---
CNNM2	54805	broad.mit.edu	37	10	104693765	104693765	+	Intron	DEL	T	-	-	rs67700319		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104693765delT	uc001kwm.2	+						CNNM2_uc001kwn.2_Intron	NM_017649	NP_060119			cyclin M2 isoform 1						ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)														---	---	---	---
COL17A1	1308	broad.mit.edu	37	10	105795574	105795575	+	Intron	INS	-	TA	TA			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105795574_105795575insTA	uc001kxr.2	-							NM_000494	NP_000485			alpha 1 type XVII collagen						cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)														---	---	---	---
C10orf79	80217	broad.mit.edu	37	10	105915340	105915340	+	Intron	DEL	A	-	-	rs703336	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105915340delA	uc001kxw.2	-						C10orf79_uc009xxq.2_Intron	NM_025145	NP_079421			hypothetical protein LOC80217												0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)														---	---	---	---
SORCS3	22986	broad.mit.edu	37	10	106575428	106575428	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106575428delC	uc001kyi.1	+							NM_014978	NP_055793			VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)														---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108623283	108623283	+	Intron	DEL	A	-	-	rs5787691		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108623283delA	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	112247783	112247783	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112247783delT								SMNDC1 (183076 upstream) : DUSP5 (9842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	112998213	112998213	+	IGR	DEL	C	-	-	rs78756954		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112998213delC								ADRA2A (157553 upstream) : GPAM (911409 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	113149286	113149286	+	IGR	DEL	G	-	-	rs34403602		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113149286delG								ADRA2A (308626 upstream) : GPAM (760336 downstream)																																			---	---	---	---
VTI1A	143187	broad.mit.edu	37	10	114543161	114543162	+	Intron	DEL	CA	-	-	rs34185723		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114543161_114543162delCA	uc001kzz.2	+							NM_145206	NP_660207			SNARE Vti1a-beta protein						intracellular protein transport|retrograde transport, endosome to Golgi	SNARE complex	protein transporter activity|SNAP receptor activity			ovary(1)	1		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	117717875	117717875	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117717875delG								ATRNL1 (9381 upstream) : GFRA1 (98569 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	119187692	119187692	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119187692delA								PDZD8 (52755 upstream) : EMX2OS (56113 downstream)																																			---	---	---	---
NANOS1	340719	broad.mit.edu	37	10	120787781	120787782	+	5'Flank	INS	-	A	A	rs72312094		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120787781_120787782insA	uc009xzf.1	+							NM_199461	NP_955631			nanos homolog 1						epithelial cell migration	perinuclear region of cytoplasm	protein binding|RNA binding|translation repressor activity|zinc ion binding				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0193)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	121880369	121880370	+	IGR	INS	-	T	T	rs141469098	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121880369_121880370insT								SEC23IP (179124 upstream) : PPAPDC1A (336096 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122917585	122917586	+	IGR	INS	-	A	A	rs75182991		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122917585_122917586insA								WDR11 (248550 upstream) : FGFR2 (320259 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122945325	122945325	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122945325delA								WDR11 (276290 upstream) : FGFR2 (292520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	123173225	123173226	+	IGR	DEL	TA	-	-	rs57962160		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123173225_123173226delTA								WDR11 (504190 upstream) : FGFR2 (64619 downstream)																																			---	---	---	---
CPXM2	119587	broad.mit.edu	37	10	125531488	125531488	+	Intron	DEL	G	-	-	rs35116782		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125531488delG	uc001lhk.1	-						CPXM2_uc001lhj.2_Intron	NM_198148	NP_937791			carboxypeptidase X (M14 family), member 2						cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	126002130	126002131	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126002130_126002131delAC								CHST15 (148924 upstream) : OAT (83741 downstream)																																			---	---	---	---
FAM175B	23172	broad.mit.edu	37	10	126499158	126499159	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126499158_126499159insT	uc001lib.3	+							NM_032182	NP_115558			hypothetical protein LOC23172							BRISC complex	polyubiquitin binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	126543392	126543393	+	IGR	INS	-	T	T	rs113912607		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126543392_126543393insT								FAM175B (18154 upstream) : ZRANB1 (85579 downstream)																																			---	---	---	---
CTBP2	1488	broad.mit.edu	37	10	126722029	126722029	+	Intron	DEL	T	-	-	rs3837350		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126722029delT	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron|hsa-mir-4296|MI0015823_5'Flank	NM_001329	NP_001320			C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)														---	---	---	---
ADAM12	8038	broad.mit.edu	37	10	127940096	127940107	+	Intron	DEL	GGATGGATAGAT	-	-	rs148035377	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127940096_127940107delGGATGGATAGAT	uc001ljk.2	-						ADAM12_uc010qul.1_Intron|ADAM12_uc001ljm.2_Intron|ADAM12_uc001ljn.2_Intron|ADAM12_uc001ljl.3_Intron	NM_003474	NP_003465			ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	128505249	128505249	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128505249delT								C10orf90 (146170 upstream) : DOCK1 (88774 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	129279393	129279394	+	IGR	INS	-	C	C	rs68020730		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129279393_129279394insC								DOCK1 (28612 upstream) : NPS (68219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	129356159	129356160	+	IGR	INS	-	C	C	rs72513986	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129356159_129356160insC								NPS (5224 upstream) : FOXI2 (179378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	130941891	130941892	+	IGR	INS	-	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130941891_130941892insC								None (None upstream) : MGMT (323562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132844695	132844696	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132844695_132844696delCA								GLRX3 (861911 upstream) : TCERG1L (45960 downstream)																																			---	---	---	---
TCERG1L	256536	broad.mit.edu	37	10	133100593	133100594	+	Intron	INS	-	T	T	rs146038095	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133100593_133100594insT	uc001lkp.2	-							NM_174937	NP_777597			transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	133290713	133290714	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133290713_133290714delTG								TCERG1L (180729 upstream) : PPP2R2D (457246 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133549064	133549064	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133549064delA								TCERG1L (439080 upstream) : PPP2R2D (198896 downstream)																																			---	---	---	---
FRG2B	441581	broad.mit.edu	37	10	135441079	135441080	+	5'Flank	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135441079_135441080insT	uc010qvg.1	-							NM_001080998	NP_001074467			FSHD region gene 2 family, member B							nucleus					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	135449419	135449420	+	IGR	INS	-	TA	TA			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135449419_135449420insTA								FRG2B (9120 upstream) : LOC653544 (40859 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	333748	333749	+	IGR	INS	-	CC	CC			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:333748_333749insCC								IFITM3 (12834 upstream) : B4GALNT4 (36046 downstream)																																			---	---	---	---
PTDSS2	81490	broad.mit.edu	37	11	475112	475113	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:475112_475113delTG	uc001lpj.2	+						PTDSS2_uc009ybv.1_Intron	NM_030783	NP_110410			phosphatidylserine synthase 2							integral to membrane					0		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;2.76e-26)|Epithelial(43;2.56e-25)|OV - Ovarian serous cystadenocarcinoma(40;7.54e-20)|BRCA - Breast invasive adenocarcinoma(625;8.76e-05)|Lung(200;0.0407)|LUSC - Lung squamous cell carcinoma(625;0.0735)	Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	1070092	1070099	+	IGR	DEL	CCACTCAC	-	-	rs142840922	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1070092_1070099delCCACTCAC								MUC6 (33386 upstream) : MUC2 (4776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	1339522	1339523	+	IGR	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1339522_1339523delGT								TOLLIP (8683 upstream) : BRSK2 (71606 downstream)																																			---	---	---	---
NUP98	4928	broad.mit.edu	37	11	3711490	3711490	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3711490delT	uc001lyh.2	-						NUP98_uc001lyi.2_Intron|NUP98_uc001lyg.2_Intron	NM_016320	NP_057404			nucleoporin 98kD isoform 1						carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)				T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								---	---	---	---
OR52K2	119774	broad.mit.edu	37	11	4469170	4469170	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4469170delT	uc001lyz.1	+							NM_001005172	NP_001005172			olfactory receptor, family 52, subfamily K,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	4635252	4635252	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4635252delG								TRIM68 (5815 upstream) : OR51D1 (25769 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	6306447	6306450	+	IGR	DEL	TGTG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6306447_6306450delTGTG								CCKBR (13092 upstream) : PRKCDBP (33726 downstream)																																			---	---	---	---
RPL27A	6157	broad.mit.edu	37	11	8702004	8702005	+	5'Flank	INS	-	G	G	rs146354873	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8702004_8702005insG	uc001mgs.3	+						uc001mgo.2_5'Flank	NM_000990	NP_000981			ribosomal protein L27a						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0				Epithelial(150;3.24e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	9624589	9624589	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9624589delA								WEE1 (13278 upstream) : SWAP70 (61039 downstream)																																			---	---	---	---
SBF2	81846	broad.mit.edu	37	11	10263105	10263105	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10263105delA	uc001mib.2	-							NM_030962	NP_112224			SET binding factor 2						myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)														---	---	---	---
MRVI1	10335	broad.mit.edu	37	11	10653738	10653738	+	Intron	DEL	T	-	-	rs72349102		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10653738delT	uc010rcc.1	-						MRVI1_uc001miw.2_Intron|MRVI1_uc010rcb.1_Intron|MRVI1_uc009ygb.1_Intron|MRVI1_uc001mix.2_Intron|MRVI1_uc001miz.2_Intron|MRVI1_uc009ygc.1_Intron|MRVI1_uc010rcd.1_Intron|MRVI1_uc009ygd.1_Intron|MRVI1_uc010rce.1_Intron	NM_001100167	NP_001093637			JAW1-related protein isoform c						platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	11095413	11095417	+	IGR	DEL	TTTCA	-	-	rs76834037		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11095413_11095417delTTTCA								ZBED5 (215793 upstream) : GALNTL4 (197004 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	11117807	11117808	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11117807_11117808delTG								ZBED5 (238187 upstream) : GALNTL4 (174613 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	11132446	11132446	+	IGR	DEL	T	-	-	rs111229764		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11132446delT								ZBED5 (252826 upstream) : GALNTL4 (159975 downstream)																																			---	---	---	---
PARVA	55742	broad.mit.edu	37	11	12426404	12426404	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12426404delG	uc001mki.2	+						PARVA_uc001mkh.2_Intron|PARVA_uc010rck.1_Intron	NM_018222	NP_060692			parvin, alpha						cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)														---	---	---	---
PARVA	55742	broad.mit.edu	37	11	12505514	12505514	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12505514delC	uc001mki.2	+						PARVA_uc010rck.1_Intron	NM_018222	NP_060692			parvin, alpha						cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	12686501	12686502	+	IGR	INS	-	A	A	rs146986036	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12686501_12686502insA								PARVA (135091 upstream) : TEAD1 (9467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	13631240	13631241	+	IGR	INS	-	AC	AC	rs150799261	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13631240_13631241insAC								PTH (113673 upstream) : FAR1 (58965 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	13791667	13791667	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13791667delA								FAR1 (37776 upstream) : SPON1 (192247 downstream)																																			---	---	---	---
PDE3B	5140	broad.mit.edu	37	11	14876894	14876895	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14876894_14876895insA	uc001mln.2	+						PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913			phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	15935257	15935258	+	IGR	DEL	CA	-	-	rs111378170	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15935257_15935258delCA								INSC (666505 upstream) : SOX6 (52738 downstream)																																			---	---	---	---
ABCC8	6833	broad.mit.edu	37	11	17493292	17493293	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17493292_17493293delAC	uc001mnc.2	-						ABCC8_uc010rcy.1_Intron	NM_000352	NP_000343			ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)													---	---	---	---
SERGEF	26297	broad.mit.edu	37	11	17940173	17940174	+	Intron	DEL	AC	-	-	rs34623550		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17940173_17940174delAC	uc001mnm.2	-						SERGEF_uc009yhd.2_Intron|SERGEF_uc001mnn.2_Intron|SERGEF_uc010rcz.1_Intron	NM_012139	NP_036271			deafness locus associated putative guanine						negative regulation of protein secretion|signal transduction	cytoplasm|nucleus	protein binding|Ran guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1																		---	---	---	---
HPS5	11234	broad.mit.edu	37	11	18308457	18308458	+	Intron	INS	-	A	A	rs114860794		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18308457_18308458insA	uc001mod.1	-						HPS5_uc001moe.1_Intron|HPS5_uc001mof.1_Intron	NM_181507	NP_852608			Hermansky-Pudlak syndrome 5 isoform a							cytosol				ovary(1)|pancreas(1)|skin(1)	3														Hermansky-Pudlak_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	11	20210778	20210778	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20210778delA								DBX1 (28908 upstream) : HTATIP2 (174453 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	20360951	20360952	+	IGR	INS	-	T	T	rs148053418	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20360951_20360952insT								DBX1 (179081 upstream) : HTATIP2 (24279 downstream)																																			---	---	---	---
SLC6A5	9152	broad.mit.edu	37	11	20656954	20656955	+	Intron	INS	-	T	T	rs34348153		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20656954_20656955insT	uc001mqd.2	+						SLC6A5_uc009yic.2_Intron	NM_004211	NP_004202			solute carrier family 6 (neurotransmitter						synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	22633741	22633741	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22633741delT								SLC17A6 (232697 upstream) : FANCF (10338 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	23846820	23846820	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:23846820delA								SVIP (995438 upstream) : LUZP2 (671736 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	24167309	24167309	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24167309delT								None (None upstream) : LUZP2 (351247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	24483667	24483667	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24483667delT								None (None upstream) : LUZP2 (34889 downstream)																																			---	---	---	---
LUZP2	338645	broad.mit.edu	37	11	24646892	24646892	+	Intron	DEL	A	-	-	rs113156322		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24646892delA	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909			leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2																		---	---	---	---
LUZP2	338645	broad.mit.edu	37	11	24792499	24792500	+	Intron	INS	-	A	A	rs139242910	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24792499_24792500insA	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909			leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	25787312	25787313	+	IGR	INS	-	T	T	rs142108132	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25787312_25787313insT								LUZP2 (683130 upstream) : ANO3 (423516 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	25799695	25799696	+	IGR	DEL	AC	-	-	rs140821211		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25799695_25799696delAC								LUZP2 (695513 upstream) : ANO3 (411133 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	26080384	26080384	+	IGR	DEL	T	-	-	rs143246387		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26080384delT								LUZP2 (976202 upstream) : ANO3 (130445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	26131267	26131268	+	IGR	INS	-	TGAA	TGAA	rs148199530	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26131267_26131268insTGAA								None (None upstream) : ANO3 (79561 downstream)																																			---	---	---	---
SLC5A12	159963	broad.mit.edu	37	11	26705575	26705576	+	Intron	INS	-	TG	TG	rs145705590	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26705575_26705576insTG	uc001mra.2	-						SLC5A12_uc001mrb.2_Intron	NM_178498	NP_848593			solute carrier family 5 (sodium/glucose						sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2																		---	---	---	---
LGR4	55366	broad.mit.edu	37	11	27435944	27435944	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27435944delA	uc001mrj.3	-						LGR4_uc001mrk.3_Intron	NM_018490	NP_060960			leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	28359623	28359623	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28359623delT								METT5D1 (4569 upstream) : None (None downstream)																																			---	---	---	---
ELP4	26610	broad.mit.edu	37	11	31621060	31621077	+	Intron	DEL	ACACACACACAAAAAAAA	-	-	rs71060494		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31621060_31621077delACACACACACAAAAAAAA	uc001mtb.2	+						ELP4_uc001mta.1_Intron|ELP4_uc001mtc.2_Intron|ELP4_uc010rdz.1_Intron	NM_019040	NP_061913			elongation protein 4 homolog						histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	32303264	32303266	+	IGR	DEL	CAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32303264_32303266delCAA								RCN1 (175993 upstream) : WT1 (106059 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	32348127	32348128	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32348127_32348128insT								RCN1 (220856 upstream) : WT1 (61197 downstream)																																			---	---	---	---
CCDC73	493860	broad.mit.edu	37	11	32761687	32761690	+	Intron	DEL	TTTC	-	-	rs112153577		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32761687_32761690delTTTC	uc001mtv.2	-						CCDC73_uc001mtw.1_Intron|CCDC73_uc009yjt.2_Intron	NM_001008391	NP_001008392			sarcoma antigen NY-SAR-79											ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	36822393	36822395	+	IGR	DEL	ACA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36822393_36822395delACA								C11orf74 (126003 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	37821156	37821156	+	IGR	DEL	A	-	-	rs11345568		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37821156delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	38838624	38838625	+	IGR	INS	-	CTTT	CTTT	rs145119024	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38838624_38838625insCTTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	39048262	39048262	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:39048262delA								None (None upstream) : None (None downstream)																																			---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40874612	40874612	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40874612delG	uc001mxc.1	-						LRRC4C_uc001mxd.1_Intron	NM_020929	NP_065980			netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	42010502	42010503	+	IGR	INS	-	AAG	AAG			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42010502_42010503insAAG								LRRC4C (529179 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	42311943	42311943	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42311943delT								LRRC4C (830620 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	42808014	42808014	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42808014delA								None (None upstream) : API5 (525491 downstream)																																			---	---	---	---
API5	8539	broad.mit.edu	37	11	43339539	43339540	+	Intron	INS	-	TTTG	TTTG	rs150179034	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43339539_43339540insTTTG	uc010rfh.1	+						API5_uc010rfg.1_Intron|API5_uc001mxf.2_Intron|API5_uc010rfi.1_Intron|API5_uc001mxg.2_5'Flank	NM_001142930	NP_001136402			apoptosis inhibitor 5 isoform a						anti-apoptosis|apoptosis	cytoplasm|spliceosomal complex	fibroblast growth factor binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3																		---	---	---	---
EXT2	2132	broad.mit.edu	37	11	44264859	44264859	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44264859delC	uc001mxz.2	+						EXT2_uc010rfo.1_Intron|EXT2_uc001mxy.2_Intron|EXT2_uc009ykt.2_Intron|EXT2_uc001mya.2_Intron	NM_207122	NP_997005			exostosin 2 isoform 2						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity			lung(2)|breast(2)|skin(1)	5								Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses				---	---	---	---
SLC39A13	91252	broad.mit.edu	37	11	47378844	47378844	+	Intron	DEL	C	-	-	rs11290095		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47378844delC	uc001nfd.2	+						SPI1_uc001nfb.1_Intron|SPI1_uc001nfc.1_Intron					RecName: Full=Zinc transporter ZIP13; AltName: Full=Zrt- and Irt-like protein 13;          Short=ZIP-13; AltName: Full=Solute carrier family 39 member 13; AltName: Full=LIV-1 subfamily of ZIP zinc transporter 9; AltName: Full=LZT-Hs9;						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity				0				Lung(87;0.0936)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	47884966	47884966	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47884966delA								NUP160 (14909 upstream) : PTPRJ (117144 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48341071	48341072	+	IGR	INS	-	GAA	GAA	rs66844251		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48341071_48341072insGAA								OR4S1 (12368 upstream) : OR4C3 (5421 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48380286	48380286	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48380286delA								OR4C45 (6287 upstream) : OR4A47 (130059 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48388859	48388860	+	IGR	INS	-	GT	GT	rs141279013	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48388859_48388860insGT								OR4C45 (14860 upstream) : OR4A47 (121485 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	54808335	54808336	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:54808335_54808336insT								None (None upstream) : TRIM48 (221322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	54943034	54943035	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:54943034_54943035insA								None (None upstream) : TRIM48 (86623 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	55712999	55713000	+	IGR	DEL	TG	-	-	rs72146471		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55712999_55713000delTG								OR5I1 (9123 upstream) : OR10AG1 (22035 downstream)																																			---	---	---	---
GLYAT	10249	broad.mit.edu	37	11	58496275	58496276	+	Intron	DEL	GA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58496275_58496276delGA	uc001nnb.2	-						GLYAT_uc001nnc.2_Intron	NM_201648	NP_964011			glycine-N-acyltransferase isoform a						acyl-CoA metabolic process|response to toxin|xenobiotic metabolic process	mitochondrial matrix	glycine N-acyltransferase activity|glycine N-benzoyltransferase activity				0		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	59455471	59455472	+	IGR	DEL	AC	-	-	rs33982501		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59455471_59455472delAC								PATL1 (18960 upstream) : OR10V1 (24917 downstream)																																			---	---	---	---
SLC15A3	51296	broad.mit.edu	37	11	60708362	60708362	+	Intron	DEL	G	-	-	rs5792207		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60708362delG	uc001nqn.2	-						SLC15A3_uc001nqo.2_Intron	NM_016582	NP_057666			solute carrier family 15, member 3						oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity				0																		---	---	---	---
CD5	921	broad.mit.edu	37	11	60869384	60869387	+	5'Flank	DEL	ACAC	-	-	rs35047661		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60869384_60869387delACAC	uc009ynk.2	+							NM_014207	NP_055022			CD5 molecule precursor						cell proliferation|cell recognition	integral to plasma membrane	scavenger receptor activity			ovary(1)	1		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)														---	---	---	---
STX5	6811	broad.mit.edu	37	11	62578633	62578633	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62578633delT	uc001nvh.2	-						STX5_uc010rmi.1_Intron|STX5_uc009yoh.2_Intron|STX5_uc001nvi.2_Intron|STX5_uc010rmj.1_Intron|STX5_uc001nvj.2_Intron	NM_003164	NP_003155			syntaxin 5						intracellular protein transport|retrograde transport, endosome to Golgi|vesicle targeting	ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|nucleus|SNARE complex	protein N-terminus binding|SNAP receptor activity			ovary(1)|breast(1)	2																		---	---	---	---
SLC3A2	6520	broad.mit.edu	37	11	62644535	62644536	+	Intron	INS	-	T	T	rs151312208		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62644535_62644536insT	uc001nwd.2	+						SLC3A2_uc001nwb.2_Intron|SLC3A2_uc001nwc.2_Intron|SLC3A2_uc001nwe.2_Intron|SLC3A2_uc001nwf.2_Intron	NM_002394	NP_002385			solute carrier family 3, member 2 isoform c						blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding				0																		---	---	---	---
SLC22A25	387601	broad.mit.edu	37	11	62991681	62991681	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62991681delT	uc001nwr.1	-						SLC22A10_uc010rmo.1_Intron|SLC22A25_uc009yoq.1_Intron|SLC22A25_uc001nws.1_Intron|SLC22A25_uc001nwt.1_Intron	NM_199352	NP_955384			putative UST1-like organic anion transporter						transmembrane transport	integral to membrane				ovary(3)|skin(1)	4																		---	---	---	---
NRXN2	9379	broad.mit.edu	37	11	64414680	64414681	+	Intron	DEL	TG	-	-	rs10535079		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64414680_64414681delTG	uc001oar.2	-						NRXN2_uc001oas.2_Intron|NRXN2_uc001oaq.2_Intron	NM_015080	NP_055895			neurexin 2 isoform alpha-1 precursor						cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10																		---	---	---	---
C11orf85	283129	broad.mit.edu	37	11	64736303	64736304	+	Intron	INS	-	A	A	rs75300437		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64736303_64736304insA	uc001ocd.1	-						C11orf85_uc001occ.1_Intron					SubName: Full=cDNA FLJ35811 fis, clone TESTI2006045;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	65140040	65140041	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65140040_65140041insA								TIGD3 (14960 upstream) : SLC25A45 (2622 downstream)																																			---	---	---	---
CHKA	1119	broad.mit.edu	37	11	67856174	67856174	+	Intron	DEL	A	-	-	rs34956463		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67856174delA	uc001onj.2	-						CHKA_uc001onk.2_Intron	NM_001277	NP_001268			choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	67903053	67903053	+	IGR	DEL	A	-	-	rs112828366		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67903053delA								CHKA (14195 upstream) : SUV420H1 (20454 downstream)																																			---	---	---	---
TPCN2	219931	broad.mit.edu	37	11	68927655	68927656	+	RNA	DEL	TT	-	-	rs138463124		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68927655_68927656delTT	uc001oot.2	+	15		c.2369_2370delTT				NM_139075				two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	68962130	68962132	+	IGR	DEL	TGG	-	-	rs111805683		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68962130_68962132delTGG								TPCN2 (32223 upstream) : MYEOV (99490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	68996521	68996523	+	IGR	DEL	AAC	-	-	rs146951630		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68996521_68996523delAAC								TPCN2 (66614 upstream) : MYEOV (65099 downstream)																																			---	---	---	---
PPFIA1	8500	broad.mit.edu	37	11	70148082	70148083	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70148082_70148083insT	uc001opo.2	+						PPFIA1_uc001opn.1_Intron|PPFIA1_uc001opp.2_Intron	NM_003626	NP_003617			PTPRF interacting protein alpha 1 isoform b						cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)															---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70587289	70587296	+	Intron	DEL	CATGCATT	-	-	rs111385717		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70587289_70587296delCATGCATT	uc001oqc.2	-							NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70620431	70620432	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70620431_70620432insT	uc001oqc.2	-							NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
FAM168A	23201	broad.mit.edu	37	11	73121137	73121137	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73121137delA	uc001otz.1	-						FAM168A_uc001oty.1_Intron|FAM168A_uc009ytp.1_Intron	NM_015159	NP_055974			hypothetical protein LOC23201												0																		---	---	---	---
SLCO2B1	11309	broad.mit.edu	37	11	74886662	74886665	+	Intron	DEL	TCTA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74886662_74886665delTCTA	uc001owb.2	+						SLCO2B1_uc010rrq.1_Intron|SLCO2B1_uc010rrr.1_Intron|SLCO2B1_uc010rrs.1_Intron|SLCO2B1_uc001owc.2_Intron|SLCO2B1_uc001owd.2_Intron	NM_007256	NP_009187			solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|breast(1)	2					Ergoloid mesylate(DB01049)													---	---	---	---
PAK1	5058	broad.mit.edu	37	11	77150618	77150618	+	Intron	DEL	A	-	-	rs34990278		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77150618delA	uc001oyh.3	-						PAK1_uc001oyg.3_Intron	NM_002576	NP_002567			p21-activated kinase 1 isoform 2						apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity			skin(2)|stomach(1)|lung(1)	4	all_cancers(14;1.75e-18)																	---	---	---	---
PAK1	5058	broad.mit.edu	37	11	77173529	77173529	+	Intron	DEL	T	-	-	rs112024629		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77173529delT	uc001oyh.3	-						PAK1_uc001oyg.3_Intron	NM_002576	NP_002567			p21-activated kinase 1 isoform 2						apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity			skin(2)|stomach(1)|lung(1)	4	all_cancers(14;1.75e-18)																	---	---	---	---
INTS4	92105	broad.mit.edu	37	11	77674267	77674268	+	Intron	INS	-	AG	AG			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77674267_77674268insAG	uc001oys.2	-						INTS4_uc001oyt.2_Intron|INTS4_uc001oyu.1_Intron	NM_033547	NP_291025			integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)															---	---	---	---
ODZ4	26011	broad.mit.edu	37	11	78472744	78472744	+	Intron	DEL	C	-	-	rs148997731		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78472744delC	uc001ozl.3	-							NM_001098816	NP_001092286			odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	79191951	79191952	+	IGR	INS	-	AC	AC	rs139982269	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79191951_79191952insAC								ODZ4 (40256 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	81473178	81473179	+	IGR	INS	-	CA	CA	rs144886834	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81473178_81473179insCA								None (None upstream) : FAM181B (969874 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	82169988	82169989	+	IGR	DEL	GT	-	-	rs1355972	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82169988_82169989delGT								None (None upstream) : FAM181B (273064 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	82271374	82271375	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82271374_82271375delCA								None (None upstream) : FAM181B (171678 downstream)																																			---	---	---	---
C11orf73	51501	broad.mit.edu	37	11	86036915	86036916	+	Intron	INS	-	A	A	rs147758229		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86036915_86036916insA	uc001pbu.2	+						C11orf73_uc001pbt.2_Intron|C11orf73_uc010rto.1_Intron|C11orf73_uc010rtp.1_Intron|C11orf73_uc001pbv.2_Intron	NM_016401	NP_057485			lethal, Chr 7, Rinchik 6							cytoplasm					0		Acute lymphoblastic leukemia(157;1.17e-07)|all_hematologic(158;0.000556)																---	---	---	---
ME3	10873	broad.mit.edu	37	11	86253023	86253023	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86253023delG	uc001pbz.2	-						ME3_uc001pca.2_Intron|ME3_uc009yvk.2_Intron|ME3_uc010rtr.1_Intron	NM_001014811	NP_001014811			mitochondrial malic enzyme 3 precursor						aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)													---	---	---	---
ME3	10873	broad.mit.edu	37	11	86347305	86347306	+	Intron	INS	-	T	T	rs34315700		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86347305_86347306insT	uc001pbz.2	-						ME3_uc001pca.2_Intron|ME3_uc009yvk.2_Intron|ME3_uc010rtr.1_Intron	NM_001014811	NP_001014811			mitochondrial malic enzyme 3 precursor						aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	86701695	86701696	+	Intron	INS	-	AC	AC	rs150032479	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86701695_86701696insAC	uc001pcf.2	+											Homo sapiens cDNA clone IMAGE:5303543.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	87305230	87305233	+	IGR	DEL	ACTT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87305230_87305233delACTT								TMEM135 (270662 upstream) : RAB38 (541198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	87940207	87940209	+	IGR	DEL	TAT	-	-	rs151132329		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87940207_87940209delTAT								RAB38 (31608 upstream) : CTSC (86552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	91088328	91088329	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91088328_91088329delTG								MIR1261 (485958 upstream) : FAT3 (996933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	94690770	94690770	+	IGR	DEL	T	-	-	rs11361590		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94690770delT								AMOTL1 (80853 upstream) : CWC15 (5019 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	96489078	96489078	+	IGR	DEL	C	-	-	rs5793812		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96489078delC								JRKL (362351 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	97360102	97360103	+	IGR	INS	-	G	G	rs71040195		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97360102_97360103insG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	98430298	98430298	+	IGR	DEL	T	-	-	rs71785956		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98430298delT								None (None upstream) : CNTN5 (461573 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	100531446	100531446	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100531446delT								CNTN5 (303974 upstream) : ARHGAP42 (26961 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	106294165	106294165	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106294165delT								AASDHPPT (324746 upstream) : GUCY1A2 (263745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	106295040	106295040	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106295040delT								AASDHPPT (325621 upstream) : GUCY1A2 (262870 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	106337885	106337886	+	IGR	INS	-	G	G	rs143524031	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106337885_106337886insG								AASDHPPT (368466 upstream) : GUCY1A2 (220024 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	107859127	107859127	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107859127delA								RAB39 (24921 upstream) : CUL5 (20281 downstream)																																			---	---	---	---
DDX10	1662	broad.mit.edu	37	11	108714888	108714888	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108714888delT	uc001pkm.2	+						DDX10_uc001pkl.1_Intron	NM_004398	NP_004389			DEAD (Asp-Glu-Ala-Asp) box polypeptide 10								ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity			breast(2)|lung(1)|prostate(1)	4		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)				T	NUP98	AML*								---	---	---	---
Unknown	0	broad.mit.edu	37	11	109069814	109069814	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109069814delA								DDX10 (258168 upstream) : C11orf87 (223061 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	110612310	110612311	+	IGR	INS	-	TG	TG	rs149980657	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110612310_110612311insTG								ARHGAP20 (28398 upstream) : C11orf53 (514396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	112240552	112240553	+	IGR	DEL	GA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112240552_112240553delGA								PTS (99875 upstream) : NCAM1 (591442 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	113821225	113821225	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113821225delC								HTR3B (3943 upstream) : HTR3A (24572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	115702253	115702263	+	IGR	DEL	CTGGACACTCA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115702253_115702263delCTGGACACTCA								CADM1 (327012 upstream) : BUD13 (916625 downstream)																																			---	---	---	---
DSCAML1	57453	broad.mit.edu	37	11	117316946	117316946	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117316946delG	uc001prh.1	-							NM_020693	NP_065744			Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	118145308	118145311	+	IGR	DEL	GTGT	-	-	rs71988015		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118145308_118145311delGTGT								MPZL2 (10299 upstream) : CD3E (29984 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	118162601	118162602	+	IGR	INS	-	C	C	rs142883495	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118162601_118162602insC								MPZL2 (27592 upstream) : CD3E (12693 downstream)																																			---	---	---	---
PVRL1	5818	broad.mit.edu	37	11	119587567	119587570	+	Intron	DEL	CGCA	-	-	rs59128946		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119587567_119587570delCGCA	uc001pwv.2	-						PVRL1_uc001pwu.1_Intron|PVRL1_uc001pww.2_Intron	NM_002855	NP_002846			poliovirus receptor-related 1 isoform 1						adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)														---	---	---	---
ARHGEF12	23365	broad.mit.edu	37	11	120250172	120250172	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120250172delC	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron	NM_015313	NP_056128			Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)				T	MLL	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	11	122349640	122349640	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122349640delG								LOC399959 (111173 upstream) : UBASH3B (176758 downstream)																																			---	---	---	---
ASAM	79827	broad.mit.edu	37	11	123018525	123018525	+	Intron	DEL	T	-	-	rs34811211		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123018525delT	uc001pyt.2	-							NM_024769	NP_079045			adipocyte-specific adhesion molecule precursor							integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	124731529	124731529	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124731529delA								C11orf61 (61230 upstream) : ROBO3 (3753 downstream)																																			---	---	---	---
CCDC15	80071	broad.mit.edu	37	11	124865733	124865735	+	Intron	DEL	TTT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124865733_124865735delTTT	uc001qbm.3	+							NM_025004	NP_079280			coiled-coil domain containing 15							centrosome				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)														---	---	---	---
CDON	50937	broad.mit.edu	37	11	125849641	125849641	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125849641delC	uc009zbw.2	-						CDON_uc001qdb.3_Intron|CDON_uc001qdc.3_Intron	NM_016952	NP_058648			surface glycoprotein, Ig superfamily member						cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	128111481	128111482	+	IGR	INS	-	T	T	rs72514227	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128111481_128111482insT								None (None upstream) : ETS1 (217174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	129162518	129162518	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129162518delA								ARHGAP32 (100425 upstream) : BARX2 (83363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	129168373	129168373	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129168373delA								ARHGAP32 (106280 upstream) : BARX2 (77508 downstream)																																			---	---	---	---
BARX2	8538	broad.mit.edu	37	11	129272220	129272220	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129272220delA	uc001qfc.3	+							NM_003658	NP_003649			BarH-like homeobox 2												0	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)														---	---	---	---
TMEM45B	120224	broad.mit.edu	37	11	129697431	129697432	+	Intron	INS	-	T	T	rs148765354	by1000genomes;by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129697431_129697432insT	uc001qfe.1	+							NM_138788	NP_620143			transmembrane protein 45B							integral to membrane					0	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	130368742	130368742	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130368742delT								ADAMTS15 (25027 upstream) : SNX19 (377025 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	130947184	130947185	+	IGR	INS	-	C	C	rs147347046	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130947184_130947185insC								SNX19 (160802 upstream) : NTM (293186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	130992588	130992588	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130992588delC								SNX19 (206206 upstream) : NTM (247783 downstream)																																			---	---	---	---
NTM	50863	broad.mit.edu	37	11	131885996	131885996	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131885996delT	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606			neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
NTM	50863	broad.mit.edu	37	11	132141277	132141278	+	Intron	DEL	AT	-	-	rs35097711		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132141277_132141278delAT	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron|NTM_uc001qgr.2_Intron	NM_016522	NP_057606			neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
OPCML	4978	broad.mit.edu	37	11	132828966	132828966	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132828966delA	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
OPCML	4978	broad.mit.edu	37	11	133357670	133357671	+	Intron	INS	-	TG	TG	rs142446450	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133357670_133357671insTG	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
B3GAT1	27087	broad.mit.edu	37	11	134256317	134256318	+	Intron	INS	-	AG	AG	rs144467310	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134256317_134256318insAG	uc001qhq.2	-						B3GAT1_uc001qhr.2_Intron|B3GAT1_uc010scv.1_Intron	NM_018644	NP_061114			beta-1,3-glucuronyltransferase 1						carbohydrate metabolic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)														---	---	---	---
RAD52	5893	broad.mit.edu	37	12	1046594	1046594	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1046594delT	uc001qis.1	-						RAD52_uc001qit.1_Intron|RAD52_uc010sdt.1_Intron|RAD52_uc001qiu.1_Intron|RAD52_uc001qiv.1_Intron|RAD52_uc001qiw.1_Intron|RAD52_uc010sdu.1_Intron	NM_134424	NP_602296			RAD52 homolog						DNA recombinase assembly|mitotic recombination|reciprocal meiotic recombination	nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)										Homologous_recombination					---	---	---	---
WNT5B	81029	broad.mit.edu	37	12	1729711	1729711	+	Intron	DEL	T	-	-	rs111366537		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1729711delT	uc009zdq.2	+						WNT5B_uc001qjj.2_Intron	NM_032642	NP_116031			wingless-type MMTV integration site family,						angiogenesis|anterior/posterior pattern formation|cell migration involved in gastrulation|cellular response to retinoic acid|chondrocyte differentiation|convergent extension involved in axis elongation|convergent extension involved in gastrulation|dorsal/ventral axis specification|endocrine pancreas development|fat cell differentiation|lens fiber cell development|negative regulation of canonical Wnt receptor signaling pathway|neuron differentiation|positive regulation of cell migration|positive regulation of fat cell differentiation|respiratory system development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)															---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2626667	2626667	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2626667delA	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc009zdy.1_Intron|CACNA1C_uc001qkv.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	3160356	3160378	+	IGR	DEL	CCTCCCTCCCTCCTTCCCTCCTT	-	-	rs71057888		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3160356_3160378delCCTCCCTCCCTCCTTCCCTCCTT								TEAD4 (10515 upstream) : TSPAN9 (26179 downstream)																																			---	---	---	---
TSPAN9	10867	broad.mit.edu	37	12	3205697	3205698	+	Intron	INS	-	TGAA	TGAA	rs139740261	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3205697_3205698insTGAA	uc001qlp.2	+							NM_006675	NP_006666			tetraspanin 9							integral to plasma membrane|membrane fraction				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)															---	---	---	---
C1S	716	broad.mit.edu	37	12	7123404	7123404	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7123404delT	uc001qsj.2	+						LPCAT3_uc010sfw.1_Intron|LPCAT3_uc001qsi.2_Intron|LPCAT3_uc009zfp.2_Intron|LPCAT3_uc010sfx.1_Intron|LPCAT3_uc009zfq.1_Intron	NM_201442	NP_958850			complement component 1, s subcomponent						complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	8058274	8058275	+	IGR	DEL	TT	-	-	rs142173368		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8058274_8058275delTT								SLC2A14 (14530 upstream) : SLC2A3 (13550 downstream)																																			---	---	---	---
LOC389634	389634	broad.mit.edu	37	12	8523306	8523306	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8523306delT	uc001quk.3	-							NR_024420				Homo sapiens cDNA FLJ90405 fis, clone NT2RP2006099.												0																		---	---	---	---
A2ML1	144568	broad.mit.edu	37	12	8989078	8989079	+	Intron	DEL	TT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8989078_8989079delTT	uc001quz.3	+							NM_144670	NP_653271			alpha-2-macroglobulin-like 1 precursor							extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	9380646	9380649	+	IGR	DEL	ACTT	-	-	rs142787718		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9380646_9380649delACTT								PZP (19680 upstream) : MIR1244 (11414 downstream)																																			---	---	---	---
PRB4	5545	broad.mit.edu	37	12	11285719	11285720	+	Intron	INS	-	AC	AC	rs146193223	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11285719_11285720insAC	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qzj.2_Intron	NM_002723	NP_002714			proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1															HNSCC(22;0.051)			---	---	---	---
Unknown	0	broad.mit.edu	37	12	12464531	12464531	+	IGR	DEL	G	-	-	rs34042390		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12464531delG								LRP6 (44720 upstream) : MANSC1 (17687 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	13470992	13470993	+	IGR	INS	-	A	A	rs34699286		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13470992_13470993insA								EMP1 (101285 upstream) : C12orf36 (53030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	14242135	14242136	+	IGR	INS	-	A	A	rs11055753		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14242135_14242136insA								GRIN2B (109113 upstream) : ATF7IP (276475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	14332418	14332422	+	IGR	DEL	GCTGT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14332418_14332422delGCTGT								GRIN2B (199396 upstream) : ATF7IP (186189 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	14496370	14496370	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14496370delT								GRIN2B (363348 upstream) : ATF7IP (22241 downstream)																																			---	---	---	---
LMO3	55885	broad.mit.edu	37	12	16710302	16710303	+	Intron	DEL	TT	-	-	rs142134074		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16710302_16710303delTT	uc001rdk.1	-						LMO3_uc001rdj.1_Intron|LMO3_uc010shy.1_Intron|LMO3_uc001rdl.1_Intron|LMO3_uc009zii.1_Intron|LMO3_uc010shz.1_Intron|LMO3_uc001rdm.1_Intron|LMO3_uc001rdo.1_Intron|LMO3_uc001rdp.1_Intron|LMO3_uc001rdn.1_Intron|LMO3_uc009zij.1_Intron|LMO3_uc009zik.1_Intron	NM_018640	NP_061110			LIM domain only 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent		zinc ion binding				0		Hepatocellular(102;0.244)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	18924886	18924886	+	IGR	DEL	T	-	-	rs34960622		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18924886delT								CAPZA3 (32765 upstream) : PLEKHA5 (357762 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	19186521	19186521	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19186521delT								CAPZA3 (294400 upstream) : PLEKHA5 (96127 downstream)																																			---	---	---	---
PDE3A	5139	broad.mit.edu	37	12	20521540	20521540	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20521540delT	uc001reh.1	+							NM_000921	NP_000912			phosphodiesterase 3A						lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)													---	---	---	---
SLCO1B3	28234	broad.mit.edu	37	12	21201613	21201616	+	Intron	DEL	TATA	-	-	rs72380267		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21201613_21201616delTATA	uc010sil.1	+						LST-3TM12_uc010sim.1_Intron|LST-3TM12_uc010sin.1_Intron					SubName: Full=Liver-specific organic anion transporter 3TM13; SubName: Full=Organic anion transporter LST-3c;						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)																	---	---	---	---
SOX5	6660	broad.mit.edu	37	12	24339872	24339873	+	Intron	INS	-	G	G	rs140894155	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24339872_24339873insG	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534			SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26949400	26949400	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26949400delA	uc001rhg.2	-						ITPR2_uc001rhh.1_Intron|ITPR2_uc001rhi.1_Intron	NM_002223	NP_002214			inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
TM7SF3	51768	broad.mit.edu	37	12	27134451	27134451	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27134451delA	uc010sjl.1	-							NM_016551	NP_057635			transmembrane 7 superfamily member 3 precursor							integral to membrane|plasma membrane				upper_aerodigestive_tract(2)	2	Colorectal(261;0.0847)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	28033284	28033284	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28033284delT								KLHDC5 (77312 upstream) : PTHLH (77734 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	28326164	28326164	+	IGR	DEL	C	-	-	rs66769304		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28326164delC								PTHLH (201248 upstream) : CCDC91 (6046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	30388077	30388078	+	IGR	DEL	GT	-	-	rs66466319		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30388077_30388078delGT								TMTC1 (450385 upstream) : IPO8 (393845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	31346825	31346825	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31346825delT	uc010sjy.1	-											RecName: Full=Ovostatin homolog 1; Flags: Precursor;																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	34459501	34459501	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34459501delA								ALG10 (278267 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38090033	38090033	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38090033delA								None (None upstream) : ALG10B (620524 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38108817	38108817	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38108817delC								None (None upstream) : ALG10B (601740 downstream)																																			---	---	---	---
PRICKLE1	144165	broad.mit.edu	37	12	42908819	42908819	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42908819delC	uc001rnm.2	-						PRICKLE1_uc009zka.2_Intron	NM_153026	NP_694571			prickle homolog 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein import into nucleus	cytosol|nuclear membrane	zinc ion binding			ovary(3)|skin(1)	4	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	43024514	43024515	+	IGR	DEL	TT	-	-	rs35810828		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43024514_43024515delTT								PRICKLE1 (40942 upstream) : ADAMTS20 (723498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	44845140	44845141	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44845140_44845141insT								TMEM117 (61600 upstream) : NELL2 (56917 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	46031335	46031335	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46031335delA								ANO6 (197148 upstream) : LOC400027 (88475 downstream)																																			---	---	---	---
FAIM2	23017	broad.mit.edu	37	12	50291547	50291548	+	Intron	INS	-	C	C	rs144837790	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50291547_50291548insC	uc001rvj.1	-						FAIM2_uc001rvi.1_Intron|FAIM2_uc001rvk.1_Intron	NM_012306	NP_036438			Fas apoptotic inhibitory molecule 2						anti-apoptosis|apoptosis	cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
LIMA1	51474	broad.mit.edu	37	12	50630518	50630519	+	Intron	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50630518_50630519delCA	uc001rwj.3	-						LIMA1_uc001rwk.3_Intron|LIMA1_uc010smr.1_Intron|LIMA1_uc010sms.1_Intron|MIR1293_hsa-mir-1293|MI0006355_5'Flank	NM_016357	NP_057441			LIM domain and actin binding 1 isoform b						actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1																		---	---	---	---
SLC4A8	9498	broad.mit.edu	37	12	51798631	51798632	+	Intron	INS	-	T	T	rs142847625	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51798631_51798632insT	uc010snj.1	+						SLC4A8_uc010sni.1_Intron|SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryo.2_Intron|SLC4A8_uc001ryp.1_Intron	NM_004858	NP_004849			solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	58555941	58555942	+	IGR	DEL	TT	-	-	rs34867235		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58555941_58555942delTT								XRCC6BP1 (204890 upstream) : LRIG3 (709996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	58590646	58590647	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58590646_58590647delTG								XRCC6BP1 (239595 upstream) : LRIG3 (675291 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	58778227	58778227	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58778227delT								XRCC6BP1 (427176 upstream) : LRIG3 (487711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	59744754	59744754	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59744754delC								LRIG3 (430492 upstream) : SLC16A7 (245094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	59843137	59843137	+	IGR	DEL	A	-	-	rs72371167		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59843137delA								LRIG3 (528875 upstream) : SLC16A7 (146711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	60816039	60816040	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60816039_60816040insT								SLC16A7 (640632 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	61956083	61956086	+	IGR	DEL	CCTC	-	-	rs66610622		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61956083_61956086delCCTC								None (None upstream) : FAM19A2 (145957 downstream)																																			---	---	---	---
SRGAP1	57522	broad.mit.edu	37	12	64539337	64539337	+	3'UTR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64539337delT	uc010ssp.1	+	22					SRGAP1_uc001srv.2_3'UTR	NM_020762	NP_065813			SLIT-ROBO Rho GTPase activating protein 1						axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	66095490	66095490	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66095490delC								MSRB3 (234810 upstream) : RPSAP52 (56313 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	66507101	66507102	+	IGR	INS	-	T	T	rs72099918		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66507101_66507102insT								HMGA2 (147033 upstream) : LLPH (9748 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	66508310	66508310	+	IGR	DEL	T	-	-	rs111975343		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66508310delT								HMGA2 (148242 upstream) : LLPH (8540 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	67214599	67214599	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67214599delA								GRIP1 (16705 upstream) : CAND1 (448462 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	68475784	68475785	+	IGR	DEL	AC	-	-	rs143423582		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68475784_68475785delAC								DYRK2 (419341 upstream) : IFNG (72765 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	68730922	68730923	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68730922_68730923insT								MDM1 (4761 upstream) : RAP1B (273729 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	68808221	68808221	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68808221delA								MDM1 (82060 upstream) : RAP1B (196431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	69074554	69074554	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69074554delA	uc001sud.1	-						uc001sue.1_Intron					Homo sapiens cDNA clone IMAGE:5268292.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	69542423	69542423	+	IGR	DEL	A	-	-	rs146476156		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69542423delA								CPM (185403 upstream) : CPSF6 (90894 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	69595213	69595214	+	IGR	INS	-	T	T	rs148671863	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69595213_69595214insT								CPM (238193 upstream) : CPSF6 (38103 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	69626246	69626246	+	IGR	DEL	A	-	-	rs35481107		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69626246delA								CPM (269226 upstream) : CPSF6 (7071 downstream)																																			---	---	---	---
CCT2	10576	broad.mit.edu	37	12	69985660	69985662	+	Intron	DEL	AAC	-	-	rs34385564		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69985660_69985662delAAC	uc001svb.1	+						CCT2_uc009zrm.1_Intron|CCT2_uc009zrn.1_Intron|CCT2_uc010stl.1_Intron	NM_006431	NP_006422			chaperonin containing TCP1, subunit 2						'de novo' posttranslational protein folding	nucleus	ATP binding|unfolded protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	70900390	70900392	+	Intron	DEL	AAG	-	-	rs78625576		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70900390_70900392delAAG	uc001svz.2	+											Homo sapiens cDNA clone IMAGE:4823238.																														---	---	---	---
TSPAN8	7103	broad.mit.edu	37	12	71576434	71576435	+	Intron	DEL	CA	-	-	rs34002910		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71576434_71576435delCA	uc001swk.1	-							NM_004616	NP_004607			transmembrane 4 superfamily member 3						protein glycosylation	integral to membrane|lysosome	signal transducer activity			skin(2)|lung(1)|central_nervous_system(1)	4			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)															---	---	---	---
TBC1D15	64786	broad.mit.edu	37	12	72246591	72246592	+	Intron	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72246591_72246592delCA	uc001swu.2	+						TBC1D15_uc009zrv.2_Intron|TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron|MRS2P2_uc010stu.1_5'Flank	NM_022771	NP_073608			TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	73412170	73412172	+	IGR	DEL	AAG	-	-	rs35281398		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73412170_73412172delAAG								TRHDE (352749 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	73759960	73759963	+	IGR	DEL	AATG	-	-	rs74350264		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73759960_73759963delAATG								TRHDE (700539 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	74221408	74221408	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74221408delA								None (None upstream) : ATXN7L3B (710143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77320155	77320156	+	IGR	INS	-	GTGT	GTGT	rs144825940	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77320155_77320156insGTGT								CSRP2 (47356 upstream) : E2F7 (94871 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77388306	77388306	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77388306delC								CSRP2 (115507 upstream) : E2F7 (26721 downstream)																																			---	---	---	---
E2F7	144455	broad.mit.edu	37	12	77459994	77459997	+	5'Flank	DEL	TTTT	-	-	rs35897876		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77459994_77459997delTTTT	uc001sym.3	-						E2F7_uc001syn.2_5'Flank	NM_203394	NP_976328			E2F transcription factor 7						cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3																		---	---	---	---
E2F7	144455	broad.mit.edu	37	12	77460259	77460261	+	5'Flank	DEL	TTA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77460259_77460261delTTA	uc001sym.3	-						E2F7_uc001syn.2_5'Flank	NM_203394	NP_976328			E2F transcription factor 7						cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3																		---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78275846	78275846	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78275846delA	uc001syp.2	+						NAV3_uc001syo.2_Intron	NM_014903	NP_055718			neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78389381	78389381	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78389381delT	uc001syp.2	+						NAV3_uc001syo.2_Intron	NM_014903	NP_055718			neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
Unknown	0	broad.mit.edu	37	12	78778383	78778384	+	IGR	DEL	TT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78778383_78778384delTT								NAV3 (171595 upstream) : SYT1 (479389 downstream)																																			---	---	---	---
SYT1	6857	broad.mit.edu	37	12	79618901	79618904	+	Intron	DEL	AAAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79618901_79618904delAAAA	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron|SYT1_uc001syv.2_Intron	NM_001135805	NP_001129277			synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	79923525	79923526	+	IGR	INS	-	C	C	rs145465912	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79923525_79923526insC								SYT1 (77738 upstream) : PAWR (62221 downstream)																																			---	---	---	---
PPP1R12A	4659	broad.mit.edu	37	12	80273146	80273146	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80273146delA	uc001syz.2	-						PPP1R12A_uc010suc.1_Intron|PPP1R12A_uc001sza.2_Intron|PPP1R12A_uc010sud.1_Intron|PPP1R12A_uc001szb.2_Intron|PPP1R12A_uc001szc.2_Intron	NM_002480	NP_002471			protein phosphatase 1, regulatory (inhibitor)							contractile fiber	protein binding|signal transducer activity			ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	80691112	80691112	+	IGR	DEL	T	-	-	rs67262923		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80691112delT								PPP1R12A (361877 upstream) : PTPRQ (147014 downstream)																																			---	---	---	---
PTPRQ	374462	broad.mit.edu	37	12	81027066	81027066	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81027066delT	uc001sze.2	+							NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	84605067	84605067	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84605067delA								None (None upstream) : SLC6A15 (648202 downstream)																																			---	---	---	---
LRRIQ1	84125	broad.mit.edu	37	12	85569086	85569086	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85569086delA	uc001tac.2	+							NM_001079910	NP_001073379			leucine-rich repeats and IQ motif containing 1											ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)														---	---	---	---
CEP290	80184	broad.mit.edu	37	12	88535298	88535299	+	Intron	INS	-	A	A	rs141191057	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88535298_88535299insA	uc001tar.2	-						CEP290_uc009zsl.1_5'Flank|TMTC3_uc009zsm.2_5'Flank|TMTC3_uc001tau.2_5'Flank	NM_025114	NP_079390			centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	92213365	92213366	+	IGR	DEL	CA	-	-	rs28564388	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92213365_92213366delCA								DCN (636559 upstream) : BTG1 (165500 downstream)																																			---	---	---	---
BTG1	694	broad.mit.edu	37	12	92424266	92424267	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92424266_92424267insA	uc001tbv.1	-						BTG1_uc001tbw.1_Intron|BTG1_uc001tbx.1_Intron|BTG1_uc009zss.1_Intron					Homo sapiens full length insert cDNA clone YW25A12.						cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)						T	MYC	BCLL								---	---	---	---
BTG1	694	broad.mit.edu	37	12	92531856	92531857	+	Intron	DEL	AC	-	-	rs71824302		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92531856_92531857delAC	uc001tbv.1	-						BTG1_uc001tbw.1_Intron|BTG1_uc001tbx.1_Intron|BTG1_uc009zss.1_Intron					Homo sapiens full length insert cDNA clone YW25A12.						cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)						T	MYC	BCLL								---	---	---	---
Unknown	0	broad.mit.edu	37	12	93851420	93851421	+	IGR	INS	-	A	A	rs59820152		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93851420_93851421insA								UBE2N (15394 upstream) : MRPL42 (9849 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	94310510	94310511	+	IGR	INS	-	A	A	rs141343750	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94310510_94310511insA								CRADD (21894 upstream) : PLXNC1 (231988 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	95778537	95778537	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95778537delC								MIR331 (76248 upstream) : METAP2 (89285 downstream)																																			---	---	---	---
CDK17	5128	broad.mit.edu	37	12	96777838	96777838	+	Intron	DEL	A	-	-	rs148938707		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96777838delA	uc001tep.1	-						CDK17_uc009ztk.2_Intron|CDK17_uc010svb.1_Intron	NM_002595	NP_002586			PCTAIRE protein kinase 2								ATP binding|cyclin-dependent protein kinase activity			ovary(3)|lung(2)|kidney(1)|central_nervous_system(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	98027844	98027845	+	IGR	DEL	AC	-	-	rs35524088		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98027844_98027845delAC								RMST (69051 upstream) : LOC100128191 (878908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98081259	98081259	+	IGR	DEL	A	-	-	rs67828518		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98081259delA								RMST (122466 upstream) : LOC100128191 (825494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98383444	98383449	+	IGR	DEL	AAGGGA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98383444_98383449delAAGGGA								RMST (424651 upstream) : LOC100128191 (523304 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98845944	98845951	+	IGR	DEL	AAAAAAAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98845944_98845951delAAAAAAAA								RMST (887151 upstream) : LOC100128191 (60802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98885464	98885464	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98885464delT	uc001tff.1	-											Homo sapiens cDNA FLJ44867 fis, clone BRALZ2017607.																														---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	99285616	99285616	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99285616delA	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc001tgk.2_Intron|ANKS1B_uc010svd.1_Intron|ANKS1B_uc001tgd.1_Intron|ANKS1B_uc010sve.1_Intron|ANKS1B_uc001tgh.3_Intron|ANKS1B_uc001tgi.2_Intron|ANKS1B_uc009ztr.2_Intron|ANKS1B_uc001tgj.2_Intron|ANKS1B_uc009ztp.2_Intron|ANKS1B_uc010svf.1_Intron|ANKS1B_uc001tgg.3_Intron|ANKS1B_uc010svg.1_Intron|ANKS1B_uc009zts.1_Intron|ANKS1B_uc001tgm.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	99606137	99606137	+	Intron	DEL	T	-	-	rs67580699		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99606137delT	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc001tgk.2_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	100833230	100833230	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100833230delA								SLC17A8 (17394 upstream) : NR1H4 (34449 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	102241380	102241381	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102241380_102241381delAC								GNPTAB (16748 upstream) : DRAM1 (29724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	103443998	103444003	+	IGR	DEL	GTGTGT	-	-	rs62881062		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103443998_103444003delGTGTGT								ASCL1 (89711 upstream) : C12orf42 (187367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	104841650	104841650	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104841650delT								TXNRD1 (97592 upstream) : CHST11 (9099 downstream)																																			---	---	---	---
CHST11	50515	broad.mit.edu	37	12	104942904	104942904	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104942904delA	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883			carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0																		---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	108042158	108042159	+	Intron	DEL	CA	-	-	rs5800757		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108042158_108042159delCA	uc001tmk.1	+						BTBD11_uc001tmj.2_Intron|BTBD11_uc001tml.1_Intron|BTBD11_uc001tmm.1_Intron	NM_001018072	NP_001018082			BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3																		---	---	---	---
SVOP	55530	broad.mit.edu	37	12	109426550	109426551	+	Intron	INS	-	CTTC	CTTC			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109426550_109426551insCTTC	uc010sxh.1	-							NM_018711	NP_061181			SV2 related protein							cell junction|integral to membrane|synaptic vesicle membrane	ion transmembrane transporter activity				0																		---	---	---	---
USP30	84749	broad.mit.edu	37	12	109516229	109516229	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109516229delA	uc010sxi.1	+						USP30_uc001tnu.3_Intron	NM_032663	NP_116052			ubiquitin specific peptidase 30						ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	110110699	110110699	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110110699delC								MVK (75629 upstream) : C12orf34 (41491 downstream)																																			---	---	---	---
FAM109A	144717	broad.mit.edu	37	12	111802568	111802568	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111802568delA	uc001tsd.3	-						FAM109A_uc009zvu.2_Intron|FAM109A_uc001tsc.2_5'Flank	NM_144671	NP_653272			hypothetical protein LOC144717						endosome organization|receptor recycling|retrograde transport, endosome to Golgi	clathrin-coated vesicle|early endosome|recycling endosome|trans-Golgi network	protein homodimerization activity				0																		---	---	---	---
RBM19	9904	broad.mit.edu	37	12	114389329	114389330	+	Intron	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114389329_114389330delCA	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171			RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)																	---	---	---	---
MED13L	23389	broad.mit.edu	37	12	116477407	116477407	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116477407delG	uc001tvw.2	-							NM_015335	NP_056150			mediator complex subunit 13-like						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)														---	---	---	---
MED13L	23389	broad.mit.edu	37	12	116581136	116581136	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116581136delA	uc001tvw.2	-							NM_015335	NP_056150			mediator complex subunit 13-like						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)														---	---	---	---
TAOK3	51347	broad.mit.edu	37	12	118708034	118708034	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118708034delA	uc001twx.2	-						TAOK3_uc001twy.3_Intron	NM_016281	NP_057365			TAO kinase 3						MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	119063100	119063101	+	IGR	INS	-	TT	TT	rs146058291	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119063100_119063101insTT								SUDS3 (207261 upstream) : SRRM4 (356295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	119122703	119122704	+	IGR	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119122703_119122704delAG								SUDS3 (266864 upstream) : SRRM4 (296692 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	119356162	119356163	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119356162_119356163insT								SUDS3 (500323 upstream) : SRRM4 (63233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	120831070	120831070	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120831070delA								MSI1 (24112 upstream) : COX6A1 (44834 downstream)																																			---	---	---	---
KDM2B	84678	broad.mit.edu	37	12	121947035	121947035	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121947035delT	uc001uat.2	-						KDM2B_uc001uar.2_Intron|KDM2B_uc001uas.2_Intron|KDM2B_uc001uau.2_Intron|KDM2B_uc001uav.3_Intron	NM_032590	NP_115979			F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	122126100	122126100	+	IGR	DEL	T	-	-	rs34328366		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122126100delT								MORN3 (15563 upstream) : TMEM120B (24558 downstream)																																			---	---	---	---
LRRC43	254050	broad.mit.edu	37	12	122668643	122668643	+	Intron	DEL	T	-	-	rs35033444		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122668643delT	uc009zxm.2	+						LRRC43_uc001ubw.3_Intron|LRRC43_uc009zxl.1_Intron	NM_001098519	NP_001091989			leucine rich repeat containing 43 isoform 1												0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)														---	---	---	---
CLIP1	6249	broad.mit.edu	37	12	122890307	122890308	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122890307_122890308insA	uc001uch.1	-						CLIP1_uc001uci.1_Intron	NM_002956	NP_002947			restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)														---	---	---	---
KNTC1	9735	broad.mit.edu	37	12	123014999	123015000	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123014999_123015000insT	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523			Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)														---	---	---	---
RILPL1	353116	broad.mit.edu	37	12	124010468	124010471	+	Intron	DEL	AAAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124010468_124010471delAAAC	uc001ufe.2	-						RILPL1_uc010tas.1_Intron	NM_178314	NP_847884			Rab interacting lysosomal protein-like 1						neuroprotection	cytosol					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)														---	---	---	---
DNAH10	196385	broad.mit.edu	37	12	124264697	124264700	+	Intron	DEL	TCTC	-	-	rs72526274		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124264697_124264700delTCTC	uc001uft.3	+							NM_207437	NP_997320			dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	124645178	124645179	+	IGR	INS	-	T	T	rs145475656	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124645178_124645179insT								ZNF664 (145211 upstream) : FAM101A (128531 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	124719639	124719641	+	IGR	DEL	CCT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124719639_124719641delCCT								ZNF664 (219672 upstream) : FAM101A (54069 downstream)																																			---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	124970498	124970515	+	Intron	DEL	CCCCACCTCCCTCCCACT	-	-	rs72157657		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124970498_124970515delCCCCACCTCCCTCCCACT	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron|uc001ugl.2_RNA	NM_001077261	NP_001070729			nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	125157148	125157149	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125157148_125157149delCA								NCOR2 (105138 upstream) : SCARB1 (105026 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	126178025	126178026	+	IGR	INS	-	GT	GT	rs148160356	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126178025_126178026insGT								TMEM132B (34436 upstream) : LOC100128554 (749001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	128257984	128257985	+	IGR	INS	-	A	A	rs72524742	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128257984_128257985insA								None (None upstream) : TMEM132C (641306 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	129241587	129241588	+	IGR	DEL	AG	-	-	rs10646301		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129241587_129241588delAG								TMEM132C (49124 upstream) : SLC15A4 (36151 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	129270965	129270965	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129270965delA								TMEM132C (78502 upstream) : SLC15A4 (6774 downstream)																																			---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	129865103	129865104	+	Intron	DEL	TG	-	-	rs142813137		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129865103_129865104delTG	uc009zyl.1	-							NM_133448	NP_597705			transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	130502136	130502137	+	IGR	DEL	TT	-	-	rs74492646		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130502136_130502137delTT								TMEM132D (113924 upstream) : LOC100190940 (15862 downstream)																																			---	---	---	---
ULK1	8408	broad.mit.edu	37	12	132403267	132403275	+	Intron	DEL	GGGTGTGTG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132403267_132403275delGGGTGTGTG	uc001uje.2	+							NM_003565	NP_003556			Unc-51-like kinase 1						autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	133040132	133040134	+	IGR	DEL	CAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133040132_133040134delCAC								GALNT9 (134227 upstream) : FBRSL1 (27023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	20371304	20371305	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20371304_20371305insA								PSPC1 (14221 upstream) : ZMYM5 (26319 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	20474739	20474741	+	IGR	DEL	CCA	-	-	rs12868293		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20474739_20474741delCCA								ZMYM5 (36963 upstream) : ZMYM2 (58069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22198716	22198716	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22198716delA								EFHA1 (20409 upstream) : FGF9 (46499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22704634	22704634	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22704634delA	uc001uoi.2	+											Homo sapiens cDNA FLJ30283 fis, clone BRACE2002807.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	23533631	23533634	+	IGR	DEL	TGTG	-	-	rs141488289		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23533631_23533634delTGTG								None (None upstream) : SGCG (221426 downstream)																																			---	---	---	---
ATP8A2	51761	broad.mit.edu	37	13	26280497	26280497	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26280497delT	uc001uqk.2	+						ATP8A2_uc010tdi.1_Intron|ATP8A2_uc010tdj.1_Intron|ATP8A2_uc010aaj.1_Intron	NM_016529	NP_057613			ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	28525591	28525591	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28525591delT								ATP5EP2 (5882 upstream) : CDX2 (10688 downstream)																																			---	---	---	---
SLC46A3	283537	broad.mit.edu	37	13	29276291	29276292	+	Intron	INS	-	T	T	rs147993910	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29276291_29276292insT	uc001usi.2	-						SLC46A3_uc001usg.2_Intron|SLC46A3_uc001usj.2_Intron|SLC46A3_uc001ush.2_Intron	NM_181785	NP_861450			solute carrier family 46, member 3 isoform a						transmembrane transport	integral to membrane				central_nervous_system(1)|skin(1)	2		Lung SC(185;0.0367)		all cancers(112;0.159)														---	---	---	---
SLC7A1	6541	broad.mit.edu	37	13	30129027	30129027	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30129027delA	uc001uso.2	-							NM_003045	NP_003036			solute carrier family 7 (cationic amino acid						cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	receptor activity				0		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)													---	---	---	---
KATNAL1	84056	broad.mit.edu	37	13	30864463	30864464	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30864463_30864464insA	uc001uss.2	-						KATNAL1_uc001ust.2_Intron	NM_001014380	NP_001014402			katanin p60 subunit A-like 1							cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity				0		Lung SC(185;0.0257)		all cancers(112;0.114)|OV - Ovarian serous cystadenocarcinoma(117;0.213)														---	---	---	---
LOC100188949	100188949	broad.mit.edu	37	13	30949958	30949959	+	5'Flank	INS	-	T	T	rs28744629		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30949958_30949959insT	uc001usu.2	-							NR_024464				full-length cDNA clone CS0DG007YC17 of B cells (Ramos cell line) of Homo sapiens (human).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	31592359	31592359	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31592359delA								C13orf26 (43208 upstream) : HSPH1 (118406 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	32062137	32062137	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32062137delC								B3GALTL (155728 upstream) : RXFP2 (251542 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	34586805	34586805	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34586805delC								RFC3 (46111 upstream) : NBEA (929651 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	34626182	34626182	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34626182delT								RFC3 (85488 upstream) : NBEA (890274 downstream)																																			---	---	---	---
SMAD9	4093	broad.mit.edu	37	13	37491536	37491537	+	Intron	INS	-	T	T	rs78613950		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37491536_37491537insT	uc001uvw.2	-						SMAD9_uc001uvx.2_Intron	NM_001127217	NP_001120689			SMAD family member 9 isoform a						BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	38541488	38541489	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38541488_38541489insT								TRPC4 (97549 upstream) : UFM1 (382453 downstream)																																			---	---	---	---
FREM2	341640	broad.mit.edu	37	13	39336582	39336583	+	Intron	INS	-	T	T	rs144738051		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39336582_39336583insT	uc001uwv.2	+							NM_207361	NP_997244			FRAS1-related extracellular matrix protein 2						cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	40464881	40464881	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40464881delT								COG6 (99079 upstream) : LOC646982 (456392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	40871936	40871937	+	IGR	INS	-	A	A	rs113703371		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40871936_40871937insA								COG6 (506134 upstream) : LOC646982 (49336 downstream)																																			---	---	---	---
KIAA0564	23078	broad.mit.edu	37	13	42213027	42213027	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42213027delA	uc001uyj.2	-							NM_015058	NP_055873			hypothetical protein LOC23078 isoform a							extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)														---	---	---	---
KIAA0564	23078	broad.mit.edu	37	13	42403667	42403670	+	Intron	DEL	ACAC	-	-	rs139040721		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42403667_42403670delACAC	uc001uyj.2	-						KIAA0564_uc001uyk.2_Intron	NM_015058	NP_055873			hypothetical protein LOC23078 isoform a							extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	43278904	43278904	+	IGR	DEL	T	-	-	rs151146775		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43278904delT								TNFSF11 (96755 upstream) : C13orf30 (76782 downstream)																																			---	---	---	---
ENOX1	55068	broad.mit.edu	37	13	43827409	43827410	+	Intron	DEL	TC	-	-	rs67749331		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43827409_43827410delTC	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron|ENOX1_uc001uyz.3_Intron	NM_001127615	NP_001121087			ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)														---	---	---	---
LRCH1	23143	broad.mit.edu	37	13	47266460	47266460	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47266460delC	uc001vbj.2	+						LRCH1_uc010acp.2_Intron|LRCH1_uc001vbk.2_Intron|LRCH1_uc001vbl.3_Intron	NM_015116	NP_055931			leucine-rich repeats and calponin homology (CH)											ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)														---	---	---	---
RB1	5925	broad.mit.edu	37	13	48897110	48897110	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48897110delT	uc001vcb.2	+						RB1_uc010acs.1_Intron	NM_000321	NP_000312			retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding			lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			---	---	---	---
DLEU1	10301	broad.mit.edu	37	13	50733192	50733200	+	Intron	DEL	AGCATTTGC	-	-	rs77615043		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50733192_50733200delAGCATTTGC	uc010adl.1	+						DLEU1_uc001vee.1_Intron|DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0																		---	---	---	---
GUCY1B2	2974	broad.mit.edu	37	13	51569476	51569476	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51569476delT	uc001vfc.3	-							NR_003923				Homo sapiens soluble guanylyl cyclase subunit beta 2 (GUCY1B2) mRNA, complete cds.												0																		---	---	---	---
WDFY2	115825	broad.mit.edu	37	13	52163504	52163504	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52163504delT	uc001vfp.2	+						WDFY2_uc010ads.1_Intron|WDFY2_uc010adt.1_Intron	NM_052950	NP_443182			WD repeat and FYVE domain containing 2								metal ion binding				0		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	54252594	54252595	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54252594_54252595delAC								OLFM4 (626408 upstream) : MIR1297 (633512 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	54949238	54949238	+	IGR	DEL	T	-	-	rs34195232		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54949238delT								MIR1297 (63055 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	56379867	56379867	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:56379867delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57496160	57496161	+	IGR	DEL	GA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57496160_57496161delGA								None (None upstream) : PRR20C (218891 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	60009592	60009593	+	IGR	INS	-	T	T	rs149646776	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60009592_60009593insT								None (None upstream) : DIAPH3 (230132 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62128266	62128266	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62128266delT								PCDH20 (126187 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62622376	62622376	+	IGR	DEL	A	-	-	rs11318070		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62622376delA								PCDH20 (620297 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62746677	62746678	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62746677_62746678insA								PCDH20 (744598 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63527624	63527625	+	IGR	INS	-	CTC	CTC	rs138639341	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63527624_63527625insCTC								None (None upstream) : OR7E156P (783943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	64933427	64933428	+	IGR	DEL	AA	-	-	rs35379512		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64933427_64933428delAA								OR7E156P (616726 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	65316412	65316412	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65316412delT								OR7E156P (999711 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	68735109	68735109	+	IGR	DEL	A	-	-	rs35109772		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:68735109delA								PCDH9 (930641 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69114227	69114227	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69114227delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69217362	69217363	+	IGR	INS	-	C	C	rs142943661	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69217362_69217363insC								None (None upstream) : None (None downstream)																																			---	---	---	---
KLHL1	57626	broad.mit.edu	37	13	70312092	70312092	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70312092delC	uc001vip.2	-						KLHL1_uc010thm.1_Intron	NM_020866	NP_065917			kelch-like 1 protein						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)														---	---	---	---
KLHL1	57626	broad.mit.edu	37	13	70521161	70521172	+	Intron	DEL	TGTGTGTGTGTG	-	-	rs72070395		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70521161_70521172delTGTGTGTGTGTG	uc001vip.2	-						KLHL1_uc010thm.1_Intron	NM_020866	NP_065917			kelch-like 1 protein						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	71951704	71951704	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:71951704delA								None (None upstream) : DACH1 (60394 downstream)																																			---	---	---	---
DACH1	1602	broad.mit.edu	37	13	72294316	72294316	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72294316delA	uc010thn.1	-						DACH1_uc010tho.1_Intron|DACH1_uc010thp.1_Intron	NM_080759	NP_542937			dachshund homolog 1 isoform a						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	73248572	73248572	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73248572delT								DACH1 (807242 upstream) : C13orf37 (33923 downstream)																																			---	---	---	---
PIBF1	10464	broad.mit.edu	37	13	73478990	73478990	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73478990delT	uc001vjc.2	+						PIBF1_uc010aeo.1_RNA|PIBF1_uc001vjb.2_Intron|PIBF1_uc010aep.2_Intron	NM_006346	NP_006337			progesterone-induced blocking factor 1							centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	76896631	76896632	+	IGR	DEL	GA	-	-	rs35695853		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76896631_76896632delGA								LMO7 (462627 upstream) : KCTD12 (557672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	77312482	77312483	+	IGR	INS	-	T	T	rs141155743		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77312482_77312483insT								LMO7 (878478 upstream) : KCTD12 (141821 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	78998897	78998900	+	Intron	DEL	ACAG	-	-	rs2876727		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78998897_78998900delACAG	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	80220191	80220192	+	IGR	DEL	GA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80220191_80220192delGA								NDFIP2 (89986 upstream) : SPRY2 (689922 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	80860539	80860539	+	IGR	DEL	A	-	-	rs34380685		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80860539delA								NDFIP2 (730334 upstream) : SPRY2 (49575 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	81951277	81951278	+	IGR	INS	-	T	T	rs35266856		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81951277_81951278insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	83019924	83019925	+	IGR	DEL	AA	-	-	rs148293814		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83019924_83019925delAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	85012049	85012050	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85012049_85012050insT								SLITRK1 (555521 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	85239247	85239249	+	IGR	DEL	AAG	-	-	rs71770096		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85239247_85239249delAAG								SLITRK1 (782719 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	85370952	85370953	+	IGR	DEL	GT	-	-	rs10537028		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85370952_85370953delGT								SLITRK1 (914424 upstream) : SLITRK6 (995969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	85386445	85386446	+	IGR	INS	-	AC	AC	rs149503049	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85386445_85386446insAC								SLITRK1 (929917 upstream) : SLITRK6 (980476 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	85921039	85921040	+	IGR	DEL	AA	-	-	rs113918902		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85921039_85921040delAA								None (None upstream) : SLITRK6 (445882 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	87989393	87989393	+	IGR	DEL	A	-	-	rs35312252		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87989393delA								None (None upstream) : SLITRK5 (335477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	90889328	90889329	+	IGR	INS	-	A	A	rs139473380	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90889328_90889329insA								MIR622 (5797 upstream) : LOC144776 (653879 downstream)																																			---	---	---	---
GPC6	10082	broad.mit.edu	37	13	93918060	93918061	+	Intron	INS	-	T	T	rs141252461	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93918060_93918061insT	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94714048	94714049	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94714048_94714049insA	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
Unknown	0	broad.mit.edu	37	13	99331472	99331473	+	IGR	INS	-	CAAAGACGG	CAAAGACGG	rs143480459	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99331472_99331473insCAAAGACGG								STK24 (102076 upstream) : SLC15A1 (4584 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	103836788	103836789	+	IGR	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103836788_103836789delGT								SLC10A2 (117592 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	104205499	104205500	+	IGR	INS	-	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104205499_104205500insG								SLC10A2 (486303 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	104382766	104382766	+	IGR	DEL	G	-	-	rs35461719		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104382766delG								SLC10A2 (663570 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	104669763	104669764	+	IGR	DEL	TT	-	-	rs113668887		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104669763_104669764delTT								SLC10A2 (950567 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	107606696	107606696	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107606696delC								ARGLU1 (386182 upstream) : FAM155A (214184 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	108603044	108603044	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108603044delG								FAM155A (83584 upstream) : LIG4 (256750 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	108609729	108609730	+	IGR	DEL	CA	-	-	rs147479654		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108609729_108609730delCA								FAM155A (90269 upstream) : LIG4 (250064 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	108759094	108759095	+	IGR	INS	-	AAGA	AAGA	rs142070813	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108759094_108759095insAAGA								FAM155A (239634 upstream) : LIG4 (100699 downstream)																																			---	---	---	---
COL4A1	1282	broad.mit.edu	37	13	110951848	110951848	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110951848delA	uc001vqw.3	-						COL4A1_uc010agl.2_Intron	NM_001845	NP_001836			alpha 1 type IV collagen preproprotein						angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)															---	---	---	---
TFDP1	7027	broad.mit.edu	37	13	114267903	114267904	+	Intron	DEL	GT	-	-	rs67914818		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114267903_114267904delGT	uc001vtw.2	+						TFDP1_uc010tkd.1_Intron|TFDP1_uc010tke.1_Intron|TFDP1_uc001vty.3_Intron|TFDP1_uc010agx.2_Intron	NM_007111	NP_009042			transcription factor Dp-1						cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|regulation of transcription from RNA polymerase II promoter	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			lung(4)|ovary(2)|skin(1)	7	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)												TSP Lung(29;0.18)			---	---	---	---
RASA3	22821	broad.mit.edu	37	13	114827663	114827664	+	Intron	INS	-	TT	TT	rs149175119	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114827663_114827664insTT	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron|RASA3_uc010tkl.1_Intron	NM_007368	NP_031394			RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	114907157	114907160	+	IGR	DEL	ACAT	-	-	rs77200912		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114907157_114907160delACAT								RASA3 (9062 upstream) : CDC16 (93202 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19224449	19224452	+	IGR	DEL	CACT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19224449_19224452delCACT								None (None upstream) : OR11H12 (153142 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19887196	19887197	+	Intron	DEL	TT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19887196_19887197delTT	uc001vvq.1	-						uc001vvr.1_Intron|uc010ahe.1_Intron					Homo sapiens cDNA FLJ12852 fis, clone NT2RP2003445.																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	20477748	20477748	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20477748delA								OR4K15 (33026 upstream) : OR4K14 (4673 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20991042	20991043	+	IGR	INS	-	CTC	CTC	rs145796079	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20991042_20991043insCTC								RNASE10 (11728 upstream) : RNASE9 (33210 downstream)																																			---	---	---	---
DAD1	1603	broad.mit.edu	37	14	23049156	23049157	+	Intron	INS	-	A	A	rs142268404	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23049156_23049157insA	uc001wgl.2	-							NM_001344	NP_001335			defender against cell death 1						anti-apoptosis|apoptosis|post-translational protein modification	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity			ovary(1)	1	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0156)														---	---	---	---
PSMB5	5693	broad.mit.edu	37	14	23503335	23503335	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23503335delA	uc001wii.2	-						PSMB5_uc001wij.2_Intron|PSMB5_uc010tni.1_Intron	NM_002797	NP_002788			proteasome beta 5 subunit isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus	protein binding|threonine-type endopeptidase activity			ovary(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)													---	---	---	---
ACIN1	22985	broad.mit.edu	37	14	23550267	23550267	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23550267delT	uc001wit.3	-						ACIN1_uc001wis.3_5'Flank|ACIN1_uc010akg.2_Intron|ACIN1_uc010tnj.1_Intron	NM_014977	NP_055792			apoptotic chromatin condensation inducer 1						apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	25165098	25165099	+	IGR	INS	-	A	A	rs138255425	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25165098_25165099insA								GZMB (61666 upstream) : STXBP6 (116209 downstream)																																			---	---	---	---
STXBP6	29091	broad.mit.edu	37	14	25295226	25295227	+	Intron	DEL	AC	-	-	rs71449214		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25295226_25295227delAC	uc001wpu.2	-						STXBP6_uc001wpv.2_Intron|STXBP6_uc001wpw.2_Intron|STXBP6_uc001wpx.1_Intron	NM_014178	NP_054897			amisyn						vesicle-mediated transport	cytoplasm|integral to membrane					0				GBM - Glioblastoma multiforme(265;0.0296)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	26212921	26212928	+	IGR	DEL	CCTTCTTT	-	-	rs35291897		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26212921_26212928delCCTTCTTT								STXBP6 (693750 upstream) : NOVA1 (702162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	26673265	26673266	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26673265_26673266delCA								None (None upstream) : NOVA1 (241824 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	28669781	28669782	+	IGR	INS	-	A	A	rs144010516	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28669781_28669782insA								None (None upstream) : FOXG1 (566505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	29231250	29231251	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29231250_29231251delTG								None (None upstream) : FOXG1 (5036 downstream)																																			---	---	---	---
EAPP	55837	broad.mit.edu	37	14	34997251	34997252	+	Intron	INS	-	TT	TT	rs10641754		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34997251_34997252insTT	uc001wsd.1	-							NM_018453	NP_060923			E2F-associated phosphoprotein						negative regulation of transcription elongation from RNA polymerase II promoter|positive regulation of cell proliferation|positive regulation of transcription elongation from RNA polymerase II promoter	Golgi apparatus|nucleus|plasma membrane				ovary(1)	1	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)														---	---	---	---
SLC25A21	89874	broad.mit.edu	37	14	37433151	37433152	+	Intron	INS	-	T	T	rs72100537		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37433151_37433152insT	uc001wtz.1	-							NM_030631	NP_085134			solute carrier family 25 (mitochondrial						lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	38921449	38921449	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38921449delA								CLEC14A (195875 upstream) : SEC23A (579674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	39013497	39013497	+	IGR	DEL	A	-	-	rs71861186		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39013497delA								CLEC14A (287923 upstream) : SEC23A (487626 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	40094315	40094316	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40094315_40094316insT								FBXO33 (192611 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	40786760	40786761	+	IGR	DEL	GG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40786760_40786761delGG								FBXO33 (885056 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	43334213	43334214	+	IGR	INS	-	TTTG	TTTG	rs141976887		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43334213_43334214insTTTG								LRFN5 (960463 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44866386	44866387	+	IGR	INS	-	T	T	rs77332347		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44866386_44866387insT								None (None upstream) : FSCB (106968 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	46052975	46052976	+	IGR	DEL	TC	-	-	rs144263726		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46052975_46052976delTC								C14orf106 (330370 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	46791885	46791886	+	IGR	INS	-	A	A	rs76229803		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46791885_46791886insA								None (None upstream) : RPL10L (328336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	47010763	47010763	+	IGR	DEL	T	-	-	rs74930431		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47010763delT								None (None upstream) : RPL10L (109459 downstream)																																			---	---	---	---
MDGA2	161357	broad.mit.edu	37	14	48082806	48082806	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48082806delG	uc001wwj.3	-						MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970			MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	48640426	48640427	+	IGR	DEL	AA	-	-	rs72115980		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48640426_48640427delAA								MDGA2 (496438 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	49442569	49442569	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49442569delT								None (None upstream) : SDCCAG1 (590458 downstream)																																			---	---	---	---
C14orf183	196913	broad.mit.edu	37	14	50560323	50560324	+	5'Flank	DEL	CT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50560323_50560324delCT	uc010tqk.1	-							NM_001014830	NP_001014830			hypothetical protein LOC196913												0																		---	---	---	---
ATP5S	27109	broad.mit.edu	37	14	50784490	50784492	+	Intron	DEL	AAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50784490_50784492delAAA	uc001wxw.1	+						ATP5S_uc001wxv.2_Intron|ATP5S_uc001wxx.1_Intron|ATP5S_uc010ant.1_5'Flank	NM_001003803	NP_001003803			ATP synthase, H+ transporting, mitochondrial F0						ATP biosynthetic process	mitochondrial inner membrane|proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity			ovary(1)|skin(1)	2	all_epithelial(31;0.000636)|Breast(41;0.0102)			OV - Ovarian serous cystadenocarcinoma(311;0.0685)														---	---	---	---
MAP4K5	11183	broad.mit.edu	37	14	50945904	50945905	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50945904_50945905insT	uc001wya.2	-						MAP4K5_uc001wyb.2_Intron|MAP4K5_uc010anv.1_Intron	NM_006575	NP_006566			mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(1)	1	all_epithelial(31;0.000415)|Breast(41;0.0102)																	---	---	---	---
DDHD1	80821	broad.mit.edu	37	14	53539173	53539173	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53539173delT	uc001xai.2	-						DDHD1_uc001xaj.2_Intron|DDHD1_uc001xah.2_Intron|DDHD1_uc001xag.2_Intron	NM_001160148	NP_001153620			DDHD domain containing 1 isoform c						lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding			ovary(2)	2	Breast(41;0.037)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	53899117	53899117	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53899117delA								DDHD1 (279071 upstream) : BMP4 (517340 downstream)																																	OREG0022686	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	14	54622345	54622345	+	IGR	DEL	T	-	-	rs35399740		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54622345delT								BMP4 (198791 upstream) : CDKN3 (241328 downstream)																																			---	---	---	---
FBXO34	55030	broad.mit.edu	37	14	55735500	55735501	+	5'Flank	INS	-	TT	TT			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55735500_55735501insTT	uc001xbu.2	+							NM_017943	NP_060413			F-box only protein 34											ovary(2)|lung(2)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	56307744	56307745	+	IGR	INS	-	G	G	rs147108872	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56307744_56307745insG								C14orf34 (44352 upstream) : PELI2 (277348 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	57342235	57342236	+	Intron	INS	-	TTTTCTTTTC	TTTTCTTTTC	rs149192820	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57342235_57342236insTTTTCTTTTC	uc001xcr.1	+											Homo sapiens cDNA clone IMAGE:5492202, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	57551208	57551209	+	IGR	INS	-	AA	AA	rs11414851		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57551208_57551209insAA								OTX2 (274024 upstream) : EXOC5 (117987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	58446360	58446360	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58446360delG								SLC35F4 (382745 upstream) : C14orf37 (24449 downstream)																																			---	---	---	---
C14orf37	145407	broad.mit.edu	37	14	58718005	58718006	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58718005_58718006delTG	uc010tro.1	-						PSMA3_uc001xdj.1_Intron|PSMA3_uc001xdk.1_Intron	NM_001001872	NP_001001872			hypothetical protein LOC145407 precursor							integral to membrane	binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	59216482	59216482	+	IGR	DEL	T	-	-	rs5808992		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59216482delT								DACT1 (101446 upstream) : DAAM1 (438917 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	59585331	59585332	+	IGR	INS	-	G	G	rs148416396	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59585331_59585332insG								DACT1 (470295 upstream) : DAAM1 (70067 downstream)																																			---	---	---	---
MNAT1	4331	broad.mit.edu	37	14	61210013	61210014	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61210013_61210014insT	uc001xfd.2	+						MNAT1_uc010apq.1_Intron|MNAT1_uc001xfe.2_Intron	NM_002431	NP_002422			menage a trois 1 (CAK assembly factor)						cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein complex assembly|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	cytoplasm|holo TFIIH complex	protein N-terminus binding|zinc ion binding			ovary(1)|lung(1)	2				OV - Ovarian serous cystadenocarcinoma(108;0.0174)									Direct_reversal_of_damage|NER					---	---	---	---
SYT16	83851	broad.mit.edu	37	14	62458048	62458049	+	Intron	INS	-	TG	TG	rs148245040	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62458048_62458049insTG	uc010tsd.1	+											SubName: Full=cDNA FLJ60997, highly similar to Homo sapiens synaptotagmin XVI (SYT16), mRNA;											central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	62708802	62708803	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62708802_62708803delTG								FLJ43390 (111570 upstream) : KCNH5 (465144 downstream)																																			---	---	---	---
SPTB	6710	broad.mit.edu	37	14	65301512	65301512	+	Intron	DEL	A	-	-	rs34654100		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65301512delA	uc001xhs.2	-						SPTB_uc001xhu.2_Intron	NM_001024858	NP_001020029			spectrin beta isoform a						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	65727633	65727634	+	IGR	INS	-	T	T	rs34093617		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65727633_65727634insT								MAX (158406 upstream) : LOC645431 (149679 downstream)																																			---	---	---	---
ATP6V1D	51382	broad.mit.edu	37	14	67825847	67825847	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67825847delA	uc001xjf.2	-						ATP6V1D_uc001xje.2_Intron|EIF2S1_uc001xjg.2_5'Flank	NM_015994	NP_057078			H(+)-transporting two-sector ATPase						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting two-sector ATPase complex, catalytic domain|vacuolar proton-transporting V-type ATPase complex	protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)|lung(1)	2				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)														---	---	---	---
SLC10A1	6554	broad.mit.edu	37	14	70258022	70258022	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70258022delT	uc001xlr.2	-							NM_003049	NP_003040			solute carrier family 10, member 1						bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(1)	1				all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)														---	---	---	---
SIPA1L1	26037	broad.mit.edu	37	14	72028626	72028626	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72028626delT	uc001xms.2	+						SIPA1L1_uc001xmr.1_Intron|SIPA1L1_uc001xmt.2_Intron	NM_015556	NP_056371			signal-induced proliferation-associated 1 like						actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)														---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72829346	72829346	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72829346delT	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
RGS6	9628	broad.mit.edu	37	14	73026816	73026816	+	Intron	DEL	T	-	-	rs68026599		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73026816delT	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron|RGS6_uc001xmz.1_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
DPF3	8110	broad.mit.edu	37	14	73350634	73350635	+	Intron	INS	-	A	A	rs5809597		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73350634_73350635insA	uc001xnc.2	-						DPF3_uc001xnf.2_Intron|DPF3_uc010ari.1_Intron|DPF3_uc010ttq.1_Intron	NM_012074	NP_036206			D4, zinc and double PHD fingers, family 3						chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	73590855	73590856	+	IGR	INS	-	CTAA	CTAA	rs138065121	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73590855_73590856insCTAA								RBM25 (2781 upstream) : PSEN1 (12287 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	74749812	74749813	+	IGR	INS	-	A	A	rs140567207		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74749812_74749813insA								VSX2 (20378 upstream) : ABCD4 (2167 downstream)																																			---	---	---	---
PGF	5228	broad.mit.edu	37	14	75424118	75424118	+	5'Flank	DEL	T	-	-	rs75780549		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75424118delT	uc010ase.1	-						PGF_uc001xqz.2_5'Flank|PGF_uc001xra.2_5'Flank|PGF_uc001xrb.2_5'Flank|PGF_uc010asf.1_5'Flank	NM_002632	NP_002623			placental growth factor, vascular endothelial						angiogenesis|cell differentiation|cell-cell signaling|positive regulation of cell division|positive regulation of cell proliferation|vascular endothelial growth factor receptor signaling pathway	extracellular region|membrane	growth factor activity|heparin binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00668)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	77191684	77191684	+	IGR	DEL	T	-	-	rs34634614		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77191684delT								ESRRB (223506 upstream) : VASH1 (36551 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	77629110	77629110	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77629110delT								ZDHHC22 (20976 upstream) : TMEM63C (18992 downstream)																																			---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	78693691	78693692	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78693691_78693692insA	uc001xum.1	+											Homo sapiens mRNA for KIAA0743 protein, partial cds.						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	78723486	78723486	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78723486delG	uc001xum.1	+											Homo sapiens mRNA for KIAA0743 protein, partial cds.						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	80244275	80244275	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80244275delA	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc001xup.2_Intron|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
C14orf145	145508	broad.mit.edu	37	14	81363951	81363952	+	Intron	DEL	AG	-	-	rs138062254		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81363951_81363952delAG	uc001xux.2	-						C14orf145_uc001xuz.2_Intron|C14orf145_uc001xuy.1_Intron	NM_152446	NP_689659			hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)														---	---	---	---
STON2	85439	broad.mit.edu	37	14	81792280	81792281	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81792280_81792281insA	uc010tvu.1	-						STON2_uc001xvk.1_Intron	NM_033104	NP_149095			stonin 2						endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding			skin(3)|pancreas(2)	5				BRCA - Breast invasive adenocarcinoma(234;0.0348)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	83187108	83187109	+	IGR	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83187108_83187109delGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	83639930	83639930	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83639930delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	83713966	83713966	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83713966delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84748750	84748751	+	IGR	DEL	AA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84748750_84748751delAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85070122	85070123	+	IGR	INS	-	T	T	rs151006710	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85070122_85070123insT								None (None upstream) : FLRT2 (926365 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	86949923	86949924	+	IGR	INS	-	TGTT	TGTT			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86949923_86949924insTGTT								FLRT2 (855654 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	87992742	87992742	+	IGR	DEL	T	-	-	rs112435076		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87992742delT								None (None upstream) : GALC (311422 downstream)																																			---	---	---	---
ZC3H14	79882	broad.mit.edu	37	14	89066785	89066786	+	Intron	INS	-	T	T	rs72444012		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89066785_89066786insT	uc001xww.2	+						ZC3H14_uc010twd.1_Intron|ZC3H14_uc010twe.1_Intron|ZC3H14_uc001xwx.2_Intron|ZC3H14_uc010twf.1_Intron|ZC3H14_uc001xwy.2_Intron|ZC3H14_uc010twg.1_Intron|ZC3H14_uc001xxa.2_Intron|ZC3H14_uc001xxc.2_Intron|ZC3H14_uc001xxb.2_Intron	NM_024824	NP_079100			zinc finger CCCH-type containing 14 isoform 1							cytoplasm|cytoplasm|nuclear speck	protein binding|RNA binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89790063	89790064	+	Intron	INS	-	AAAC	AAAC	rs143748256	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89790063_89790064insAAAC	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	90011418	90011418	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90011418delA	uc001xxo.3	-						FOXN3_uc010atk.2_Intron|FOXN3_uc001xxp.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
KCNK13	56659	broad.mit.edu	37	14	90637169	90637169	+	Intron	DEL	A	-	-	rs34729492		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90637169delA	uc001xye.1	+							NM_022054	NP_071337			potassium channel, subfamily K, member 13							integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(1)	1		all_cancers(154;0.186)																---	---	---	---
CCDC88C	440193	broad.mit.edu	37	14	91761850	91761850	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91761850delG	uc010aty.2	-							NM_001080414	NP_001073883			DVL-binding protein DAPLE						microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association			ovary(3)	3		all_cancers(154;0.0468)																---	---	---	---
FBLN5	10516	broad.mit.edu	37	14	92347971	92347971	+	Intron	DEL	A	-	-	rs35187606		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92347971delA	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320			fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	92634115	92634119	+	IGR	DEL	TAATG	-	-	rs72079768		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92634115_92634119delTAATG								CPSF2 (3572 upstream) : SLC24A4 (154806 downstream)																																			---	---	---	---
DDX24	57062	broad.mit.edu	37	14	94543027	94543028	+	Intron	DEL	AA	-	-	rs80192775		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94543027_94543028delAA	uc001ycj.2	-						DDX24_uc010twq.1_Intron|DDX24_uc010twr.1_Intron	NM_020414	NP_065147			DEAD (Asp-Glu-Ala-Asp) box polypeptide 24						RNA metabolic process	cytoplasm|nucleolus|nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|skin(1)	4		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	95368353	95368354	+	IGR	INS	-	CATGGA	CATGGA			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95368353_95368354insCATGGA								GSC (131854 upstream) : DICER1 (184211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	95522551	95522552	+	IGR	INS	-	AAAGA	AAAGA	rs148784418	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95522551_95522552insAAAGA								GSC (286052 upstream) : DICER1 (30013 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	95946732	95946732	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95946732delT								C14orf49 (4559 upstream) : SNHG10 (52521 downstream)																																			---	---	---	---
C14orf132	56967	broad.mit.edu	37	14	96540885	96540886	+	Intron	INS	-	T	T	rs34503291		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96540885_96540886insT	uc001yff.3	+							NR_023938				Homo sapiens clone 25027 mRNA sequence.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	97686219	97686220	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97686219_97686220delTG								VRK1 (338269 upstream) : C14orf64 (705727 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99003079	99003080	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99003079_99003080delCA								C14orf64 (558618 upstream) : C14orf177 (174870 downstream)																																			---	---	---	---
BCL11B	64919	broad.mit.edu	37	14	99724681	99724681	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99724681delC	uc001yga.2	-						BCL11B_uc001ygb.2_Intron	NM_138576	NP_612808			B-cell CLL/lymphoma 11B isoform 1							nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)				T	TLX3	T-ALL								---	---	---	---
MEG3	55384	broad.mit.edu	37	14	101304044	101304045	+	Intron	INS	-	C	C	rs148859953	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101304044_101304045insC	uc001yid.1	+						MEG3_uc001yhy.2_Intron|MEG3_uc010txb.1_Intron|MEG3_uc010txc.1_Intron|MEG3_uc001yib.2_Intron|MEG3_uc010txd.1_Intron|MEG3_uc010txe.1_Intron|MEG3_uc001yic.2_Intron|MEG3_uc010txf.1_Intron|MEG3_uc010avz.1_Intron|MEG3_uc001yhw.2_Intron|MEG3_uc001yie.2_Intron|MEG3_uc001yhx.2_Intron|MEG3_uc010txg.1_Intron|MEG3_uc001yhz.2_Intron|MEG3_uc001yia.2_Intron|MEG3_uc010txh.1_Intron|MEG3_uc001yhv.2_Intron					SubName: Full=HCG25025, isoform CRA_b; SubName: Full=Full-length cDNA clone CS0DI033YL14 of Placenta of Homo sapiens (human);												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	101511106	101511106	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101511106delT	uc010awd.2	+						MIR381_hsa-mir-381|MI0000789_5'Flank|MIR487B_hsa-mir-487b|MI0003530_5'Flank|MIR539_hsa-mir-539|MI0003514_5'Flank					DM004803																														---	---	---	---
RCOR1	23186	broad.mit.edu	37	14	103171296	103171297	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103171296_103171297insA	uc001ymb.2	+							NM_015156	NP_055971			REST corepressor 1						blood coagulation|histone H4 deacetylation|interspecies interaction between organisms	transcriptional repressor complex	protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription regulatory region DNA binding			ovary(1)	1																		---	---	---	---
C14orf73	91828	broad.mit.edu	37	14	103571770	103571771	+	Intron	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103571770_103571771delGT	uc001ymk.2	+							NM_001077594	NP_001071062			hypothetical protein LOC91828												0		Melanoma(154;0.155)	Epithelial(46;0.221)													OREG0022947	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
KLC1	3831	broad.mit.edu	37	14	104053862	104053863	+	Intron	DEL	TG	-	-	rs28514618	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104053862_104053863delTG	uc010tyd.1	+						C14orf153_uc001ynl.3_Intron|C14orf153_uc010tyc.1_Intron	NM_005552	NP_005543			kinesin light chain 1 isoform 1						blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	104776251	104776252	+	IGR	INS	-	T	T	rs147153906	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104776251_104776252insT								KIF26A (129017 upstream) : C14orf180 (269804 downstream)																																			---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106156597	106156598	+	Intron	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106156597_106156598delCA	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106731327	106731328	+	Intron	INS	-	T	T	rs150534606	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106731327_106731328insT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106785781	106785781	+	Intron	DEL	G	-	-	rs67203002		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106785781delG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106816850	106816851	+	Intron	INS	-	TTG	TTG	rs140835063	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106816850_106816851insTTG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	107186869	107186869	+	Intron	DEL	T	-	-	rs67553506		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107186869delT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20139078	20139078	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20139078delT								None (None upstream) : GOLGA6L6 (598016 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20144683	20144683	+	IGR	DEL	C	-	-	rs143228371		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20144683delC								None (None upstream) : GOLGA6L6 (592411 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20183076	20183077	+	IGR	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20183076_20183077delGT								None (None upstream) : GOLGA6L6 (554017 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20454589	20454589	+	IGR	DEL	T	-	-	rs71399653		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20454589delT								None (None upstream) : GOLGA6L6 (282505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20514954	20514955	+	IGR	INS	-	ATGAA	ATGAA	rs145597587	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20514954_20514955insATGAA								None (None upstream) : GOLGA6L6 (222139 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20850156	20850159	+	IGR	DEL	ATAA	-	-	rs151226806		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20850156_20850159delATAA								GOLGA8C (69130 upstream) : BCL8 (19897 downstream)																																			---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22324037	22324038	+	Intron	INS	-	TTA	TTA			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22324037_22324038insTTA	uc001yuc.1	+						LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
CYFIP1	23191	broad.mit.edu	37	15	22924055	22924056	+	Intron	INS	-	T	T	rs145457026	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22924055_22924056insT	uc001yus.2	+						CYFIP1_uc001yut.2_Intron|CYFIP1_uc010aya.1_Intron	NM_014608	NP_055423			cytoplasmic FMR1 interacting protein 1 isoform						axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	25788941	25788942	+	IGR	INS	-	T	T	rs67638967		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25788941_25788942insT								UBE3A (104813 upstream) : ATP10A (134920 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	26572864	26572864	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26572864delG								ATP10A (462547 upstream) : GABRB3 (215831 downstream)																																			---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27539371	27539371	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27539371delT	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
FAM189A1	23359	broad.mit.edu	37	15	29740280	29740280	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29740280delA	uc010azk.1	-							NM_015307	NP_056122			hypothetical protein LOC23359							integral to membrane					0																		---	---	---	---
KLF13	51621	broad.mit.edu	37	15	31636299	31636300	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31636299_31636300insA	uc001zfo.2	+							NM_015995	NP_057079			Kruppel-like factor 13						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|zinc ion binding				0		all_lung(180;3.71e-11)		all cancers(64;1.11e-18)|Epithelial(43;1.73e-14)|GBM - Glioblastoma multiforme(186;0.00016)|Colorectal(1;0.00158)|BRCA - Breast invasive adenocarcinoma(123;0.00255)|COAD - Colon adenocarcinoma(236;0.0446)|READ - Rectum adenocarcinoma(1;0.13)|Lung(196;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	33519470	33519471	+	IGR	DEL	TT	-	-	rs75457336	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33519470_33519471delTT								FMN1 (159385 upstream) : RYR3 (83706 downstream)																																			---	---	---	---
AQR	9716	broad.mit.edu	37	15	35174666	35174667	+	Intron	INS	-	AA	AA	rs34949352		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35174666_35174667insAA	uc001ziv.2	-							NM_014691	NP_055506			aquarius							catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	35971596	35971596	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35971596delC	uc001zjc.2	+											Homo sapiens, Similar to LOC161538, clone IMAGE:5199550, mRNA.																														---	---	---	---
C15orf41	84529	broad.mit.edu	37	15	37015157	37015158	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37015157_37015158delTG	uc001zje.3	+						C15orf41_uc001zjd.2_Intron|C15orf41_uc010bbb.1_Intron|C15orf41_uc001zjf.2_Intron|C15orf41_uc010uci.1_Intron	NM_001130010	NP_001123482			hypothetical protein LOC84529 isoform 1								protein binding			pancreas(1)	1		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)														---	---	---	---
LOC145845	145845	broad.mit.edu	37	15	37162836	37162836	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37162836delT	uc001zji.2	-							NR_024264				Homo sapiens cDNA FLJ13192 fis, clone NT2RP3004341.												0																		---	---	---	---
MEIS2	4212	broad.mit.edu	37	15	37323622	37323623	+	Intron	INS	-	TG	TG	rs138775214	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37323622_37323623insTG	uc001zjr.2	-						MEIS2_uc001zjl.2_Intron|MEIS2_uc010ucj.1_Intron|MEIS2_uc001zjm.2_Intron|MEIS2_uc001zjn.2_Intron|MEIS2_uc001zjo.2_Intron|MEIS2_uc001zjp.2_Intron|MEIS2_uc001zjs.2_Intron|MEIS2_uc001zju.2_Intron|MEIS2_uc001zjt.2_Intron	NM_170675	NP_733775			Meis homeobox 2 isoform c						negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)	2		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	38914824	38914825	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38914824_38914825insT								RASGRP1 (57817 upstream) : C15orf53 (73974 downstream)																																			---	---	---	---
C15orf57	90416	broad.mit.edu	37	15	40835339	40835340	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40835339_40835340insA	uc001zly.2	-						uc001zlx.1_Intron|MRPL42P5_uc010bbq.1_Intron	NM_052849	NP_443081			coiled-coil domain containing 32 isoform a											ovary(1)	1																		---	---	---	---
HAUS2	55142	broad.mit.edu	37	15	42842483	42842483	+	Intron	DEL	A	-	-	rs72070315		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42842483delA	uc001zqe.2	+						HAUS2_uc010udi.1_Intron|HAUS2_uc001zqf.2_Intron|LRRC57_uc001zqd.1_5'Flank|LRRC57_uc001zqc.2_5'Flank	NM_018097	NP_060567			centrosomal protein 27kDa isoform 1						cell division|centrosome organization|G2/M transition of mitotic cell cycle|mitosis|spindle assembly	centrosome|cytosol|HAUS complex|microtubule|spindle					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	42874421	42874422	+	Intron	DEL	GG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42874421_42874422delGG	uc001zqg.2	+											Homo sapiens cDNA FLJ16106 fis, clone THYMU1000496, moderately similar to KINESIN-LIKE PROTEIN KIF1C.																														---	---	---	---
FRMD5	84978	broad.mit.edu	37	15	44192817	44192818	+	Intron	INS	-	T	T	rs678513	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44192817_44192818insT	uc001ztl.2	-						FRMD5_uc001ztj.1_Intron|FRMD5_uc001ztk.1_Intron|FRMD5_uc001ztm.2_Intron|FRMD5_uc001ztn.2_Intron	NM_032892	NP_116281			FERM domain containing 5 isoform 2							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)														---	---	---	---
SPATA5L1	79029	broad.mit.edu	37	15	45708122	45708122	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45708122delT	uc001zve.2	+						SPATA5L1_uc001zvf.2_Intron	NM_024063	NP_076968			spermatogenesis associated 5-like 1							cytoplasm	ATP binding|nucleoside-triphosphatase activity			ovary(3)|skin(1)	4		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)														---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	47714290	47714291	+	Intron	INS	-	T	T	rs148157267	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47714290_47714291insT	uc001zvw.2	+							NM_020858	NP_065909			semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	49345641	49345641	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49345641delA								SECISBP2L (7011 upstream) : COPS2 (71832 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	50708315	50708316	+	IGR	INS	-	AC	AC	rs145918653	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50708315_50708316insAC								LOC100129387 (57814 upstream) : USP8 (8263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	51159485	51159485	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51159485delG								SPPL2A (101575 upstream) : AP4E1 (41461 downstream)																																			---	---	---	---
KIAA1370	56204	broad.mit.edu	37	15	52916109	52916109	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52916109delC	uc002acg.3	-						KIAA1370_uc002ach.3_Intron|KIAA1370_uc010bfg.1_Intron|KIAA1370_uc010ugf.1_Intron	NM_019600	NP_062546			hypothetical protein LOC56204												0				all cancers(107;0.0803)														---	---	---	---
PRTG	283659	broad.mit.edu	37	15	55916374	55916376	+	Intron	DEL	CCT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55916374_55916376delCCT	uc002adg.2	-							NM_173814	NP_776175			protogenin precursor						multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)														---	---	---	---
NEDD4	4734	broad.mit.edu	37	15	56213073	56213073	+	Intron	DEL	A	-	-	rs78910147		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56213073delA	uc002adl.2	-							NM_006154	NP_006145			neural precursor cell expressed, developmentally						development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	56829093	56829093	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56829093delT								MNS1 (71758 upstream) : ZNF280D (93283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	58010118	58010121	+	IGR	DEL	GTTT	-	-	rs149534218		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58010118_58010121delGTTT								GCOM1 (366 upstream) : ALDH1A2 (235507 downstream)																																			---	---	---	---
ALDH1A2	8854	broad.mit.edu	37	15	58356175	58356175	+	Intron	DEL	T	-	-	rs4646551		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58356175delT	uc002aex.2	-						ALDH1A2_uc002aey.2_Intron|ALDH1A2_uc010ugv.1_Intron|ALDH1A2_uc010ugw.1_Intron	NM_003888	NP_003879			aldehyde dehydrogenase 1A2 isoform 1						negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	58611555	58611555	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58611555delT								ALDH1A2 (40093 upstream) : LIPC (91220 downstream)																																			---	---	---	---
MYO1E	4643	broad.mit.edu	37	15	59439995	59439996	+	Intron	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59439995_59439996delGT	uc002aga.2	-							NM_004998	NP_004989			myosin IE						actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	59818024	59818024	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59818024delA								FAM81A (2273 upstream) : GCNT3 (85958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	60504782	60504782	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60504782delT								FOXB1 (176374 upstream) : ANXA2 (134569 downstream)																																			---	---	---	---
ANXA2	302	broad.mit.edu	37	15	60674251	60674258	+	Intron	DEL	GGGAGGGA	-	-	rs66471857		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60674251_60674258delGGGAGGGA	uc002agn.2	-						ANXA2_uc002agk.2_Intron|ANXA2_uc002agl.2_Intron|ANXA2_uc002agm.2_Intron|ANXA2_uc010uhd.1_Intron|ANXA2_uc010bgj.2_Intron	NM_001136015	NP_001129487			annexin A2 isoform 2						angiogenesis|positive regulation of vesicle fusion|skeletal system development	basement membrane|melanosome|midbody|soluble fraction	calcium ion binding|calcium-dependent phospholipid binding|cytoskeletal protein binding|phospholipase inhibitor activity			ovary(1)	1					Alteplase(DB00009)|Anistreplase(DB00029)|Tenecteplase(DB00031)													---	---	---	---
RORA	6095	broad.mit.edu	37	15	60945498	60945499	+	Intron	DEL	GT	-	-	rs67500110		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60945498_60945499delGT	uc002agx.2	-							NM_134261	NP_599023			RAR-related orphan receptor A isoform a						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
RORA	6095	broad.mit.edu	37	15	61125811	61125811	+	Intron	DEL	C	-	-	rs149904365		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61125811delC	uc002agx.2	-							NM_134261	NP_599023			RAR-related orphan receptor A isoform a						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	61871605	61871606	+	IGR	INS	-	T	T	rs34207848		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61871605_61871606insT								RORA (350103 upstream) : VPS13C (272986 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	62355715	62355716	+	IGR	INS	-	A	A	rs145985740	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62355715_62355716insA								VPS13C (3068 upstream) : C2CD4A (3460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	64173391	64173392	+	IGR	INS	-	T	T	rs11374621		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64173391_64173392insT								MIR422A (10173 upstream) : DAPK2 (25844 downstream)																																			---	---	---	---
CSNK1G1	53944	broad.mit.edu	37	15	64522502	64522502	+	Intron	DEL	T	-	-	rs80275003		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64522502delT	uc002anf.2	-						CSNK1G1_uc002ane.2_Intron|CSNK1G1_uc002ang.1_Intron|CSNK1G1_uc002anh.1_Intron|CSNK1G1_uc002anj.2_Intron	NM_022048	NP_071331			casein kinase 1, gamma 1						Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity				0																		---	---	---	---
DENND4A	10260	broad.mit.edu	37	15	66057822	66057822	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66057822delG	uc002aph.2	-						DENND4A_uc002api.2_Intron|DENND4A_uc002apj.3_Intron|DENND4A_uc010ujj.1_Intron	NM_005848	NP_005839			DENN/MADD domain containing 4A isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4																		---	---	---	---
MAP2K1	5604	broad.mit.edu	37	15	66734833	66734834	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66734833_66734834insA	uc010bhq.2	+						MAP2K1_uc010ujp.1_Intron	NM_002755	NP_002746			mitogen-activated protein kinase kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0														Cardiofaciocutaneous_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	15	67270939	67270939	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67270939delT								SMAD6 (196604 upstream) : SMAD3 (87256 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	67332887	67332888	+	IGR	INS	-	TT	TT	rs5813422		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67332887_67332888insTT								SMAD6 (258552 upstream) : SMAD3 (25307 downstream)																																			---	---	---	---
SMAD3	4088	broad.mit.edu	37	15	67461645	67461645	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67461645delA	uc002aqj.2	+						SMAD3_uc010ujr.1_Intron|SMAD3_uc010ujs.1_Intron|SMAD3_uc010ujt.1_Intron	NM_005902	NP_005893			mothers against decapentaplegic homolog 3						activation of caspase activity|cell cycle arrest|cell-cell junction organization|evasion of host defenses by virus|immune response|induction of apoptosis|negative regulation of cell growth|negative regulation of mitotic cell cycle|negative regulation of protein catabolic process|negative regulation of protein phosphorylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|protein stabilization|regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|transport|wound healing	cytosol|nuclear inner membrane|receptor complex	beta-catenin binding|co-SMAD binding|metal ion binding|protein homodimerization activity|protein kinase binding|R-SMAD binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor binding|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding			large_intestine(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	70711283	70711283	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70711283delG								TLE3 (321027 upstream) : UACA (235612 downstream)																																			---	---	---	---
THSD4	79875	broad.mit.edu	37	15	71754666	71754666	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71754666delT	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	73665945	73665946	+	IGR	INS	-	A	A	rs145153685	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73665945_73665946insA								HCN4 (4340 upstream) : C15orf60 (69553 downstream)																																			---	---	---	---
SGK269	79834	broad.mit.edu	37	15	77405003	77405008	+	3'UTR	DEL	ACACAC	-	-	rs10539940		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77405003_77405008delACACAC	uc002bcm.2	-	6						NM_024776	NP_079052			NKF3 kinase family member						cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	78089053	78089054	+	IGR	INS	-	T	T	rs59535084		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78089053_78089054insT								LINGO1 (100578 upstream) : LOC645752 (117505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	78102689	78102690	+	IGR	DEL	CA	-	-	rs74598005		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78102689_78102690delCA								LINGO1 (114214 upstream) : LOC645752 (103869 downstream)																																			---	---	---	---
ARNT2	9915	broad.mit.edu	37	15	80797126	80797126	+	Intron	DEL	T	-	-	rs113534629		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80797126delT	uc002bfr.2	+						ARNT2_uc010unm.1_Intron|ARNT2_uc002bfs.2_Intron	NM_014862	NP_055677			aryl hydrocarbon receptor nuclear translocator						central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	81324787	81324787	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81324787delT								MESDC1 (28443 upstream) : C15orf26 (66962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	81325811	81325811	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81325811delT								MESDC1 (29467 upstream) : C15orf26 (65938 downstream)																																			---	---	---	---
IL16	3603	broad.mit.edu	37	15	81523566	81523566	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81523566delA	uc002bgh.3	+						IL16_uc002bgc.2_Intron|IL16_uc010blq.1_Intron|IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron	NM_172217	NP_757366			interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	81624029	81624029	+	IGR	DEL	G	-	-	rs143180945		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81624029delG								STARD5 (7505 upstream) : TMC3 (731 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	83421175	83421176	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83421175_83421176insT								AP3B2 (42540 upstream) : SCARNA15 (3521 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	86470717	86470717	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86470717delT								KLHL25 (132528 upstream) : AGBL1 (214525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	86550125	86550126	+	IGR	INS	-	ATC	ATC	rs139715459	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86550125_86550126insATC								KLHL25 (211936 upstream) : AGBL1 (135116 downstream)																																			---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	87428044	87428045	+	Intron	INS	-	AAAC	AAAC	rs145696887	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87428044_87428045insAAAC	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	87557042	87557045	+	Intron	DEL	AGTT	-	-	rs146240814		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87557042_87557045delAGTT	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	88224897	88224899	+	IGR	DEL	AAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88224897_88224899delAAA								NCRNA00052 (101980 upstream) : NTRK3 (195089 downstream)																																			---	---	---	---
RLBP1	6017	broad.mit.edu	37	15	89755856	89755857	+	Intron	INS	-	GT	GT	rs138615112	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89755856_89755857insGT	uc002bnl.2	-							NM_000326	NP_000317			retinaldehyde binding protein 1						response to stimulus|visual perception|vitamin A metabolic process	cytoplasm|soluble fraction	retinol binding|transporter activity			central_nervous_system(1)	1	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)													---	---	---	---
C15orf42	90381	broad.mit.edu	37	15	90156774	90156775	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90156774_90156775delTG	uc002boe.2	+							NM_152259	NP_689472			leucine-rich repeat kinase 1						cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	92880365	92880366	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92880365_92880366insT								SLCO3A1 (164700 upstream) : ST8SIA2 (56774 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	94116066	94116067	+	IGR	INS	-	CCTCCCTC	CCTCCCTC	rs150224649	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94116066_94116067insCCTCCCTC								RGMA (483633 upstream) : MCTP2 (658734 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96721621	96721621	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96721621delT								LOC145820 (670547 upstream) : NR2F2 (147536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96811972	96811973	+	IGR	INS	-	CTC	CTC	rs3833034		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96811972_96811973insCTC								LOC145820 (760898 upstream) : NR2F2 (57184 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96841309	96841310	+	Intron	DEL	AG	-	-	rs10544300		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96841309_96841310delAG	uc010bol.1	-						uc002bto.1_Intron					Homo sapiens cDNA FLJ10010 fis, clone HEMBA1000302.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	97084152	97084153	+	IGR	INS	-	GA	GA	rs139696623	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97084152_97084153insGA								NR2F2 (200662 upstream) : SPATA8 (242526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97458088	97458089	+	IGR	INS	-	TT	TT	rs71772203		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97458088_97458089insTT								SPATA8 (129244 upstream) : LOC91948 (827757 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97787614	97787614	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97787614delT								SPATA8 (458770 upstream) : LOC91948 (498232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	98789354	98789354	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98789354delT								ARRDC4 (272287 upstream) : FAM169B (191037 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	98884400	98884401	+	IGR	DEL	AA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98884400_98884401delAA								ARRDC4 (367333 upstream) : FAM169B (95990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	99577805	99577805	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99577805delT								PGPEP1L (26781 upstream) : SYNM (67481 downstream)																																			---	---	---	---
SYNM	23336	broad.mit.edu	37	15	99654982	99654983	+	Intron	INS	-	C	C	rs139805932	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99654982_99654983insC	uc002bup.2	+						SYNM_uc002buo.2_Intron|SYNM_uc002buq.2_Intron	NM_145728	NP_663780			desmuslin isoform A						intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
TTC23	64927	broad.mit.edu	37	15	99753212	99753212	+	Intron	DEL	G	-	-	rs56165340		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99753212delG	uc002bur.2	-						TTC23_uc002bus.2_Intron|TTC23_uc002but.2_Intron|TTC23_uc002buu.2_Intron|TTC23_uc002buv.2_Intron|TTC23_uc002bux.2_Intron|TTC23_uc002buw.2_Intron|TTC23_uc010boq.2_Intron|TTC23_uc002buy.2_Intron|TTC23_uc010bor.2_Intron|TTC23_uc002buz.2_Intron	NM_022905	NP_075056			tetratricopeptide repeat domain 23								binding				0	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	100023642	100023643	+	IGR	INS	-	T	T	rs34337413		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100023642_100023643insT								LRRC28 (96362 upstream) : MEF2A (82490 downstream)																																			---	---	---	---
MEF2A	4205	broad.mit.edu	37	15	100241364	100241364	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100241364delA	uc010urw.1	+						MEF2A_uc010urv.1_Intron|MEF2A_uc010bos.2_Intron|MEF2A_uc002bvf.2_Intron|MEF2A_uc002bve.2_Intron|MEF2A_uc002bvg.2_Intron|MEF2A_uc002bvi.2_Intron|MEF2A_uc010bot.2_Intron	NM_005587	NP_005578			myocyte enhancer factor 2A isoform 1						apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)															---	---	---	---
LYSMD4	145748	broad.mit.edu	37	15	100257796	100257797	+	RNA	INS	-	CAGCTGTTG	CAGCTGTTG	rs142692538	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100257796_100257797insCAGCTGTTG	uc002bvj.1	-	3		c.491_492insCAACAGCTG			LYSMD4_uc010bou.1_RNA					Homo sapiens cDNA FLJ32156 fis, clone PLACE6000137.						cell wall macromolecule catabolic process	integral to membrane					0	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00162)|LUSC - Lung squamous cell carcinoma(107;0.17)|Lung(145;0.208)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	102283689	102283689	+	5'Flank	DEL	A	-	-	rs113945974		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102283689delA	uc010usj.1	+											RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	102374410	102374411	+	IGR	DEL	AA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102374410_102374411delAA								OR4F15 (15084 upstream) : OR4F4 (87934 downstream)																																			---	---	---	---
RAB11FIP3	9727	broad.mit.edu	37	16	512984	512984	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:512984delT	uc002chf.2	+							NM_014700	NP_055515			rab11-family interacting protein 3 isoform 1						cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding				0		Hepatocellular(16;0.0218)																---	---	---	---
ABCA3	21	broad.mit.edu	37	16	2366310	2366310	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2366310delA	uc002cpy.1	-						ABCA3_uc010bsk.1_Intron|ABCA3_uc010bsl.1_Intron	NM_001089	NP_001080			ATP-binding cassette, sub-family A member 3						response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)																---	---	---	---
TBC1D24	57465	broad.mit.edu	37	16	2567775	2567776	+	Intron	INS	-	T	T	rs140250664	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2567775_2567776insT	uc002cqm.2	+						ATP6V0C_uc002cqn.2_Intron|ATP6V0C_uc002cqo.2_5'Flank|AMDHD2_uc002cqp.2_5'Flank|AMDHD2_uc002cqq.2_5'Flank|AMDHD2_uc010uwc.1_5'Flank|AMDHD2_uc010uwd.1_5'Flank	NM_020705	NP_065756			TBC1 domain family, member 24						neuron projection development	cytoplasm	protein binding|Rab GTPase activator activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	4352262	4352262	+	IGR	DEL	T	-	-	rs113425472		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4352262delT								TFAP4 (29261 upstream) : GLIS2 (29963 downstream)																																			---	---	---	---
HMOX2	3163	broad.mit.edu	37	16	4540918	4540919	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4540918_4540919delTG	uc010bts.2	+						HMOX2_uc002cwr.3_Intron|HMOX2_uc002cwq.3_Intron|HMOX2_uc002cws.3_Intron	NM_001127206	NP_001120678			heme oxygenase (decyclizing) 2						cellular iron ion homeostasis|heme catabolic process|heme oxidation|response to hypoxia|transmembrane transport	endoplasmic reticulum membrane|microsome|plasma membrane	electron carrier activity|heme oxygenase (decyclizing) activity|metal ion binding|protein binding				0					NADH(DB00157)													---	---	---	---
C16orf5	29965	broad.mit.edu	37	16	4589947	4589947	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4589947delT	uc002cwv.2	-						C16orf5_uc002cww.2_5'Flank|C16orf5_uc010uxl.1_5'Flank|C16orf5_uc010uxm.1_5'Flank|C16orf5_uc010btu.2_5'Flank	NM_013399	NP_037531			cell death inducing protein						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|tumor necrosis factor-mediated signaling pathway	nucleus				ovary(1)	1		Ovarian(90;0.17)																---	---	---	---
GLYR1	84656	broad.mit.edu	37	16	4875657	4875658	+	Intron	INS	-	T	T	rs112834357		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4875657_4875658insT	uc002cxx.3	-						GLYR1_uc002cxy.2_Intron|GLYR1_uc002cxz.1_Intron|GLYR1_uc002cya.2_Intron|GLYR1_uc010uxv.1_Intron	NM_032569	NP_115958			cytokine-like nuclear factor n-pac						pentose-phosphate shunt	nucleus	coenzyme binding|DNA binding|methylated histone residue binding|phosphogluconate dehydrogenase (decarboxylating) activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	6011170	6011171	+	IGR	INS	-	T	T	rs147075300	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6011170_6011171insT								FAM86A (863381 upstream) : A2BP1 (57961 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	6035323	6035324	+	IGR	INS	-	A	A	rs147235325	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6035323_6035324insA								FAM86A (887534 upstream) : A2BP1 (33808 downstream)																																			---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	6156304	6156305	+	Intron	INS	-	A	A	rs141909226	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6156304_6156305insA	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7249328	7249329	+	Intron	INS	-	T	T	rs146222145	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7249328_7249329insT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7718664	7718665	+	Intron	DEL	AC	-	-	rs71394334		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7718664_7718665delAC	uc002cys.2	+						A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	7895523	7895524	+	IGR	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7895523_7895524delTC								A2BP1 (132183 upstream) : TMEM114 (723979 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	8348210	8348210	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8348210delA								A2BP1 (584870 upstream) : TMEM114 (271293 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	9269515	9269515	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9269515delT								C16orf72 (55970 upstream) : GRIN2A (577752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	11314794	11314794	+	IGR	DEL	G	-	-	rs113980144		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11314794delG								CLEC16A (38750 upstream) : C16orf75 (28712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	11598418	11598419	+	IGR	INS	-	A	A	rs74506112		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11598418_11598419insA								C16orf75 (152801 upstream) : LITAF (43163 downstream)																																			---	---	---	---
TXNDC11	51061	broad.mit.edu	37	16	11811676	11811677	+	Intron	INS	-	A	A	rs76311516		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11811676_11811677insA	uc010buu.1	-						TXNDC11_uc002dbg.1_Intron	NM_015914	NP_056998			thioredoxin domain containing 11						cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane					0																		---	---	---	---
CPPED1	55313	broad.mit.edu	37	16	12826309	12826310	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12826309_12826310delAC	uc002dca.3	-						CPPED1_uc002dcb.3_Intron	NM_018340	NP_060810			calcineurin-like phosphoesterase domain								hydrolase activity|metal ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	12949507	12949508	+	IGR	INS	-	A	A	rs77967297		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12949507_12949508insA								CPPED1 (51763 upstream) : SHISA9 (45969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	13858455	13858455	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13858455delA								SHISA9 (524183 upstream) : ERCC4 (155559 downstream)																																			---	---	---	---
MKL2	57496	broad.mit.edu	37	16	14210023	14210023	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14210023delT	uc010uza.1	+						MKL2_uc002dcg.2_Intron	NM_014048	NP_054767			megakaryoblastic leukemia 2 protein						cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5																		---	---	---	---
MKL2	57496	broad.mit.edu	37	16	14215060	14215061	+	Intron	INS	-	T	T	rs75728032		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14215060_14215061insT	uc010uza.1	+						MKL2_uc002dcg.2_Intron	NM_014048	NP_054767			megakaryoblastic leukemia 2 protein						cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5																		---	---	---	---
MKL2	57496	broad.mit.edu	37	16	14297002	14297002	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14297002delT	uc010uza.1	+						MKL2_uc002dcg.2_Intron|MKL2_uc002dch.2_Intron|MKL2_uc010uzb.1_Intron	NM_014048	NP_054767			megakaryoblastic leukemia 2 protein						cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	17170465	17170466	+	IGR	INS	-	AC	AC	rs142971631	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17170465_17170466insAC								LOC339047 (726028 upstream) : XYLT1 (25717 downstream)																																			---	---	---	---
TMC5	79838	broad.mit.edu	37	16	19443726	19443727	+	Intron	INS	-	AAAC	AAAC	rs34596434		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19443726_19443727insAAAC	uc002dgc.3	+						TMC5_uc010vaq.1_Intron|TMC5_uc002dgb.3_Intron|TMC5_uc010var.1_Intron	NM_001105248	NP_001098718			transmembrane channel-like 5 isoform a							integral to membrane				skin(1)	1																		---	---	---	---
UMOD	7369	broad.mit.edu	37	16	20358347	20358348	+	Intron	INS	-	T	T	rs146909309	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20358347_20358348insT	uc002dgz.2	-						UMOD_uc002dha.2_Intron|UMOD_uc002dhb.2_Intron	NM_003361	NP_003352			uromodulin precursor						cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)|skin(1)	2																		---	---	---	---
ACSM5	54988	broad.mit.edu	37	16	20445005	20445005	+	Intron	DEL	T	-	-	rs67285065		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20445005delT	uc002dhe.2	+							NM_017888	NP_060358			acyl-CoA synthetase medium-chain family member 5						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2																		---	---	---	---
CDR2	1039	broad.mit.edu	37	16	22380609	22380609	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22380609delA	uc002dkn.2	-							NM_001802	NP_001793			cerebellar degeneration-related protein 2							nucleus	protein binding			skin(1)	1				GBM - Glioblastoma multiforme(48;0.0188)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	24532047	24532047	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24532047delA								CACNG3 (158311 upstream) : RBBP6 (16967 downstream)																																			---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	25717890	25717891	+	Intron	INS	-	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25717890_25717891insC	uc002dof.2	+							NM_006040	NP_006031			heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	25736523	25736523	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25736523delT	uc002dof.2	+							NM_006040	NP_006031			heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	26687232	26687232	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26687232delG								HS3ST4 (538224 upstream) : C16orf82 (390987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	27395949	27395952	+	IGR	DEL	TCGC	-	-	rs146185114		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27395949_27395952delTCGC								IL4R (19851 upstream) : IL21R (17771 downstream)																																			---	---	---	---
KIAA0556	23247	broad.mit.edu	37	16	27572330	27572331	+	Intron	INS	-	T	T	rs9922827		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27572330_27572331insT	uc002dow.2	+							NM_015202	NP_056017			hypothetical protein LOC23247											ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	28231585	28231585	+	IGR	DEL	T	-	-	rs150587621		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28231585delT								XPO6 (8395 upstream) : SBK1 (72255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	30601045	30601045	+	IGR	DEL	A	-	-	rs113913048		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30601045delA								ZNF785 (4035 upstream) : ZNF689 (13656 downstream)																																			---	---	---	---
SETD1A	9739	broad.mit.edu	37	16	30984175	30984175	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30984175delA	uc002ead.1	+							NM_014712	NP_055527			SET domain containing 1A						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	32342333	32342335	+	IGR	DEL	TAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32342333_32342335delTAA								HERC2P4 (178459 upstream) : TP53TG3B (342506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32554024	32554025	+	IGR	INS	-	A	A	rs145747086		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32554024_32554025insA								HERC2P4 (390150 upstream) : TP53TG3B (130816 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32841009	32841009	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32841009delT								TP53TG3B (152131 upstream) : SLC6A10P (47788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33340853	33340854	+	IGR	INS	-	TCATTTCATC	TCATTTCATC	rs148830792	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33340853_33340854insTCATTTCATC								SLC6A10P (444390 upstream) : MIR1826 (624654 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33385519	33385519	+	IGR	DEL	T	-	-	rs77185006		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33385519delT								SLC6A10P (489056 upstream) : MIR1826 (579989 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33398556	33398556	+	IGR	DEL	T	-	-	rs112274831		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33398556delT								SLC6A10P (502093 upstream) : MIR1826 (566952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33442556	33442559	+	IGR	DEL	AAGT	-	-	rs56201308		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33442556_33442559delAAGT								SLC6A10P (546093 upstream) : MIR1826 (522949 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33473889	33473890	+	IGR	INS	-	G	G	rs150889862	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33473889_33473890insG								SLC6A10P (577426 upstream) : MIR1826 (491618 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33519736	33519739	+	IGR	DEL	TATA	-	-	rs113502053		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33519736_33519739delTATA								SLC6A10P (623273 upstream) : MIR1826 (445769 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33530741	33530741	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33530741delA								SLC6A10P (634278 upstream) : MIR1826 (434767 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33537029	33537030	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33537029_33537030insT								SLC6A10P (640566 upstream) : MIR1826 (428478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33541941	33541941	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33541941delA								SLC6A10P (645478 upstream) : MIR1826 (423567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33707960	33707961	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33707960_33707961insA								SLC6A10P (811497 upstream) : MIR1826 (257547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33834581	33834582	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33834581_33834582insA								SLC6A10P (938118 upstream) : MIR1826 (130926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33873232	33873234	+	IGR	DEL	GTC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33873232_33873234delGTC								SLC6A10P (976769 upstream) : MIR1826 (92274 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33955276	33955277	+	IGR	INS	-	TG	TG			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33955276_33955277insTG								None (None upstream) : MIR1826 (10231 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34186437	34186437	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34186437delG								MIR1826 (220845 upstream) : UBE2MP1 (217365 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	35237957	35237957	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:35237957delG								LOC146481 (522990 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46451267	46451267	+	IGR	DEL	A	-	-	rs144612178	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46451267delA								None (None upstream) : ANKRD26P1 (51982 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46496453	46496454	+	IGR	DEL	AT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46496453_46496454delAT								None (None upstream) : ANKRD26P1 (6795 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46499562	46499563	+	IGR	INS	-	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46499562_46499563insG								None (None upstream) : ANKRD26P1 (3686 downstream)																																			---	---	---	---
ZNF423	23090	broad.mit.edu	37	16	49850695	49850695	+	Intron	DEL	A	-	-	rs35801600		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49850695delA	uc002efs.2	-							NM_015069	NP_055884			zinc finger protein 423						cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)																---	---	---	---
HEATR3	55027	broad.mit.edu	37	16	50107426	50107426	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50107426delA	uc002efw.2	+						HEATR3_uc002efx.2_Intron	NM_182922	NP_891552			HEAT repeat containing 3								binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	51687465	51687468	+	IGR	DEL	CCTT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51687465_51687468delCCTT								SALL1 (502282 upstream) : TOX3 (784450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51765810	51765810	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51765810delC								SALL1 (580627 upstream) : TOX3 (706108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52195845	52195845	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52195845delT								None (None upstream) : TOX3 (276073 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	54895628	54895628	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54895628delT								IRX3 (575250 upstream) : IRX5 (69483 downstream)																																			---	---	---	---
NUP93	9688	broad.mit.edu	37	16	56869397	56869398	+	Intron	INS	-	G	G	rs142287696	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56869397_56869398insG	uc002eka.2	+						NUP93_uc002ekb.2_Intron|NUP93_uc010vhi.1_Intron	NM_014669	NP_055484			nucleoporin 93kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	58797440	58797447	+	IGR	DEL	TGTGTGTG	-	-	rs112958129		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58797440_58797447delTGTGTGTG								GOT2 (29194 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	58852772	58852773	+	IGR	INS	-	TTT	TTT	rs79571444		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58852772_58852773insTTT								GOT2 (84526 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	58947156	58947156	+	IGR	DEL	T	-	-	rs34979550		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58947156delT								GOT2 (178910 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59166646	59166647	+	IGR	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59166646_59166647delGT								GOT2 (398400 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59530189	59530189	+	IGR	DEL	T	-	-	rs34457097		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59530189delT								GOT2 (761943 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	62626990	62626991	+	IGR	DEL	TC	-	-	rs112029267		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62626990_62626991delTC								CDH8 (556954 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	62919771	62919772	+	IGR	DEL	AA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62919771_62919772delAA								CDH8 (849735 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	62933022	62933023	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62933022_62933023delTG								CDH8 (862986 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63084077	63084078	+	IGR	INS	-	GT	GT	rs146312657	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63084077_63084078insGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63537755	63537755	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63537755delA								None (None upstream) : None (None downstream)																																			---	---	---	---
CMTM4	146223	broad.mit.edu	37	16	66671473	66671473	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66671473delG	uc002epz.2	-						CMTM4_uc002eqa.2_Intron	NM_178818	NP_848933			chemokine-like factor superfamily 4 isoform 1						chemotaxis	extracellular space|integral to membrane	cytokine activity			pancreas(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0811)|Epithelial(162;0.214)														---	---	---	---
CTCF	10664	broad.mit.edu	37	16	67614787	67614787	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67614787delG	uc002etl.2	+						CTCF_uc010cek.2_Intron	NM_006565	NP_006556			CCCTC-binding factor						chromatin modification|chromosome segregation|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|regulation of centromeric sister chromatid cohesion|regulation of molecular function, epigenetic	chromosome, centromeric region|condensed chromosome|nucleolus|nucleoplasm	chromatin insulator sequence binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)														---	---	---	---
TSNAXIP1	55815	broad.mit.edu	37	16	67853549	67853549	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67853549delT	uc002euj.2	+						TSNAXIP1_uc010cep.2_Intron|TSNAXIP1_uc010vjz.1_Intron|TSNAXIP1_uc002euf.3_Intron|TSNAXIP1_uc010vka.1_Intron|TSNAXIP1_uc010vkb.1_Intron|TSNAXIP1_uc002eug.3_Intron|TSNAXIP1_uc002euh.3_Intron|TSNAXIP1_uc002eui.3_Intron|TSNAXIP1_uc002euk.2_5'Flank	NM_018430	NP_060900			translin-associated factor X interacting protein						cell differentiation|multicellular organismal development|spermatogenesis	perinuclear region of cytoplasm					0		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00432)|Epithelial(162;0.0192)|all cancers(182;0.125)														---	---	---	---
EDC4	23644	broad.mit.edu	37	16	67906204	67906205	+	5'Flank	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67906204_67906205insT	uc002eur.2	+						NUTF2_uc002euq.3_RNA|EDC4_uc010cer.2_5'Flank|EDC4_uc010vkg.1_5'Flank	NM_014329	NP_055144			autoantigen RCD8						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|central_nervous_system(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)														---	---	---	---
FUK	197258	broad.mit.edu	37	16	70490923	70490923	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70490923delA	uc002eyy.2	+						FUK_uc010vmb.1_Intron|FUK_uc010cft.2_Intron|FUK_uc002eyz.2_Intron	NM_145059	NP_659496			fucokinase							cytoplasm	ATP binding|fucokinase activity			ovary(1)	1		Ovarian(137;0.0694)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	71349643	71349643	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71349643delT								FTSJD1 (26130 upstream) : CALB2 (42983 downstream)																																			---	---	---	---
PHLPP2	23035	broad.mit.edu	37	16	71711020	71711021	+	Intron	INS	-	AC	AC	rs72523689		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71711020_71711021insAC	uc002fax.2	-						PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_Intron	NM_015020	NP_055835			PH domain and leucine rich repeat protein							cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	72340854	72340855	+	IGR	INS	-	A	A	rs142543161	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72340854_72340855insA								PMFBP1 (134505 upstream) : ZFHX3 (475933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	73283668	73283669	+	IGR	INS	-	A	A	rs144519237	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73283668_73283669insA								HTA (155998 upstream) : None (None downstream)																																			---	---	---	---
ZNRF1	84937	broad.mit.edu	37	16	75073941	75073948	+	Intron	DEL	TTTTTTTT	-	-	rs71378734		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75073941_75073948delTTTTTTTT	uc002fdk.2	+						ZNRF1_uc010vmz.1_Intron|ZNRF1_uc002fdl.1_Intron|ZNRF1_uc010cgr.1_Intron	NM_032268	NP_115644			zinc and ring finger protein 1							cell junction|endosome|lysosome|synaptic vesicle membrane	ligase activity|protein binding|zinc ion binding				0																		---	---	---	---
CFDP1	10428	broad.mit.edu	37	16	75426603	75426603	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75426603delC	uc002fdy.2	-						CFDP1_uc002fdz.2_Intron	NM_006324	NP_006315			craniofacial development protein 1						multicellular organismal development					upper_aerodigestive_tract(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	75763411	75763412	+	IGR	DEL	TT	-	-	rs113700151		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75763411_75763412delTT								TERF2IP (72083 upstream) : CNTNAP4 (547764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	77201759	77201760	+	IGR	INS	-	AG	AG	rs139267959	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77201759_77201760insAG								CNTNAP4 (608624 upstream) : MON1B (23076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	77488800	77488801	+	IGR	INS	-	T	T	rs138795935	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77488800_77488801insT								ADAMTS18 (19789 upstream) : NUDT7 (267610 downstream)																																			---	---	---	---
VAT1L	57687	broad.mit.edu	37	16	77924034	77924034	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77924034delT	uc002ffg.1	+							NM_020927	NP_065978			vesicle amine transport protein 1 homolog (T.								oxidoreductase activity|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
WWOX	51741	broad.mit.edu	37	16	78334892	78334893	+	Intron	INS	-	CCAT	CCAT			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78334892_78334893insCCAT	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457			WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	81458465	81458465	+	IGR	DEL	A	-	-	rs71746468		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81458465delA								GAN (44664 upstream) : CMIP (20310 downstream)																																			---	---	---	---
CMIP	80790	broad.mit.edu	37	16	81486146	81486146	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81486146delG	uc002fgp.2	+							NM_198390	NP_938204			c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	82374516	82374516	+	IGR	DEL	T	-	-	rs5818377		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82374516delT								MPHOSPH6 (170687 upstream) : CDH13 (286062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86053563	86053564	+	IGR	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86053563_86053564delTC								IRF8 (97354 upstream) : LOC732275 (311892 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86783129	86783130	+	IGR	INS	-	T	T	rs148591411	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86783129_86783130insT								FOXL1 (167826 upstream) : FBXO31 (579814 downstream)																																			---	---	---	---
TCF25	22980	broad.mit.edu	37	16	89953712	89953713	+	Intron	DEL	AA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89953712_89953713delAA	uc002fpb.2	+						TCF25_uc002fpc.2_Intron	NM_014972	NP_055787			NULP1						heart development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)														---	---	---	---
GAS8	2622	broad.mit.edu	37	16	90093497	90093498	+	Intron	INS	-	T	T	rs35606607		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90093497_90093498insT	uc002fqi.1	+						GAS8_uc010vps.1_Intron|GAS8_uc002fqh.2_Intron|GAS8_uc010vpt.1_Intron|GAS8_uc010vpu.1_Intron|GAS8_uc010vpv.1_Intron|GAS8_uc010cjc.1_Intron|GAS8_uc010vpw.1_Intron|GAS8_uc002fqj.1_Intron	NM_001481	NP_001472			growth arrest-specific 8						negative regulation of cell proliferation|sperm motility	cilium|Golgi apparatus|microtubule|microtubule basal body|microtubule-based flagellum	protein binding			ovary(1)	1		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)														---	---	---	---
RPH3AL	9501	broad.mit.edu	37	17	203333	203333	+	5'Flank	DEL	A	-	-	rs113666311		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:203333delA	uc002fre.1	-						RPH3AL_uc002frf.1_5'Flank|RPH3AL_uc010cjl.1_5'Flank	NM_006987	NP_008918			rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)														---	---	---	---
NXN	64359	broad.mit.edu	37	17	806022	806023	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:806022_806023insT	uc002fsa.2	-							NM_022463	NP_071908			nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)														---	---	---	---
ABR	29	broad.mit.edu	37	17	1023461	1023462	+	Intron	INS	-	T	T	rs150638312	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1023461_1023462insT	uc002fsd.2	-						ABR_uc002fse.2_Intron|ABR_uc010cjq.1_Intron	NM_021962	NP_068781			active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)														---	---	---	---
SERPINF2	5345	broad.mit.edu	37	17	1649723	1649723	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1649723delT	uc002ftk.1	+						SERPINF2_uc010vqr.1_Intron	NM_000934	NP_000925			alpha-2-antiplasmin isoform a precursor						acute-phase response|fibrinolysis|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Streptokinase(DB00086)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	1815431	1815431	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1815431delT								RPA1 (12583 upstream) : RTN4RL1 (22542 downstream)																																			---	---	---	---
SGSM2	9905	broad.mit.edu	37	17	2257060	2257061	+	Intron	INS	-	A	A	rs147295902	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2257060_2257061insA	uc002fun.3	+						SGSM2_uc002fum.3_Intron|SGSM2_uc010vqw.1_Intron	NM_001098509	NP_001091979			RUN and TBC1 domain containing 1 isoform 2							intracellular	Rab GTPase activator activity				0				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)														---	---	---	---
PELP1	27043	broad.mit.edu	37	17	4582328	4582328	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4582328delT	uc002fyi.3	-						PELP1_uc010vsf.1_Intron	NM_014389	NP_055204			proline, glutamic acid and leucine rich protein						transcription, DNA-dependent	cytoplasm|MLL1 complex	protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	5671310	5671311	+	IGR	DEL	TT	-	-	rs113020465		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5671310_5671311delTT								NLRP1 (183478 upstream) : WSCD1 (301126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	6238982	6238982	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6238982delT								WSCD1 (211237 upstream) : AIPL1 (88078 downstream)																																			---	---	---	---
KIAA0753	9851	broad.mit.edu	37	17	6519950	6519950	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6519950delG	uc002gde.3	-						KIAA0753_uc010vtd.1_Intron|KIAA0753_uc010clo.2_Intron|KIAA0753_uc010vte.1_Intron	NM_014804	NP_055619			hypothetical protein LOC9851							centrosome					0				COAD - Colon adenocarcinoma(228;0.157)														---	---	---	---
SLC25A35	399512	broad.mit.edu	37	17	8199739	8199740	+	5'Flank	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8199739_8199740insT	uc002gla.3	-						SLC25A35_uc002gku.1_5'Flank|SLC25A35_uc002gkt.2_5'Flank|SLC25A35_uc002gkz.1_5'Flank	NM_201520	NP_958928			solute carrier family 25, member 35						transport	integral to membrane|mitochondrial inner membrane					0																		---	---	---	---
MYH10	4628	broad.mit.edu	37	17	8485736	8485737	+	Intron	DEL	TT	-	-	rs71361806		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8485736_8485737delTT	uc002gll.2	-						MYH10_uc002glm.2_Intron|MYH10_uc010cnx.2_Intron	NM_005964	NP_005955			myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2																		---	---	---	---
GAS7	8522	broad.mit.edu	37	17	9993487	9993487	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9993487delA	uc002gmg.1	-						GAS7_uc010coh.1_Intron	NM_201433	NP_958839			growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2								T	MLL	AML*								---	---	---	---
Unknown	0	broad.mit.edu	37	17	10564300	10564300	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10564300delT								MYH3 (4835 upstream) : SCO1 (19351 downstream)																																			---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11815342	11815343	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11815342_11815343insT	uc002gne.2	+						DNAH9_uc010coo.2_Intron|DNAH9_uc002gnf.2_Intron|DNAH9_uc010vvh.1_Intron	NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	12401872	12401873	+	IGR	INS	-	T	T	rs142618594	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12401872_12401873insT								MAP2K4 (354822 upstream) : MYOCD (167334 downstream)																																			---	---	---	---
RICH2	9912	broad.mit.edu	37	17	12881690	12881691	+	Intron	INS	-	T	T	rs142033025	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12881690_12881691insT	uc002gnr.3	+						RICH2_uc010vvk.1_Intron|RICH2_uc010vvl.1_Intron|RICH2_uc002gns.3_Intron|RICH2_uc010vvm.1_Intron|RICH2_uc010vvn.1_Intron	NM_014859	NP_055674			Rho GTPase-activating protein RICH2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	13648691	13648691	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13648691delG								HS3ST3A1 (143447 upstream) : CDRT15P (279124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	14112310	14112311	+	IGR	DEL	CA	-	-	rs139737760		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14112310_14112311delCA								COX10 (318 upstream) : CDRT15 (26864 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	15067012	15067012	+	IGR	DEL	A	-	-	rs112922616		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15067012delA								HS3ST3B1 (817520 upstream) : PMP22 (66085 downstream)																																			---	---	---	---
TRIM16	10626	broad.mit.edu	37	17	15577859	15577859	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15577859delG	uc002gox.2	-						TRIM16_uc002goy.2_Intron	NM_006470	NP_006461			tripartite motif-containing 16						histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)														---	---	---	---
LRRC48	83450	broad.mit.edu	37	17	17903614	17903615	+	Intron	DEL	GT	-	-	rs68125224		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17903614_17903615delGT	uc010vxd.1	+						LRRC48_uc002gsa.2_Intron|LRRC48_uc010vxc.1_Intron|LRRC48_uc002gsb.2_Intron|LRRC48_uc010vxe.1_Intron	NM_001130090	NP_001123562			leucine rich repeat containing 48 isoform a							cytoplasm				pancreas(1)	1	all_neural(463;0.228)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	19345720	19345720	+	IGR	DEL	A	-	-	rs146080531		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19345720delA								RNF112 (25133 upstream) : SLC47A1 (91447 downstream)																																			---	---	---	---
CYTSB	92521	broad.mit.edu	37	17	20140629	20140630	+	Intron	DEL	TT	-	-	rs67408271		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20140629_20140630delTT	uc002gwq.2	+						CYTSB_uc002gws.2_Intron|CYTSB_uc002gwv.2_Intron|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Intron	NM_001033553	NP_001028725			spectrin domain with coiled-coils 1 NSP5b3b							nucleus					0																		---	---	---	---
CCDC144NL	339184	broad.mit.edu	37	17	20774533	20774534	+	Intron	INS	-	AAT	AAT	rs111531776		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20774533_20774534insAAT	uc002gyf.2	-						uc002gyg.1_Intron|uc002gyh.1_Intron	NM_001004306	NP_001004306			coiled-coil domain containing 144 family,												0																		---	---	---	---
MAP2K3	5606	broad.mit.edu	37	17	21210484	21210485	+	Intron	INS	-	A	A	rs143826793		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21210484_21210485insA	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731			mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	21227396	21227396	+	IGR	DEL	G	-	-	rs66676557		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21227396delG								MAP2K3 (8847 upstream) : KCNJ12 (52303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21341833	21341833	+	IGR	DEL	G	-	-	rs63315060		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21341833delG								KCNJ12 (18654 upstream) : C17orf51 (89739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21530529	21530531	+	IGR	DEL	CTG	-	-	rs113355264		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21530529_21530531delCTG								C17orf51 (52798 upstream) : FAM27L (294839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21553859	21553859	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21553859delA								C17orf51 (76128 upstream) : FAM27L (271511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21561015	21561020	+	IGR	DEL	ACACAA	-	-	rs71371070		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21561015_21561020delACACAA								C17orf51 (83284 upstream) : FAM27L (264350 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21561692	21561692	+	IGR	DEL	G	-	-	rs79167069		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21561692delG								C17orf51 (83961 upstream) : FAM27L (263678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25278196	25278197	+	IGR	INS	-	AT	AT	rs62050990		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25278196_25278197insAT								None (None upstream) : WSB1 (342909 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25308627	25308627	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25308627delT								None (None upstream) : WSB1 (312479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	26045402	26045402	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26045402delG								LGALS9 (68817 upstream) : NOS2 (38391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	27654479	27654480	+	IGR	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27654479_27654480delAG								NUFIP2 (33313 upstream) : TAOK1 (63463 downstream)																																			---	---	---	---
TAOK1	57551	broad.mit.edu	37	17	27820513	27820513	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27820513delA	uc002hdz.1	+						TAOK1_uc010wbe.1_Intron|TAOK1_uc010wbf.1_Intron|TAOK1_uc002heb.1_Intron	NM_020791	NP_065842			TAO kinase 1						mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)															---	---	---	---
CPD	1362	broad.mit.edu	37	17	28714131	28714133	+	Intron	DEL	TTG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28714131_28714133delTTG	uc002hfb.1	+						CPD_uc010wbo.1_Intron|CPD_uc010wbp.1_Intron	NM_001304	NP_001295			carboxypeptidase D precursor						proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2																		---	---	---	---
GOSR1	9527	broad.mit.edu	37	17	28815127	28815127	+	Intron	DEL	T	-	-	rs34393041		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28815127delT	uc002hfe.2	+						GOSR1_uc002hfd.2_Intron|GOSR1_uc002hff.2_Intron	NM_004871	NP_004862			golgi SNAP receptor complex member 1 isoform 1						intra-Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|SNARE complex	SNAP receptor activity				0																		---	---	---	---
RAB11FIP4	84440	broad.mit.edu	37	17	29814478	29814479	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29814478_29814479insT	uc002hgn.1	+						RAB11FIP4_uc002hgo.2_5'Flank	NM_032932	NP_116321			RAB11 family interacting protein 4 (class II)						cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding			skin(1)	1		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	30259987	30259987	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30259987delT								UTP6 (31258 upstream) : SUZ12 (4057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	30736025	30736026	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30736025_30736026insT								ZNF207 (28050 upstream) : PSMD11 (35476 downstream)																																			---	---	---	---
MYO1D	4642	broad.mit.edu	37	17	30908555	30908556	+	Intron	DEL	CT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30908555_30908556delCT	uc002hho.1	-							NM_015194	NP_056009			myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)															---	---	---	---
MYO1D	4642	broad.mit.edu	37	17	31064381	31064381	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31064381delT	uc002hho.1	-						MYO1D_uc002hhp.1_Intron	NM_015194	NP_056009			myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)															---	---	---	---
MYO1D	4642	broad.mit.edu	37	17	31184603	31184603	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31184603delA	uc002hho.1	-						MYO1D_uc002hhp.1_Intron|MYO1D_uc010wcb.1_Intron	NM_015194	NP_056009			myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)															---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31488643	31488643	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31488643delT	uc002hhu.2	-						ACCN1_uc002hht.2_Intron	NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
ACCN1	40	broad.mit.edu	37	17	32240438	32240438	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32240438delT	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	33335648	33335648	+	RNA	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33335648delT	uc002hil.2	+	1		c.2321delT								Homo sapiens cDNA FLJ34173 fis, clone FCBBF3015809.																														---	---	---	---
CCL16	6360	broad.mit.edu	37	17	34310104	34310105	+	5'Flank	INS	-	CATC	CATC			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34310104_34310105insCATC	uc002hkl.2	-						CCL16_uc002hkm.2_5'Flank|uc002hkq.2_5'Flank	NM_004590	NP_004581			small inducible cytokine A16 precursor						cell-cell signaling|immune response|inflammatory response	extracellular space	chemoattractant activity|chemokine activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	35205116	35205116	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35205116delG								MRM1 (239710 upstream) : LHX1 (89383 downstream)																																			---	---	---	---
ACACA	31	broad.mit.edu	37	17	35644658	35644659	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35644658_35644659insA	uc002hnm.2	-						ACACA_uc002hnk.2_Intron|ACACA_uc002hnl.2_Intron|ACACA_uc002hnn.2_Intron|ACACA_uc002hno.2_Intron|ACACA_uc010cuz.2_Intron|ACACA_uc002hnq.2_Intron|ACACA_uc002hnp.1_Intron	NM_198836	NP_942133			acetyl-Coenzyme A carboxylase alpha isoform 2						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	36124199	36124200	+	IGR	INS	-	T	T	rs147137988	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36124199_36124200insT								HNF1B (19103 upstream) : LOC284100 (78373 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	36420161	36420162	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36420161_36420162insT	uc002hpx.2	-											Homo sapiens cDNA FLJ43844 fis, clone TESTI4006308, highly  similar to Puromycin-sensitive aminopeptidase (EC 3.4.11.-).																														---	---	---	---
BRCA1	672	broad.mit.edu	37	17	41208719	41208720	+	Intron	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41208719_41208720delAG	uc002icq.2	-						BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Intron|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Intron|BRCA1_uc002ict.2_Intron|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron	NM_007294	NP_009225			breast cancer 1, early onset isoform 1						androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)				D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			---	---	---	---
ETV4	2118	broad.mit.edu	37	17	41613486	41613489	+	Intron	DEL	AAAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41613486_41613489delAAAC	uc002idw.2	-						ETV4_uc010wih.1_Intron|ETV4_uc010czh.2_Intron|ETV4_uc010wii.1_Intron|ETV4_uc002idx.2_Intron|ETV4_uc010wij.1_Intron|ETV4_uc002idy.1_Intron	NM_001986	NP_001977			ets variant gene 4 (E1A enhancer binding						positive regulation of transcription, DNA-dependent	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/ETV4(6)	bone(4)|soft_tissue(2)|ovary(1)	7		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0798)				T	EWSR1|TMPRSS2|DDX5|KLK2|CANT1	Ewing sarcoma|Prostate carcinoma								---	---	---	---
Unknown	0	broad.mit.edu	37	17	42280930	42280931	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42280930_42280931insA								ATXN7L3 (5401 upstream) : UBTF (1471 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	42694221	42694221	+	IGR	DEL	T	-	-	rs11311713		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42694221delT								FZD2 (57314 upstream) : C17orf104 (39761 downstream)																																			---	---	---	---
EFTUD2	9343	broad.mit.edu	37	17	42937009	42937010	+	Intron	INS	-	CA	CA	rs139421777	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42937009_42937010insCA	uc002ihn.2	-						EFTUD2_uc010wje.1_Intron|EFTUD2_uc010wjf.1_Intron	NM_004247	NP_004238			elongation factor Tu GTP binding domain							Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	43080425	43080426	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43080425_43080426insA								C1QL1 (34781 upstream) : DCAKD (20280 downstream)																																			---	---	---	---
PLCD3	113026	broad.mit.edu	37	17	43191994	43191994	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43191994delC	uc002iib.2	-							NM_133373	NP_588614			phospholipase C delta 3						intracellular signal transduction|lipid catabolic process	cleavage furrow|cytoplasm|membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			breast(2)|lung(1)	3					Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	44328624	44328625	+	IGR	INS	-	T	T	rs66840784		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44328624_44328625insT								KIAA1267 (25907 upstream) : ARL17B (35238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	47353792	47353792	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47353792delA								PHOSPHO1 (45664 upstream) : ZNF652 (12777 downstream)																																			---	---	---	---
MYST2	11143	broad.mit.edu	37	17	47873414	47873414	+	Intron	DEL	T	-	-	rs34699326		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47873414delT	uc002ipm.2	+						MYST2_uc002ipl.1_Intron|MYST2_uc010wma.1_Intron|MYST2_uc010wmb.1_Intron|MYST2_uc010wmc.1_Intron|MYST2_uc010wmd.1_Intron|MYST2_uc010wme.1_Intron	NM_007067	NP_008998			MYST histone acetyltransferase 2						DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	histone acetyltransferase activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---
ABCC3	8714	broad.mit.edu	37	17	48731120	48731120	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48731120delA	uc002isl.2	+						ABCC3_uc002isk.3_Intron	NM_003786	NP_003777			ATP-binding cassette, sub-family C, member 3						bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	48884319	48884319	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48884319delA								C17orf73 (39401 upstream) : WFIKKN2 (27692 downstream)																																			---	---	---	---
SPAG9	9043	broad.mit.edu	37	17	49084472	49084473	+	Intron	DEL	GT	-	-	rs35415974		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49084472_49084473delGT	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron|SPAG9_uc002ita.2_Intron|SPAG9_uc002ite.2_Intron	NM_001130528	NP_001124000			sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	50440992	50440993	+	IGR	DEL	AC	-	-	rs113415135		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50440992_50440993delAC								CA10 (203615 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	51809275	51809276	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51809275_51809276insA								None (None upstream) : KIF2B (90963 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52499957	52499957	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52499957delA								KIF2B (597384 upstream) : TOM1L1 (478095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52652775	52652776	+	IGR	DEL	AA	-	-	rs66819631		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52652775_52652776delAA								KIF2B (750202 upstream) : TOM1L1 (325276 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52936169	52936173	+	IGR	DEL	TAAGA	-	-	rs3078016		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52936169_52936173delTAAGA								None (None upstream) : TOM1L1 (41879 downstream)																																			---	---	---	---
VEZF1	7716	broad.mit.edu	37	17	56056915	56056916	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56056915_56056916insA	uc002ivf.1	-						VEZF1_uc010dcn.1_Intron	NM_007146	NP_009077			zinc finger protein 161						cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	56212913	56212914	+	IGR	INS	-	AC	AC	rs143850947	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56212913_56212914insAC								DYNLL2 (45295 upstream) : OR4D1 (19601 downstream)																																			---	---	---	---
HSF5	124535	broad.mit.edu	37	17	56530960	56530961	+	Intron	INS	-	AAC	AAC	rs137875596	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56530960_56530961insAAC	uc002iwi.1	-							NM_001080439	NP_001073908			heat shock transcription factor family member 5							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
TEX14	56155	broad.mit.edu	37	17	56756797	56756798	+	Intron	INS	-	TCG	TCG	rs142746101	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56756797_56756798insTCG	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron|TEX14_uc010wnz.1_Intron	NM_198393	NP_938207			testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	57491480	57491480	+	IGR	DEL	T	-	-	rs111315681		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57491480delT								YPEL2 (12385 upstream) : DHX40 (151406 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	58163725	58163725	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58163725delA	uc002iyl.2	-											Homo sapiens full length insert cDNA clone ZC45B12.																														---	---	---	---
PPM1D	8493	broad.mit.edu	37	17	58693649	58693649	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58693649delA	uc002iyt.1	+						PPM1D_uc010ddm.1_Intron	NM_003620	NP_003611			protein phosphatase 1D						negative regulation of cell proliferation|protein dephosphorylation|response to radiation	nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein binding|protein serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)															---	---	---	---
BRIP1	83990	broad.mit.edu	37	17	59884055	59884056	+	Intron	INS	-	TTGG	TTGG	rs143923706	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59884055_59884056insTTGG	uc002izk.1	-							NM_032043	NP_114432			BRCA1 interacting protein C-terminal helicase 1						DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1								F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
LRRC37A3	374819	broad.mit.edu	37	17	62917345	62917346	+	5'Flank	INS	-	AACACTCT	AACACTCT	rs150548483	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62917345_62917346insAACACTCT	uc002jey.2	-						LRRC37A3_uc010wqg.1_5'Flank	NM_199340	NP_955372			leucine rich repeat containing 37, member A3							integral to membrane					0																		---	---	---	---
AXIN2	8313	broad.mit.edu	37	17	63570129	63570129	+	Intron	DEL	A	-	-	rs111575319		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63570129delA	uc010den.1	-							NM_004655	NP_004646			axin 2						cellular protein localization|cellular response to organic cyclic compound|dorsal/ventral axis specification|intramembranous ossification|maintenance of DNA repeat elements|mRNA stabilization|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of osteoblast differentiation|odontogenesis|positive regulation of cell death|positive regulation of epithelial to mesenchymal transition|positive regulation of protein phosphorylation|regulation of centromeric sister chromatid cohesion|regulation of mismatch repair|Wnt receptor signaling pathway involved in somitogenesis	Axin-APC-beta-catenin-GSK3B complex|cell cortex|centrosome|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|nucleus|plasma membrane|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			central_nervous_system(1)|skin(1)	2														Oligodontia_Ectodermal_Dysplasia_and_Colorectal_Polyp_syndrome				---	---	---	---
CCDC46	201134	broad.mit.edu	37	17	63732312	63732312	+	Intron	DEL	G	-	-	rs66630302		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63732312delG	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron|CCDC46_uc002jfk.2_Intron	NM_145036	NP_659473			coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)															---	---	---	---
CACNG4	27092	broad.mit.edu	37	17	64998735	64998736	+	Intron	DEL	TC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64998735_64998736delTC	uc002jft.1	+							NM_014405	NP_055220			voltage-dependent calcium channel gamma-4						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane	voltage-gated calcium channel activity			central_nervous_system(1)	1	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	65280979	65280982	+	IGR	DEL	AAAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65280979_65280982delAAAC								HELZ (39660 upstream) : PSMD12 (55638 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	67074351	67074352	+	IGR	INS	-	TT	TT	rs67222081		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67074351_67074352insTT								ABCA9 (17215 upstream) : ABCA6 (495 downstream)																																			---	---	---	---
ABCA6	23460	broad.mit.edu	37	17	67124602	67124603	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67124602_67124603insT	uc002jhw.1	-							NM_080284	NP_525023			ATP-binding cassette, sub-family A, member 6						transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	68902497	68902497	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68902497delA								KCNJ2 (726316 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69561057	69561057	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69561057delT								None (None upstream) : SOX9 (556104 downstream)																																			---	---	---	---
FAM104A	84923	broad.mit.edu	37	17	71226545	71226545	+	Intron	DEL	T	-	-	rs34120915		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71226545delT	uc002jji.3	-						FAM104A_uc002jjj.3_Intron|C17orf80_uc010wqu.1_5'Flank|C17orf80_uc010dfj.2_5'Flank|C17orf80_uc002jjk.1_5'Flank|C17orf80_uc002jjm.3_5'Flank|C17orf80_uc002jjl.3_5'Flank	NM_032837	NP_116226			hypothetical protein LOC84923 isoform 2												0			LUSC - Lung squamous cell carcinoma(166;0.197)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	71833172	71833173	+	IGR	DEL	TT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71833172_71833173delTT								C17orf54 (8496 upstream) : RPL38 (366622 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	71937277	71937278	+	IGR	DEL	TT	-	-	rs72125728		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71937277_71937278delTT								C17orf54 (112601 upstream) : RPL38 (262517 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	71950734	71950735	+	IGR	INS	-	CACA	CACA	rs150379667	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71950734_71950735insCACA								C17orf54 (126058 upstream) : RPL38 (249060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	72555442	72555443	+	IGR	DEL	CT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72555442_72555443delCT								CD300C (13160 upstream) : CD300LD (20668 downstream)																																			---	---	---	---
C17orf77	146723	broad.mit.edu	37	17	72583991	72583991	+	Intron	DEL	A	-	-	rs68081603		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72583991delA	uc002jla.1	+						CD300LD_uc002jkz.2_Intron	NM_152460	NP_689673			hypothetical protein LOC146723							extracellular region					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	73573393	73573395	+	IGR	DEL	AAC	-	-	rs78770334		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73573393_73573395delAAC								LLGL2 (2104 upstream) : MYO15B (10744 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	74247286	74247288	+	IGR	DEL	GTT	-	-	rs35206928		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74247286_74247288delGTT								RNF157 (10896 upstream) : FAM100B (13998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	74788530	74788530	+	IGR	DEL	T	-	-	rs35823101		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74788530delT								MFSD11 (13194 upstream) : MGAT5B (76268 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	75055217	75055218	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75055217_75055218insA								MGAT5B (108747 upstream) : C17orf86 (29507 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	75119138	75119139	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75119138_75119139insT								C17orf86 (28071 upstream) : SEC14L1 (17866 downstream)																																			---	---	---	---
SEPT9	10801	broad.mit.edu	37	17	75296423	75296428	+	Intron	DEL	TTGACT	-	-	rs148812847		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75296423_75296428delTTGACT	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron	NM_001113491	NP_001106963			septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	75523786	75523794	+	5'Flank	DEL	TGCCAAGAG	-	-	rs146309077		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75523786_75523794delTGCCAAGAG	uc002jtz.2	+											Homo sapiens cDNA clone IMAGE:4812691.																														---	---	---	---
HRNBP3	146713	broad.mit.edu	37	17	77276194	77276195	+	Intron	INS	-	CA	CA	rs144505215	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77276194_77276195insCA	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044			hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)															---	---	---	---
HRNBP3	146713	broad.mit.edu	37	17	77412021	77412021	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77412021delC	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044			hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)															---	---	---	---
CCDC40	55036	broad.mit.edu	37	17	78046783	78046784	+	Intron	INS	-	TTTG	TTTG	rs141456935	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78046783_78046784insTTTG	uc010dht.2	+						CCDC40_uc002jxm.3_Intron	NM_017950	NP_060420			coiled-coil domain containing 40						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	80338751	80338751	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80338751delA								UTS2R (5382 upstream) : C17orf101 (11349 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	80342629	80342629	+	5'Flank	DEL	G	-	-	rs76001515		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80342629delG	uc002kes.2	-											Homo sapiens full length insert cDNA YU76E12.																														---	---	---	---
RAB40B	10966	broad.mit.edu	37	17	80618562	80618565	+	Intron	DEL	GTAC	-	-	rs144087093	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80618562_80618565delGTAC	uc002kft.2	-						RAB40B_uc002kfs.2_Intron	NM_006822	NP_006813			RAB40B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			central_nervous_system(1)	1	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)															---	---	---	---
USP14	9097	broad.mit.edu	37	18	195975	195975	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:195975delT	uc002kkf.1	+						USP14_uc002kkg.1_Intron|USP14_uc010wyr.1_Intron	NM_005151	NP_005142			ubiquitin specific protease 14 isoform a						regulation of chemotaxis|regulation of proteasomal protein catabolic process|ubiquitin-dependent protein catabolic process	cell surface|cytoplasmic membrane-bounded vesicle|plasma membrane|proteasome complex	cysteine-type endopeptidase activity|endopeptidase inhibitor activity|proteasome binding|tRNA guanylyltransferase activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)	2		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)																---	---	---	---
C18orf2	56651	broad.mit.edu	37	18	1389774	1389776	+	Intron	DEL	CCC	-	-	rs10561808		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1389774_1389776delCCC	uc002kld.1	-											Homo sapiens C18orf2 isoform 1 mRNA, complete sequence, alternatively spliced.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	1695641	1695642	+	IGR	INS	-	TTG	TTG	rs145893464	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1695641_1695642insTTG								C18orf2 (288460 upstream) : METTL4 (841883 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	1868558	1868558	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1868558delT								C18orf2 (461377 upstream) : METTL4 (668967 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	2345615	2345615	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2345615delA								C18orf2 (938434 upstream) : METTL4 (191910 downstream)																																			---	---	---	---
SMCHD1	23347	broad.mit.edu	37	18	2762652	2762653	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2762652_2762653insT	uc002klm.3	+						SMCHD1_uc002klk.3_Intron|SMCHD1_uc002kll.3_Intron	NM_015295	NP_056110			structural maintenance of chromosomes flexible						chromosome organization		ATP binding				0																		---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	4010875	4010875	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4010875delA	uc010wyz.1	-						uc002kmm.2_Intron	NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	4306034	4306045	+	Intron	DEL	ACACACACACAC	-	-	rs36227691		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4306034_4306045delACACACACACAC	uc010wyz.1	-							NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	4683233	4683234	+	IGR	DEL	GA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4683233_4683234delGA								DLGAP1 (227967 upstream) : LOC642597 (460438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	5941079	5941080	+	IGR	INS	-	CA	CA	rs144721530	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5941079_5941080insCA								TMEM200C (48976 upstream) : L3MBTL4 (13626 downstream)																																			---	---	---	---
L3MBTL4	91133	broad.mit.edu	37	18	6071832	6071833	+	Intron	DEL	AA	-	-	rs71774905		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6071832_6071833delAA	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron|L3MBTL4_uc002kmy.3_Intron	NM_173464	NP_775735			l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)																---	---	---	---
LAMA1	284217	broad.mit.edu	37	18	7027573	7027574	+	Intron	INS	-	A	A	rs34480009		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7027573_7027574insA	uc002knm.2	-						LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550			laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	7605025	7605025	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7605025delG	uc002knn.3	+						PTPRM_uc010dkv.2_Intron	NM_002845	NP_002836			protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	8292668	8292668	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8292668delT	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836			protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
ANKRD12	23253	broad.mit.edu	37	18	9223970	9223970	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9223970delC	uc002knv.2	+						ANKRD12_uc010wzn.1_Intron|ANKRD12_uc002knw.2_Intron|ANKRD12_uc002knx.2_Intron|ANKRD12_uc010dkx.1_Intron	NM_015208	NP_056023			ankyrin repeat domain 12 isoform 1							nucleus				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	10199527	10199528	+	IGR	DEL	AG	-	-	rs142230786		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10199527_10199528delAG								VAPA (239510 upstream) : APCDD1 (255097 downstream)																																			---	---	---	---
SLMO1	10650	broad.mit.edu	37	18	12430677	12430678	+	Intron	INS	-	TGTG	TGTG	rs147525832	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12430677_12430678insTGTG	uc002kra.2	+						SLMO1_uc010wzu.1_Intron|SLMO1_uc010wzv.1_Intron	NM_001142405	NP_001135877			slowmo homolog 1 isoform 1												0																		---	---	---	---
SLMO1	10650	broad.mit.edu	37	18	12430746	12430755	+	Intron	DEL	TGTGTGTGCA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12430746_12430755delTGTGTGTGCA	uc002kra.2	+						SLMO1_uc010wzu.1_Intron|SLMO1_uc010wzv.1_Intron	NM_001142405	NP_001135877			slowmo homolog 1 isoform 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	14584641	14584641	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14584641delA								POTEC (41042 upstream) : ANKRD30B (163598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	20376674	20376675	+	IGR	DEL	TT	-	-	rs35855396		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20376674_20376675delTT								CTAGE1 (378796 upstream) : RBBP8 (136620 downstream)																																			---	---	---	---
CABYR	26256	broad.mit.edu	37	18	21716045	21716046	+	5'Flank	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21716045_21716046delCA	uc002kux.2	+						CABYR_uc010xbb.1_5'Flank|CABYR_uc002kuy.2_5'Flank|CABYR_uc002kuz.2_5'Flank|CABYR_uc002kva.2_5'Flank|CABYR_uc002kvb.2_5'Flank	NM_012189	NP_036321			calcium-binding tyrosine						ciliary or flagellar motility|signal transduction|sperm capacitation	cytoplasm|cytoskeleton|flagellum|motile cilium|nucleus	calcium ion binding|cAMP-dependent protein kinase regulator activity|enzyme binding|protein heterodimerization activity|SH3 domain binding				0	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)																	---	---	---	---
Unknown	0	broad.mit.edu	37	18	22639229	22639229	+	IGR	DEL	C	-	-	rs5823465		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22639229delC								HRH4 (579309 upstream) : ZNF521 (2659 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	28356790	28356791	+	IGR	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28356790_28356791delTG								MIR302F (477864 upstream) : DSC3 (213262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	31909307	31909307	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31909307delT								NOL4 (105861 upstream) : DTNA (163947 downstream)																																			---	---	---	---
DTNA	1837	broad.mit.edu	37	18	32262292	32262292	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32262292delA	uc010dmj.2	+						DTNA_uc002kxu.2_Intron|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Intron|DTNA_uc002kxw.2_Intron|DTNA_uc002kxx.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010dmk.1_Intron	NM_032975	NP_116757			dystrobrevin alpha isoform 2						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0																		---	---	---	---
MAPRE2	10982	broad.mit.edu	37	18	32687977	32687977	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32687977delA	uc002kyg.2	+						MAPRE2_uc010xcb.1_Intron|MAPRE2_uc010xcc.1_Intron|MAPRE2_uc002kyf.2_Intron|MAPRE2_uc002kyh.2_Intron|MAPRE2_uc010xcd.1_Intron	NM_014268	NP_055083			microtubule-associated protein, RP/EB family,						cell division|cell proliferation|mitosis|signal transduction	cytoplasm|microtubule	microtubule binding			ovary(1)	1																		---	---	---	---
RPRD1A	55197	broad.mit.edu	37	18	33574285	33574285	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33574285delC	uc002kzf.1	-						RPRD1A_uc002kze.1_Intron|RPRD1A_uc002kzg.2_Intron|RPRD1A_uc010dmw.2_Intron	NM_018170	NP_060640			regulation of nuclear pre-mRNA domain containing											ovary(1)|breast(1)	2																		---	---	---	---
FHOD3	80206	broad.mit.edu	37	18	33935346	33935346	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33935346delC	uc002kzt.1	+						FHOD3_uc002kzr.1_Intron|FHOD3_uc002kzs.1_Intron	NM_025135	NP_079411			formin homology 2 domain containing 3						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	41337557	41337557	+	IGR	DEL	T	-	-	rs33971332		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41337557delT								SYT4 (479942 upstream) : SETBP1 (922581 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	42089743	42089744	+	Intron	INS	-	T	T	rs142940497	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42089743_42089744insT	uc002lax.3	-											Homo sapiens cDNA clone IMAGE:5265929.																														---	---	---	---
LOXHD1	125336	broad.mit.edu	37	18	44097942	44097942	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44097942delG	uc010xcw.1	-						LOXHD1_uc002lcg.1_Intron|LOXHD1_uc002lcd.3_Intron|LOXHD1_uc002lce.3_Intron|LOXHD1_uc002lcf.3_Intron|LOXHD1_uc010xcv.1_Intron|LOXHD1_uc010xcu.1_Intron	NM_144612	NP_653213			lipoxygenase homology domains 1 isoform 1						sensory perception of sound	stereocilium	protein binding				0																		---	---	---	---
KATNAL2	83473	broad.mit.edu	37	18	44614124	44614125	+	Intron	DEL	TG	-	-	rs35852657		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44614124_44614125delTG	uc002lco.2	+						KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lcp.3_Intron	NM_031303	NP_112593			katanin p60 subunit A-like 2							cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	45549864	45549865	+	IGR	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45549864_45549865delGT								SMAD2 (92349 upstream) : ZBTB7C (3883 downstream)																																	OREG0024963	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
KIAA0427	9811	broad.mit.edu	37	18	46302748	46302749	+	Intron	INS	-	C	C	rs143142912	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46302748_46302749insC	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron|KIAA0427_uc002lde.3_Intron	NM_014772	NP_055587			hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	47879362	47879363	+	IGR	INS	-	TTC	TTC	rs145675301	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47879362_47879363insTTC								CXXC1 (64670 upstream) : SKA1 (22029 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	48745197	48745197	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48745197delT								MEX3C (21507 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	49681059	49681060	+	IGR	INS	-	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49681059_49681060insC								MEX3C (957369 upstream) : DCC (185511 downstream)																																			---	---	---	---
DCC	1630	broad.mit.edu	37	18	49991126	49991127	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49991126_49991127insT	uc002lfe.1	+							NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
DCC	1630	broad.mit.edu	37	18	50446904	50446904	+	Intron	DEL	T	-	-	rs145103174		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50446904delT	uc002lfe.1	+						DCC_uc010xdr.1_Intron	NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
DCC	1630	broad.mit.edu	37	18	50939021	50939022	+	Intron	INS	-	T	T	rs145119774	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50939021_50939022insT	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	51479097	51479097	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51479097delA								DCC (421315 upstream) : MBD2 (201478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	52482178	52482178	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52482178delT								C18orf26 (215454 upstream) : RAB27B (13662 downstream)																																			---	---	---	---
CCDC68	80323	broad.mit.edu	37	18	52605641	52605641	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52605641delA	uc002lfs.2	-						CCDC68_uc002lft.2_Intron	NM_001143829	NP_001137301			coiled-coil domain containing 68											skin(1)	1				Colorectal(16;0.0256)|READ - Rectum adenocarcinoma(59;0.21)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	53671609	53671610	+	IGR	INS	-	TT	TT	rs147715757	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53671609_53671610insTT								TCF4 (368424 upstream) : TXNL1 (598445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	55206603	55206604	+	IGR	INS	-	ACAC	ACAC	rs145734344	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55206603_55206604insACAC								ONECUT2 (48074 upstream) : FECH (5470 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	55515819	55515819	+	IGR	DEL	A	-	-	rs35601218		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55515819delA								ATP8B1 (116780 upstream) : NEDD4L (195800 downstream)																																			---	---	---	---
NEDD4L	23327	broad.mit.edu	37	18	55870204	55870205	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55870204_55870205insT	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lhc.2_Intron|NEDD4L_uc002lhd.2_Intron|NEDD4L_uc002lhb.2_Intron|NEDD4L_uc002lhe.2_Intron|NEDD4L_uc002lhf.2_Intron	NM_001144967	NP_001138439			neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4																		---	---	---	---
NEDD4L	23327	broad.mit.edu	37	18	56028047	56028047	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56028047delT	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lhc.2_Intron|NEDD4L_uc002lhd.2_Intron|NEDD4L_uc002lhb.2_Intron|NEDD4L_uc002lhe.2_Intron|NEDD4L_uc002lhf.2_Intron|NEDD4L_uc002lhg.2_Intron|NEDD4L_uc002lhh.2_Intron	NM_001144967	NP_001138439			neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	56503570	56503571	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56503570_56503571insA								MALT1 (86200 upstream) : ZNF532 (26490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	56908728	56908728	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56908728delT								GRP (10728 upstream) : RAX (25541 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	57897298	57897299	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57897298_57897299insT								PMAIP1 (325760 upstream) : MC4R (141265 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	58185941	58185941	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58185941delA								MC4R (145940 upstream) : CDH20 (815047 downstream)																																			---	---	---	---
RNF152	220441	broad.mit.edu	37	18	59524928	59524931	+	Intron	DEL	AAAC	-	-	rs111801758		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59524928_59524931delAAAC	uc002lih.1	-							NM_173557	NP_775828			ring finger protein 152						apoptosis|protein K48-linked ubiquitination	integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			breast(1)	1		Colorectal(73;0.186)																---	---	---	---
PHLPP1	23239	broad.mit.edu	37	18	60440612	60440612	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60440612delT	uc002lis.2	+							NM_194449	NP_919431			PH domain and leucine rich repeat protein						apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	63074996	63074996	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63074996delT								None (None upstream) : CDH7 (342492 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	64663727	64663730	+	IGR	DEL	ACAC	-	-	rs147499519		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64663727_64663730delACAC								CDH19 (392511 upstream) : DSEL (510089 downstream)																																			---	---	---	---
DOK6	220164	broad.mit.edu	37	18	67160662	67160662	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67160662delA	uc002lkl.2	+							NM_152721	NP_689934			docking protein 6								insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	68992009	68992009	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68992009delA								SOCS6 (994575 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	71499786	71499786	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71499786delC								NETO1 (964976 upstream) : FBXO15 (240802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	71585140	71585140	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71585140delA								None (None upstream) : FBXO15 (155448 downstream)																																			---	---	---	---
ZNF407	55628	broad.mit.edu	37	18	72628738	72628739	+	Intron	DEL	GT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72628738_72628739delGT	uc002llw.2	+						ZNF407_uc010dqu.1_Intron	NM_017757	NP_060227			zinc finger protein 407 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	74509898	74509900	+	IGR	DEL	AAC	-	-	rs72353739		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74509898_74509900delAAC								LOC284276 (238115 upstream) : ZNF236 (26216 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	75027584	75027585	+	IGR	INS	-	T	T	rs139482635	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75027584_75027585insT								GALR1 (45490 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	75306981	75306982	+	IGR	INS	-	AAAC	AAAC	rs142489862	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75306981_75306982insAAAC								GALR1 (324887 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	75849556	75849556	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75849556delC								GALR1 (867462 upstream) : SALL3 (890719 downstream)																																			---	---	---	---
SALL3	27164	broad.mit.edu	37	18	76737752	76737752	+	5'Flank	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76737752delA	uc002lmt.2	+							NM_171999	NP_741996			sal-like 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)														---	---	---	---
ATP9B	374868	broad.mit.edu	37	18	76835082	76835082	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76835082delT	uc002lmx.2	+						ATP9B_uc002lmv.1_Intron|ATP9B_uc002lmw.1_Intron|ATP9B_uc002lmu.2_Intron	NM_198531	NP_940933			ATPase, class II, type 9B						ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)														---	---	---	---
NFATC1	4772	broad.mit.edu	37	18	77268219	77268220	+	Intron	INS	-	GGAG	GGAG	rs142088680	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77268219_77268220insGGAG	uc010xfg.1	+						NFATC1_uc002lnd.2_Intron|NFATC1_uc002lne.2_Intron|NFATC1_uc010xfh.1_Intron|NFATC1_uc010xfj.1_Intron|NFATC1_uc002lnf.2_Intron|NFATC1_uc002lng.2_Intron|NFATC1_uc010xfk.1_Intron	NM_006162	NP_006153			nuclear factor of activated T-cells, cytosolic						intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)														---	---	---	---
STK11	6794	broad.mit.edu	37	19	1225275	1225276	+	Intron	INS	-	T	T	rs79428562		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1225275_1225276insT	uc002lrl.1	+							NM_000455	NP_000446			serine/threonine protein kinase 11						anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	p.0?(19)		lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)			14	D|Mis|N|F|S		NSCLC|pancreatic	jejunal harmartoma|ovarian|testicular|pancreatic			Peutz-Jeghers_syndrome	TSP Lung(3;<1E-08)			---	---	---	---
TMPRSS9	360200	broad.mit.edu	37	19	2418722	2418722	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2418722delT	uc010xgx.1	+							NM_182973	NP_892018			transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
LMNB2	84823	broad.mit.edu	37	19	2432931	2432932	+	Intron	INS	-	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2432931_2432932insC	uc002lvy.2	-						LMNB2_uc010dtc.1_5'Flank|LMNB2_uc002lwa.1_Intron	NM_032737	NP_116126			lamin B2							nuclear inner membrane	structural molecule activity			large_intestine(1)|ovary(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
TLE2	7089	broad.mit.edu	37	19	3002702	3002702	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3002702delT	uc002lww.2	-						TLE2_uc010xhb.1_Intron|TLE2_uc010dth.2_Intron|TLE2_uc010xhc.1_Intron|TLE2_uc010dti.2_Intron	NM_003260	NP_003251			transducin-like enhancer protein 2 isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
MPND	84954	broad.mit.edu	37	19	4350026	4350026	+	Intron	DEL	A	-	-	rs79127761		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4350026delA	uc002mae.2	+						MPND_uc010dtx.2_Intron|MPND_uc002mag.2_Intron|MPND_uc002maf.2_Intron|MPND_uc002mah.2_Intron|MPND_uc002mai.2_Intron	NM_032868	NP_116257			MPN domain containing isoform 1								peptidase activity			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
CHAF1A	10036	broad.mit.edu	37	19	4431123	4431124	+	Intron	INS	-	TT	TT	rs140816719	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4431123_4431124insTT	uc002mal.2	+							NM_005483	NP_005474			chromatin assembly factor 1, subunit A (p150)						cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)									Chromatin_Structure					---	---	---	---
SEMA6B	10501	broad.mit.edu	37	19	4547801	4547802	+	Intron	INS	-	CGT	CGT	rs150110159	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4547801_4547802insCGT	uc010duc.1	-						SEMA6B_uc010dud.2_Intron|SEMA6B_uc010xih.1_Intron	NM_032108	NP_115484			semaphorin 6B precursor						cell differentiation|nervous system development	integral to membrane	receptor activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
RANBP3	8498	broad.mit.edu	37	19	5919076	5919077	+	Intron	DEL	GA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5919076_5919077delGA	uc002mdw.2	-						RANBP3_uc002mdv.2_Intron|RANBP3_uc002mdx.2_Intron|RANBP3_uc002mdy.2_Intron|RANBP3_uc002mdz.2_Intron|RANBP3_uc010duq.2_Intron|RANBP3_uc002mea.2_Intron|RANBP3_uc010xix.1_Intron	NM_007322	NP_015561			RAN binding protein 3 isoform RANBP3-d						intracellular transport|protein transport	cytoplasm|nucleus	Ran GTPase binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	5990016	5990025	+	IGR	DEL	ACCCTAATCT	-	-	rs67982039		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5990016_5990025delACCCTAATCT								RANBP3 (11696 upstream) : RFX2 (3151 downstream)																																			---	---	---	---
INSR	3643	broad.mit.edu	37	19	7191940	7191943	+	Intron	DEL	GGAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7191940_7191943delGGAA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199			insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	7415669	7415676	+	IGR	DEL	GTGTGTGT	-	-	rs74174890		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7415669_7415676delGTGTGTGT								INSR (121658 upstream) : ARHGEF18 (32044 downstream)																																			---	---	---	---
ELAVL1	1994	broad.mit.edu	37	19	8031909	8031910	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8031909_8031910insT	uc002mjb.2	-							NM_001419	NP_001410			ELAV-like 1						3'-UTR-mediated mRNA stabilization|multicellular organismal development	cytoplasm|nucleoplasm	identical protein binding|mRNA binding|nucleotide binding				0																		---	---	---	---
FBN3	84467	broad.mit.edu	37	19	8141132	8141133	+	Intron	DEL	GT	-	-	rs11883158	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8141132_8141133delGT	uc002mjf.2	-						FBN3_uc002mje.2_Intron	NM_032447	NP_115823			fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	8415261	8415261	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8415261delT								KANK3 (7115 upstream) : ANGPTL4 (13750 downstream)																																			---	---	---	---
ANGPTL4	51129	broad.mit.edu	37	19	8434798	8434798	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8434798delA	uc002mjq.1	+						ANGPTL4_uc002mjr.1_Intron|ANGPTL4_uc010xkc.1_Intron	NM_139314	NP_647475			angiopoietin-like 4 protein isoform a precursor						angiogenesis|cell differentiation|cellular lipid metabolic process|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|positive regulation of angiogenesis|response to hypoxia|signal transduction|triglyceride homeostasis	extracellular space|proteinaceous extracellular matrix	enzyme inhibitor activity|receptor binding			ovary(1)	1																		---	---	---	---
ZNF177	7730	broad.mit.edu	37	19	9480380	9480381	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9480380_9480381insT	uc002mli.2	+						ZNF177_uc002mlj.2_Intron|ZNF177_uc002mlk.2_Intron	NM_003451	NP_003442			zinc finger protein 177						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
ZNF560	147741	broad.mit.edu	37	19	9590232	9590232	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9590232delA	uc002mlp.1	-						ZNF560_uc010dwr.1_Intron	NM_152476	NP_689689			zinc finger protein 560						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	10067794	10067795	+	IGR	INS	-	A	A	rs142499985	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10067794_10067795insA								OLFM2 (20724 upstream) : COL5A3 (2442 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	12534594	12534595	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12534594_12534595insA								ZNF799 (22560 upstream) : ZNF443 (5926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	12555728	12555731	+	IGR	DEL	AACT	-	-	rs148729699		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12555728_12555731delAACT								ZNF443 (3802 upstream) : ZNF709 (16268 downstream)																																			---	---	---	---
NFIX	4784	broad.mit.edu	37	19	13118939	13118939	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13118939delG	uc002mwd.2	+							NM_002501	NP_002492			nuclear factor I/X (CCAAT-binding transcription						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)															---	---	---	---
IL27RA	9466	broad.mit.edu	37	19	14151185	14151186	+	Intron	INS	-	T	T	rs139766338	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14151185_14151186insT	uc002mxx.2	+							NM_004843	NP_004834			class I cytokine receptor precursor						cell surface receptor linked signaling pathway|immune response	integral to plasma membrane	transmembrane receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	14458882	14458883	+	IGR	INS	-	CAAA	CAAA			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14458882_14458883insCAAA								LPHN1 (141885 upstream) : CD97 (33330 downstream)																																			---	---	---	---
CLEC17A	388512	broad.mit.edu	37	19	14702711	14702712	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14702711_14702712delTG	uc010dzn.1	+						CLEC17A_uc002mzh.1_Intron|CLEC17A_uc010xnt.1_Intron|CLEC17A_uc010xnu.1_Intron|CLEC17A_uc010dzo.1_Intron					SubName: Full=CLEC17A protein;							cell surface|integral to membrane	fucose binding|mannose binding|metal ion binding|receptor activity				0																		---	---	---	---
CLEC17A	388512	broad.mit.edu	37	19	14706796	14706798	+	Intron	DEL	AGA	-	-	rs76735461	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14706796_14706798delAGA	uc010dzn.1	+						CLEC17A_uc002mzh.1_Intron|CLEC17A_uc010xnt.1_Intron|CLEC17A_uc010xnu.1_Intron|CLEC17A_uc010dzo.1_Intron					SubName: Full=CLEC17A protein;							cell surface|integral to membrane	fucose binding|mannose binding|metal ion binding|receptor activity				0																		---	---	---	---
CYP4F8	11283	broad.mit.edu	37	19	15727751	15727751	+	Intron	DEL	G	-	-	rs34865325		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15727751delG	uc002nbi.2	+						CYP4F8_uc010xoi.1_Intron|CYP4F8_uc010xoj.1_Intron	NM_007253	NP_009184			cytochrome P450, family 4, subfamily F,						prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	16825311	16825312	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16825311_16825312insA								TMEM38A (25497 upstream) : NWD1 (5475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	17497819	17497820	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17497819_17497820insT								PLVAP (9682 upstream) : BST2 (15936 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	19970038	19970039	+	IGR	INS	-	A	A	rs34661226		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19970038_19970039insA								ZNF506 (37478 upstream) : ZNF253 (6675 downstream)																																			---	---	---	---
ZNF93	81931	broad.mit.edu	37	19	20016990	20016991	+	Intron	INS	-	A	A	rs140755854	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20016990_20016991insA	uc002non.2	+						ZNF93_uc002nom.2_Intron	NM_031218	NP_112495			zinc finger protein 93							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1																		---	---	---	---
ZNF737	100129842	broad.mit.edu	37	19	20742294	20742295	+	Intron	INS	-	A	A	rs140658617	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20742294_20742295insA	uc002npa.2	-							NM_001159293	NP_001152765			zinc finger protein 737						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	21435040	21435041	+	IGR	INS	-	AA	AA			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21435040_21435041insAA								ZNF431 (66235 upstream) : ZNF708 (38922 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	23073210	23073210	+	IGR	DEL	T	-	-	rs35250792		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23073210delT								ZNF99 (120426 upstream) : ZNF91 (448209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	23173007	23173007	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23173007delT	uc002nqy.1	-						uc002nqz.1_5'Flank					Homo sapiens zinc finger protein 117, mRNA (cDNA clone IMAGE:40112371).																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	23693987	23693987	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23693987delA								ZNF91 (115718 upstream) : ZNF675 (141722 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	24585401	24585402	+	IGR	DEL	CT	-	-	rs143249063		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24585401_24585402delCT								LOC100101266 (239152 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28866937	28866938	+	IGR	INS	-	T	T	rs150974681	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28866937_28866938insT								LOC148189 (582089 upstream) : LOC148145 (589102 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29044612	29044613	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29044612_29044613delAC	uc002nsa.1	-											Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	29519646	29519646	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29519646delA								LOC148145 (59591 upstream) : UQCRFS1 (178521 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31091914	31091914	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31091914delA								ZNF536 (42949 upstream) : DKFZp566F0947 (548869 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31196216	31196217	+	IGR	INS	-	TGTG	TGTG	rs76233203		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31196216_31196217insTGTG								ZNF536 (147251 upstream) : DKFZp566F0947 (444566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31259788	31259789	+	IGR	INS	-	TG	TG	rs143326052	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31259788_31259789insTG								ZNF536 (210823 upstream) : DKFZp566F0947 (380994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31535281	31535284	+	IGR	DEL	ATGG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31535281_31535284delATGG								ZNF536 (486316 upstream) : DKFZp566F0947 (105499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	32656679	32656680	+	IGR	INS	-	A	A	rs139122061	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32656679_32656680insA								TSHZ3 (816489 upstream) : ZNF507 (179834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	33741251	33741252	+	IGR	INS	-	AT	AT			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33741251_33741252insAT								SLC7A10 (24495 upstream) : CEBPA (49590 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	34417395	34417395	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34417395delA								KCTD15 (110730 upstream) : LSM14A (245957 downstream)																																			---	---	---	---
LSM14A	26065	broad.mit.edu	37	19	34704709	34704710	+	Intron	INS	-	A	A	rs138252526	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34704709_34704710insA	uc002nvb.3	+						LSM14A_uc002nva.3_Intron|LSM14A_uc010xru.1_Intron|LSM14A_uc002nvc.3_Intron	NM_001114093	NP_001107565			LSM14 homolog A isoform a						cytoplasmic mRNA processing body assembly|multicellular organismal development|regulation of translation	cytoplasmic mRNA processing body|intracellular membrane-bounded organelle|stress granule				skin(1)	1	Esophageal squamous(110;0.162)																	---	---	---	---
HPN	3249	broad.mit.edu	37	19	35555723	35555726	+	Intron	DEL	TTTG	-	-	rs75410006		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35555723_35555726delTTTG	uc002nxq.1	+						HPN_uc002nxr.1_Intron|HPN_uc002nxs.1_Intron|HPN_uc010xsh.1_Intron|HPN_uc002nxt.1_Intron|LOC100128675_uc010xsi.1_Intron	NM_002151	NP_002142			hepsin						cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)													---	---	---	---
NPHS1	4868	broad.mit.edu	37	19	36323447	36323448	+	Intron	INS	-	A	A	rs144637430	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36323447_36323448insA	uc002oby.2	-						NPHS1_uc010eem.1_Intron	NM_004646	NP_004637			nephrin precursor						cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)															---	---	---	---
WDR62	284403	broad.mit.edu	37	19	36566359	36566359	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36566359delC	uc002odc.2	+						WDR62_uc002odd.2_Intron	NM_173636	NP_775907			WD repeat domain 62 isoform 2						cerebral cortex development	nucleus					0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)															---	---	---	---
TBCB	1155	broad.mit.edu	37	19	36610796	36610796	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36610796delA	uc002odg.1	+						TBCB_uc002odh.1_Intron	NM_001281	NP_001272			cytoskeleton associated protein 1						'de novo' posttranslational protein folding|cell differentiation|nervous system development	cytoplasm|microtubule	protein binding				0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	36656571	36656572	+	IGR	INS	-	A	A	rs77291777		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36656571_36656572insA								COX7A1 (12800 upstream) : ZNF565 (16616 downstream)																																			---	---	---	---
SPINT2	10653	broad.mit.edu	37	19	38757017	38757018	+	Intron	INS	-	A	A	rs112054111		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38757017_38757018insA	uc002ohr.1	+						SPINT2_uc002ohs.1_Intron	NM_021102	NP_066925			serine protease inhibitor, Kunitz type, 2						cellular component movement	cytoplasm|extracellular region|integral to membrane|soluble fraction	serine-type endopeptidase inhibitor activity				0	all_cancers(60;6.83e-07)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
HNRNPL	3191	broad.mit.edu	37	19	39343380	39343380	+	5'Flank	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39343380delG	uc010xul.1	-						HNRNPL_uc010xum.1_5'Flank	NM_001533	NP_001524			heterogeneous nuclear ribonucleoprotein L						nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)															---	---	---	---
SARS2	54938	broad.mit.edu	37	19	39435289	39435292	+	Intron	DEL	CTGT	-	-	rs140885997		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39435289_39435292delCTGT	uc010xuq.1	-						FBXO17_uc002okg.1_Intron|FBXO17_uc002okf.1_Intron	NM_017827	NP_060297			seryl-tRNA synthetase 2 isoform b precursor						seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)															---	---	---	---
PAF1	54623	broad.mit.edu	37	19	39876311	39876312	+	3'UTR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39876311_39876312insA	uc002old.2	-	14						NM_019088	NP_061961			Paf1, RNA polymerase II associated factor,						histone H2B ubiquitination|histone monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding			pancreas(1)	1	all_cancers(60;9.14e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)															---	---	---	---
FCGBP	8857	broad.mit.edu	37	19	40443294	40443295	+	5'Flank	DEL	GG	-	-	rs74328255	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40443294_40443295delGG	uc002omp.3	-							NM_003890	NP_003881			Fc fragment of IgG binding protein precursor							extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)															---	---	---	---
SPTBN4	57731	broad.mit.edu	37	19	41005471	41005471	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41005471delT	uc002ony.2	+						SPTBN4_uc002onx.2_Intron|SPTBN4_uc002onz.2_Intron	NM_020971	NP_066022			spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)															---	---	---	---
ARHGEF1	9138	broad.mit.edu	37	19	42419035	42419036	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42419035_42419036insT	uc002osc.2	+											SubName: Full=ARHGEF1 protein; SubName: Full=Rho guanine nucleotide exchange factor (GEF) 1, isoform CRA_g;						cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(3)|large_intestine(1)	4		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)														---	---	---	---
PSG6	5675	broad.mit.edu	37	19	43640613	43640613	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43640613delA	uc010xwk.1	-											SubName: Full=Pregnancy-specific beta-1 glycoprotein; Flags: Fragment;						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)																---	---	---	---
LYPD5	284348	broad.mit.edu	37	19	44306390	44306395	+	Intron	DEL	CCCCCA	-	-	rs72214885		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44306390_44306395delCCCCCA	uc002oxm.3	-						LYPD5_uc002oxn.3_Intron	NM_001031749	NP_001026919			LY6/PLAUR domain containing 5 isoform A							anchored to membrane|plasma membrane					0		Prostate(69;0.0352)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	45097286	45097287	+	IGR	INS	-	TGAA	TGAA	rs142209106	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45097286_45097287insTGAA								CEACAM22P (37136 upstream) : PVR (49811 downstream)																																			---	---	---	---
GEMIN7	79760	broad.mit.edu	37	19	45590103	45590104	+	Intron	INS	-	TTTG	TTTG	rs141012049	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45590103_45590104insTTTG	uc002pap.1	+						GEMIN7_uc002paq.1_Intron|GEMIN7_uc002par.1_Intron	NM_001007270	NP_001007271			gemin 7						ncRNA metabolic process|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0131)														---	---	---	---
VASP	7408	broad.mit.edu	37	19	46025136	46025137	+	Intron	INS	-	A	A	rs78337476		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46025136_46025137insA	uc002pcg.2	+						VASP_uc010eki.2_Intron|VASP_uc002pci.2_Intron	NM_003370	NP_003361			vasodilator-stimulated phosphoprotein						axon guidance|cell junction assembly|T cell receptor signaling pathway	actin cytoskeleton|cytosol|filopodium membrane|focal adhesion|lamellipodium membrane	actin binding|profilin binding|SH3 domain binding				0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	46681539	46681540	+	IGR	INS	-	A	A	rs142540321	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46681539_46681540insA								IGFL2 (16980 upstream) : DKFZp434J0226 (25143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	47131378	47131379	+	IGR	INS	-	TG	TG	rs147374918	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47131378_47131379insTG								PTGIR (3024 upstream) : GNG8 (5955 downstream)																																			---	---	---	---
SNAR-C2	100170218	broad.mit.edu	37	19	48429434	48429434	+	5'Flank	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48429434delT	uc010xyz.1	+							NR_024220				Homo sapiens small ILF3/NF90-associated RNA C2 (SNAR-C2), non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	48795764	48795765	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48795764_48795765insT								ZNF114 (4901 upstream) : CCDC114 (3944 downstream)																																			---	---	---	---
NUCB1	4924	broad.mit.edu	37	19	49411979	49411986	+	Intron	DEL	GTGTGTGT	-	-	rs66602779	by1000genomes;by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49411979_49411986delGTGTGTGT	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175			nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)														---	---	---	---
TRPM4	54795	broad.mit.edu	37	19	49685210	49685211	+	Intron	INS	-	TCTG	TCTG	rs139882884	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49685210_49685211insTCTG	uc002pmw.2	+						TRPM4_uc010emu.2_Intron|TRPM4_uc010yak.1_Intron|TRPM4_uc002pmx.2_Intron|TRPM4_uc010emv.2_Intron|TRPM4_uc010yal.1_Intron|TRPM4_uc002pmy.2_5'Flank	NM_017636	NP_060106			transient receptor potential cation channel,						dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)														---	---	---	---
CPT1C	126129	broad.mit.edu	37	19	50214360	50214360	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50214360delT	uc002ppj.2	+						CPT1C_uc002ppl.3_3'UTR|CPT1C_uc002ppi.2_Intron|CPT1C_uc002ppk.2_Intron|CPT1C_uc010eng.2_Intron|CPT1C_uc010enh.2_Intron|CPT1C_uc010ybc.1_3'UTR|CPT1C_uc010eni.1_Intron	NM_152359	NP_689572			carnitine palmitoyltransferase 1C isoform 2						fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	50571404	50571407	+	IGR	DEL	AAAC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50571404_50571407delAAAC								FLJ26850 (1355 upstream) : SNAR-A4 (49570 downstream)																																			---	---	---	---
ZNF175	7728	broad.mit.edu	37	19	52092522	52092523	+	3'UTR	INS	-	GTAT	GTAT	rs150214159	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52092522_52092523insGTAT	uc002pxb.2	+	5					uc002pxc.1_5'Flank	NM_007147	NP_009078			zinc finger protein 175						response to virus	cytoplasm|intermediate filament cytoskeleton|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	52682152	52682153	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52682152_52682153insT								ZNF836 (7256 upstream) : PPP2R1A (11038 downstream)																																			---	---	---	---
MIR523	574471	broad.mit.edu	37	19	54201051	54201059	+	5'Flank	DEL	GGTTCAAGT	-	-	rs67268527		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54201051_54201059delGGTTCAAGT	hsa-mir-523|MI0003153	+						MIR518F_hsa-mir-518f|MI0003154_5'Flank																	0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	55207429	55207443	+	IGR	DEL	GAAGGAAGGAGGGAA	-	-	rs36205639		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55207429_55207443delGAAGGAAGGAGGGAA								LILRB4 (27585 upstream) : LILRP2 (12158 downstream)																																			---	---	---	---
NLRP2	55655	broad.mit.edu	37	19	55511019	55511020	+	Intron	INS	-	ATC	ATC	rs145761446	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55511019_55511020insATC	uc002qij.2	+						NLRP2_uc010yfp.1_Intron|NLRP2_uc010esn.2_Intron|NLRP2_uc010eso.2_Intron|NLRP2_uc010esp.2_Intron	NM_017852	NP_060322			NLR family, pyrin domain containing 2						apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)														---	---	---	---
NLRP8	126205	broad.mit.edu	37	19	56483019	56483020	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56483019_56483020delAC	uc002qmh.2	+						NLRP8_uc010etg.2_Intron	NM_176811	NP_789781			NLR family, pyrin domain containing 8							cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	57209250	57209251	+	IGR	INS	-	TTCT	TTCT	rs149807795	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57209250_57209251insTTCT								ZNF835 (25004 upstream) : ZIM2 (76672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	57224079	57224079	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57224079delG	uc010ygp.1	+											Homo sapiens cDNA clone IMAGE:4793694.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	57529043	57529044	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57529043_57529044insT								MIMT1 (169121 upstream) : USP29 (102465 downstream)																																			---	---	---	---
ZNF256	10172	broad.mit.edu	37	19	58454854	58454854	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58454854delA	uc002qqu.2	-						ZNF256_uc010euj.2_Intron	NM_005773	NP_005764			zinc finger protein 256						multicellular organismal development|negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)														---	---	---	---
ZNF446	55663	broad.mit.edu	37	19	58990038	58990038	+	Intron	DEL	A	-	-	rs78201902		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58990038delA	uc002qsz.2	+						ZNF446_uc002qta.2_Intron|ZNF446_uc010eur.2_Intron	NM_017908	NP_060378			zinc finger protein 446						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)														---	---	---	---
Unknown	0	broad.mit.edu	37	20	805554	805554	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:805554delG								C20orf54 (56326 upstream) : FAM110A (8802 downstream)																																			---	---	---	---
SIRPB2	284759	broad.mit.edu	37	20	1466298	1466299	+	Intron	INS	-	CA	CA	rs147649910	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1466298_1466299insCA	uc002wfg.2	-						SIRPB2_uc002wfh.3_Intron|SIRPB2_uc010zpr.1_Intron	NM_001122962	NP_001116434			signal-regulatory protein beta 2 isoform 1							integral to membrane					0																		---	---	---	---
C20orf194	25943	broad.mit.edu	37	20	3278996	3278997	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3278996_3278997insT	uc002wii.2	-						C20orf194_uc002wij.3_Intron|C20orf194_uc002wik.2_Intron	NM_001009984	NP_001009984			hypothetical protein LOC25943												0																		---	---	---	---
GPCPD1	56261	broad.mit.edu	37	20	5585420	5585421	+	Intron	INS	-	AC	AC	rs139653722	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5585420_5585421insAC	uc002wme.3	-							NM_019593	NP_062539			hypothetical protein LOC56261						glycerol metabolic process|lipid metabolic process		carbohydrate binding|glycerophosphodiester phosphodiesterase activity				0																		---	---	---	---
CRLS1	54675	broad.mit.edu	37	20	5998213	5998213	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5998213delT	uc002wmn.3	+						CRLS1_uc010gbq.2_Intron|CRLS1_uc010gbr.2_Intron	NM_019095	NP_061968			cardiolipin synthase 1 isoform 1						phospholipid biosynthetic process	integral to membrane|mitochondrial inner membrane	phosphotransferase activity, for other substituted phosphate groups				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	6769949	6769949	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6769949delA								BMP2 (9039 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7746865	7746867	+	IGR	DEL	CAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7746865_7746867delCAA								BMP2 (985955 upstream) : HAO1 (116764 downstream)																																			---	---	---	---
HAO1	54363	broad.mit.edu	37	20	7923851	7923851	+	5'Flank	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7923851delA	uc002wmw.1	-						HAO1_uc010gbu.2_5'Flank	NM_017545	NP_060015			hydroxyacid oxidase 1						cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3																		---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8255897	8255898	+	Intron	INS	-	GTGT	GTGT	rs117409082	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8255897_8255898insGTGT	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc010gbv.1_Intron|PLCB1_uc002wmz.1_Intron|PLCB1_uc002wna.2_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8595232	8595243	+	Intron	DEL	TGTGTGTGTGTG	-	-	rs71331317		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8595232_8595243delTGTGTGTGTGTG	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc010gbv.1_Intron|PLCB1_uc002wmz.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	10831718	10831718	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10831718delA								JAG1 (177024 upstream) : None (None downstream)																																			---	---	---	---
SPTLC3	55304	broad.mit.edu	37	20	13111779	13111780	+	Intron	INS	-	A	A	rs139265873	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13111779_13111780insA	uc002wod.1	+							NM_018327	NP_060797			serine palmitoyltransferase, long chain base						sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	13668101	13668101	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13668101delC								TASP1 (48518 upstream) : ESF1 (26869 downstream)																																			---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	14438756	14438756	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14438756delA	uc002wou.2	+						MACROD2_uc002wot.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	16005176	16005177	+	Intron	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16005176_16005177delAC	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron|MACROD2_uc002wpd.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19302997	19303009	+	Intron	DEL	CCTTCCTTCCTTC	-	-	rs143174662	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19302997_19303009delCCTTCCTTCCTTC	uc002wrl.2	+							NM_020689	NP_065740			solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1																		---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19450725	19450726	+	Intron	INS	-	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19450725_19450726insC	uc002wrl.2	+							NM_020689	NP_065740			solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1																		---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19480561	19480562	+	Intron	DEL	TG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19480561_19480562delTG	uc002wrl.2	+							NM_020689	NP_065740			solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1																		---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20338557	20338558	+	Intron	INS	-	TG	TG			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20338557_20338558insTG	uc002wru.2	+						C20orf26_uc002wrw.2_Intron	NM_015585	NP_056400			hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
PLK1S1	55857	broad.mit.edu	37	20	21216210	21216210	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21216210delC	uc002wsb.2	+						PLK1S1_uc010zsh.1_Intron|PLK1S1_uc010zsi.1_Intron|PLK1S1_uc010zsj.1_Intron|PLK1S1_uc002wsd.2_Intron	NM_018474	NP_060944			polo-like kinase 1 substrate 1 isoform 1						spindle organization	centrosome	protein kinase binding				0																OREG0025814	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	20	21589456	21589457	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21589456_21589457delAC								NKX2-2 (94792 upstream) : PAX1 (96840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	21809118	21809118	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21809118delT								PAX1 (112498 upstream) : LOC284788 (571853 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	22061160	22061161	+	IGR	INS	-	A	A	rs76378010		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22061160_22061161insA								PAX1 (364540 upstream) : LOC284788 (319810 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	23487520	23487520	+	IGR	DEL	C	-	-	rs71330899		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23487520delC								CST8 (10865 upstream) : CSTT (12263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24013443	24013445	+	IGR	DEL	TTG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24013443_24013445delTTG								GGTLC1 (44027 upstream) : TMEM90B (436390 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24106326	24106327	+	IGR	DEL	GT	-	-	rs72102820		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24106326_24106327delGT								GGTLC1 (136910 upstream) : TMEM90B (343508 downstream)																																			---	---	---	---
TMEM90B	79953	broad.mit.edu	37	20	24620990	24620991	+	Intron	INS	-	GA	GA	rs142254268	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24620990_24620991insGA	uc002wtw.1	+							NM_024893	NP_079169			transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	24816910	24816911	+	IGR	INS	-	CATACCTATCCAC	CATACCTATCCAC	rs137999704	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24816910_24816911insCATACCTATCCAC								TMEM90B (169743 upstream) : CST7 (112955 downstream)																																			---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25831101	25831102	+	Intron	INS	-	C	C	rs147373877	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25831101_25831102insC	uc002wvd.1	-						FAM182B_uc002wve.2_Intron					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25909583	25909584	+	IGR	INS	-	AGG	AGG	rs113773320		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25909583_25909584insAGG								FAM182B (60797 upstream) : LOC100134868 (80851 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25945931	25945931	+	RNA	DEL	G	-	-	rs73620349		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25945931delG	uc002wvf.2	+	4		c.606delG								Homo sapiens cDNA clone IMAGE:5298175.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	25986206	25986207	+	IGR	INS	-	A	A	rs140280825		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25986206_25986207insA								FAM182B (137420 upstream) : LOC100134868 (4228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26075417	26075418	+	IGR	INS	-	TCC	TCC	rs147363891		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26075417_26075418insTCC								FAM182A (7865 upstream) : C20orf191 (8635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26117648	26117649	+	IGR	INS	-	A	A	rs149172160		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26117648_26117649insA								C20orf191 (22971 upstream) : MIR663 (71173 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26147605	26147606	+	IGR	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26147605_26147606delAG								C20orf191 (52928 upstream) : MIR663 (41216 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26205482	26205482	+	IGR	DEL	C	-	-	rs79336099		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26205482delC								MIR663 (16568 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26252699	26252700	+	IGR	INS	-	T	T	rs143639929		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26252699_26252700insT								MIR663 (63785 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29422533	29422534	+	IGR	DEL	AA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29422533_29422534delAA								None (None upstream) : FRG1B (189345 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29480977	29480978	+	IGR	INS	-	G	G	rs148111006	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29480977_29480978insG								None (None upstream) : FRG1B (130901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29527652	29527653	+	IGR	INS	-	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29527652_29527653insC								None (None upstream) : FRG1B (84226 downstream)																																			---	---	---	---
HCK	3055	broad.mit.edu	37	20	30641801	30641801	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30641801delT	uc002wxh.2	+						HCK_uc010gdy.2_Intron|HCK_uc002wxi.2_Intron	NM_002110	NP_002101			hemopoietic cell kinase isoform p61HCK						interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)															---	---	---	---
TM9SF4	9777	broad.mit.edu	37	20	30719284	30719285	+	Intron	INS	-	GTGT	GTGT	rs145621877	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30719284_30719285insGTGT	uc002wxj.2	+						TM9SF4_uc010ztr.1_Intron|TM9SF4_uc010zts.1_Intron|TM9SF4_uc002wxk.2_Intron	NM_014742	NP_055557			transmembrane 9 superfamily protein member 4							integral to membrane				central_nervous_system(1)|pancreas(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	31864826	31864830	+	IGR	DEL	CCCTT	-	-	rs71873190		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31864826_31864830delCCCTT								PLUNC (33712 upstream) : C20orf114 (6111 downstream)																																			---	---	---	---
ITCH	83737	broad.mit.edu	37	20	33041947	33041948	+	Intron	DEL	TT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33041947_33041948delTT	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671			itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
ITCH	83737	broad.mit.edu	37	20	33079802	33079802	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33079802delG	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671			itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
GSS	2937	broad.mit.edu	37	20	33540243	33540243	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33540243delT	uc002xbg.2	-						GSS_uc010zuo.1_5'Flank|GSS_uc010zup.1_Intron|GSS_uc002xbh.2_Intron|GSS_uc010gez.1_Intron	NM_000178	NP_000169			glutathione synthetase						nervous system development|response to oxidative stress|xenobiotic metabolic process	cytosol	ATP binding|glutathione binding|glutathione synthase activity|magnesium ion binding|protein homodimerization activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(18;0.035)		Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)													---	---	---	---
C20orf173	140873	broad.mit.edu	37	20	34115454	34115454	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34115454delT	uc002xcp.2	-						C20orf173_uc010gff.2_Intron|C20orf173_uc010zvf.1_Intron					RecName: Full=Uncharacterized protein C20orf173;												0																		---	---	---	---
PHF20	51230	broad.mit.edu	37	20	34484004	34484007	+	Intron	DEL	TGTG	-	-	rs35800229		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34484004_34484007delTGTG	uc002xek.1	+						PHF20_uc002xei.1_Intron|PHF20_uc010gfo.1_Intron|PHF20_uc002xej.1_Intron	NM_016436	NP_057520			PHD finger protein 20						regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)																	---	---	---	---
RBL1	5933	broad.mit.edu	37	20	35719762	35719762	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35719762delA	uc002xgi.2	-						RBL1_uc010zvt.1_Intron|RBL1_uc002xgj.1_Intron|RBL1_uc010gfv.1_Intron	NM_002895	NP_002886			retinoblastoma-like protein 1 isoform a						cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36125575	36125575	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36125575delA								SRC (91756 upstream) : BLCAP (20245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	36128158	36128159	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36128158_36128159delAC								SRC (94339 upstream) : BLCAP (17661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37019931	37019931	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37019931delT								LBP (14278 upstream) : LOC388796 (29308 downstream)																																			---	---	---	---
DHX35	60625	broad.mit.edu	37	20	37616599	37616600	+	Intron	INS	-	AA	AA			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37616599_37616600insAA	uc002xjh.2	+						DHX35_uc010zwa.1_Intron|DHX35_uc010zwb.1_Intron|DHX35_uc010zwc.1_Intron	NM_021931	NP_068750			DEAH (Asp-Glu-Ala-His) box polypeptide 35							catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	38384078	38384078	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38384078delA								LOC339568 (530687 upstream) : MAFB (930441 downstream)																																			---	---	---	---
CHD6	84181	broad.mit.edu	37	20	40082859	40082860	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40082859_40082860insT	uc002xka.1	-							NM_032221	NP_115597			chromodomain helicase DNA binding protein 6						chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	40323755	40323755	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40323755delT								CHD6 (76622 upstream) : PTPRT (377638 downstream)																																			---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	40815012	40815025	+	Intron	DEL	TCCTTCTACCACAT	-	-	rs67445848		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40815012_40815025delTCCTTCTACCACAT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron|PTPRT_uc010ggi.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
TOX2	84969	broad.mit.edu	37	20	42558133	42558134	+	Intron	INS	-	C	C	rs139639034	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42558133_42558134insC	uc010ggo.2	+						TOX2_uc002xle.3_Intron|TOX2_uc010ggp.2_Intron	NM_001098797	NP_001092267			TOX high mobility group box family member 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
MATN4	8785	broad.mit.edu	37	20	43926078	43926078	+	Intron	DEL	A	-	-	rs141550810		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43926078delA	uc002xnn.2	-						MATN4_uc002xno.2_Intron|MATN4_uc002xnp.2_Intron|MATN4_uc010zwr.1_Intron|MATN4_uc002xnr.1_Intron	NM_003833	NP_003824			matrilin 4 isoform 1 precursor							extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
WFDC2	10406	broad.mit.edu	37	20	44095918	44095918	+	5'Flank	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44095918delG	uc002xoo.2	+						WFDC2_uc002xoq.2_5'Flank|WFDC2_uc002xop.2_5'Flank	NM_006103	NP_006094			WAP four-disulfide core domain 2 precursor						proteolysis|spermatogenesis	extracellular space	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	44762135	44762136	+	IGR	DEL	TT	-	-	rs11475778		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44762135_44762136delTT								CD40 (3751 upstream) : CDH22 (40240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	44776004	44776004	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44776004delT								CD40 (17620 upstream) : CDH22 (26372 downstream)																																			---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45599719	45599720	+	Intron	INS	-	AC	AC	rs148380754	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45599719_45599720insAC	uc002xsm.2	+						EYA2_uc010ghp.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	47508060	47508068	+	IGR	DEL	AACAAGAAC	-	-	rs140996567	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47508060_47508068delAACAAGAAC								PREX1 (63640 upstream) : ARFGEF2 (30207 downstream)																																			---	---	---	---
NFATC2	4773	broad.mit.edu	37	20	50009986	50009990	+	Intron	DEL	TAACT	-	-	rs145921703		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50009986_50009990delTAACT	uc002xwd.2	-						NFATC2_uc002xwc.2_Intron|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Intron|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Intron	NM_173091	NP_775114			nuclear factor of activated T-cells,						B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)																	---	---	---	---
NFATC2	4773	broad.mit.edu	37	20	50104348	50104348	+	Intron	DEL	A	-	-	rs67468123		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50104348delA	uc002xwd.2	-						NFATC2_uc002xwc.2_Intron|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Intron|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Intron	NM_173091	NP_775114			nuclear factor of activated T-cells,						B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	50908607	50908607	+	IGR	DEL	A	-	-	rs2426430	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50908607delA								ZFP64 (100083 upstream) : TSHZ2 (680270 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	51058845	51058848	+	IGR	DEL	AGAA	-	-	rs144149431		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51058845_51058848delAGAA								ZFP64 (250321 upstream) : TSHZ2 (530029 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52895813	52895813	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52895813delT								PFDN4 (59322 upstream) : DOK5 (196444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	53347813	53347813	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53347813delT								DOK5 (80104 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	53586224	53586224	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53586224delA								DOK5 (318515 upstream) : CBLN4 (986273 downstream)																																			---	---	---	---
AURKA	6790	broad.mit.edu	37	20	54949073	54949074	+	Intron	DEL	AC	-	-	rs144437309		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54949073_54949074delAC	uc002xxd.1	-						AURKA_uc002xxe.1_Intron|AURKA_uc002xxf.1_Intron|AURKA_uc002xxg.1_Intron|AURKA_uc002xxh.1_Intron|AURKA_uc002xxi.1_Intron|AURKA_uc002xxj.1_Intron|AURKA_uc002xxk.1_Intron|AURKA_uc010zzd.1_Intron	NM_198433	NP_940835			serine/threonine protein kinase 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|phosphatidylinositol-mediated signaling|regulation of protein stability|spindle organization	cytosol|nucleus|perinuclear region of cytoplasm|spindle microtubule|spindle pole centrosome	ATP binding|protein kinase binding|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(1)|large_intestine(1)|skin(1)	8			Colorectal(105;0.202)															---	---	---	---
RAE1	8480	broad.mit.edu	37	20	55933384	55933385	+	Intron	INS	-	AG	AG			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55933384_55933385insAG	uc002xyg.2	+						RAE1_uc010gis.1_Intron|RAE1_uc010git.1_Intron|RAE1_uc002xyh.2_Intron|RAE1_uc002xyi.2_Intron	NM_003610	NP_003601			RAE1 (RNA export 1, S.pombe) homolog						carbohydrate metabolic process|glucose transport|mRNA export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|cytoskeleton|nuclear outer membrane|nuclear pore	microtubule binding|RNA binding				0	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)															---	---	---	---
ZBP1	81030	broad.mit.edu	37	20	56179330	56179330	+	3'UTR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56179330delA	uc002xyo.2	-	8					ZBP1_uc010gjm.2_3'UTR|ZBP1_uc002xyp.2_3'UTR	NM_030776	NP_110403			Z-DNA binding protein 1 isoform a							cytoplasm|nucleus	double-stranded RNA adenosine deaminase activity|left-handed Z-DNA binding|RNA binding			ovary(2)	2	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	57202019	57202020	+	IGR	INS	-	G	G	rs148390260	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57202019_57202020insG								APCDD1L (112070 upstream) : STX16 (24289 downstream)																																			---	---	---	---
CDH26	60437	broad.mit.edu	37	20	58565921	58565922	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58565921_58565922insT	uc002ybe.2	+						CDH26_uc002ybf.1_Intron|CDH26_uc010zzy.1_Intron	NM_177980	NP_817089			cadherin-like 26 isoform a						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|central_nervous_system(1)	4	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)															---	---	---	---
LAMA5	3911	broad.mit.edu	37	20	60909814	60909815	+	Intron	INS	-	T	T	rs56242777		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60909814_60909815insT	uc002ycq.2	-							NM_005560	NP_005551			laminin alpha 5 precursor						angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	62918434	62918435	+	5'Flank	INS	-	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62918434_62918435insG	uc002yin.2	+											DQ590432																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	9418733	9418734	+	IGR	DEL	AA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9418733_9418734delAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9735165	9735166	+	Intron	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9735165_9735166delAG	uc011abu.1	+											Homo sapiens, clone IMAGE:4720764, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10424454	10424455	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10424454_10424455insT								None (None upstream) : TPTE (482288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10598275	10598276	+	5'Flank	INS	-	T	T	rs150196532	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10598275_10598276insT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10599057	10599058	+	5'Flank	INS	-	A	A	rs71270017		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10599057_10599058insA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11023566	11023566	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11023566delC	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11037607	11037608	+	Intron	INS	-	AG	AG	rs56387029		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11037607_11037608insAG	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11061894	11061894	+	Intron	DEL	G	-	-	rs56157850		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11061894delG	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	11187952	11187954	+	IGR	DEL	ATA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11187952_11187954delATA								BAGE (89015 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14373499	14373500	+	IGR	INS	-	A	A	rs138382892	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14373499_14373500insA								None (None upstream) : C21orf99 (36987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	18507577	18507577	+	IGR	DEL	A	-	-	rs34570816		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18507577delA								C21orf34 (525483 upstream) : CXADR (377753 downstream)																																			---	---	---	---
CXADR	1525	broad.mit.edu	37	21	18913876	18913876	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18913876delA	uc002yki.2	+						CXADR_uc002ykh.1_Intron|CXADR_uc010gld.1_Intron|CXADR_uc010gle.1_Intron	NM_001338	NP_001329			coxsackie virus and adenovirus receptor						blood coagulation|cell adhesion|interspecies interaction between organisms|leukocyte migration|regulation of immune response	adherens junction|basolateral plasma membrane|extracellular region|integral to plasma membrane|nucleus|tight junction	receptor activity			ovary(1)	1				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	21317849	21317852	+	IGR	DEL	TGTT	-	-	rs141773351		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21317849_21317852delTGTT								None (None upstream) : C21orf131 (797062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	23605003	23605003	+	IGR	DEL	A	-	-	rs66463347		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23605003delA								NCAM2 (693789 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	25417812	25417812	+	IGR	DEL	G	-	-	rs74831361		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25417812delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	28185913	28185914	+	IGR	DEL	AG	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28185913_28185914delAG								CYYR1 (240332 upstream) : ADAMTS1 (22694 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	28443796	28443797	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28443796_28443797insA								ADAMTS5 (104357 upstream) : NCRNA00113 (650901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	28663558	28663558	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28663558delT								ADAMTS5 (324119 upstream) : NCRNA00113 (431140 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29037187	29037187	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29037187delA								ADAMTS5 (697748 upstream) : NCRNA00113 (57511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29371358	29371359	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29371358_29371359delCA								NCRNA00113 (247806 upstream) : C21orf94 (14323 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29899380	29899380	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29899380delT								C21orf94 (503852 upstream) : NCRNA00161 (12260 downstream)																																			---	---	---	---
GRIK1	2897	broad.mit.edu	37	21	30916293	30916293	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30916293delA	uc011acs.1	-						GRIK1_uc002ynn.2_Intron|GRIK1_uc011act.1_Intron	NM_000830	NP_000821			glutamate receptor, ionotropic, kainate 1						central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)													---	---	---	---
KRTAP19-2	337969	broad.mit.edu	37	21	31861440	31861441	+	5'Flank	DEL	AC	-	-	rs72074425		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31861440_31861441delAC	uc011acy.1	-							NM_181608	NP_853639			keratin associated protein 19-2							intermediate filament					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	32490474	32490475	+	IGR	INS	-	C	C	rs145816015	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32490474_32490475insC								KRTAP19-8 (79679 upstream) : TIAM1 (261 downstream)																																			---	---	---	---
HUNK	30811	broad.mit.edu	37	21	33372189	33372190	+	3'UTR	INS	-	T	T	rs140154922	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33372189_33372190insT	uc002yph.2	+	11						NM_014586	NP_055401			hormonally upregulated Neu-associated kinase						multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	34274216	34274217	+	IGR	INS	-	A	A	rs112291339		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34274216_34274217insA								C21orf62 (88163 upstream) : OLIG2 (124022 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	35336056	35336057	+	Intron	INS	-	TGCT	TGCT	rs142596934	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35336056_35336057insTGCT	uc002ytn.2	+											Homo sapiens cDNA, FLJ18587.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	35423339	35423346	+	IGR	DEL	ACACACAT	-	-	rs10470169		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35423339_35423346delACACACAT								ATP5O (135181 upstream) : MRPS6 (22477 downstream)																																			---	---	---	---
RUNX1	861	broad.mit.edu	37	21	37167168	37167169	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37167168_37167169insT	uc002yut.1	-											Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
CLDN14	23562	broad.mit.edu	37	21	37835239	37835240	+	Intron	DEL	AC	-	-	rs148792260	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37835239_37835240delAC	uc002yvk.1	-						CLDN14_uc002yvn.1_Intron|CLDN14_uc002yvo.1_Intron|CLDN14_uc002yvl.1_Intron|CLDN14_uc002yvm.1_Intron	NM_012130	NP_036262			claudin 14						calcium-independent cell-cell adhesion|protein complex assembly|tight junction assembly	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity				0																		---	---	---	---
BRWD1	54014	broad.mit.edu	37	21	40648681	40648684	+	Intron	DEL	TAGA	-	-	rs144682304		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40648681_40648684delTAGA	uc002yxk.1	-						BRWD1_uc002yxl.2_Intron|BRWD1_uc010goe.1_Intron|BRWD1_uc010gof.1_Intron|BRWD1_uc010gog.1_Intron|BRWD1_uc010goh.1_Intron|BRWD1_uc010goi.1_Intron	NM_018963	NP_061836			bromodomain and WD repeat domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)																---	---	---	---
C2CD2	25966	broad.mit.edu	37	21	43328353	43328354	+	Intron	DEL	TG	-	-	rs68020858		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43328353_43328354delTG	uc002yzw.2	-						C2CD2_uc002yzt.2_Splice_Site|C2CD2_uc002yzu.2_Intron|C2CD2_uc002yzv.2_Intron|C2CD2_uc002yzx.1_Intron	NM_015500	NP_056315			C2 calcium-dependent domain containing 2 isoform							cytosol|extracellular region|nucleus				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	44200275	44200276	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44200275_44200276insA								PDE9A (4659 upstream) : WDR4 (62930 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	45632082	45632083	+	IGR	INS	-	TGAA	TGAA	rs150240279	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45632082_45632083insTGAA								C21orf33 (66478 upstream) : ICOSLG (14641 downstream)																																			---	---	---	---
TRPM2	7226	broad.mit.edu	37	21	45824711	45824713	+	Intron	DEL	TGA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45824711_45824713delTGA	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron	NM_003307	NP_003298			transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
ITGB2	3689	broad.mit.edu	37	21	46320553	46320569	+	Intron	DEL	ACGCCCAGGAGGAGACA	-	-	rs79643064		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46320553_46320569delACGCCCAGGAGGAGACA	uc002zgd.2	-						ITGB2_uc002zge.2_Intron|ITGB2_uc002zgf.3_Intron|ITGB2_uc011afl.1_Intron|ITGB2_uc010gpw.2_Intron|ITGB2_uc002zgg.2_Intron	NM_001127491	NP_001120963			integrin, beta 2 precursor						apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)													---	---	---	---
DIP2A	23181	broad.mit.edu	37	21	47880110	47880110	+	Intron	DEL	A	-	-	rs142850456	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47880110delA	uc002zjo.2	+						DIP2A_uc011afy.1_Intron|DIP2A_uc011afz.1_Intron|uc002zjk.2_5'Flank|DIP2A_uc002zjl.2_Intron|DIP2A_uc002zjm.2_Intron|DIP2A_uc010gql.2_Intron|DIP2A_uc002zjn.2_Intron	NM_015151	NP_055966			disco-interacting protein 2A isoform a						multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	17504140	17504143	+	IGR	DEL	TATC	-	-	rs60343151		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17504140_17504143delTATC								GAB4 (15028 upstream) : CECR7 (13317 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	17656774	17656775	+	IGR	INS	-	T	T	rs148789051	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17656774_17656775insT								CECR4 (10440 upstream) : CECR1 (3417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	17822853	17822853	+	IGR	DEL	T	-	-	rs113899764		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17822853delT								CECR1 (120115 upstream) : CECR2 (17986 downstream)																																			---	---	---	---
BCL2L13	23786	broad.mit.edu	37	22	18141342	18141342	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18141342delC	uc002zmw.2	+						BCL2L13_uc002zmu.2_Intron|BCL2L13_uc002zmv.2_Intron|BCL2L13_uc002zmx.2_Intron|BCL2L13_uc002zmy.2_Intron|BCL2L13_uc010gqy.2_Intron|BCL2L13_uc011agk.1_Intron|BCL2L13_uc010gqz.2_Intron	NM_015367	NP_056182			BCL2-like 13 (apoptosis facilitator)						induction of apoptosis	integral to membrane|mitochondrial membrane|nucleus	caspase activator activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4		all_epithelial(15;0.123)		Lung(27;0.199)														---	---	---	---
MICAL3	57553	broad.mit.edu	37	22	18497753	18497753	+	Intron	DEL	A	-	-	rs72341314		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18497753delA	uc002zng.3	-						MICAL3_uc002znh.2_Intron|MICAL3_uc010grf.2_Intron|MICAL3_uc011agm.1_Intron	NM_015241	NP_056056			microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	18831278	18831278	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18831278delC								GGT3P (38286 upstream) : DGCR6 (62263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	18843613	18843613	+	Intron	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18843613delG	uc002zoe.2	+											Homo sapiens cDNA FLJ76361 complete cds.																														---	---	---	---
CLTCL1	8218	broad.mit.edu	37	22	19237854	19237854	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19237854delT	uc002zpb.2	-						CLTCL1_uc011agv.1_Intron|CLTCL1_uc011agw.1_Intron	NM_007098	NP_009029			clathrin, heavy polypeptide-like 1 isoform 1						anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)							T	?	ALCL								---	---	---	---
ARVCF	421	broad.mit.edu	37	22	19986490	19986490	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19986490delC	uc002zqz.2	-							NM_001670	NP_001661			armadillo repeat protein						cell adhesion|multicellular organismal development		protein binding			liver(1)	1	Colorectal(54;0.0993)																	---	---	---	---
C22orf25	128989	broad.mit.edu	37	22	20042077	20042077	+	Intron	DEL	G	-	-	rs148856659		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20042077delG	uc010grw.1	+						C22orf25_uc002zrb.1_Intron|C22orf25_uc002zrc.1_Intron|C22orf25_uc002zrd.1_Intron|C22orf25_uc002zre.2_3'UTR|C22orf25_uc010grx.2_Intron|C22orf25_uc011ahe.1_Intron|C22orf25_uc011ahf.1_Intron|C22orf25_uc011ahg.1_Intron|C22orf25_uc002zrg.2_Intron|C22orf25_uc011ahh.1_Intron|C22orf25_uc002zrf.2_Intron|C22orf25_uc011ahi.1_Intron|C22orf25_uc010gry.1_Intron|C22orf25_uc002zrh.1_Intron	NM_152906	NP_690870			hypothetical protein LOC128989												0	Colorectal(54;0.0533)																	---	---	---	---
Unknown	0	broad.mit.edu	37	22	20626771	20626771	+	IGR	DEL	C	-	-	rs75830540		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20626771delC								RIMBP3 (164985 upstream) : ZNF74 (121708 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	20732014	20732015	+	5'Flank	INS	-	A	A	rs362117		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20732014_20732015insA	uc011ahq.1	-											RecName: Full=Putative ubiquitin carboxyl-terminal hydrolase 41;          EC=3.1.2.15; AltName: Full=Ubiquitin thioesterase 41; AltName: Full=Ubiquitin-specific-processing protease 41; AltName: Full=Deubiquitinating enzyme 41;																														---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22646007	22646008	+	Intron	INS	-	GGGCAG	GGGCAG			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22646007_22646008insGGGCAG	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
LOC91316	91316	broad.mit.edu	37	22	24013007	24013009	+	Intron	DEL	CTT	-	-	rs147809331		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24013007_24013009delCTT	uc002zxh.3	-						LOC91316_uc002zxi.3_Intron|LOC91316_uc002zxk.3_Intron|LOC91316_uc010gua.2_Intron|LOC91316_uc002zxl.3_Intron|LOC91316_uc011aiz.1_Intron|LOC91316_uc002zxm.3_Intron					Homo sapiens cDNA FLJ32313 fis, clone PROST2003232, weakly similar to BETA-GLUCURONIDASE PRECURSOR (EC 3.2.1.31).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	25701787	25701788	+	IGR	INS	-	T	T	rs145055987		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25701787_25701788insT								CRYBB2 (73951 upstream) : IGLL3 (12100 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	25840064	25840064	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25840064delG								LRP5L (62520 upstream) : ADRBK2 (120797 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	25903356	25903359	+	Intron	DEL	ATCC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25903356_25903359delATCC	uc003abv.2	+											Homo sapiens cDNA clone IMAGE:3542716, partial cds.																														---	---	---	---
MYO18B	84700	broad.mit.edu	37	22	26346705	26346705	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26346705delT	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron	NM_032608	NP_115997			myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	27742286	27742286	+	IGR	DEL	T	-	-	rs68090636		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27742286delT								MIAT (627337 upstream) : MN1 (401980 downstream)																																			---	---	---	---
TTC28	23331	broad.mit.edu	37	22	28924561	28924561	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28924561delA	uc003adp.3	-							NM_001145418	NP_001138890			tetratricopeptide repeat domain 28								binding				0																		---	---	---	---
AP1B1	162	broad.mit.edu	37	22	29770274	29770275	+	Intron	INS	-	AAAT	AAAT	rs10667003		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29770274_29770275insAAAT	uc003afj.2	-						AP1B1_uc003afk.2_Intron|AP1B1_uc003afl.2_Intron	NM_001127	NP_001118			adaptor-related protein complex 1 beta 1 subunit						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
OSBP2	23762	broad.mit.edu	37	22	31103704	31103704	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31103704delA	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc003aix.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron	NM_030758	NP_110385			oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	32730017	32730018	+	IGR	DEL	CA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32730017_32730018delCA								SLC5A4 (78699 upstream) : RFPL3 (20854 downstream)																																			---	---	---	---
SYN3	8224	broad.mit.edu	37	22	33405064	33405067	+	5'Flank	DEL	TAGA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33405064_33405067delTAGA	uc003amx.2	-						SYN3_uc003amy.2_5'Flank|SYN3_uc003amz.2_Intron	NM_003490	NP_003481			synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	34403107	34403107	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34403107delT								LARGE (84523 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	34700635	34700636	+	IGR	INS	-	AAA	AAA	rs150984411	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34700635_34700636insAAA								LARGE (382051 upstream) : ISX (761493 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	34934756	34934756	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34934756delC								LARGE (616172 upstream) : ISX (527373 downstream)																																			---	---	---	---
MYH9	4627	broad.mit.edu	37	22	36708400	36708401	+	Intron	INS	-	A	A	rs143290016	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36708400_36708401insA	uc003apg.2	-						MYH9_uc003aph.1_Intron	NM_002473	NP_002464			myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11								T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				---	---	---	---
EIF3D	8664	broad.mit.edu	37	22	36907942	36907942	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36907942delT	uc003apq.2	-						EIF3D_uc011amr.1_Intron|EIF3D_uc003apr.2_Intron|EIF3D_uc011ams.1_Intron|EIF3D_uc011amt.1_Intron	NM_003753	NP_003744			eukaryotic translation initiation factor 3							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			pancreas(1)	1																		---	---	---	---
TMPRSS6	164656	broad.mit.edu	37	22	37468652	37468653	+	Intron	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37468652_37468653insA	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron	NM_153609	NP_705837			transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6																		---	---	---	---
TMPRSS6	164656	broad.mit.edu	37	22	37487126	37487129	+	Intron	DEL	TCAT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37487126_37487129delTCAT	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron|TMPRSS6_uc003aqu.2_Intron	NM_153609	NP_705837			transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6																		---	---	---	---
ELFN2	114794	broad.mit.edu	37	22	37819228	37819228	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37819228delA	uc003asq.3	-							NM_052906	NP_443138			leucine rich repeat containing 62							cell surface|integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	Melanoma(58;0.0574)																	---	---	---	---
APOBEC3D	140564	broad.mit.edu	37	22	39382946	39382946	+	Intron	DEL	G	-	-	rs112595223		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39382946delG	uc011aoe.1	+						APOBEC3A_uc011aoc.1_Intron|APOBEC3B_uc003awo.1_Intron|APOBEC3B_uc003awp.1_Intron|APOBEC3B_uc003awq.1_Intron|APOBEC3D_uc011aod.1_Intron|APOBEC3D_uc011aof.1_Intron	NM_152426	NP_689639			apolipoprotein B mRNA editing enzyme, catalytic						negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding				0	Melanoma(58;0.04)																	---	---	---	---
CACNA1I	8911	broad.mit.edu	37	22	39966252	39966259	+	5'Flank	DEL	CCTTCCTT	-	-	rs10528897		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39966252_39966259delCCTTCCTT	uc003ayc.2	+						CACNA1I_uc003ayd.2_5'Flank	NM_021096	NP_066919			calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)													---	---	---	---
GRAP2	9402	broad.mit.edu	37	22	40353529	40353530	+	Intron	DEL	CT	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40353529_40353530delCT	uc003ayh.1	+						GRAP2_uc003ayi.2_Intron|GRAP2_uc011aom.1_Intron|GRAP2_uc011aon.1_Intron|GRAP2_uc010gya.1_Intron|GRAP2_uc011aoo.1_Intron|GRAP2_uc011aop.1_Intron|GRAP2_uc011aoq.1_Intron|GRAP2_uc003ayj.1_Intron	NM_004810	NP_004801			GRB2-related adaptor protein 2						cell-cell signaling|Ras protein signal transduction|T cell costimulation|T cell receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2																		---	---	---	---
TNRC6B	23112	broad.mit.edu	37	22	40532375	40532376	+	Intron	INS	-	TG	TG	rs150445100	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40532375_40532376insTG	uc003aym.2	+							NM_001024843	NP_001020014			trinucleotide repeat containing 6B isoform 3						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	41071970	41071970	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41071970delT								MKL1 (39280 upstream) : MCHR1 (3212 downstream)																																			---	---	---	---
ST13	6767	broad.mit.edu	37	22	41222904	41222905	+	Intron	INS	-	CTA	CTA	rs149609837	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41222904_41222905insCTA	uc003aze.2	-						ST13_uc011aow.1_Intron	NM_003932	NP_003923			heat shock 70kD protein binding protein								protein binding, bridging				0																		---	---	---	---
ST13	6767	broad.mit.edu	37	22	41234916	41234916	+	Intron	DEL	A	-	-	rs66598437		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41234916delA	uc003aze.2	-						ST13_uc011aow.1_Intron	NM_003932	NP_003923			heat shock 70kD protein binding protein								protein binding, bridging				0																		---	---	---	---
XPNPEP3	63929	broad.mit.edu	37	22	41264432	41264433	+	Intron	INS	-	GT	GT	rs145069443	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41264432_41264433insGT	uc003azh.2	+						XPNPEP3_uc011aox.1_Intron|XPNPEP3_uc003azi.2_Intron|XPNPEP3_uc011aoy.1_Intron|XPNPEP3_uc010gyh.1_Intron	NM_022098	NP_071381			X-prolyl aminopeptidase (aminopeptidase P) 3,						cellular process	mitochondrion	aminopeptidase activity|manganese ion binding|metallopeptidase activity				0																		---	---	---	---
NFAM1	150372	broad.mit.edu	37	22	42802789	42802790	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42802789_42802790insT	uc003bcn.3	-							NM_145912	NP_666017			NFAT activation molecule 1 precursor						B cell differentiation|inflammatory response|intracellular signal transduction|positive regulation of B cell receptor signaling pathway|positive regulation of cytokine production|positive regulation of sequence-specific DNA binding transcription factor activity	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity				0																		---	---	---	---
PACSIN2	11252	broad.mit.edu	37	22	43387314	43387314	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43387314delC	uc003bdg.3	-							NM_007229	NP_009160			protein kinase C and casein kinase substrate in						actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)																---	---	---	---
MPPED1	758	broad.mit.edu	37	22	43816968	43816971	+	Intron	DEL	TCCA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43816968_43816971delTCCA	uc011apv.1	+						MPPED1_uc011apw.1_Intron|MPPED1_uc011apx.1_Intron|MPPED1_uc011apy.1_Intron|MPPED1_uc011apz.1_Intron	NM_001044370	NP_001037835			metallophosphoesterase domain containing 1								hydrolase activity				0		all_neural(38;0.0244)|Ovarian(80;0.0694)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	47010757	47010758	+	IGR	DEL	CA	-	-	rs67259334		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47010757_47010758delCA								CELSR1 (77690 upstream) : GRAMD4 (11900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	48058986	48058986	+	Intron	DEL	A	-	-	rs35691662		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48058986delA	uc003bik.1	+											Homo sapiens cDNA FLJ35788 fis, clone TESTI2005683.																														---	---	---	---
Unknown	0	broad.mit.edu	37	22	48120500	48120501	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48120500_48120501insT	uc003bik.1	+											Homo sapiens cDNA FLJ35788 fis, clone TESTI2005683.																														---	---	---	---
Unknown	0	broad.mit.edu	37	22	48477442	48477443	+	IGR	INS	-	G	G	rs147876879	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48477442_48477443insG								TBC1D22A (907720 upstream) : FAM19A5 (407845 downstream)																																			---	---	---	---
FAM19A5	25817	broad.mit.edu	37	22	49034500	49034500	+	Intron	DEL	T	-	-	rs11703204	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49034500delT	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436			family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)														---	---	---	---
TTLL8	164714	broad.mit.edu	37	22	50486544	50486545	+	Intron	INS	-	GT	GT	rs137999530	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50486544_50486545insGT	uc011ark.1	-							NM_001080447	NP_001073916			tubulin tyrosine ligase-like family, member 8											ovary(2)	2		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	51103752	51103752	+	IGR	DEL	T	-	-	rs34883101		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51103752delT								ARSA (37145 upstream) : SHANK3 (9318 downstream)																																			---	---	---	---
PPP2R3B	28227	broad.mit.edu	37	X	302445	302445	+	Intron	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:302445delC	uc004cpg.2	-						PPP2R3B_uc004cpf.2_5'UTR	NM_013239	NP_037371			protein phosphatase 2, regulatory subunit B'',						cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	448857	448860	+	IGR	DEL	AGAA	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:448857_448860delAGAA								PPP2R3B (101230 upstream) : SHOX (136219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	728944	728945	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:728944_728945delAC								SHOX (108799 upstream) : CRLF2 (585942 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	1027409	1027410	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1027409_1027410insA								SHOX (407264 upstream) : CRLF2 (287477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	2056334	2056334	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2056334delA								ASMT (294361 upstream) : DHRSX (81223 downstream)																																			---	---	---	---
DHRSX	207063	broad.mit.edu	37	X	2248261	2248262	+	Intron	INS	-	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2248261_2248262insG	uc004cqf.3	-							NM_145177	NP_660160			dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)																---	---	---	---
DHRSX	207063	broad.mit.edu	37	X	2363475	2363475	+	Intron	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2363475delA	uc004cqf.3	-							NM_145177	NP_660160			dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	2896227	2896227	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2896227delT								ARSE (9941 upstream) : ARSH (28427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	38374011	38374012	+	IGR	DEL	AC	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38374011_38374012delAC								OTC (93309 upstream) : TSPAN7 (46719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	38410636	38410636	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38410636delC								OTC (129934 upstream) : TSPAN7 (10095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	61760975	61760975	+	IGR	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61760975delT								None (None upstream) : SPIN4 (806133 downstream)																																			---	---	---	---
NCRNA00182	100302692	broad.mit.edu	37	X	73436603	73436603	+	Intron	DEL	T	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73436603delT	uc010nlq.1	-						uc004ebq.1_Intron					Homo sapiens cDNA FLJ33139 fis, clone UTERU1000109.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	76375216	76375216	+	IGR	DEL	A	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76375216delA								MIR325 (149290 upstream) : FGF16 (334431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	81917216	81917217	+	IGR	INS	-	AC	AC			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:81917216_81917217insAC								None (None upstream) : POU3F4 (846052 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	105475127	105475128	+	IGR	INS	-	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105475127_105475128insA								MUM1L1 (22179 upstream) : CXorf57 (380032 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	139333315	139333316	+	IGR	DEL	CA	-	-	rs72115502		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139333315_139333316delCA								CXorf66 (285638 upstream) : SOX3 (251836 downstream)																																			---	---	---	---
F8	2157	broad.mit.edu	37	X	154179960	154179961	+	Intron	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154179960_154179961insT	uc004fmt.2	-							NM_000132	NP_000123			coagulation factor VIII isoform a precursor						acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)													---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9932644	9932644	+	IGR	DEL	C	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9932644delC								TTTY22 (281790 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9934634	9934635	+	IGR	INS	-	GT	GT			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9934634_9934635insGT								TTTY22 (283780 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9951328	9951329	+	IGR	DEL	AA	-	-	rs148567096		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9951328_9951329delAA								TTTY22 (300474 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13391698	13391699	+	IGR	INS	-	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13391698_13391699insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13601466	13601467	+	IGR	INS	-	T	T	rs112972965		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13601466_13601467insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13705803	13705804	+	IGR	INS	-	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13705803_13705804insG								None (None upstream) : None (None downstream)																																			---	---	---	---
CD24	100133941	broad.mit.edu	37	Y	21152663	21152664	+	Splice_Site	DEL	AA	-	-	rs111913046		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:21152663_21152664delAA	uc004ftz.1	-	2	2042	c.1932_splice	c.e2+1		TTTY14_uc004fty.2_Intron	NM_013230	NP_037362			CD24 antigen precursor						axon guidance|B cell receptor transport into membrane raft|cell activation|cell migration|cell-cell adhesion|chemokine receptor transport out of membrane raft|cholesterol homeostasis|elevation of cytosolic calcium ion concentration|induction of apoptosis by intracellular signals|negative regulation of transforming growth factor-beta3 production|positive regulation of activated T cell proliferation|positive regulation of MAP kinase activity|regulation of cytokine-mediated signaling pathway|regulation of epithelial cell differentiation|regulation of MAPKKK cascade|respiratory burst|response to estrogen stimulus|response to hypoxia|response to molecule of bacterial origin|T cell costimulation|Wnt receptor signaling pathway	anchored to membrane|cell surface|membrane raft|plasma membrane	protein kinase binding|protein tyrosine kinase activator activity|signal transducer activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	Y	28805317	28805317	+	IGR	DEL	G	-	-			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28805317delG								None (None upstream) : None (None downstream)																																			---	---	---	---
TIE1	7075	broad.mit.edu	37	1	43775136	43775136	+	Silent	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43775136G>T	uc001ciu.2	+	9	1345	c.1266G>T	c.(1264-1266)GGG>GGT	p.G422G	TIE1_uc010okd.1_Silent_p.G422G|TIE1_uc010oke.1_Silent_p.G377G|TIE1_uc009vwq.2_Silent_p.G378G|TIE1_uc010okf.1_Silent_p.G67G|TIE1_uc010okg.1_Silent_p.G67G|TIE1_uc010okc.1_3'UTR	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	422	Ig-like C2-type 2.|Extracellular (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)																---	---	---	---
USP21	27005	broad.mit.edu	37	1	161130467	161130467	+	Silent	SNP	C	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161130467C>A	uc010pke.1	+	3	414	c.37C>A	c.(37-39)CGA>AGA	p.R13R	USP21_uc010pkc.1_Silent_p.R13R|USP21_uc010pkd.1_Silent_p.R13R|USP21_uc010pkf.1_Silent_p.R13R	NM_001014443	NP_001014443	Q9UK80	UBP21_HUMAN	ubiquitin-specific protease 21	13					histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding|NEDD8-specific protease activity|protein binding|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)|prostate(1)|breast(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)															---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	186014824	186014824	+	Silent	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186014824G>A	uc001grq.1	+	41	6538	c.6309G>A	c.(6307-6309)CCG>CCA	p.P2103P		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2103					response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	89475869	89475869	+	RNA	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89475869G>A	uc010ytr.1	-	28		c.3612C>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																														---	---	---	---
NEB	4703	broad.mit.edu	37	2	152370909	152370909	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152370909G>A	uc010fnx.2	-	131	18138	c.17947C>T	c.(17947-17949)CGT>TGT	p.R5983C	NEB_uc002txr.2_Missense_Mutation_p.R2406C|NEB_uc002txt.3_Missense_Mutation_p.R488C	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	5983					muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)														---	---	---	---
ACADL	33	broad.mit.edu	37	2	211059934	211059934	+	Splice_Site	SNP	C	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211059934C>A	uc002vdz.3	-	9	1340	c.1112_splice	c.e9+1	p.W371_splice		NM_001608	NP_001599			long-chain acyl-CoA dehydrogenase precursor						carnitine catabolic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|negative regulation of fatty acid biosynthetic process|negative regulation of fatty acid oxidation|regulation of cholesterol metabolic process|temperature homeostasis	mitochondrial matrix	long-chain-acyl-CoA dehydrogenase activity|palmitoyl-CoA oxidase activity				0		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)														---	---	---	---
GALNTL2	117248	broad.mit.edu	37	3	16268961	16268961	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16268961G>A	uc003car.3	+	10	2349	c.1874G>A	c.(1873-1875)CGC>CAC	p.R625H	GALNTL2_uc003caq.3_Missense_Mutation_p.R358H|GALNTL2_uc003cas.3_Missense_Mutation_p.R155H	NM_054110	NP_473451	Q8N3T1	GLTL2_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	625	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1																		---	---	---	---
RBM6	10180	broad.mit.edu	37	3	50099471	50099471	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50099471G>A	uc003cyc.2	+	15	2649	c.2516G>A	c.(2515-2517)GGA>GAA	p.G839E	RBM6_uc010hlc.1_Missense_Mutation_p.G358E|RBM6_uc003cyd.2_Missense_Mutation_p.G317E|RBM6_uc003cye.2_Missense_Mutation_p.G317E|RBM6_uc011bdi.1_Missense_Mutation_p.G181E|RBM6_uc010hld.1_RNA|RBM6_uc010hle.1_RNA|RBM6_uc010hlf.1_RNA	NM_005777	NP_005768	P78332	RBM6_HUMAN	RNA binding motif protein 6	839					RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)														---	---	---	---
ATG3	64422	broad.mit.edu	37	3	112267407	112267407	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112267407C>T	uc003dzd.2	-	5	426	c.316G>A	c.(316-318)GGA>AGA	p.G106R	ATG3_uc003dzc.2_Missense_Mutation_p.G106R|ATG3_uc010hqe.2_Missense_Mutation_p.G106R	NM_022488	NP_071933	Q9NT62	ATG3_HUMAN	Apg3p	106					autophagic vacuole assembly|mitochondrial fragmentation involved in apoptosis|protein targeting to membrane|protein ubiquitination	cytoplasmic ubiquitin ligase complex|cytosol	Atg12 ligase activity|Atg8 ligase activity|enzyme binding			ovary(3)	3																		---	---	---	---
PRR23B	389151	broad.mit.edu	37	3	138739182	138739182	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138739182C>T	uc003esy.1	-	1	587	c.322G>A	c.(322-324)GTC>ATC	p.V108I		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	108										breast(1)	1																		---	---	---	---
FNDC3B	64778	broad.mit.edu	37	3	172060852	172060852	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172060852C>T	uc003fhy.2	+	18	2195	c.2023C>T	c.(2023-2025)CGA>TGA	p.R675*	FNDC3B_uc003fhz.3_Nonsense_Mutation_p.R675*	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	675	Fibronectin type-III 5.					endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)														---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	20852258	20852258	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20852258C>T	uc003gqe.2	-	2	229	c.145G>A	c.(145-147)GTC>ATC	p.V49I	KCNIP4_uc003gqf.1_Missense_Mutation_p.V45I|KCNIP4_uc003gqg.1_Missense_Mutation_p.V4I|KCNIP4_uc003gqh.1_Missense_Mutation_p.V41I|KCNIP4_uc003gqi.1_Missense_Mutation_p.V4I|KCNIP4_uc010iel.2_Missense_Mutation_p.V46I|KCNIP4_uc003gqd.3_Missense_Mutation_p.V29I	NM_147182	NP_671711	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 3	66	EF-hand 1; degenerate.					plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
TLR6	10333	broad.mit.edu	37	4	38828822	38828822	+	Missense_Mutation	SNP	C	T	T	rs55963748		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38828822C>T	uc003gtm.2	-	1	2339	c.2273G>A	c.(2272-2274)CGG>CAG	p.R758Q	TLR6_uc010ifg.1_Missense_Mutation_p.R758Q	NM_006068	NP_006059	Q9Y2C9	TLR6_HUMAN	toll-like receptor 6 precursor	758	TIR.|Cytoplasmic (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to diacyl bacterial lipopeptide|defense response to bacterium|detection of diacyl bacterial lipopeptide|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-6 biosynthetic process|positive regulation of JUN kinase activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	integral to plasma membrane|phagocytic vesicle membrane	lipopeptide binding|transmembrane receptor activity			ovary(2)	2																		---	---	---	---
COL25A1	84570	broad.mit.edu	37	4	109745367	109745367	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109745367C>A	uc003hze.1	-	34	2339	c.1808G>T	c.(1807-1809)CGG>CTG	p.R603L	COL25A1_uc003hzg.2_Missense_Mutation_p.R603L|COL25A1_uc003hzd.2_RNA|COL25A1_uc003hzf.2_Missense_Mutation_p.R391L	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN	collagen, type XXV, alpha 1 isoform 1	603	Extracellular (Potential).|Collagen-like 7.					collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)														---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126328196	126328196	+	Silent	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126328196G>A	uc003ifj.3	+	3	5469	c.5469G>A	c.(5467-5469)TCG>TCA	p.S1823S	FAT4_uc011cgp.1_Silent_p.S121S	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1823	Cadherin 17.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
PHF17	79960	broad.mit.edu	37	4	129793292	129793292	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129793292G>T	uc003igk.2	+	11	2684	c.2404G>T	c.(2404-2406)GGG>TGG	p.G802W	PHF17_uc003igl.2_Missense_Mutation_p.G790W|PHF17_uc011cgy.1_Missense_Mutation_p.G802W	NM_199320	NP_955352	Q6IE81	JADE1_HUMAN	PHD finger protein 17 long isoform	802					apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding				0																		---	---	---	---
IRX1	79192	broad.mit.edu	37	5	3599703	3599703	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3599703C>T	uc003jde.2	+	2	693	c.641C>T	c.(640-642)CCG>CTG	p.P214L		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	214						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2																		---	---	---	---
OSMR	9180	broad.mit.edu	37	5	38876363	38876363	+	Missense_Mutation	SNP	G	A	A	rs147223683		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38876363G>A	uc003jln.1	+	3	501	c.134G>A	c.(133-135)CGT>CAT	p.R45H	OSMR_uc003jlm.1_Missense_Mutation_p.R45H	NM_003999	NP_003990	Q99650	OSMR_HUMAN	oncostatin M receptor precursor	45	Extracellular (Potential).				cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_lung(31;0.000365)																	---	---	---	---
GPR98	84059	broad.mit.edu	37	5	89989926	89989926	+	Silent	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89989926G>A	uc003kju.2	+	33	7449	c.7353G>A	c.(7351-7353)GCG>GCA	p.A2451A	GPR98_uc003kjt.2_Silent_p.A157A|GPR98_uc003kjv.2_Silent_p.A51A	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2451	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
IL13	3596	broad.mit.edu	37	5	131995955	131995955	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131995955G>A	uc003kxj.1	+	4	436	c.422G>A	c.(421-423)CGC>CAC	p.R141H		NM_002188	NP_002179	P35225	IL13_HUMAN	interleukin 13 precursor	141					cellular component movement|immune response|inflammatory response|signal transduction	extracellular space|soluble fraction	cytokine activity			ovary(1)|skin(1)	2		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
PCDHA4	56144	broad.mit.edu	37	5	140188443	140188443	+	Silent	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140188443C>T	uc003lhi.2	+	1	1772	c.1671C>T	c.(1669-1671)GAC>GAT	p.D557D	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Silent_p.D557D|PCDHA4_uc011daa.1_Silent_p.D557D	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	557	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHA8	56140	broad.mit.edu	37	5	140221295	140221295	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140221295C>T	uc003lhs.2	+	1	389	c.389C>T	c.(388-390)CCG>CTG	p.P130L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.P130L	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	130	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHB15	56121	broad.mit.edu	37	5	140625165	140625165	+	Missense_Mutation	SNP	C	T	T	rs147410183		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140625165C>T	uc003lje.2	+	1	19	c.19C>T	c.(19-21)CGC>TGC	p.R7C		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	7					homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
SYNPO	11346	broad.mit.edu	37	5	150029778	150029778	+	Silent	SNP	C	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150029778C>A	uc003lsn.2	+	3	3047	c.2673C>A	c.(2671-2673)CCC>CCA	p.P891P	SYNPO_uc003lso.3_Silent_p.P647P|SYNPO_uc003lsp.2_Silent_p.P647P	NM_001109974	NP_001103444	Q8N3V7	SYNPO_HUMAN	synaptopodin isoform B	891	Pro-rich.				positive regulation of actin filament bundle assembly|regulation of stress fiber assembly	actin cytoskeleton|cytoplasm|dendritic spine|perikaryon|postsynaptic density|postsynaptic membrane|tight junction	actin binding|protein binding			large_intestine(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
HAVCR2	84868	broad.mit.edu	37	5	156533941	156533941	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156533941C>T	uc003lwk.1	-	2	235	c.91G>A	c.(91-93)GGT>AGT	p.G31S	HAVCR2_uc003lwl.2_Missense_Mutation_p.G31S	NM_032782	NP_116171	Q8TDQ0	HAVR2_HUMAN	T cell immunoglobulin mucin 3 precursor	31	Ig-like V-type.|Extracellular (Potential).					integral to membrane					0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
NSD1	64324	broad.mit.edu	37	5	176721281	176721281	+	Silent	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176721281C>T	uc003mfr.3	+	23	7050	c.6912C>T	c.(6910-6912)ACC>ACT	p.T2304T	NSD1_uc003mft.3_Silent_p.T2035T|NSD1_uc011dfx.1_Silent_p.T1952T	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2304	Pro-rich.			TK -> AQ (in Ref. 3; AAK92049).	negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)				T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			---	---	---	---
RUNX2	860	broad.mit.edu	37	6	45459791	45459791	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45459791C>T	uc011dvx.1	+	6	1009	c.799C>T	c.(799-801)CGG>TGG	p.R267W	RUNX2_uc011dvy.1_Missense_Mutation_p.R267W|RUNX2_uc003oxt.2_Missense_Mutation_p.R253W	NM_001024630	NP_001019801	Q13950	RUNX2_HUMAN	runt-related transcription factor 2 isoform a	267	Pro/Ser/Thr-rich.				negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3																		---	---	---	---
ENPP5	59084	broad.mit.edu	37	6	46135385	46135385	+	Silent	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46135385C>T	uc003oxz.1	-	2	823	c.615G>A	c.(613-615)GGG>GGA	p.G205G	ENPP5_uc003oya.1_Silent_p.G205G|ENPP5_uc011dvz.1_Silent_p.G111G|ENPP5_uc010jzc.1_Silent_p.G205G	NM_021572	NP_067547	Q9UJA9	ENPP5_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	205						extracellular region|integral to membrane	hydrolase activity				0																		---	---	---	---
BAI3	577	broad.mit.edu	37	6	69666692	69666692	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69666692C>T	uc003pev.3	+	8	1964	c.1516C>T	c.(1516-1518)CGA>TGA	p.R506*	BAI3_uc010kak.2_Nonsense_Mutation_p.R506*	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	506	TSP type-1 4.|Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	p.R506R(1)		lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
SIM1	6492	broad.mit.edu	37	6	100838829	100838829	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100838829G>C	uc003pqj.3	-	11	1916	c.1709C>G	c.(1708-1710)GCC>GGC	p.A570G	SIM1_uc010kcu.2_Missense_Mutation_p.A570G	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	570	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)														---	---	---	---
ARID1B	57492	broad.mit.edu	37	6	157528936	157528936	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157528936C>T	uc003qqn.2	+	20	6759	c.6607C>T	c.(6607-6609)CGG>TGG	p.R2203W	ARID1B_uc003qqo.2_Missense_Mutation_p.R2163W|ARID1B_uc003qqp.2_Missense_Mutation_p.R2150W	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	2208					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)														---	---	---	---
IGF2R	3482	broad.mit.edu	37	6	160464229	160464229	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160464229G>C	uc003qta.2	+	12	1678	c.1530G>C	c.(1528-1530)GAG>GAC	p.E510D		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	510	4.|Lumenal (Potential).			E -> K (in Ref. 2; AAA59866).	receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)														---	---	---	---
FZD1	8321	broad.mit.edu	37	7	90894881	90894881	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90894881G>T	uc003ula.2	+	1	1099	c.686G>T	c.(685-687)GGC>GTC	p.G229V		NM_003505	NP_003496	Q9UP38	FZD1_HUMAN	frizzled 1 precursor	229	FZ.|Extracellular (Potential).				autocrine signaling|axonogenesis|brain development|canonical Wnt receptor signaling pathway involved in mesenchymal stem cell differentiation|canonical Wnt receptor signaling pathway involved in osteoblast differentiation|embryo development|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|lung alveolus development|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|response to drug|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cell surface|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|receptor binding|Wnt receptor activity|Wnt-protein binding				0	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)															---	---	---	---
FLNC	2318	broad.mit.edu	37	7	128497191	128497191	+	Silent	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128497191C>T	uc003vnz.3	+	46	7790	c.7581C>T	c.(7579-7581)ATC>ATT	p.I2527I	FLNC_uc003voa.3_Silent_p.I2494I	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	2527	Interaction with INPPL1.|Filamin 23.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12																		---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	132193152	132193152	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132193152C>T	uc003vra.3	-	2	530	c.301G>A	c.(301-303)GTC>ATC	p.V101I	PLXNA4_uc003vrc.2_Missense_Mutation_p.V101I|PLXNA4_uc003vrb.2_Missense_Mutation_p.V101I	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	101	Extracellular (Potential).|Sema.					integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
KEL	3792	broad.mit.edu	37	7	142643302	142643302	+	Silent	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142643302G>T	uc003wcb.2	-	11	1516	c.1306C>A	c.(1306-1308)CGA>AGA	p.R436R		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	436	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)																	---	---	---	---
GIMAP5	55340	broad.mit.edu	37	7	150439730	150439730	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150439730C>T	uc003whr.1	+	3	855	c.503C>T	c.(502-504)ACG>ATG	p.T168M	GIMAP5_uc010lpu.2_Missense_Mutation_p.T26M	NM_018384	NP_060854	Q96F15	GIMA5_HUMAN	GTPase, IMAP family member 5	168	Cytoplasmic (Potential).					integral to membrane|mitochondrial outer membrane	GTP binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
LZTS1	11178	broad.mit.edu	37	8	20107756	20107756	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20107756C>T	uc003wzr.2	-	3	1379	c.1268G>A	c.(1267-1269)CGG>CAG	p.R423Q	LZTS1_uc010ltg.1_Missense_Mutation_p.R423Q	NM_021020	NP_066300	Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	423					cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)														---	---	---	---
MAK16	84549	broad.mit.edu	37	8	33347821	33347821	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33347821G>C	uc003xjj.2	+	6	451	c.411G>C	c.(409-411)TTG>TTC	p.L137F	C8orf41_uc010lvu.1_Intron	NM_032509	NP_115898	Q9BXY0	MAK16_HUMAN	MAK16 homolog	137						nucleolus				ovary(1)	1																		---	---	---	---
PREX2	80243	broad.mit.edu	37	8	68934283	68934283	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68934283C>G	uc003xxv.1	+	4	376	c.349C>G	c.(349-351)CGT>GGT	p.R117G	PREX2_uc003xxu.1_Missense_Mutation_p.R117G|PREX2_uc011lez.1_Missense_Mutation_p.R52G	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	117	DH.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
CPNE3	8895	broad.mit.edu	37	8	87568330	87568330	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87568330C>T	uc003ydv.2	+	16	1417	c.1255C>T	c.(1255-1257)CAA>TAA	p.Q419*	CPNE3_uc003ydw.1_Nonsense_Mutation_p.Q135*	NM_003909	NP_003900	O75131	CPNE3_HUMAN	copine III	419	VWFA.			Q -> R (in Ref. 4; AAH36242).	lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
SLC46A2	57864	broad.mit.edu	37	9	115648870	115648870	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115648870A>C	uc004bgk.2	-	3	1472	c.1240T>G	c.(1240-1242)TCC>GCC	p.S414A		NM_033051	NP_149040	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	414	Helical; Name=11; (Potential).					integral to membrane|plasma membrane	symporter activity			central_nervous_system(1)	1																		---	---	---	---
ITIH5	80760	broad.mit.edu	37	10	7659159	7659159	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7659159C>A	uc001ijq.2	-	6	818	c.739G>T	c.(739-741)GCC>TCC	p.A247S	ITIH5_uc001ijp.2_Missense_Mutation_p.A33S|ITIH5_uc001ijr.1_Missense_Mutation_p.A247S	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	247					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
MKX	283078	broad.mit.edu	37	10	27964469	27964469	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27964469C>A	uc001ity.3	-	6	1078	c.853G>T	c.(853-855)GGA>TGA	p.G285*	MKX_uc001itx.3_Nonsense_Mutation_p.G285*	NM_173576	NP_775847	Q8IYA7	MKX_HUMAN	mohawk homeobox	285					muscle organ development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
MYPN	84665	broad.mit.edu	37	10	69961645	69961645	+	Missense_Mutation	SNP	G	A	A	rs145923914		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69961645G>A	uc001jnm.3	+	19	3738	c.3553G>A	c.(3553-3555)GAA>AAA	p.E1185K	MYPN_uc001jnn.3_Missense_Mutation_p.E910K|MYPN_uc001jno.3_Missense_Mutation_p.E1185K|MYPN_uc009xpt.2_Missense_Mutation_p.E1185K|MYPN_uc010qit.1_Missense_Mutation_p.E891K|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	1185	Interaction with ACTN.|Ig-like 5.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5																		---	---	---	---
LIPN	643418	broad.mit.edu	37	10	90524288	90524288	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90524288G>T	uc010qmw.1	+	3	348	c.348G>T	c.(346-348)ATG>ATT	p.M116I		NM_001102469	NP_001095939	Q5VXI9	LIPN_HUMAN	lipase-like, ab-hydrolase domain containing 4	116					lipid catabolic process	extracellular region	hydrolase activity				0		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)														---	---	---	---
C11orf17	56672	broad.mit.edu	37	11	8934020	8934020	+	Silent	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8934020C>T	uc001mgx.2	+	3	319	c.243C>T	c.(241-243)ACC>ACT	p.T81T	ST5_uc001mgv.2_5'Flank|C11orf17_uc001mgz.2_Silent_p.T81T|C11orf17_uc001mgy.2_Intron|C11orf17_uc010rbr.1_Silent_p.T81T|C11orf17_uc010rbs.1_Intron|C11orf17_uc001mha.2_Silent_p.T81T	NM_020642	NP_065693	Q9NQ31	AKIP1_HUMAN	chromosome 11 open reading frame 17	81						nucleus	protein binding				0				Epithelial(150;5.08e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0243)														---	---	---	---
OR9G4	283189	broad.mit.edu	37	11	56510896	56510896	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56510896G>T	uc010rjo.1	-	1	392	c.392C>A	c.(391-393)GCA>GAA	p.A131E		NM_001005284	NP_001005284	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G,	131	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3																		---	---	---	---
PYGM	5837	broad.mit.edu	37	11	64523005	64523005	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64523005G>A	uc001oax.3	-	6	1503	c.686C>T	c.(685-687)ACG>ATG	p.T229M	PYGM_uc001oay.3_Missense_Mutation_p.T141M	NM_005609	NP_005600	P11217	PYGM_HUMAN	muscle glycogen phosphorylase isoform 1	229					glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding			ovary(2)	2					Pyridoxal Phosphate(DB00114)													---	---	---	---
MAP6	4135	broad.mit.edu	37	11	75298623	75298623	+	Silent	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75298623G>T	uc001owu.2	-	4	1988	c.1923C>A	c.(1921-1923)CCC>CCA	p.P641P		NM_033063	NP_149052	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6 isoform 1	641	Pro-rich.					Golgi apparatus|microtubule|perinuclear region of cytoplasm	calmodulin binding				0	Ovarian(111;0.11)																	---	---	---	---
GRM5	2915	broad.mit.edu	37	11	88258539	88258539	+	Silent	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88258539C>T	uc001pcq.2	-	8	2864	c.2664G>A	c.(2662-2664)TCG>TCA	p.S888S	GRM5_uc009yvm.2_Intron	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	888	Cytoplasmic (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)													---	---	---	---
TYR	7299	broad.mit.edu	37	11	88911154	88911154	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88911154G>C	uc001pcs.2	+	1	115	c.33G>C	c.(31-33)TGG>TGC	p.W11C		NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor	11					eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)									Oculocutaneous_Albinism				---	---	---	---
AMOTL1	154810	broad.mit.edu	37	11	94554892	94554892	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94554892C>T	uc001pfb.2	+	4	1488	c.1318C>T	c.(1318-1320)CGA>TGA	p.R440*	AMOTL1_uc001pfc.2_Nonsense_Mutation_p.R390*	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN	angiomotin like 1	440	Potential.					cytoplasm|tight junction	identical protein binding			ovary(1)|breast(1)	2		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)																---	---	---	---
ZNF202	7753	broad.mit.edu	37	11	123597209	123597209	+	Nonsense_Mutation	SNP	A	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123597209A>C	uc001pzd.1	-	9	1843	c.1443T>G	c.(1441-1443)TAT>TAG	p.Y481*	ZNF202_uc001pzc.1_Nonsense_Mutation_p.Y257*|ZNF202_uc001pze.1_Nonsense_Mutation_p.Y481*|ZNF202_uc001pzf.1_Nonsense_Mutation_p.Y481*	NM_003455	NP_003446	O95125	ZN202_HUMAN	zinc finger protein 202	481	C2H2-type 3.				lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)														---	---	---	---
CD163L1	283316	broad.mit.edu	37	12	7531680	7531680	+	Silent	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7531680C>T	uc001qsy.2	-	9	2291	c.2265G>A	c.(2263-2265)TCG>TCA	p.S755S	CD163L1_uc010sge.1_Silent_p.S765S	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	755	SRCR 7.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11																		---	---	---	---
OLR1	4973	broad.mit.edu	37	12	10319473	10319473	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10319473G>A	uc001qxo.1	-	3	376	c.262C>T	c.(262-264)CGG>TGG	p.R88W	OLR1_uc010sgz.1_5'UTR|OLR1_uc010sha.1_Missense_Mutation_p.R88W	NM_002543	NP_002534	P78380	OLR1_HUMAN	oxidized low density lipoprotein (lectin-like)	88	Extracellular (Potential).|Neck.|Potential.				blood circulation|blood coagulation|inflammatory response|leukocyte migration|proteolysis	extracellular region|integral to plasma membrane|membrane fraction	sugar binding			ovary(1)	1																		---	---	---	---
LMBR1L	55716	broad.mit.edu	37	12	49496741	49496741	+	Intron	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49496741G>T	uc001rth.3	-						LMBR1L_uc001rtg.3_Intron|LMBR1L_uc001rti.3_Intron|LMBR1L_uc001rtj.1_Intron|LMBR1L_uc009zld.1_Intron|LMBR1L_uc010smf.1_Intron	NM_018113	NP_060583			lipocalin-interacting membrane receptor						endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1																		---	---	---	---
NFE2	4778	broad.mit.edu	37	12	54686312	54686312	+	Missense_Mutation	SNP	C	T	T	rs142410365		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54686312C>T	uc009znk.2	-	2	1478	c.968G>A	c.(967-969)CGC>CAC	p.R323H	NFE2_uc001sfq.2_Missense_Mutation_p.R323H|NFE2_uc001sfr.3_Missense_Mutation_p.R323H|NFE2_uc009znl.2_Missense_Mutation_p.R323H	NM_006163	NP_006154	Q16621	NFE2_HUMAN	nuclear factor, erythroid derived 2 isoform 1	323	Leucine-zipper.				blood circulation|blood coagulation|multicellular organismal development|nucleosome disassembly|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	actin cytoskeleton|cytoplasm|PML body	protein dimerization activity|protein N-terminus binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|WW domain binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	66502095	66502095	+	IGR	SNP	C	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66502095C>A								HMGA2 (142027 upstream) : LLPH (14755 downstream)																																	OREG0021973	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
BEST3	144453	broad.mit.edu	37	12	70048746	70048746	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70048746C>A	uc001svg.2	-	10	2175	c.1948G>T	c.(1948-1950)GAC>TAC	p.D650Y	BEST3_uc001svd.1_Intron|BEST3_uc001sve.1_Intron|BEST3_uc001svf.2_Missense_Mutation_p.D437Y|BEST3_uc010stm.1_Missense_Mutation_p.D544Y	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	vitelliform macular dystrophy 2-like 3 isoform	650	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)															---	---	---	---
BEST3	144453	broad.mit.edu	37	12	70048869	70048869	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70048869C>G	uc001svg.2	-	10	2052	c.1825G>C	c.(1825-1827)GAC>CAC	p.D609H	BEST3_uc001svd.1_Intron|BEST3_uc001sve.1_Intron|BEST3_uc001svf.2_Missense_Mutation_p.D396H|BEST3_uc010stm.1_Missense_Mutation_p.D503H	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	vitelliform macular dystrophy 2-like 3 isoform	609	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)															---	---	---	---
BEST3	144453	broad.mit.edu	37	12	70049190	70049190	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70049190C>A	uc001svg.2	-	10	1731	c.1504G>T	c.(1504-1506)GAG>TAG	p.E502*	BEST3_uc001svd.1_Intron|BEST3_uc001sve.1_Intron|BEST3_uc001svf.2_Nonsense_Mutation_p.E289*|BEST3_uc010stm.1_Nonsense_Mutation_p.E396*	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	vitelliform macular dystrophy 2-like 3 isoform	502	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)															---	---	---	---
BEST3	144453	broad.mit.edu	37	12	70049222	70049222	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70049222C>T	uc001svg.2	-	10	1699	c.1472G>A	c.(1471-1473)AGA>AAA	p.R491K	BEST3_uc001svd.1_Intron|BEST3_uc001sve.1_Intron|BEST3_uc001svf.2_Missense_Mutation_p.R278K|BEST3_uc010stm.1_Missense_Mutation_p.R385K	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	vitelliform macular dystrophy 2-like 3 isoform	491	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)															---	---	---	---
GCN1L1	10985	broad.mit.edu	37	12	120576118	120576118	+	Intron	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120576118G>T	uc001txo.2	-							NM_006836	NP_006827			GCN1 general control of amino-acid synthesis						regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
KNTC1	9735	broad.mit.edu	37	12	123055666	123055666	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123055666T>A	uc001ucv.2	+	24	2175	c.2012T>A	c.(2011-2013)ATT>AAT	p.I671N	KNTC1_uc010taf.1_Missense_Mutation_p.I634N	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	671					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding	p.W670fs*3(1)		ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)														---	---	---	---
ZC3H13	23091	broad.mit.edu	37	13	46543374	46543374	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46543374G>A	uc010tfw.1	-	13	3311	c.3305C>T	c.(3304-3306)CCT>CTT	p.P1102L	ZC3H13_uc001vaq.2_5'Flank|ZC3H13_uc001vas.1_Missense_Mutation_p.P1102L|ZC3H13_uc001vat.1_Missense_Mutation_p.P1102L	NM_015070	NP_055885	Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	1102							nucleic acid binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)														---	---	---	---
DOCK9	23348	broad.mit.edu	37	13	99460936	99460936	+	Intron	SNP	A	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99460936A>G	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnq.2_Intron|DOCK9_uc001vnr.2_Intron|DOCK9_uc010tin.1_Intron|DOCK9_uc001vns.2_Intron|DOCK9_uc010tio.1_Intron|DOCK9_uc010tip.1_Intron	NM_015296	NP_056111			dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
TEP1	7011	broad.mit.edu	37	14	20854596	20854596	+	Intron	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20854596G>A	uc001vxe.2	-						TEP1_uc010ahk.2_Intron|TEP1_uc010tlf.1_Intron|TEP1_uc010tlg.1_Intron	NM_007110	NP_009041			telomerase-associated protein 1						telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)														---	---	---	---
MDGA2	161357	broad.mit.edu	37	14	47566087	47566087	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47566087C>A	uc001wwj.3	-	6	1154	c.958G>T	c.(958-960)GCA>TCA	p.A320S	MDGA2_uc001wwi.3_Missense_Mutation_p.A91S|MDGA2_uc010ani.2_5'UTR	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	320	Ig-like 3.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106208447	106208447	+	RNA	SNP	G	A	A	rs1042409		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106208447G>A	uc010tyt.1	-	3627		c.58767C>T			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Silent_p.H17H|uc001ysf.2_Silent_p.H17H					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
TPM1	7168	broad.mit.edu	37	15	63351862	63351862	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63351862G>T	uc002alg.2	+	4	666	c.475G>T	c.(475-477)GAC>TAC	p.D159Y	TPM1_uc002alh.2_Missense_Mutation_p.D159Y|TPM1_uc010bgn.2_Intron|TPM1_uc002ali.2_Missense_Mutation_p.D159Y|TPM1_uc002alj.2_Missense_Mutation_p.D159Y|TPM1_uc002alk.2_Missense_Mutation_p.D159Y|TPM1_uc002all.2_Missense_Mutation_p.D159Y|TPM1_uc002alm.2_Missense_Mutation_p.D201Y|TPM1_uc010uie.1_Missense_Mutation_p.D159Y|TPM1_uc002alp.2_Missense_Mutation_p.D159Y|TPM1_uc010uif.1_Missense_Mutation_p.D123Y|TPM1_uc002alr.2_Missense_Mutation_p.D123Y|TPM1_uc002als.2_Missense_Mutation_p.D123Y|TPM1_uc010uig.1_Missense_Mutation_p.D123Y|TPM1_uc002alt.2_Missense_Mutation_p.D123Y|TPM1_uc010bgp.2_Missense_Mutation_p.D33Y	NM_001018005	NP_001018005	P09493	TPM1_HUMAN	tropomyosin 1 alpha chain isoform 1	159	By similarity.				cardiac muscle contraction|cellular component movement|cellular response to reactive oxygen species|muscle filament sliding|negative regulation of cell migration|positive regulation of ATPase activity|positive regulation of cell adhesion|positive regulation of heart rate by epinephrine|positive regulation of stress fiber assembly|regulation of muscle contraction|ruffle organization|sarcomere organization|ventricular cardiac muscle tissue morphogenesis|wound healing	bleb|cytosol|muscle thin filament tropomyosin|ruffle membrane|stress fiber	actin binding|structural constituent of cytoskeleton|structural constituent of muscle				0																		---	---	---	---
LINGO1	84894	broad.mit.edu	37	15	77906470	77906470	+	Silent	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77906470G>T	uc002bct.1	-	2	1831	c.1779C>A	c.(1777-1779)ATC>ATA	p.I593I	LINGO1_uc002bcu.1_Silent_p.I587I	NM_032808	NP_116197	Q96FE5	LIGO1_HUMAN	leucine-rich repeat neuronal 6A	593	Cytoplasmic (Potential).				negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)|lung(1)	2																		---	---	---	---
WDR90	197335	broad.mit.edu	37	16	711623	711623	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:711623C>A	uc002cii.1	+	31	3754	c.3700C>A	c.(3700-3702)CTG>ATG	p.L1234M	WDR90_uc002cij.1_Intron|WDR90_uc002cik.1_Missense_Mutation_p.L761M|WDR90_uc002cil.1_RNA|WDR90_uc002cim.1_Missense_Mutation_p.L408M|WDR90_uc002cin.1_Translation_Start_Site	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	1234	WD 13.									ovary(1)	1		Hepatocellular(780;0.0218)																---	---	---	---
MAPK8IP3	23162	broad.mit.edu	37	16	1797051	1797051	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1797051G>T	uc002cmk.2	+	6	886	c.766G>T	c.(766-768)GAG>TAG	p.E256*	MAPK8IP3_uc002cmi.1_3'UTR|MAPK8IP3_uc002cmj.1_RNA|MAPK8IP3_uc002cml.2_Nonsense_Mutation_p.E256*|MAPK8IP3_uc010uvl.1_Nonsense_Mutation_p.E257*	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	256					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
ZNF174	7727	broad.mit.edu	37	16	3458638	3458638	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3458638G>T	uc002cvc.2	+	3	1758	c.943G>T	c.(943-945)GGT>TGT	p.G315C		NM_003450	NP_003441	Q15697	ZN174_HUMAN	zinc finger protein 174 isoform a	315					negative regulation of transcription from RNA polymerase II promoter|viral reproduction	actin cytoskeleton|cytoplasm|nucleus	protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0																		---	---	---	---
CDH1	999	broad.mit.edu	37	16	68847283	68847283	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68847283A>T	uc002ewg.1	+	9	1329	c.1205A>T	c.(1204-1206)GAT>GTT	p.D402V	CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Intron	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	402	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding	p.Y380_K440del(5)|p.D402N(2)		breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)				Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578211	7578211	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578211C>T	uc002gim.2	-	6	832	c.638G>A	c.(637-639)CGA>CAA	p.R213Q	TP53_uc002gig.1_Missense_Mutation_p.R213Q|TP53_uc002gih.2_Missense_Mutation_p.R213Q|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R81Q|TP53_uc010cng.1_Missense_Mutation_p.R81Q|TP53_uc002gii.1_Missense_Mutation_p.R81Q|TP53_uc010cnh.1_Missense_Mutation_p.R213Q|TP53_uc010cni.1_Missense_Mutation_p.R213Q|TP53_uc002gij.2_Missense_Mutation_p.R213Q|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.R120Q|TP53_uc002gio.2_Missense_Mutation_p.R81Q|TP53_uc010vug.1_Missense_Mutation_p.R174Q	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	213	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R213*(182)|p.R213L(25)|p.R213Q(22)|p.R213fs*34(10)|p.0?(7)|p.R213P(5)|p.R213G(2)|p.K164_P219del(1)|p.D208_V216delDRNTFRHSV(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R213*33(1)|p.D208fs*1(1)|p.R213>L(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
THRA	7067	broad.mit.edu	37	17	38243080	38243080	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38243080G>T	uc002htw.2	+	7	1180	c.697G>T	c.(697-699)GCC>TCC	p.A233S	THRA_uc010cwp.1_Missense_Mutation_p.A233S|THRA_uc002htv.2_Missense_Mutation_p.A233S|THRA_uc002htx.2_Missense_Mutation_p.A233S	NM_003250	NP_003241	P10827	THA_HUMAN	thyroid hormone receptor, alpha isoform 2	233	Ligand-binding.				negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|negative regulation of transcription initiation, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription from RNA polymerase II promoter	cytosol|nucleoplasm	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|TBP-class protein binding|thyroid hormone binding|thyroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding				0	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Levothyroxine(DB00451)|Liothyronine(DB00279)											OREG0024390	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
KRT26	353288	broad.mit.edu	37	17	38925277	38925277	+	Silent	SNP	A	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38925277A>G	uc002hvf.2	-	6	1087	c.1041T>C	c.(1039-1041)GAT>GAC	p.D347D		NM_181539	NP_853517	Q7Z3Y9	K1C26_HUMAN	keratin 26	347	Rod.|Coil 2.					intermediate filament	structural molecule activity				0		Breast(137;0.00526)																---	---	---	---
WNK4	65266	broad.mit.edu	37	17	40939917	40939917	+	Silent	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40939917G>T	uc002ibj.2	+	8	1884	c.1863G>T	c.(1861-1863)TCG>TCT	p.S621S	WNK4_uc010wgx.1_Silent_p.S285S|WNK4_uc002ibk.1_Silent_p.S393S|WNK4_uc010wgy.1_Intron	NM_032387	NP_115763	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	621					intracellular protein kinase cascade	tight junction	ATP binding|protein serine/threonine kinase activity			ovary(3)|skin(3)|stomach(1)	7		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)														---	---	---	---
EXOC7	23265	broad.mit.edu	37	17	74079836	74079836	+	Intron	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74079836G>T	uc002jqs.2	-						EXOC7_uc002jqp.1_Intron|EXOC7_uc010dgv.1_Intron|EXOC7_uc002jqq.2_Intron|EXOC7_uc010wsw.1_Intron|EXOC7_uc010wsx.1_Intron|EXOC7_uc002jqr.2_Intron|EXOC7_uc010wsv.1_Intron	NM_001145297	NP_001138769			exocyst complex component 7 isoform 4						exocytosis|protein transport	centriolar satellite|cytosol|exocyst|plasma membrane	protein binding				0			LUSC - Lung squamous cell carcinoma(166;0.187)															---	---	---	---
SEC14L1	6397	broad.mit.edu	37	17	75192297	75192297	+	Silent	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75192297C>T	uc002jto.2	+	8	990	c.723C>T	c.(721-723)GCC>GCT	p.A241A	SEC14L1_uc010dhc.2_Silent_p.A241A|SEC14L1_uc010wth.1_Silent_p.A241A|SEC14L1_uc002jtm.2_Silent_p.A241A|SEC14L1_uc010wti.1_Silent_p.A207A	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a	241					transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2																		---	---	---	---
EPB41L3	23136	broad.mit.edu	37	18	5396233	5396233	+	Silent	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5396233G>A	uc002kmt.1	-	19	3026	c.2940C>T	c.(2938-2940)ACC>ACT	p.T980T	EPB41L3_uc010wzh.1_Silent_p.T811T|EPB41L3_uc002kmu.1_Silent_p.T758T|EPB41L3_uc010dkq.1_Silent_p.T649T|EPB41L3_uc002kms.1_Silent_p.T215T|EPB41L3_uc010wze.1_Silent_p.T285T|EPB41L3_uc010wzf.1_Silent_p.T277T|EPB41L3_uc010wzg.1_Silent_p.T252T|EPB41L3_uc010dkr.2_Silent_p.T372T	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	980	Carboxyl-terminal (CTD).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5																		---	---	---	---
SMAD2	4087	broad.mit.edu	37	18	45368211	45368211	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45368211G>C	uc002lcy.2	-	11	1639	c.1391C>G	c.(1390-1392)TCA>TGA	p.S464*	SMAD2_uc002lcz.2_Nonsense_Mutation_p.S464*|SMAD2_uc010xdc.1_Nonsense_Mutation_p.S434*	NM_005901	NP_005892	Q15796	SMAD2_HUMAN	Sma- and Mad-related protein 2 isoform 1	464	MH2.			S->A: Loss of phosphorylation by TGFBR1; when associated with A-465 and A-467.	anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding	p.R462fs*>4(1)		large_intestine(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
C19orf62	29086	broad.mit.edu	37	19	17379839	17379839	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17379839T>G	uc002nfu.2	+	2	342	c.224T>G	c.(223-225)GTG>GGG	p.V75G	C19orf62_uc010xpl.1_Missense_Mutation_p.V75G|C19orf62_uc002nfv.2_Missense_Mutation_p.V75G|C19orf62_uc010ean.2_RNA|C19orf62_uc002nfw.2_Missense_Mutation_p.V75G	NM_014173	NP_054892	Q9NWV8	BABA1_HUMAN	mediator of Rap80 interactions and targeting 40	75					chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of DNA repair|protein K63-linked deubiquitination|response to ionizing radiation	BRCA1-A complex|BRISC complex|cytoplasm	protein binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2																		---	---	---	---
LRRC25	126364	broad.mit.edu	37	19	18502806	18502806	+	Silent	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18502806G>T	uc002niw.2	-	2	1551	c.909C>A	c.(907-909)CCC>CCA	p.P303P	LRRC25_uc002nix.2_Silent_p.P303P	NM_145256	NP_660299	Q8N386	LRC25_HUMAN	leucine rich repeat containing 25 precursor	303	Cytoplasmic (Potential).					integral to membrane					0																		---	---	---	---
SELV	348303	broad.mit.edu	37	19	40009796	40009796	+	3'UTR	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40009796G>T	uc010xvc.1	+	6						NM_182704	NP_874363			selenoprotein V						cell redox homeostasis		selenium binding				0	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;8.61e-26)|all cancers(26;2.76e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)															---	---	---	---
SYCP2	10388	broad.mit.edu	37	20	58490536	58490536	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58490536C>T	uc002yaz.2	-	8	722	c.583G>A	c.(583-585)GAA>AAA	p.E195K	SYCP2_uc010gju.1_Missense_Mutation_p.E96K	NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	195					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)															---	---	---	---
HSF2BP	11077	broad.mit.edu	37	21	45064191	45064191	+	Silent	SNP	G	A	A	rs138962676	by1000genomes	TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45064191G>A	uc002zdi.2	-	4	602	c.270C>T	c.(268-270)GCC>GCT	p.A90A	HSF2BP_uc011aey.1_Silent_p.A15A	NM_007031	NP_008962	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding	90					spermatogenesis|transcription from RNA polymerase II promoter	cytosol	binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.18)														---	---	---	---
MYH9	4627	broad.mit.edu	37	22	36680481	36680481	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36680481C>A	uc003apg.2	-	39	5791	c.5560G>T	c.(5560-5562)GAG>TAG	p.E1854*		NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	1854	Potential.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11								T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				---	---	---	---
CSF2RB	1439	broad.mit.edu	37	22	37322201	37322201	+	Missense_Mutation	SNP	G	A	A	rs146302338		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37322201G>A	uc003aqa.3	+	4	590	c.373G>A	c.(373-375)GTC>ATC	p.V125I	CSF2RB_uc003aqc.3_Missense_Mutation_p.V125I	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta	125	Extracellular (Potential).				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)													---	---	---	---
VCX3A	51481	broad.mit.edu	37	X	6451796	6451796	+	Missense_Mutation	SNP	G	A	A	rs145354032		TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6451796G>A	uc004crs.2	-	3	858	c.551C>T	c.(550-552)CCG>CTG	p.P184L	VCX3A_uc010ndk.1_Intron	NM_016379	NP_057463	Q9NNX9	VCX3_HUMAN	variable charge, X-linked 3A	184	Glu-rich.				brain development	nucleolus					0																		---	---	---	---
VCX3B	425054	broad.mit.edu	37	X	8434414	8434414	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8434414C>T	uc010ndo.2	+	4	948	c.641C>T	c.(640-642)CCG>CTG	p.P214L		NM_001001888	NP_001001888	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	214						nucleolus					0																		---	---	---	---
IL1RAPL1	11141	broad.mit.edu	37	X	29301188	29301188	+	Silent	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29301188C>T	uc004dby.2	+	3	724	c.216C>T	c.(214-216)CTC>CTT	p.L72L		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	72	Ig-like C2-type 1.|Extracellular (Potential).				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5																		---	---	---	---
AWAT2	158835	broad.mit.edu	37	X	69262067	69262067	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69262067G>C	uc004dxt.1	-	6	823	c.817C>G	c.(817-819)CTG>GTG	p.L273V		NM_001002254	NP_001002254	Q6E213	AWAT2_HUMAN	wax synthase 2	273						endoplasmic reticulum membrane|integral to membrane	long-chain-alcohol O-fatty-acyltransferase activity				0																		---	---	---	---
LPAR4	2846	broad.mit.edu	37	X	78010787	78010787	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78010787G>T	uc010nme.2	+	2	826	c.421G>T	c.(421-423)GTC>TTC	p.V141F		NM_005296	NP_005287	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	141	Cytoplasmic (Potential).					integral to plasma membrane	lipid binding|purinergic nucleotide receptor activity, G-protein coupled			ovary(3)	3																		---	---	---	---
CAPN6	827	broad.mit.edu	37	X	110494199	110494199	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110494199C>T	uc004epc.1	-	8	1272	c.1104G>A	c.(1102-1104)ATG>ATA	p.M368I	CAPN6_uc011msu.1_Missense_Mutation_p.M113I	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6	368	Domain III.				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6																		---	---	---	---
GPC4	2239	broad.mit.edu	37	X	132458229	132458229	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4199-01A-01D-1126-08	TCGA-BR-4199-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132458229G>A	uc004exc.1	-	3	867	c.655C>T	c.(655-657)CGT>TGT	p.R219C	GPC4_uc011mvg.1_Missense_Mutation_p.R149C	NM_001448	NP_001439	O75487	GPC4_HUMAN	glypican 4 precursor	219					anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
