Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
PRKCZ	5590	broad.mit.edu	37	1	2052983	2052985	+	Intron	DEL	ATC	-	-	rs60501185		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2052983_2052985delATC	uc001aiq.2	+						PRKCZ_uc001air.2_Intron|PRKCZ_uc010nyw.1_Intron|PRKCZ_uc001ais.2_Intron	NM_002744	NP_002735			protein kinase C, zeta isoform 1						anti-apoptosis|intracellular signal transduction|negative regulation of insulin receptor signaling pathway|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein complex assembly|peptidyl-serine phosphorylation|platelet activation	endosome	ATP binding|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(2)	6	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	2438343	2438353	+	IGR	DEL	AAGGGCTGGGG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2438343_2438353delAAGGGCTGGGG								PLCH2 (1374 upstream) : PANK4 (1622 downstream)																																			---	---	---	---
PRDM16	63976	broad.mit.edu	37	1	3092717	3092724	+	Intron	DEL	ATCCATCC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3092717_3092724delATCCATCC	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397			PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)				T	EVI1	MDS|AML								---	---	---	---
MEGF6	1953	broad.mit.edu	37	1	3435012	3435012	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3435012delC	uc001akl.2	-						MEGF6_uc001akk.2_Intron	NM_001409	NP_001400			EGF-like-domain, multiple 3 precursor							extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)												OREG0013017	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
CCDC27	148870	broad.mit.edu	37	1	3682435	3682436	+	Intron	DEL	TT	-	-	rs149710424		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3682435_3682436delTT	uc001akv.2	+							NM_152492	NP_689705			coiled-coil domain containing 27											skin(1)	1	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7558985	7558986	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7558985_7558986delGT	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	8320700	8320700	+	IGR	DEL	T	-	-	rs35474248		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8320700delT								ERRFI1 (234307 upstream) : SLC45A1 (63690 downstream)																																			---	---	---	---
RERE	473	broad.mit.edu	37	1	8535434	8535434	+	Intron	DEL	A	-	-	rs113006451		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8535434delA	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc010nzx.1_Intron|RERE_uc001aph.1_Intron	NM_012102	NP_036234			atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)														---	---	---	---
SPSB1	80176	broad.mit.edu	37	1	9374234	9374235	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9374234_9374235insA	uc010oae.1	+							NM_025106	NP_079382			splA/ryanodine receptor domain and SOCS box						intracellular signal transduction	cytoplasm					0	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	9441708	9441709	+	IGR	INS	-	A	A	rs111811868		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9441708_9441709insA								SPSB1 (12120 upstream) : SLC25A33 (157819 downstream)																																			---	---	---	---
CASZ1	54897	broad.mit.edu	37	1	10854532	10854532	+	Intron	DEL	T	-	-	rs71583893		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10854532delT	uc001aro.2	-						CASZ1_uc001arp.1_Intron	NM_001079843	NP_001073312			castor homolog 1, zinc finger isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	11825543	11825543	+	Intron	DEL	T	-	-	rs139036502	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11825543delT	uc001asy.1	+											Homo sapiens chromosome 1 open reading frame 167, mRNA (cDNA clone IMAGE:40108751), partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	11934020	11934020	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11934020delA								NPPB (15028 upstream) : KIAA2013 (46104 downstream)																																			---	---	---	---
PRAMEF11	440560	broad.mit.edu	37	1	12890855	12890855	+	Intron	DEL	A	-	-	rs34338341		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12890855delA	uc001auk.2	-							NM_001146344	NP_001139816			PRAME family member 11												0																		---	---	---	---
KAZ	23254	broad.mit.edu	37	1	15340250	15340250	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15340250delA	uc001avm.3	+						KAZ_uc009vog.1_Intron|KAZ_uc010obj.1_Intron|KAZ_uc001avo.2_Intron|KAZ_uc001avp.2_Intron|KAZ_uc001avq.2_Intron|KAZ_uc001avr.2_Intron	NM_201628	NP_963922			kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0																		---	---	---	---
TMEM51	55092	broad.mit.edu	37	1	15484646	15484646	+	Intron	DEL	G	-	-	rs113596222		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15484646delG	uc001avw.3	+						TMEM51_uc010obk.1_Intron|TMEM51_uc001avz.2_Intron|TMEM51_uc001avy.2_Intron|TMEM51_uc001avx.2_Intron	NM_001136216	NP_001129688			transmembrane protein 51							integral to membrane					0		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)														---	---	---	---
FHAD1	114827	broad.mit.edu	37	1	15634231	15634231	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15634231delT	uc001awb.2	+						FHAD1_uc001awa.1_Intron	NM_052929	NP_443161			forkhead-associated (FHA) phosphopeptide binding											skin(1)	1																		---	---	---	---
ARHGEF19	128272	broad.mit.edu	37	1	16526340	16526340	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16526340delT	uc001ayc.1	-						ARHGEF19_uc009voo.1_Intron|ARHGEF19_uc001ayb.1_Intron	NM_153213	NP_694945			Rho guanine nucleotide exchange factor (GEF) 19						regulation of actin cytoskeleton organization	intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
NBPF1	55672	broad.mit.edu	37	1	16925995	16926006	+	Intron	DEL	CACACACATACA	-	-	rs72333783		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16925995_16926006delCACACACATACA	uc009vos.1	-							NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)														---	---	---	---
ESPNP	284729	broad.mit.edu	37	1	17019432	17019433	+	Intron	INS	-	GC	GC	rs138548890	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17019432_17019433insGC	uc001azn.1	-							NR_026567				RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;												0																		---	---	---	---
MST1P9	11223	broad.mit.edu	37	1	17082466	17082466	+	3'UTR	DEL	G	-	-	rs57178582		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17082466delG	uc010ock.1	-	15					CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_3'UTR	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0																		---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17233969	17233970	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17233969_17233970insT	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
IFFO2	126917	broad.mit.edu	37	1	19252548	19252548	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19252548delT	uc001bbd.2	-							NM_001136265	NP_001129737			intermediate filament family orphan 2												0																		---	---	---	---
UBR4	23352	broad.mit.edu	37	1	19420283	19420283	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19420283delT	uc001bbi.2	-						UBR4_uc010ocv.1_Intron|UBR4_uc009vph.2_Intron|UBR4_uc010ocw.1_Intron|UBR4_uc001bbg.2_Intron|UBR4_uc001bbh.2_Intron	NM_020765	NP_065816			retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)														---	---	---	---
EIF4G3	8672	broad.mit.edu	37	1	21334633	21334636	+	Intron	DEL	CAAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21334633_21334636delCAAA	uc001bec.2	-						EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beg.2_Intron|EIF4G3_uc010odk.1_Intron|EIF4G3_uc001beh.2_Intron	NM_003760	NP_003751			eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)														---	---	---	---
WNT4	54361	broad.mit.edu	37	1	22445554	22445555	+	3'UTR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22445554_22445555delGT	uc001bfs.3	-	5					WNT4_uc010odt.1_3'UTR	NM_030761	NP_110388			wingless-type MMTV integration site family,						adrenal gland development|androgen biosynthetic process|anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|dermatome development|endoderm development|epithelial to mesenchymal transition|establishment of protein localization in plasma membrane|female gonad development|female sex determination|liver development|male gonad development|mesonephric tubule development|metanephric mesenchymal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of male gonad development|negative regulation of testicular blood vessel morphogenesis|negative regulation of testosterone biosynthetic process|negative regulation of transcription, DNA-dependent|oocyte development|paramesonephric duct development|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of collagen biosynthetic process|positive regulation of cortisol biosynthetic process|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|protein palmitoylation|renal vesicle formation|smooth muscle cell differentiation|somatotropin secreting cell differentiation|tertiary branching involved in mammary gland duct morphogenesis|thyroid-stimulating hormone-secreting cell differentiation|Wnt receptor signaling pathway, calcium modulating pathway	cell surface|extracellular space|Golgi apparatus|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|signal transducer activity|transcription corepressor activity			ovary(1)	1		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)														---	---	---	---
EPHA8	2046	broad.mit.edu	37	1	22904263	22904264	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22904263_22904264delGT	uc001bfx.1	+						EPHA8_uc001bfw.2_Intron	NM_020526	NP_065387			ephrin receptor EphA8 isoform 1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	23328290	23328290	+	IGR	DEL	G	-	-	rs141852649		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23328290delG								EPHB2 (86468 upstream) : KDM1A (17651 downstream)																																			---	---	---	---
TRNAU1AP	54952	broad.mit.edu	37	1	28904895	28904896	+	3'UTR	INS	-	ACTT	ACTT	rs140527979	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28904895_28904896insACTT	uc001bqi.2	+	9					TRNAU1AP_uc001bqh.2_3'UTR|TRNAU1AP_uc010ofw.1_3'UTR	NM_017846	NP_060316			tRNA selenocysteine associated protein 1						selenocysteine incorporation	cytoplasm|nucleus	nucleotide binding|RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	29691887	29691888	+	IGR	INS	-	TTTCTTTCTCTTCTTTCTTTC	TTTCTTTCTCTTCTTTCTTTC	rs139763080	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29691887_29691888insTTTCTTTCTCTTCTTTCTTTC								PTPRU (38572 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	30659378	30659381	+	IGR	DEL	CATC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30659378_30659381delCATC								None (None upstream) : MATN1 (524745 downstream)																																			---	---	---	---
MATN1	4146	broad.mit.edu	37	1	31185552	31185552	+	3'UTR	DEL	C	-	-	rs71704793		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31185552delC	uc001brz.2	-	8						NM_002379	NP_002370			matrilin 1, cartilage matrix protein precursor						protein complex assembly	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			central_nervous_system(1)	1		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	32419072	32419075	+	IGR	DEL	TGTG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32419072_32419075delTGTG								PTP4A2 (15084 upstream) : KHDRBS1 (60416 downstream)																																			---	---	---	---
LCK	3932	broad.mit.edu	37	1	32738189	32738190	+	Intron	DEL	AG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32738189_32738190delAG	uc001bux.2	+						LCK_uc001buy.2_5'Flank|LCK_uc001buz.2_5'Flank|LCK_uc010ohc.1_5'Flank|LCK_uc001bva.2_5'Flank	NM_005356	NP_005347			lymphocyte-specific protein tyrosine kinase						activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding			lung(3)|central_nervous_system(2)|ovary(1)	6		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)			T	TRB@	T-ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	1	35304809	35304810	+	IGR	DEL	GA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35304809_35304810delGA								GJA4 (43463 upstream) : C1orf212 (14314 downstream)																																			---	---	---	---
DNALI1	7802	broad.mit.edu	37	1	38026968	38026969	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38026968_38026969delGT	uc001cbj.2	+						DNALI1_uc010oie.1_Intron	NM_003462	NP_003453			dynein, axonemal, light intermediate chain 1						cellular component movement|single fertilization	axonemal dynein complex	microtubule motor activity			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	40583429	40583429	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40583429delA								PPT1 (20287 upstream) : RLF (43612 downstream)																																			---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	42181404	42181404	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42181404delA	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron	NM_024503	NP_078779			human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
CCDC30	728621	broad.mit.edu	37	1	43101479	43101479	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43101479delA	uc009vwk.1	+						CCDC30_uc001chm.2_Intron|CCDC30_uc001chn.2_Intron	NM_001080850	NP_001074319			coiled-coil domain containing 30												0																		---	---	---	---
ERI3	79033	broad.mit.edu	37	1	44739759	44739760	+	Intron	INS	-	AG	AG			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44739759_44739760insAG	uc001clt.2	-						ERI3_uc010okv.1_Intron|ERI3_uc009vxg.2_Intron|ERI3_uc010okw.1_Intron|ERI3_uc001clu.2_Intron	NM_024066	NP_076971			prion protein interacting protein							intracellular	exonuclease activity|metal ion binding|nucleic acid binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
C1orf228	339541	broad.mit.edu	37	1	45181818	45181818	+	Intron	DEL	T	-	-	rs67697786		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45181818delT	uc001cmf.2	+							NM_001145636	NP_001139108			hypothetical protein LOC339541								binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	45237272	45237272	+	IGR	DEL	T	-	-	rs35671848		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45237272delT								KIF2C (3836 upstream) : RPS8 (3974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	45249064	45249065	+	IGR	INS	-	TG	TG	rs147696977	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45249064_45249065insTG								RPS8 (4653 upstream) : BEST4 (194 downstream)																																			---	---	---	---
EIF2B3	8891	broad.mit.edu	37	1	45440888	45440889	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45440888_45440889insA	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron|EIF2B3_uc001cmw.2_Intron	NM_020365	NP_065098			eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
GPBP1L1	60313	broad.mit.edu	37	1	46143014	46143015	+	Intron	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46143014_46143015delAA	uc001coq.2	-							NM_021639	NP_067652			GC-rich promoter binding protein 1-like 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	46260823	46260823	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46260823delT								IPP (44338 upstream) : MAST2 (8462 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	46937122	46937123	+	IGR	DEL	TT	-	-	rs113348840		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46937122_46937123delTT								FAAH (57602 upstream) : DMBX1 (35545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	47302835	47302836	+	IGR	INS	-	T	T	rs146705336	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47302835_47302836insT								CYP4B1 (17815 upstream) : CYP4Z2P (21070 downstream)																																			---	---	---	---
CYP4Z2P	163720	broad.mit.edu	37	1	47332641	47332641	+	Intron	DEL	A	-	-	rs34700016		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47332641delA	uc001cqo.1	-							NR_002788				Homo sapiens cDNA FLJ40054 fis, clone TBAES2000315, weakly similar to CYTOCHROME P450 4A1 (EC 1.14.15.3).												0																		---	---	---	---
CYP4X1	260293	broad.mit.edu	37	1	47437705	47437705	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47437705delA	uc001cqr.2	+							NM_178033	NP_828847			cytochrome P450, family 4, subfamily X,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)|skin(1)	2																		---	---	---	---
CYP4X1	260293	broad.mit.edu	37	1	47497729	47497729	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47497729delA	uc001cqt.2	+						CYP4X1_uc001cqr.2_Intron|CYP4X1_uc001cqs.2_Intron	NM_178033	NP_828847			cytochrome P450, family 4, subfamily X,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)|skin(1)	2																		---	---	---	---
AGBL4	84871	broad.mit.edu	37	1	49194780	49194780	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49194780delT	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron|BEND5_uc001crx.3_Intron|BEND5_uc001crw.3_Intron	NM_032785	NP_116174			ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---
ELAVL4	1996	broad.mit.edu	37	1	50615617	50615618	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50615617_50615618insT	uc001csb.2	+						ELAVL4_uc001cry.3_Intron|ELAVL4_uc001crz.3_Intron|ELAVL4_uc001csa.3_Intron|ELAVL4_uc001csc.3_Intron|ELAVL4_uc009vyu.2_Intron|ELAVL4_uc010omz.1_Intron	NM_021952	NP_068771			ELAV-like 4 isoform 1						mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2																		---	---	---	---
ELAVL4	1996	broad.mit.edu	37	1	50624040	50624040	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50624040delC	uc001csb.2	+						ELAVL4_uc001cry.3_Intron|ELAVL4_uc001crz.3_Intron|ELAVL4_uc001csa.3_Intron|ELAVL4_uc001csc.3_Intron|ELAVL4_uc009vyu.2_Intron|ELAVL4_uc010omz.1_Intron	NM_021952	NP_068771			ELAV-like 4 isoform 1						mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2																		---	---	---	---
OSBPL9	114883	broad.mit.edu	37	1	52093731	52093731	+	Intron	DEL	T	-	-	rs34103866		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52093731delT	uc001cst.2	+						OSBPL9_uc001css.2_Intron|OSBPL9_uc001csx.2_Intron|OSBPL9_uc009vza.2_Intron|OSBPL9_uc001csu.2_Intron|OSBPL9_uc001csv.2_Intron|OSBPL9_uc001csw.2_Intron	NM_024586	NP_078862			oxysterol binding protein-like 9 isoform e						lipid transport		lipid binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	53077733	53077734	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53077733_53077734delCA								GPX7 (3011 upstream) : FAM159A (21332 downstream)																																			---	---	---	---
GLIS1	148979	broad.mit.edu	37	1	53973659	53973659	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53973659delA	uc001cvr.1	-							NM_147193	NP_671726			GLIS family zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	54453387	54453387	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54453387delC								LRRC42 (19548 upstream) : LDLRAD1 (21119 downstream)																																			---	---	---	---
SSBP3	23648	broad.mit.edu	37	1	54841865	54841866	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54841865_54841866delGT	uc001cxe.2	-						SSBP3_uc001cxf.2_Intron|SSBP3_uc001cxg.2_Intron	NM_145716	NP_663768			single stranded DNA binding protein 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	single-stranded DNA binding				0																		---	---	---	---
ACOT11	26027	broad.mit.edu	37	1	55026400	55026400	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55026400delT	uc001cxm.1	+						ACOT11_uc001cxj.1_Intron|ACOT11_uc001cxk.2_Intron|ACOT11_uc001cxl.1_Intron	NM_015547	NP_056362			thioesterase, adipose associated isoform BFIT1						fatty acid metabolic process|intracellular signal transduction|response to cold		acyl-CoA thioesterase activity|carboxylesterase activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	56007749	56007749	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56007749delA								USP24 (326987 upstream) : PPAP2B (952684 downstream)																																			---	---	---	---
PRKAA2	5563	broad.mit.edu	37	1	57124410	57124410	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57124410delT	uc001cyk.3	+							NM_006252	NP_006243			AMP-activated protein kinase alpha 2 catalytic						carnitine shuttle|cell cycle arrest|cholesterol biosynthetic process|energy reserve metabolic process|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleoplasm	ATP binding|metal ion binding			breast(4)|ovary(1)|stomach(1)	6																		---	---	---	---
PRKAA2	5563	broad.mit.edu	37	1	57130528	57130529	+	Intron	INS	-	ACAC	ACAC	rs141862954	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57130528_57130529insACAC	uc001cyk.3	+							NM_006252	NP_006243			AMP-activated protein kinase alpha 2 catalytic						carnitine shuttle|cell cycle arrest|cholesterol biosynthetic process|energy reserve metabolic process|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleoplasm	ATP binding|metal ion binding			breast(4)|ovary(1)|stomach(1)	6																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	57546429	57546430	+	Intron	INS	-	CA	CA	rs147457812	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57546429_57546430insCA	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58977309	58977310	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58977309_58977310delAC	uc001cyt.1	-						OMA1_uc001cyx.1_Intron|OMA1_uc001cyy.2_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	60970017	60970017	+	IGR	DEL	A	-	-	rs66476427		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60970017delA								C1orf87 (430591 upstream) : NFIA (572929 downstream)																																			---	---	---	---
L1TD1	54596	broad.mit.edu	37	1	62664453	62664455	+	Intron	DEL	CCT	-	-	rs67205488		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62664453_62664455delCCT	uc001dae.3	+							NM_019079	NP_061952			LINE-1 type transposase domain containing 1											ovary(1)|skin(1)	2																		---	---	---	---
ROR1	4919	broad.mit.edu	37	1	64393627	64393628	+	Intron	INS	-	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64393627_64393628insC	uc001dbj.2	+						ROR1_uc001dbi.3_Intron	NM_005012	NP_005003			receptor tyrosine kinase-like orphan receptor 1						transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|central_nervous_system(1)|skin(1)|kidney(1)	19																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	65452201	65452201	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65452201delC	uc001dbw.2	-											Homo sapiens cDNA FLJ44251 fis, clone TKIDN2004458.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	67900431	67900431	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67900431delC								SERBP1 (4308 upstream) : GADD45A (250452 downstream)																																			---	---	---	---
GNG12	55970	broad.mit.edu	37	1	68301845	68301845	+	5'Flank	DEL	T	-	-	rs11342572		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68301845delT	uc001dea.1	-						uc001deb.1_Intron|uc001dec.1_Intron	NM_018841	NP_061329			G-protein gamma-12 subunit precursor						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0																		---	---	---	---
DEPDC1	55635	broad.mit.edu	37	1	68956069	68956070	+	Intron	INS	-	TTAG	TTAG	rs148743576	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68956069_68956070insTTAG	uc001dem.3	-						DEPDC1_uc001dek.3_Intron|DEPDC1_uc001del.3_Intron	NM_001114120	NP_001107592			DEP domain containing 1 isoform a						intracellular signal transduction|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	GTPase activator activity|protein binding				0				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	71099166	71099166	+	IGR	DEL	A	-	-	rs66834327		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71099166delA								CTH (193914 upstream) : PTGER3 (218870 downstream)																																			---	---	---	---
NEGR1	257194	broad.mit.edu	37	1	72204901	72204902	+	Intron	INS	-	A	A	rs72105868		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72204901_72204902insA	uc001dfw.2	-						NEGR1_uc001dfv.2_Intron|NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169			neuronal growth regulator 1 precursor						cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)														---	---	---	---
NEGR1	257194	broad.mit.edu	37	1	72557582	72557583	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72557582_72557583delGT	uc001dfw.2	-						NEGR1_uc001dfv.2_Intron|NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169			neuronal growth regulator 1 precursor						cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)														---	---	---	---
TNNI3K	51086	broad.mit.edu	37	1	74712263	74712264	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74712263_74712264insA	uc001dgf.1	+						TNNI3K_uc001dgc.1_Intron|TNNI3K_uc001dgd.2_Intron|TNNI3K_uc001dge.1_Intron	NM_015978	NP_057062			TNNI3 interacting kinase isoform b							cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10																		---	---	---	---
SLC44A5	204962	broad.mit.edu	37	1	75880010	75880011	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75880010_75880011delAC	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910			solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4																		---	---	---	---
SLC44A5	204962	broad.mit.edu	37	1	76084764	76084765	+	Intron	INS	-	G	G	rs141643516	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76084764_76084765insG	uc010oqz.1	-						SLC44A5_uc010orb.1_Intron	NM_001130058	NP_001123530			solute carrier family 44, member 5 isoform B							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	76154998	76155001	+	Intron	DEL	TCCA	-	-	rs148782751		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76154998_76155001delTCCA	uc001dgv.2	-											Homo sapiens mRNA; cDNA DKFZp686J0423 (from clone DKFZp686J0423).																														---	---	---	---
ST6GALNAC3	256435	broad.mit.edu	37	1	76541396	76541397	+	Intron	INS	-	T	T	rs147299055		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76541396_76541397insT	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541			sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5																		---	---	---	---
ZZZ3	26009	broad.mit.edu	37	1	78073363	78073363	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78073363delC	uc001dhq.2	-						ZZZ3_uc001dhr.2_Intron|ZZZ3_uc009wbz.1_Intron|ZZZ3_uc001dhp.2_Intron	NM_015534	NP_056349			zinc finger, ZZ-type containing 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|large_intestine(1)	5																		---	---	---	---
ZZZ3	26009	broad.mit.edu	37	1	78075821	78075822	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78075821_78075822insA	uc001dhq.2	-						ZZZ3_uc001dhr.2_Intron|ZZZ3_uc009wbz.1_Intron|ZZZ3_uc001dhp.2_Intron	NM_015534	NP_056349			zinc finger, ZZ-type containing 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|large_intestine(1)	5																		---	---	---	---
ELTD1	64123	broad.mit.edu	37	1	79402858	79402858	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79402858delG	uc001diq.3	-							NM_022159	NP_071442			EGF, latrophilin and seven transmembrane domain						neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	81719678	81719678	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81719678delA								None (None upstream) : LPHN2 (52167 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	81721415	81721415	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81721415delC								None (None upstream) : LPHN2 (50430 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	82617549	82617549	+	IGR	DEL	A	-	-	rs11345820		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82617549delA								LPHN2 (159443 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	84208710	84208711	+	Intron	INS	-	A	A	rs144831738	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84208710_84208711insA	uc001diz.3	-											Homo sapiens cDNA clone IMAGE:4815396.																														---	---	---	---
ODF2L	57489	broad.mit.edu	37	1	86859068	86859068	+	Intron	DEL	A	-	-	rs66515976		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86859068delA	uc001dll.1	-						ODF2L_uc001dlm.1_Intron|ODF2L_uc001dln.2_Intron|ODF2L_uc001dlo.2_Intron|ODF2L_uc001dlp.2_Intron|ODF2L_uc010osg.1_Intron|ODF2L_uc001dlq.1_Intron|ODF2L_uc009wcr.1_Intron	NM_020729	NP_065780			outer dense fiber of sperm tails 2-like isoform							centrosome				ovary(1)	1				all cancers(265;0.0313)|Epithelial(280;0.0611)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	87304015	87304015	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87304015delG								SH3GLB1 (90149 upstream) : SEP15 (24115 downstream)																																			---	---	---	---
LRRC8B	23507	broad.mit.edu	37	1	90008070	90008073	+	Intron	DEL	TGAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90008070_90008073delTGAA	uc001dni.2	+						LRRC8B_uc001dnh.2_Intron	NM_001134476	NP_001127948			leucine rich repeat containing 8 family, member							integral to membrane				ovary(2)	2		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	90760953	90760956	+	IGR	DEL	AAGA	-	-	rs75990234		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90760953_90760956delAAGA								ZNF326 (266859 upstream) : BARHL2 (416624 downstream)																																			---	---	---	---
BTBD8	284697	broad.mit.edu	37	1	92582428	92582428	+	Intron	DEL	A	-	-	rs10875205	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92582428delA	uc001doo.2	+						BTBD8_uc010otc.1_Intron	NM_183242	NP_899065			BTB (POZ) domain containing 8							nucleus				ovary(1)	1		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	94349977	94349977	+	IGR	DEL	T	-	-	rs113472371		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94349977delT								DNTTIP2 (5235 upstream) : GCLM (2613 downstream)																																			---	---	---	---
ABCA4	24	broad.mit.edu	37	1	94501937	94501937	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94501937delT	uc001dqh.2	-							NM_000350	NP_000341			ATP-binding cassette, sub-family A member 4						phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	95242993	95242994	+	Intron	INS	-	GATGGATG	GATGGATG	rs78025101		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95242993_95242994insGATGGATG	uc001dqu.2	-											Homo sapiens cDNA clone IMAGE:4795773.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	95402045	95402046	+	IGR	DEL	TG	-	-	rs140002241	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95402045_95402046delTG								CNN3 (9310 upstream) : ALG14 (46233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	96255781	96255782	+	IGR	DEL	GT	-	-	rs5776281		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:96255781_96255782delGT								RWDD3 (543008 upstream) : PTBP2 (931393 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	96914044	96914045	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:96914044_96914045insT								None (None upstream) : PTBP2 (273130 downstream)																																			---	---	---	---
AGL	178	broad.mit.edu	37	1	100370929	100370934	+	Intron	DEL	TTGTTG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100370929_100370934delTTGTTG	uc001dsi.1	+						AGL_uc001dsj.1_Intron|AGL_uc001dsk.1_Intron|AGL_uc001dsl.1_Intron|AGL_uc001dsm.1_Intron|AGL_uc001dsn.1_Intron	NM_000642	NP_000633			amylo-1,6-glucosidase,						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)														---	---	---	---
SASS6	163786	broad.mit.edu	37	1	100559471	100559471	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100559471delA	uc001dsu.2	-						SASS6_uc009wdz.2_Intron	NM_194292	NP_919268			spindle assembly abnormal protein 6						centriole replication	centriole				upper_aerodigestive_tract(1)|ovary(1)	2		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	102183894	102183894	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102183894delA								S1PR1 (476818 upstream) : OLFM3 (84233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	102673047	102673047	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102673047delT								OLFM3 (210257 upstream) : COL11A1 (668977 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	102694480	102694480	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102694480delA								OLFM3 (231690 upstream) : COL11A1 (647544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	103289513	103289513	+	IGR	DEL	A	-	-	rs67515326		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103289513delA								OLFM3 (826723 upstream) : COL11A1 (52511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	104752259	104752265	+	IGR	DEL	TCTCAGC	-	-	rs67205957		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104752259_104752265delTCTCAGC								AMY1A (545087 upstream) : None (None downstream)																																			---	---	---	---
NTNG1	22854	broad.mit.edu	37	1	107752820	107752820	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107752820delG	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvd.1_Intron	NM_001113226	NP_001106697			netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)														---	---	---	---
NTNG1	22854	broad.mit.edu	37	1	107962246	107962246	+	Intron	DEL	A	-	-	rs141756980		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107962246delA	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvi.2_Intron|NTNG1_uc001dve.2_Intron|NTNG1_uc009wek.2_Intron|NTNG1_uc001dvg.2_Intron|NTNG1_uc009wem.2_Intron	NM_001113226	NP_001106697			netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)														---	---	---	---
NTNG1	22854	broad.mit.edu	37	1	108020424	108020424	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108020424delT	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvi.2_Intron|NTNG1_uc001dve.2_Intron|NTNG1_uc009wek.2_Intron|NTNG1_uc001dvg.2_Intron|NTNG1_uc009wem.2_Intron	NM_001113226	NP_001106697			netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)														---	---	---	---
SARS	6301	broad.mit.edu	37	1	109768979	109768979	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109768979delT	uc001dwu.1	+						SARS_uc001dwt.1_Intron|SARS_uc001dwv.1_Intron|SARS_uc001dww.1_Intron|SARS_uc001dwx.1_Intron|SARS_uc009wfa.1_Intron|SARS_uc001dwy.1_Intron	NM_006513	NP_006504			seryl-tRNA synthetase						seryl-tRNA aminoacylation|tRNA processing	cytosol	ATP binding|protein binding|RNA binding|serine-tRNA ligase activity			central_nervous_system(1)	1		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)													---	---	---	---
ADORA3	140	broad.mit.edu	37	1	112079430	112079433	+	Intron	DEL	CCTT	-	-	rs113762370		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112079430_112079433delCCTT	uc001ebg.3	-							NM_001081976	NP_001075445			adenosine A3 receptor isoform 3						activation of adenylate cyclase activity|inflammatory response|regulation of heart contraction	integral to plasma membrane	adenosine receptor activity, G-protein coupled			ovary(2)|large_intestine(1)|skin(1)	4		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)													---	---	---	---
KCND3	3752	broad.mit.edu	37	1	112459974	112459974	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112459974delG	uc001ebu.1	-						KCND3_uc001ebv.1_Intron	NM_004980	NP_004971			potassium voltage-gated channel, Shal-related							sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	112616750	112616751	+	IGR	DEL	CA	-	-	rs71909959		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112616750_112616751delCA								KCND3 (84973 upstream) : CTTNBP2NL (322049 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	112722727	112722728	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112722727_112722728delTC								KCND3 (190950 upstream) : CTTNBP2NL (216072 downstream)																																			---	---	---	---
MAGI3	260425	broad.mit.edu	37	1	114198450	114198450	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114198450delG	uc001edk.2	+						MAGI3_uc001edh.3_Intron|MAGI3_uc001edi.3_Intron|MAGI3_uc010owm.1_Intron|MAGI3_uc001edj.2_Intron	NM_001142782	NP_001136254			membrane-associated guanylate kinase-related  3						apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
SYCP1	6847	broad.mit.edu	37	1	115417796	115417797	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115417796_115417797delTG	uc001efr.2	+						SYCP1_uc010owt.1_Intron|SYCP1_uc001efq.2_Intron|SYCP1_uc009wgw.2_Intron	NM_003176	NP_003167			synaptonemal complex protein 1						cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
VANGL1	81839	broad.mit.edu	37	1	116201564	116201565	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116201564_116201565delAC	uc001efv.1	+						VANGL1_uc009wgy.1_Intron|VANGL1_uc001efw.1_Intron	NM_138959	NP_620409			vang-like 1						multicellular organismal development	integral to membrane	protein binding			central_nervous_system(1)	1	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)														---	---	---	---
GDAP2	54834	broad.mit.edu	37	1	118456024	118456024	+	Intron	DEL	T	-	-	rs76189921		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118456024delT	uc001ehf.2	-						GDAP2_uc001ehg.2_Intron	NM_017686	NP_060156			ganglioside induced differentiation associated											ovary(2)	2		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142647305	142647306	+	Intron	INS	-	T	T	rs145988756	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142647305_142647306insT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142648461	142648462	+	Intron	INS	-	T	T	rs149586890		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142648461_142648462insT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142669499	142669499	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142669499delA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143261370	143261371	+	IGR	INS	-	A	A	rs145912009		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143261370_143261371insA								None (None upstream) : LOC100286793 (386268 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	144023685	144023685	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144023685delT	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																														---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144527399	144527400	+	Intron	INS	-	T	T	rs150558386		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144527399_144527400insT	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144527481	144527481	+	Intron	DEL	A	-	-	rs58060514		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144527481delA	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144681814	144681814	+	Intron	DEL	G	-	-	rs67467472		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144681814delG	uc009wig.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF9_uc009wii.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144947488	144947489	+	Intron	INS	-	TACTA	TACTA	rs145174750	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144947488_144947489insTACTA	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144977434	144977434	+	Intron	DEL	T	-	-	rs2477085		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144977434delT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emg.1_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	145024581	145024590	+	Intron	DEL	ACACACACAT	-	-	rs72171398		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145024581_145024590delACACACACAT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145189018	145189019	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145189018_145189019insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145267664	145267664	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145267664delT	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145620149	145620149	+	Intron	DEL	G	-	-	rs11318010		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145620149delG	uc001emp.3	+						RNF115_uc001eoj.2_Intron|RNF115_uc001eok.2_Intron|RNF115_uc009wiy.2_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	146963295	146963296	+	Intron	INS	-	CTTTTTGTCTTT	CTTTTTGTCTTT	rs149959791	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146963295_146963296insCTTTTTGTCTTT	uc001epp.2	-											Homo sapiens cDNA clone IMAGE:5266739.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	147348903	147348904	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147348903_147348904insA								GJA5 (103419 upstream) : GJA8 (26032 downstream)																																			---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	147746458	147746458	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147746458delA	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	148846622	148846623	+	IGR	INS	-	TA	TA			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148846622_148846623insTA								NBPF16 (88311 upstream) : LOC645166 (81663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	150510424	150510425	+	IGR	INS	-	GG	GG	rs149764873	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150510424_150510425insGG								ECM1 (24160 upstream) : ADAMTSL4 (11473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	150893691	150893692	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150893691_150893692insA								ARNT (44505 upstream) : SETDB1 (5123 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	152719539	152719542	+	IGR	DEL	TCAA	-	-	rs138278451		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152719539_152719542delTCAA								C1orf68 (26635 upstream) : KPRP (10964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	153186501	153186501	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153186501delC								LELP1 (8907 upstream) : LOR (45678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	153470379	153470380	+	IGR	INS	-	TT	TT	rs73020485	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153470379_153470380insTT								S100A7 (37242 upstream) : S100A6 (36696 downstream)																																			---	---	---	---
INTS3	65123	broad.mit.edu	37	1	153708927	153708928	+	Intron	INS	-	T	T	rs71947114		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153708927_153708928insT	uc009wom.2	+						INTS3_uc001fct.2_Intron|INTS3_uc001fcu.2_Intron|INTS3_uc001fcv.2_Intron	NM_023015	NP_075391			integrator complex subunit 3						DNA repair|G2/M transition checkpoint|response to ionizing radiation|snRNA processing	integrator complex|SOSS complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)															---	---	---	---
UBAP2L	9898	broad.mit.edu	37	1	154227120	154227122	+	Intron	DEL	TTG	-	-	rs10562046		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154227120_154227122delTTG	uc001fep.3	+						UBAP2L_uc009wot.2_Intron|UBAP2L_uc010pek.1_Intron|UBAP2L_uc010pel.1_Intron|UBAP2L_uc010pen.1_Intron|UBAP2L_uc001feq.2_5'Flank|UBAP2L_uc001fer.2_5'Flank	NM_014847	NP_055662			ubiquitin associated protein 2-like isoform a						binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)															---	---	---	---
TDRD10	126668	broad.mit.edu	37	1	154484287	154484287	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154484287delG	uc009wow.2	+						TDRD10_uc001ffd.2_Intron	NM_001098475	NP_001091945			tudor domain containing 10 isoform a								nucleotide binding|RNA binding			ovary(1)	1	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)															---	---	---	---
ADAR	103	broad.mit.edu	37	1	154566366	154566367	+	Intron	INS	-	T	T	rs5777921		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154566366_154566367insT	uc001ffh.2	-						ADAR_uc001ffj.2_Intron|ADAR_uc001ffi.2_Intron|ADAR_uc001ffk.2_Intron	NM_001111	NP_001102			adenosine deaminase, RNA-specific isoform a						adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	156630180	156630181	+	IGR	INS	-	TG	TG	rs147948000	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156630180_156630181insTG								BCAN (862 upstream) : NES (8376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	157159255	157159255	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157159255delT								ETV3 (50872 upstream) : FCRL5 (323913 downstream)																																			---	---	---	---
KIRREL	55243	broad.mit.edu	37	1	157961087	157961088	+	5'Flank	INS	-	AA	AA	rs139468568		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157961087_157961088insAA	uc001frn.3	+						KIRREL_uc010pib.1_5'Flank	NM_018240	NP_060710			kin of IRRE like precursor							integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)																	---	---	---	---
KIRREL	55243	broad.mit.edu	37	1	157967258	157967259	+	Intron	INS	-	GT	GT	rs147774169	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157967258_157967259insGT	uc001frn.3	+						KIRREL_uc010pib.1_Intron	NM_018240	NP_060710			kin of IRRE like precursor							integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)																	---	---	---	---
KIRREL	55243	broad.mit.edu	37	1	158004778	158004779	+	Intron	INS	-	TG	TG	rs143516038	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158004778_158004779insTG	uc001frn.3	+						KIRREL_uc010pib.1_Intron	NM_018240	NP_060710			kin of IRRE like precursor							integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	159181183	159181183	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159181183delT								DARC (4895 upstream) : FCER1A (78323 downstream)																																	OREG0013915	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	1	159363604	159363605	+	Intron	INS	-	A	A	rs140311504	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159363604_159363605insA	uc001fts.3	-											Homo sapiens, clone IMAGE:3917623, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	159838142	159838143	+	IGR	DEL	CT	-	-	rs140007018		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159838142_159838143delCT								VSIG8 (5695 upstream) : CCDC19 (4013 downstream)																																			---	---	---	---
NOS1AP	9722	broad.mit.edu	37	1	162304826	162304829	+	Intron	DEL	AAGA	-	-	rs146472069		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162304826_162304829delAAGA	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512			nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	162341286	162341287	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162341286_162341287insA								NOS1AP (1473 upstream) : C1orf111 (2228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	163860486	163860486	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163860486delT								NUF2 (534933 upstream) : PBX1 (668316 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	164476025	164476025	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164476025delG								None (None upstream) : PBX1 (52777 downstream)																																			---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164710976	164710977	+	Intron	INS	-	GT	GT	rs147987402	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164710976_164710977insGT	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164839447	164839450	+	Intron	DEL	TTTC	-	-	rs60190105		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164839447_164839450delTTTC	uc010pkw.1	+							NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
Unknown	0	broad.mit.edu	37	1	165418102	165418102	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165418102delC								RXRG (3672 upstream) : LOC400794 (27977 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	166221481	166221481	+	IGR	DEL	A	-	-	rs56213645		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166221481delA								FAM78B (85275 upstream) : FMO9P (351672 downstream)																																			---	---	---	---
POU2F1	5451	broad.mit.edu	37	1	167377325	167377325	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167377325delC	uc001gec.2	+						POU2F1_uc001ged.2_Intron|POU2F1_uc001gee.2_Intron|POU2F1_uc010plh.1_Intron|POU2F1_uc001gef.2_Intron|POU2F1_uc001geg.2_Intron|POU2F1_uc009wvg.1_Intron	NM_002697	NP_002688			POU class 2 homeobox 1						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5																		---	---	---	---
DPT	1805	broad.mit.edu	37	1	168673833	168673834	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168673833_168673834delGT	uc001gfp.2	-							NM_001937	NP_001928			dermatopontin precursor						cell adhesion	extracellular space|proteinaceous extracellular matrix				ovary(1)	1	all_hematologic(923;0.208)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	169001321	169001323	+	IGR	DEL	CTC	-	-	rs72407435		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169001321_169001323delCTC								MGC4473 (239201 upstream) : ATP1B1 (74624 downstream)																																			---	---	---	---
NME7	29922	broad.mit.edu	37	1	169147078	169147081	+	Intron	DEL	TTTT	-	-	rs67251504		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169147078_169147081delTTTT	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron	NM_013330	NP_037462			nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	171382130	171382130	+	IGR	DEL	A	-	-	rs11311104		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171382130delA								FMO4 (70908 upstream) : BAT2L2 (72536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	172496703	172496706	+	IGR	DEL	AAAC	-	-	rs36166947		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172496703_172496706delAAAC								C1orf105 (58738 upstream) : C1orf9 (5554 downstream)																																			---	---	---	---
ZBTB37	84614	broad.mit.edu	37	1	173842145	173842145	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173842145delA	uc009wwp.1	+						ZBTB37_uc001gjp.1_Intron|ZBTB37_uc001gjq.3_Intron|ZBTB37_uc001gjr.2_Intron	NM_001122770	NP_001116242			zinc finger and BTB domain containing 37 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	174999185	174999186	+	IGR	DEL	CA	-	-	rs67605915		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174999185_174999186delCA								MRPS14 (6624 upstream) : TNN (37808 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	175015631	175015631	+	IGR	DEL	T	-	-	rs34927526		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175015631delT								MRPS14 (23070 upstream) : TNN (21363 downstream)																																			---	---	---	---
PAPPA2	60676	broad.mit.edu	37	1	176798426	176798426	+	Intron	DEL	A	-	-	rs113825507		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176798426delA	uc001gkz.2	+						PAPPA2_uc009www.2_Intron	NM_020318	NP_064714			pappalysin 2 isoform 1						cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16																		---	---	---	---
FAM5B	57795	broad.mit.edu	37	1	177150425	177150426	+	Intron	INS	-	T	T	rs139394382	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177150425_177150426insT	uc001glf.2	+							NM_021165	NP_066988			family with sequence similarity 5, member B							extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6																OREG0014005	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	1	179047996	179047996	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179047996delT								FAM20B (2295 upstream) : TOR3A (3116 downstream)																																			---	---	---	---
ABL2	27	broad.mit.edu	37	1	179079063	179079063	+	Intron	DEL	A	-	-	rs35640199		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179079063delA	uc001gmj.3	-						ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Intron|ABL2_uc001gmg.3_Intron|ABL2_uc001gmi.3_Intron|ABL2_uc001gmh.3_Intron|ABL2_uc010pne.1_Intron	NM_007314	NP_009298			arg tyrosine kinase isoform b						axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)			T	ETV6	AML								---	---	---	---
ABL2	27	broad.mit.edu	37	1	179187544	179187545	+	Intron	INS	-	T	T	rs147150015	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179187544_179187545insT	uc001gmj.3	-						ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Intron|ABL2_uc009wxe.2_Intron	NM_007314	NP_009298			arg tyrosine kinase isoform b						axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)			T	ETV6	AML								---	---	---	---
FAM163A	148753	broad.mit.edu	37	1	179706969	179706970	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179706969_179706970insA	uc009wxj.2	+							NM_173509	NP_775780			hypothetical protein LOC148753							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	180547833	180547833	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180547833delT								ACBD6 (75811 upstream) : XPR1 (53313 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	181328202	181328202	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181328202delT								IER5 (268225 upstream) : CACNA1E (124514 downstream)																																			---	---	---	---
CACNA1E	777	broad.mit.edu	37	1	181562020	181562020	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181562020delT	uc001gow.2	+						CACNA1E_uc009wxr.2_Intron|CACNA1E_uc009wxs.2_Intron	NM_000721	NP_000712			calcium channel, voltage-dependent, R type,						energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6																		---	---	---	---
C1orf14	81626	broad.mit.edu	37	1	182909982	182909983	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182909982_182909983delAC	uc001gpu.2	-						C1orf14_uc001gpv.2_Intron|C1orf14_uc010pnz.1_Intron|C1orf14_uc001gpw.2_Intron	NM_030933	NP_112195			chromosome 1 open reading frame 14												0				Colorectal(1306;1.64e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00267)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	182966836	182966837	+	IGR	INS	-	TGTT	TGTT	rs149819911	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182966836_182966837insTGTT								C1orf14 (44283 upstream) : LAMC1 (25758 downstream)																																			---	---	---	---
LAMC1	3915	broad.mit.edu	37	1	183054672	183054673	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183054672_183054673insT	uc001gpy.3	+						LAMC1_uc001gpx.2_Intron	NM_002293	NP_002284			laminin, gamma 1 precursor						axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	183119277	183119278	+	IGR	INS	-	CTG	CTG	rs71747330		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183119277_183119278insCTG								LAMC1 (4551 upstream) : LAMC2 (35896 downstream)																																			---	---	---	---
RGL1	23179	broad.mit.edu	37	1	183668588	183668588	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183668588delA	uc001gqm.2	+						RGL1_uc010pof.1_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron	NM_015149	NP_055964			ral guanine nucleotide dissociation						cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11																		---	---	---	---
RGL1	23179	broad.mit.edu	37	1	183719760	183719762	+	Intron	DEL	GGA	-	-	rs35330387		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183719760_183719762delGGA	uc001gqm.2	+						RGL1_uc010pof.1_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron	NM_015149	NP_055964			ral guanine nucleotide dissociation						cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	184081582	184081602	+	IGR	DEL	GGAAGGAAGGAAGGAAGGAGG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184081582_184081602delGGAAGGAAGGAAGGAAGGAGG								TSEN15 (38241 upstream) : C1orf21 (274548 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	184734726	184734726	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184734726delT								EDEM3 (10685 upstream) : FAM129A (25441 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	185683973	185683974	+	IGR	INS	-	CTAG	CTAG	rs138256511	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185683973_185683974insCTAG								IVNS1ABP (397512 upstream) : HMCN1 (19709 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	186197014	186197015	+	IGR	INS	-	A	A	rs146113283	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186197014_186197015insA								HMCN1 (36929 upstream) : PRG4 (68390 downstream)																																			---	---	---	---
TPR	7175	broad.mit.edu	37	1	186311465	186311466	+	Intron	INS	-	A	A	rs145277218	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186311465_186311466insA	uc001grv.2	-							NM_003292	NP_003283			nuclear pore complex-associated protein TPR						carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)				T	NTRK1	papillary thyroid								---	---	---	---
Unknown	0	broad.mit.edu	37	1	187548286	187548289	+	IGR	DEL	CACA	-	-	rs34046290		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187548286_187548289delCACA								PLA2G4A (590181 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	188075102	188075103	+	IGR	DEL	CA	-	-	rs138545654		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188075102_188075103delCA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	190004646	190004646	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190004646delT								None (None upstream) : FAM5C (62151 downstream)																																			---	---	---	---
FAM5C	339479	broad.mit.edu	37	1	190119397	190119398	+	Intron	DEL	TG	-	-	rs35000369		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190119397_190119398delTG	uc001gse.1	-						FAM5C_uc010pot.1_Intron	NM_199051	NP_950252			family with sequence similarity 5, member C							extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	190610892	190610893	+	IGR	INS	-	AC	AC	rs142199536	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190610892_190610893insAC								FAM5C (164133 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191060873	191060876	+	IGR	DEL	TTTG	-	-	rs112892637		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191060873_191060876delTTTG								FAM5C (614114 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191192571	191192572	+	IGR	INS	-	TA	TA	rs72513771		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191192571_191192572insTA								FAM5C (745812 upstream) : RGS18 (935020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	192113933	192113933	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192113933delT								None (None upstream) : RGS18 (13659 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	192795375	192795375	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192795375delC								RGS2 (13969 upstream) : UCHL5 (189525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	192849060	192849060	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192849060delA								RGS2 (67654 upstream) : UCHL5 (135840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	193517554	193517554	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193517554delA								CDC73 (293614 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	194722171	194722172	+	IGR	INS	-	CCTT	CCTT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194722171_194722172insCCTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	195253590	195253590	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195253590delT								None (None upstream) : KCNT2 (941323 downstream)																																			---	---	---	---
CRB1	23418	broad.mit.edu	37	1	197235807	197235807	+	5'Flank	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197235807delA	uc001gtz.2	+						CRB1_uc010poz.1_Intron|CRB1_uc001gty.1_5'Flank|CRB1_uc010ppa.1_5'Flank|CRB1_uc009wza.2_5'Flank|CRB1_uc010ppb.1_5'Flank	NM_201253	NP_957705			crumbs homolog 1 precursor						cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	198856365	198856366	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198856365_198856366delCA								MIR181A1 (28083 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	199354087	199354087	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199354087delA								MIR181A1 (525805 upstream) : NR5A2 (642683 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200276966	200276967	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200276966_200276967insA								FAM58B (93323 upstream) : ZNF281 (98459 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200408027	200408030	+	Intron	DEL	GAAA	-	-	rs149614168		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200408027_200408030delGAAA	uc010ppi.1	+											Homo sapiens clone HA_003012 unknown mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	200489293	200489294	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200489293_200489294insT								ZNF281 (110127 upstream) : KIF14 (31331 downstream)																																			---	---	---	---
DDX59	83479	broad.mit.edu	37	1	200630162	200630162	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200630162delA	uc009wzk.2	-						DDX59_uc010ppl.1_Intron	NM_001031725	NP_001026895			DEAD (Asp-Glu-Ala-Asp) box polypeptide 59							intracellular	ATP binding|ATP-dependent helicase activity|metal ion binding|RNA binding			ovary(2)|breast(1)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	201308586	201308586	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201308586delA								PKP1 (6471 upstream) : TNNT2 (19557 downstream)																																			---	---	---	---
RPS10P7	376693	broad.mit.edu	37	1	201491017	201491017	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201491017delT	uc009wzz.1	+											Homo sapiens cDNA FLJ31028 fis, clone HLUNG2000570, weakly similar to 40S RIBOSOMAL PROTEIN S10.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	203337673	203337674	+	IGR	INS	-	G	G	rs139404702	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203337673_203337674insG								FMOD (17384 upstream) : PRELP (107209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	203498366	203498367	+	IGR	INS	-	C	C	rs111413712		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203498366_203498367insC								OPTC (20289 upstream) : ATP2B4 (97561 downstream)																																			---	---	---	---
MDM4	4194	broad.mit.edu	37	1	204556990	204556991	+	Intron	INS	-	CTT	CTT	rs143394801	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204556990_204556991insCTT	uc001hbd.1	+						MDM4_uc001hbc.2_Intron	NM_002393				mouse double minute 4 homolog						apoptosis|cell proliferation|cellular response to hypoxia|G0 to G1 transition|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of protein catabolic process|negative regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization	nucleus	enzyme binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)					A		GBM|bladder|retinoblastoma								---	---	---	---
TMCC2	9911	broad.mit.edu	37	1	205200890	205200891	+	Intron	INS	-	C	C	rs146607414	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205200890_205200891insC	uc001hbz.1	+						TMCC2_uc010prf.1_Intron	NM_014858	NP_055673			transmembrane and coiled-coil domain family 2							integral to membrane	protein binding			pancreas(1)	1	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	205446890	205446890	+	IGR	DEL	G	-	-	rs116666917	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205446890delG								MIR135B (29364 upstream) : CDK18 (26837 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	206496910	206496927	+	IGR	DEL	CAGCATCAGCATCAGCAT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206496910_206496927delCAGCATCAGCATCAGCAT								CTSE (164807 upstream) : SRGAP2 (19273 downstream)																																			---	---	---	---
SRGAP2	23380	broad.mit.edu	37	1	206611673	206611673	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206611673delT	uc001hdy.2	+						SRGAP2_uc010prt.1_Intron|SRGAP2_uc001hdx.2_Intron|SRGAP2_uc010pru.1_Intron|SRGAP2_uc010prv.1_Intron	NM_015326	NP_056141			SLIT-ROBO Rho GTPase activating protein 2						axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding				0	Breast(84;0.137)																	---	---	---	---
DYRK3	8444	broad.mit.edu	37	1	206847193	206847193	+	Intron	DEL	A	-	-	rs71570024		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206847193delA	uc001hek.2	+											Homo sapiens regulatory erythroid kinase long form (RED) mRNA, alternatively spliced product, complete cds.						erythrocyte differentiation	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|central_nervous_system(1)	3	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)															---	---	---	---
FAIM3	9214	broad.mit.edu	37	1	207097665	207097666	+	5'Flank	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207097665_207097666delGT	uc001hey.2	-						FAIM3_uc010prz.1_5'Flank|FAIM3_uc010psa.1_5'Flank|FAIM3_uc010psb.1_5'Flank	NM_005449	NP_005440			Fas apoptotic inhibitory molecule 3 isoform a						anti-apoptosis|cellular defense response	integral to membrane				central_nervous_system(1)	1	Breast(84;0.201)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	207988846	207988846	+	Intron	DEL	G	-	-	rs11309446		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207988846delG	uc001hgr.2	-						uc009xcm.1_Intron|LOC148696_uc010psi.1_5'Flank					Homo sapiens cDNA FLJ35650 fis, clone SPLEN2013644.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	208119458	208119458	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208119458delG								CD34 (34775 upstream) : PLXNA2 (76132 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	208428858	208428858	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208428858delT								PLXNA2 (11193 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	209720604	209720605	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209720604_209720605insA								LOC642587 (114714 upstream) : CAMK1G (36440 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	210038328	210038328	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210038328delG								C1orf107 (7420 upstream) : SYT14 (73210 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	210445628	210445629	+	IGR	INS	-	A	A	rs113602349		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210445628_210445629insA								SERTAD4 (29190 upstream) : HHAT (55977 downstream)																																			---	---	---	---
KCNH1	3756	broad.mit.edu	37	1	210890144	210890144	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210890144delA	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872			potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)														---	---	---	---
KCNH1	3756	broad.mit.edu	37	1	210944967	210944972	+	Intron	DEL	AATAAC	-	-	rs67886007		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210944967_210944972delAATAAC	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872			potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)														---	---	---	---
KCNH1	3756	broad.mit.edu	37	1	211121387	211121388	+	Intron	INS	-	A	A	rs112366528		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211121387_211121388insA	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872			potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)														---	---	---	---
RCOR3	55758	broad.mit.edu	37	1	211478315	211478315	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211478315delT	uc001hig.2	+						RCOR3_uc010psv.1_Intron|RCOR3_uc001hie.2_Intron|RCOR3_uc010psw.1_Intron|RCOR3_uc001hif.2_Intron	NM_018254	NP_060724			REST corepressor 3 isoform d						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)														---	---	---	---
C1orf97	84791	broad.mit.edu	37	1	211555393	211555393	+	5'Flank	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211555393delA	uc010psz.1	+						C1orf97_uc001hil.3_5'Flank					SubName: Full=Putative uncharacterized protein C1orf97;												0																		---	---	---	---
LPGAT1	9926	broad.mit.edu	37	1	211993881	211993882	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211993881_211993882insA	uc001hiu.2	-						LPGAT1_uc001hiv.2_Intron	NM_014873	NP_055688			lysophosphatidylglycerol acyltransferase 1						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)														---	---	---	---
TATDN3	128387	broad.mit.edu	37	1	212967623	212967624	+	Intron	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212967623_212967624delAA	uc001hjo.2	+						NSL1_uc001hjm.2_5'Flank|NSL1_uc001hjn.2_5'Flank|NSL1_uc010pti.1_5'Flank|TATDN3_uc010ptj.1_Intron|TATDN3_uc010ptk.1_Intron|TATDN3_uc001hjp.2_Intron|TATDN3_uc010ptl.1_Intron|TATDN3_uc010ptm.1_5'Flank	NM_001042552	NP_001036017			TatD DNase domain containing 3 isoform 1							nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	213079692	213079692	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213079692delT								FLVCR1 (9495 upstream) : VASH2 (44195 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	213649685	213649685	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213649685delC								RPS6KC1 (202878 upstream) : PROX1 (511601 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	213860778	213860778	+	IGR	DEL	C	-	-	rs34215269		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213860778delC								RPS6KC1 (413971 upstream) : PROX1 (300508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	214127842	214127842	+	Intron	DEL	T	-	-	rs112139053		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214127842delT	uc001hkf.1	-											Homo sapiens cDNA FLJ34932 fis, clone NT2RP7005631.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	214369843	214369843	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214369843delT								PROX1 (160083 upstream) : SMYD2 (84722 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	214733405	214733406	+	IGR	INS	-	T	T	rs11374128		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214733405_214733406insT								PTPN14 (8763 upstream) : CENPF (43126 downstream)																																			---	---	---	---
CENPF	1063	broad.mit.edu	37	1	214783363	214783364	+	Intron	DEL	TT	-	-	rs149186215		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214783363_214783364delTT	uc001hkm.2	+						uc001hkn.1_5'Flank	NM_016343	NP_057427			centromere protein F						cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)														---	---	---	---
KCNK2	3776	broad.mit.edu	37	1	215370060	215370061	+	Intron	DEL	GA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215370060_215370061delGA	uc001hkq.2	+						KCNK2_uc001hko.2_Intron|KCNK2_uc009xdm.2_Intron|KCNK2_uc001hkp.2_Intron|KCNK2_uc001hkr.3_Intron	NM_001017425	NP_001017425			potassium channel, subfamily K, member 2 isoform								outward rectifier potassium channel activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	215589923	215589924	+	IGR	INS	-	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215589923_215589924insC								KCNK2 (179488 upstream) : KCTD3 (150811 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	216631366	216631369	+	IGR	DEL	GTGT	-	-	rs5780883		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216631366_216631369delGTGT								USH2A (34628 upstream) : ESRRG (45219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	216665759	216665759	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216665759delT								USH2A (69021 upstream) : ESRRG (10829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	218129776	218129777	+	IGR	INS	-	A	A	rs146321394	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218129776_218129777insA								SPATA17 (89274 upstream) : RRP15 (328852 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	219399933	219399934	+	IGR	INS	-	A	A	rs74997931		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219399933_219399934insA								LYPLAL1 (13727 upstream) : SLC30A10 (458835 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	219628092	219628093	+	IGR	INS	-	CTATCTG	CTATCTG	rs143129361	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219628092_219628093insCTATCTG								LYPLAL1 (241886 upstream) : SLC30A10 (230676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	219642907	219642908	+	IGR	INS	-	T	T	rs138335069	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219642907_219642908insT								LYPLAL1 (256701 upstream) : SLC30A10 (215861 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	219838792	219838792	+	IGR	DEL	A	-	-	rs12131485	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219838792delA								LYPLAL1 (452586 upstream) : SLC30A10 (19977 downstream)																																			---	---	---	---
SLC30A10	55532	broad.mit.edu	37	1	219925448	219925449	+	Intron	INS	-	AC	AC	rs67528241		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219925448_219925449insAC	uc001hlu.1	-											Synthetic construct DNA, clone: pF1KB7405, Homo sapiens SLC30A10 gene for solute carrier family 30, member 10, without stop codon, in Flexi system.						zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)														---	---	---	---
SLC30A10	55532	broad.mit.edu	37	1	219971631	219971632	+	Intron	INS	-	AAAA	AAAA	rs146870668	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219971631_219971632insAAAA	uc001hlu.1	-											Synthetic construct DNA, clone: pF1KB7405, Homo sapiens SLC30A10 gene for solute carrier family 30, member 10, without stop codon, in Flexi system.						zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)														---	---	---	---
SLC30A10	55532	broad.mit.edu	37	1	219974079	219974081	+	Intron	DEL	AAG	-	-	rs10863503		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219974079_219974081delAAG	uc001hlu.1	-											Synthetic construct DNA, clone: pF1KB7405, Homo sapiens SLC30A10 gene for solute carrier family 30, member 10, without stop codon, in Flexi system.						zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	220469466	220469467	+	IGR	INS	-	TG	TG	rs72115593		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220469466_220469467insTG								RAB3GAP2 (23623 upstream) : MARK1 (232101 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	221175814	221175817	+	IGR	DEL	TATC	-	-	rs72264129		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221175814_221175817delTATC								HLX (117416 upstream) : LOC400804 (327453 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	221639916	221639917	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221639916_221639917insT								LOC400804 (130278 upstream) : DUSP10 (234849 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	221773784	221773784	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221773784delA								LOC400804 (264146 upstream) : DUSP10 (100982 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	221965539	221965539	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221965539delT								DUSP10 (50078 upstream) : HHIPL2 (730063 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	222179830	222179830	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222179830delT								DUSP10 (264369 upstream) : HHIPL2 (515772 downstream)																																			---	---	---	---
AIDA	64853	broad.mit.edu	37	1	222880524	222880524	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222880524delA	uc001hnn.2	-						AIDA_uc001hno.2_Intron|AIDA_uc010pus.1_Intron	NM_022831	NP_073742			axin interactor, dorsalization associated						dorsal/ventral pattern formation|negative regulation of JNK cascade|negative regulation of JUN kinase activity|regulation of protein homodimerization activity						0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	223087345	223087347	+	IGR	DEL	TTT	-	-	rs143681520		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223087345_223087347delTTT								FAM177B (163344 upstream) : DISP1 (14436 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	223183456	223183456	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223183456delT								DISP1 (4121 upstream) : TLR5 (100128 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	223600661	223600661	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223600661delT								C1orf65 (31849 upstream) : CAPN8 (114311 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	224254569	224254569	+	IGR	DEL	T	-	-	rs34515888		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224254569delT								TP53BP2 (220895 upstream) : FBXO28 (47222 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	224646894	224646905	+	Intron	DEL	CTTAGATCAAGT	-	-	rs68180634		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224646894_224646905delCTTAGATCAAGT	uc001hor.1	+											full-length cDNA clone CS0DC026YN07 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225170321	225170321	+	Intron	DEL	C	-	-	rs34206942		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225170321delC	uc001how.2	+						DNAH14_uc001hou.3_Intron|DNAH14_uc001hot.3_Intron	NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225424958	225424959	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225424958_225424959insT	uc001how.2	+							NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225484211	225484212	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225484211_225484212insT	uc001how.2	+						DNAH14_uc001hox.2_Intron	NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225523001	225523002	+	Intron	DEL	AT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225523001_225523002delAT	uc001how.2	+						DNAH14_uc001hox.2_Intron	NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
SRP9	6726	broad.mit.edu	37	1	225974547	225974548	+	Intron	INS	-	T	T	rs11441168		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225974547_225974548insT	uc001hpg.2	+						SRP9_uc001hpf.3_Intron|SRP9_uc001hph.2_Intron|SRP9_uc001hpi.3_Intron|SRP9_uc001hpj.1_Intron	NM_003133	NP_003124			signal recognition particle 9kDa isoform 2						negative regulation of translational elongation|SRP-dependent cotranslational protein targeting to membrane	cytosol|signal recognition particle receptor complex|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	226169430	226169430	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226169430delA								LEFTY2 (40510 upstream) : C1orf55 (974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	226222878	226222878	+	IGR	DEL	T	-	-	rs12729024		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226222878delT								C1orf55 (35812 upstream) : H3F3A (27543 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	226518280	226518280	+	IGR	DEL	T	-	-	rs112434111		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226518280delT								LIN9 (20710 upstream) : PARP1 (30113 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	226525595	226525596	+	IGR	INS	-	T	T	rs76628573		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226525595_226525596insT								LIN9 (28025 upstream) : PARP1 (22797 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	226818487	226818490	+	IGR	DEL	AAGA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226818487_226818490delAAGA								C1orf95 (25184 upstream) : ITPKB (902 downstream)																																			---	---	---	---
ITPKB	3707	broad.mit.edu	37	1	226927187	226927187	+	5'Flank	DEL	T	-	-	rs140417179		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226927187delT	uc010pvo.1	-						ITPKB_uc001hqh.2_5'Flank	NM_002221	NP_002212			1D-myo-inositol-trisphosphate 3-kinase B								ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity			ovary(4)|central_nervous_system(1)	5		Prostate(94;0.0773)																---	---	---	---
CABC1	56997	broad.mit.edu	37	1	227148244	227148246	+	Intron	DEL	TGG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227148244_227148246delTGG	uc001hqm.1	+						CABC1_uc010pvp.1_Intron|CABC1_uc001hqn.1_Intron|CABC1_uc009xeq.1_Intron|CABC1_uc010pvq.1_Intron	NM_020247	NP_064632			chaperone, ABC1 activity of bc1 complex like						cell death	mitochondrion	ATP binding|protein serine/threonine kinase activity				0		Prostate(94;0.0771)																---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227476396	227476397	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227476396_227476397insA	uc001hqr.2	-						CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
GUK1	2987	broad.mit.edu	37	1	228331139	228331139	+	Intron	DEL	C	-	-	rs16848367	byFrequency;by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228331139delC	uc001hsh.2	+						GUK1_uc001hsi.2_Intron|GUK1_uc001hsj.2_Intron|GUK1_uc010pvv.1_5'Flank	NM_000858	NP_000849			guanylate kinase 1 isoform b						nucleobase, nucleoside and nucleotide interconversion|purine nucleotide metabolic process	cytosol	ATP binding|guanylate kinase activity				0		Prostate(94;0.0405)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	229332589	229332593	+	IGR	DEL	AAAAG	-	-	rs72243667		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229332589_229332593delAAAAG								RHOU (450180 upstream) : RAB4A (74286 downstream)																																			---	---	---	---
ARV1	64801	broad.mit.edu	37	1	231131341	231131341	+	Intron	DEL	C	-	-	rs58999793		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231131341delC	uc009xfl.1	+						ARV1_uc001huh.2_Intron	NM_022786	NP_073623			ARV1 homolog						sphingolipid metabolic process	integral to membrane				breast(2)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)		COAD - Colon adenocarcinoma(196;0.211)|Colorectal(1306;0.233)														---	---	---	---
DISC1	27185	broad.mit.edu	37	1	231869406	231869411	+	Intron	DEL	GTGGTA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231869406_231869411delGTGGTA	uc001huz.2	+						TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwg.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pwo.1_Intron|DISC1_uc010pwp.1_Intron|DISC1_uc010pwq.1_Intron|DISC1_uc010pwr.1_Intron|DISC1_uc010pws.1_Intron|DISC1_uc010pwt.1_Intron|DISC1_uc010pwu.1_Intron|DISC1_uc010pwv.1_Intron|DISC1_uc010pww.1_Intron|DISC1_uc010pwx.1_Intron|DISC1_uc010pwy.1_Intron|DISC1_uc010pwz.1_Intron|DISC1_uc010pxa.1_Intron|DISC1_uc001huy.2_Intron|DISC1_uc010pxb.1_Intron|DISC1_uc010pxc.1_Intron|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron	NM_018662	NP_061132			disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)																---	---	---	---
DISC1	27185	broad.mit.edu	37	1	232022554	232022555	+	Intron	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232022554_232022555delTT	uc001huz.2	+						TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pxb.1_Intron|DISC1_uc010pxc.1_Intron|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron	NM_018662	NP_061132			disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	233006036	233006037	+	IGR	DEL	GT	-	-	rs67567315		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233006036_233006037delGT								KIAA1383 (59944 upstream) : C1orf57 (80333 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	233053688	233053688	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233053688delT								KIAA1383 (107596 upstream) : C1orf57 (32682 downstream)																																			---	---	---	---
PCNXL2	80003	broad.mit.edu	37	1	233204108	233204108	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233204108delA	uc001hvl.2	-						PCNXL2_uc001hvm.1_Intron|PCNXL2_uc009xfu.2_Intron	NM_014801	NP_055616			pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)																---	---	---	---
PCNXL2	80003	broad.mit.edu	37	1	233424550	233424551	+	Intron	DEL	CT	-	-	rs10558976		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233424550_233424551delCT	uc001hvl.2	-							NM_014801	NP_055616			pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	234522388	234522388	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234522388delT								C1orf31 (2598 upstream) : TARBP1 (4672 downstream)																																			---	---	---	---
TARBP1	6894	broad.mit.edu	37	1	234548168	234548168	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234548168delA	uc001hwd.2	-							NM_005646	NP_005637			TAR RNA binding protein 1						regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	234625307	234625307	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234625307delT								TARBP1 (10458 upstream) : IRF2BP2 (114710 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234628269	234628269	+	IGR	DEL	T	-	-	rs12038401		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234628269delT								TARBP1 (13420 upstream) : IRF2BP2 (111748 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234859467	234859480	+	5'Flank	DEL	TGTGTGTGTGTGTG	-	-	rs113313483		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234859467_234859480delTGTGTGTGTGTGTG	uc001hwj.1	+											Homo sapiens cDNA FLJ43367 fis, clone NT2RP8000435.																														---	---	---	---
ARID4B	51742	broad.mit.edu	37	1	235378895	235378898	+	Intron	DEL	TATA	-	-	rs71907203	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235378895_235378898delTATA	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwt.3_Intron	NM_016374	NP_057458			AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)															---	---	---	---
ARID4B	51742	broad.mit.edu	37	1	235391963	235391963	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235391963delT	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwu.1_3'UTR|ARID4B_uc001hwt.3_Intron	NM_016374	NP_057458			AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)															---	---	---	---
ARID4B	51742	broad.mit.edu	37	1	235459796	235459796	+	Intron	DEL	T	-	-	rs35644965		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235459796delT	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwu.1_Intron	NM_016374	NP_057458			AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)															---	---	---	---
LYST	1130	broad.mit.edu	37	1	235879169	235879169	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235879169delA	uc001hxj.2	-						LYST_uc001hxi.2_Intron	NM_000081	NP_000072			lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)											Chediak-Higashi_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	1	236237639	236237640	+	IGR	INS	-	AAG	AAG	rs138814716		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236237639_236237640insAAG								NID1 (9158 upstream) : GPR137B (68192 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	236475204	236475205	+	IGR	INS	-	T	T	rs140911197	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236475204_236475205insT								ERO1LB (29865 upstream) : EDARADD (82475 downstream)																																			---	---	---	---
EDARADD	128178	broad.mit.edu	37	1	236619096	236619098	+	Intron	DEL	TTC	-	-	rs111763818		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236619096_236619098delTTC	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860			EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
EDARADD	128178	broad.mit.edu	37	1	236630726	236630727	+	Intron	INS	-	CA	CA	rs72237464		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236630726_236630727insCA	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860			EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	236820259	236820259	+	IGR	DEL	A	-	-	rs71559970		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236820259delA								HEATR1 (52445 upstream) : ACTN2 (29511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	236832437	236832438	+	IGR	INS	-	TCTCTC	TCTCTC	rs147189424	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236832437_236832438insTCTCTC								HEATR1 (64623 upstream) : ACTN2 (17332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	237167149	237167150	+	IGR	INS	-	GTTTCTCACCTTTT	GTTTCTCACCTTTT	rs141885396	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237167149_237167150insGTTTCTCACCTTTT								MTR (99869 upstream) : RYR2 (38552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	237191218	237191219	+	IGR	INS	-	ACAA	ACAA	rs149555744	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237191218_237191219insACAA								MTR (123938 upstream) : RYR2 (14483 downstream)																																			---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237615285	237615288	+	Intron	DEL	TGTT	-	-	rs66483747		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237615285_237615288delTGTT	uc001hyl.1	+							NM_001035	NP_001026			cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237801405	237801405	+	Intron	DEL	A	-	-	rs151267122		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237801405delA	uc001hyl.1	+							NM_001035	NP_001026			cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237829289	237829290	+	Intron	INS	-	T	T	rs148762976	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237829289_237829290insT	uc001hyl.1	+							NM_001035	NP_001026			cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	238013922	238013923	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238013922_238013923insT								RYR2 (16634 upstream) : LOC100130331 (11552 downstream)																																			---	---	---	---
LOC100130331	100130331	broad.mit.edu	37	1	238032549	238032550	+	Intron	INS	-	CTG	CTG	rs34160079		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238032549_238032550insCTG	uc010pyc.1	+							NR_027247				Homo sapiens mRNA; cDNA DKFZp434B2115 (from clone DKFZp434B2115).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	238487254	238487254	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238487254delT								LOC100130331 (395637 upstream) : LOC339535 (156432 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	238494196	238494196	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238494196delT								LOC100130331 (402579 upstream) : LOC339535 (149490 downstream)																																			---	---	---	---
CHRM3	1131	broad.mit.edu	37	1	239797687	239797688	+	Intron	INS	-	AGAC	AGAC	rs145064653	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239797687_239797688insAGAC	uc001hyp.2	+						CHRM3_uc001hyo.1_Intron	NM_000740	NP_000731			cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	240138401	240138401	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240138401delA								CHRM3 (65686 upstream) : FMN2 (116784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	240904478	240904479	+	IGR	INS	-	T	T	rs4529698		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240904478_240904479insT								GREM2 (129016 upstream) : RGS7 (27076 downstream)																																			---	---	---	---
RGS7	6000	broad.mit.edu	37	1	241049459	241049459	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241049459delA	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915			regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)															---	---	---	---
RGS7	6000	broad.mit.edu	37	1	241190121	241190121	+	Intron	DEL	G	-	-	rs147106117		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241190121delG	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915			regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)															---	---	---	---
WDR64	128025	broad.mit.edu	37	1	241921616	241921617	+	Intron	INS	-	T	T	rs34461998		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241921616_241921617insT	uc001hzf.1	+						WDR64_uc001hzg.1_Intron	NM_144625	NP_653226			WD repeat domain 64											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)															---	---	---	---
WDR64	128025	broad.mit.edu	37	1	241954978	241954978	+	Intron	DEL	A	-	-	rs150419559		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241954978delA	uc001hzf.1	+						WDR64_uc001hzg.1_Intron	NM_144625	NP_653226			WD repeat domain 64											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)															---	---	---	---
EXO1	9156	broad.mit.edu	37	1	242026725	242026726	+	Intron	INS	-	A	A	rs151293012	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242026725_242026726insA	uc001hzh.2	+						EXO1_uc001hzi.2_Intron|EXO1_uc001hzj.2_Intron|EXO1_uc009xgq.2_Intron	NM_130398	NP_569082			exonuclease 1 isoform b						meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)										Direct_reversal_of_damage|Editing_and_processing_nucleases					---	---	---	---
Unknown	0	broad.mit.edu	37	1	242055807	242055808	+	IGR	INS	-	TTT	TTT	rs851794	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242055807_242055808insTTT								EXO1 (2760 upstream) : MAP1LC3C (102984 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	242177110	242177110	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242177110delA								MAP1LC3C (14725 upstream) : PLD5 (75162 downstream)																																			---	---	---	---
PLD5	200150	broad.mit.edu	37	1	242587848	242587849	+	Intron	INS	-	A	A	rs71679010		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242587848_242587849insA	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron					RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	242855484	242855485	+	IGR	INS	-	AC	AC	rs147261190	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242855484_242855485insAC								PLD5 (167486 upstream) : CEP170 (432246 downstream)																																			---	---	---	---
AKT3	10000	broad.mit.edu	37	1	243991367	243991368	+	Intron	INS	-	AACAAC	AACAAC	rs141933732	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243991367_243991368insAACAAC	uc001iab.1	-						AKT3_uc001hzz.1_Intron	NM_005465	NP_005456			AKT3 kinase isoform 1						signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	244471396	244471397	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244471396_244471397insA								ZNF238 (250620 upstream) : C1orf100 (44540 downstream)																																			---	---	---	---
C1orf101	257044	broad.mit.edu	37	1	244775019	244775019	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244775019delT	uc001iam.2	+						C1orf101_uc001ial.2_Intron|C1orf101_uc010pym.1_Intron|C1orf101_uc010pyn.1_Intron	NM_001130957	NP_001124429			hypothetical protein LOC257044 isoform 1							integral to membrane				ovary(1)|breast(1)	2	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)															---	---	---	---
PPPDE1	51029	broad.mit.edu	37	1	244843732	244843732	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244843732delA	uc001iao.2	+						PPPDE1_uc001iap.2_Intron	NM_016076	NP_057160			PPPDE peptidase domain containing 1											breast(3)	3																		---	---	---	---
HNRNPU	3192	broad.mit.edu	37	1	245025045	245025045	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245025045delA	uc001iaz.1	-						HNRNPU_uc001iax.1_5'Flank|HNRNPU_uc001iay.1_5'Flank|HNRNPU_uc001iba.1_Intron|HNRNPU_uc001ibb.1_Intron	NM_031844	NP_114032			heterogeneous nuclear ribonucleoprotein U						CRD-mediated mRNA stabilization	catalytic step 2 spliceosome|cell surface|CRD-mediated mRNA stability complex|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	ATP binding|DNA binding|protein binding|RNA binding				0	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	245099723	245099724	+	IGR	INS	-	C	C	rs72503269		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245099723_245099724insC								HNRNPU (71896 upstream) : EFCAB2 (33447 downstream)																																			---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245332629	245332630	+	Intron	INS	-	GGTGTGTG	GGTGTGTG	rs143060843	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245332629_245332630insGGTGTGTG	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245598356	245598363	+	Intron	DEL	TCCATCCA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245598356_245598363delTCCATCCA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
SMYD3	64754	broad.mit.edu	37	1	246670934	246670947	+	5'Flank	DEL	TATTGTCGTTAAAC	-	-	rs71993891		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246670934_246670947delTATTGTCGTTAAAC	uc001ibl.2	-							NM_022743	NP_073580			SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	246837273	246837274	+	IGR	INS	-	A	A	rs113824676		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246837273_246837274insA								CNST (5390 upstream) : SCCPDH (50104 downstream)																																			---	---	---	---
ZNF670	93474	broad.mit.edu	37	1	247200173	247200174	+	3'UTR	INS	-	ACACAC	ACACAC	rs149450468	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247200173_247200174insACACAC	uc001icd.1	-	4					ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron	NM_033213	NP_149990			zinc finger protein 670						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	247252107	247252108	+	IGR	INS	-	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247252107_247252108insG								ZNF695 (10038 upstream) : ZNF669 (11156 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	247443485	247443486	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247443485_247443486insA								VN1R5 (23039 upstream) : ZNF496 (20137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	248576811	248576812	+	IGR	INS	-	A	A	rs79022933		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248576811_248576812insA								OR2T1 (6407 upstream) : OR2T2 (39287 downstream)																																			---	---	---	---
SNTG2	54221	broad.mit.edu	37	2	1355222	1355222	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1355222delC	uc002qwq.2	+						SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841			syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)														---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	1872229	1872232	+	Intron	DEL	AAGA	-	-	rs113794671		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1872229_1872232delAAGA	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	2299366	2299367	+	Intron	DEL	AG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2299366_2299367delAG	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	2343886	2343887	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2343886_2343887delCA								MYT1L (8841 upstream) : TSSC1 (848854 downstream)																																			---	---	---	---
TSSC1	7260	broad.mit.edu	37	2	3297684	3297684	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3297684delT	uc002qxj.2	-						TSSC1_uc002qxi.2_Intron	NM_003310	NP_003301			tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)														---	---	---	---
RNASEH1	246243	broad.mit.edu	37	2	3600987	3600988	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3600987_3600988insT	uc002qxt.2	-						RNASEH1_uc002qxs.2_Intron	NM_002936	NP_002927			ribonuclease H1						RNA catabolic process	cytoplasm	magnesium ion binding|ribonuclease H activity|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	4000119	4000119	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4000119delT								ALLC (249861 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5811654	5811657	+	IGR	DEL	CCTT	-	-	rs72439319	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5811654_5811657delCCTT								None (None upstream) : SOX11 (21142 downstream)																																			---	---	---	---
RNF144A	9781	broad.mit.edu	37	2	7111894	7111895	+	Intron	INS	-	T	T	rs147737133	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7111894_7111895insT	uc002qys.2	+						RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561			ring finger protein 144							Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	7750690	7750691	+	IGR	INS	-	TTG	TTG	rs146941205	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7750690_7750691insTTG								RNF144A (566383 upstream) : LOC339788 (311867 downstream)																																			---	---	---	---
ASAP2	8853	broad.mit.edu	37	2	9457692	9457693	+	Intron	DEL	CT	-	-	rs147477792		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9457692_9457693delCT	uc002qzh.2	+						ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878			ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0																		---	---	---	---
HPCAL1	3241	broad.mit.edu	37	2	10522859	10522859	+	Intron	DEL	C	-	-	rs112289870		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10522859delC	uc002raj.2	+						HPCAL1_uc002rak.2_Intron|HPCAL1_uc002ral.2_Intron|HPCAL1_uc010exe.2_Intron|HPCAL1_uc010exf.2_Intron	NM_002149	NP_002140			hippocalcin-like 1								calcium ion binding			pancreas(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)														---	---	---	---
NOL10	79954	broad.mit.edu	37	2	10794905	10794906	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10794905_10794906insA	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron|NOL10_uc002rar.2_Intron	NM_024894	NP_079170			nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)														---	---	---	---
C2orf50	130813	broad.mit.edu	37	2	11274409	11274410	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11274409_11274410insT	uc010yji.1	+						uc002raz.1_5'Flank|uc002rba.1_5'Flank|C2orf50_uc010yjj.1_Intron	NM_182500	NP_872306			hypothetical protein LOC130813												0	all_hematologic(175;0.0797)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.0997)|OV - Ovarian serous cystadenocarcinoma(76;0.134)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	12777743	12777744	+	IGR	INS	-	T	T	rs141162829	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12777743_12777744insT								LPIN1 (810212 upstream) : TRIB2 (79254 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	15129601	15129602	+	IGR	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15129601_15129602delAA								FAM84A (338668 upstream) : NBAS (177430 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16166083	16166083	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16166083delA								MYCN (78955 upstream) : FAM49A (567818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16253984	16253985	+	IGR	INS	-	GA	GA	rs149925179	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16253984_16253985insGA								MYCN (166856 upstream) : FAM49A (479916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16423672	16423672	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16423672delC								MYCN (336544 upstream) : FAM49A (310229 downstream)																																			---	---	---	---
FAM49A	81553	broad.mit.edu	37	2	16848718	16848723	+	5'Flank	DEL	ACACAC	-	-	rs35718722		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16848718_16848723delACACAC	uc002rck.1	-							NM_030797	NP_110424			family with sequence similarity 49, member A							intracellular					0	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	18054866	18054867	+	IGR	INS	-	T	T	rs78296529		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18054866_18054867insT								MSGN1 (56500 upstream) : KCNS3 (4247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19316024	19316024	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19316024delG								NT5C1B (545186 upstream) : OSR1 (235223 downstream)																																			---	---	---	---
SDC1	6382	broad.mit.edu	37	2	20418290	20418291	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20418290_20418291delAC	uc002rdo.1	-						SDC1_uc002rdp.1_Intron|SDC1_uc010exv.2_Intron|SDC1_uc010exw.1_Intron	NM_002997	NP_002988			syndecan 1 precursor						lipid metabolic process|lipoprotein metabolic process|myoblast development|striated muscle cell development	cytoplasm|extracellular region|focal adhesion|integral to plasma membrane	cytoskeletal protein binding|protein C-terminus binding			ovary(4)|skin(1)	5	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	23247939	23247939	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23247939delT								None (None upstream) : KLHL29 (507516 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23554682	23554682	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23554682delG								None (None upstream) : KLHL29 (200773 downstream)																																			---	---	---	---
ATAD2B	54454	broad.mit.edu	37	2	24082819	24082820	+	Intron	INS	-	A	A	rs74797962		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24082819_24082820insA	uc002rek.3	-						ATAD2B_uc010yki.1_Intron	NM_017552	NP_060022			ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
NCOA1	8648	broad.mit.edu	37	2	24824083	24824084	+	Intron	INS	-	T	T	rs138883180	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24824083_24824084insT	uc002rfk.2	+						NCOA1_uc010eye.2_Intron|NCOA1_uc002rfi.2_Intron|NCOA1_uc002rfj.2_Intron|NCOA1_uc002rfl.2_Intron	NM_003743	NP_003734			nuclear receptor coactivator 1 isoform 1										PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							T	PAX3	alveolar rhadomyosarcoma								---	---	---	---
NCOA1	8648	broad.mit.edu	37	2	24891671	24891672	+	Intron	INS	-	A	A	rs150059374	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24891671_24891672insA	uc002rfk.2	+						NCOA1_uc010eye.2_Intron|NCOA1_uc002rfi.2_Intron|NCOA1_uc002rfj.2_Intron|NCOA1_uc002rfl.2_Intron	NM_003743	NP_003734			nuclear receptor coactivator 1 isoform 1										PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							T	PAX3	alveolar rhadomyosarcoma								---	---	---	---
ADCY3	109	broad.mit.edu	37	2	25088359	25088362	+	Intron	DEL	TGTG	-	-	rs71397448		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25088359_25088362delTGTG	uc002rfs.3	-						ADCY3_uc010ykm.1_Intron	NM_004036	NP_004027			adenylate cyclase 3						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)																	---	---	---	---
DTNB	1838	broad.mit.edu	37	2	25714006	25714007	+	Intron	INS	-	CA	CA	rs150260864		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25714006_25714007insCA	uc002rgh.2	-						DTNB_uc010yko.1_Intron|DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc002rgr.1_Intron|DTNB_uc010ykq.1_Intron	NM_021907	NP_068707			dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	26529476	26529476	+	IGR	DEL	C	-	-	rs67398764		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26529476delC								HADHB (16144 upstream) : GPR113 (1565 downstream)																																			---	---	---	---
EPT1	85465	broad.mit.edu	37	2	26600734	26600735	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26600734_26600735insT	uc010ykz.1	+						EPT1_uc010eyl.1_Intron	NM_033505	NP_277040			selenoprotein I						phospholipid biosynthetic process	integral to membrane	ethanolaminephosphotransferase activity|metal ion binding				0																		---	---	---	---
GTF3C2	2976	broad.mit.edu	37	2	27567987	27567988	+	Intron	INS	-	A	A	rs149240209	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27567987_27567988insA	uc002rjv.1	-						GTF3C2_uc002rju.1_Intron|GTF3C2_uc002rjw.1_Intron|GTF3C2_uc010eyz.1_Intron	NM_001521	NP_001512			general transcription factor IIIC, polypeptide							transcription factor TFIIIC complex				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	28875854	28875854	+	IGR	DEL	A	-	-	rs112518316		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28875854delA								PLB1 (9241 upstream) : PPP1CB (98758 downstream)																																			---	---	---	---
WDR43	23160	broad.mit.edu	37	2	29141188	29141189	+	Intron	DEL	GT	-	-	rs111836656		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29141188_29141189delGT	uc002rmo.2	+							NM_015131	NP_055946			WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
ALK	238	broad.mit.edu	37	2	30080926	30080927	+	Intron	DEL	TG	-	-	rs67913585		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30080926_30080927delTG	uc002rmy.2	-							NM_004304	NP_004295			anaplastic lymphoma kinase precursor						protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				---	---	---	---
RASGRP3	25780	broad.mit.edu	37	2	33672507	33672508	+	Intron	INS	-	TT	TT	rs113187274		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33672507_33672508insTT	uc002rox.2	+						RASGRP3_uc002row.1_Intron	NM_170672	NP_733772			RAS guanyl releasing protein 3 (calcium and						MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	34532387	34532387	+	IGR	DEL	T	-	-	rs5830306		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34532387delT								MYADML (579103 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	35405020	35405021	+	IGR	DEL	GA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35405020_35405021delGA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	36395865	36395865	+	IGR	DEL	A	-	-	rs66823751		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36395865delA								None (None upstream) : CRIM1 (187532 downstream)																																			---	---	---	---
HEATR5B	54497	broad.mit.edu	37	2	37267970	37267970	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37267970delA	uc002rpp.1	-							NM_019024	NP_061897			HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)																---	---	---	---
PRKD3	23683	broad.mit.edu	37	2	37493633	37493633	+	Intron	DEL	T	-	-	rs67483329		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37493633delT	uc002rqd.2	-						PRKD3_uc002rqe.1_Intron	NM_005813	NP_005804			protein kinase D3						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	37562188	37562188	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37562188delA								PRKD3 (17966 upstream) : QPCT (9565 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	37713568	37713568	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37713568delC								QPCT (113104 upstream) : CDC42EP3 (157175 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	37939647	37939648	+	IGR	INS	-	T	T	rs71400315		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37939647_37939648insT								CDC42EP3 (40321 upstream) : FAM82A1 (212814 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	37961776	37961776	+	IGR	DEL	A	-	-	rs33959667		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37961776delA								CDC42EP3 (62450 upstream) : FAM82A1 (190686 downstream)																																			---	---	---	---
GALM	130589	broad.mit.edu	37	2	38929330	38929330	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38929330delA	uc002rqy.2	+							NM_138801	NP_620156			galactose mutarotase						hexose metabolic process	cytoplasm	aldose 1-epimerase activity|carbohydrate binding				0		all_hematologic(82;0.248)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	39135169	39135170	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39135169_39135170insA								MORN2 (25321 upstream) : ARHGEF33 (11419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	40043047	40043047	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40043047delA								THUMPD2 (36631 upstream) : SLC8A1 (296240 downstream)																																			---	---	---	---
SLC8A1	6546	broad.mit.edu	37	2	40415902	40415902	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40415902delC	uc002rrx.2	-						uc002rrw.2_Intron|SLC8A1_uc002rry.2_Intron|SLC8A1_uc002rrz.2_Intron|SLC8A1_uc002rsa.2_Intron|SLC8A1_uc002rsd.3_Intron|SLC8A1_uc002rsb.1_Intron	NM_021097	NP_066920			solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	43202590	43202597	+	IGR	DEL	CCTCCAGC	-	-	rs112624544	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43202590_43202597delCCTCCAGC								HAAO (182839 upstream) : ZFP36L2 (246945 downstream)																																	OREG0014575	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
THADA	63892	broad.mit.edu	37	2	43567977	43567977	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43567977delG	uc002rsw.3	-						THADA_uc010far.2_Intron|THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron|THADA_uc010fas.1_Intron	NM_001083953	NP_001077422			thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	44239162	44239163	+	IGR	INS	-	TGTTTGTG	TGTTTGTG	rs114645840	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44239162_44239163insTGTTTGTG								LRPPRC (16018 upstream) : PPM1B (156837 downstream)																																			---	---	---	---
C2orf34	79823	broad.mit.edu	37	2	44963037	44963046	+	Intron	DEL	AAACAAAACA	-	-	rs112507900		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44963037_44963046delAAACAAAACA	uc002rum.2	+							NM_024766	NP_079042			hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	45102462	45102462	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45102462delG								C2orf34 (102733 upstream) : SIX3 (66575 downstream)																																			---	---	---	---
SIX3	6496	broad.mit.edu	37	2	45167236	45167237	+	5'Flank	DEL	AA	-	-	rs111356171		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45167236_45167237delAA	uc002run.1	+							NM_005413	NP_005404			SIX homeobox 3						visual perception	nucleus					0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)																---	---	---	---
PRKCE	5581	broad.mit.edu	37	2	45930677	45930678	+	Intron	INS	-	A	A	rs146688640	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45930677_45930678insA	uc002rut.2	+						PRKCE_uc002ruu.2_Intron	NM_005400	NP_005391			protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	47552783	47552784	+	Intron	DEL	TG	-	-	rs76229370		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47552783_47552784delTG	uc002rvu.1	-											Homo sapiens cDNA FLJ37024 fis, clone BRACE2010837.									p.?(1)																					---	---	---	---
FSHR	2492	broad.mit.edu	37	2	49333587	49333587	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49333587delC	uc002rww.2	-						FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Intron|FSHR_uc010fbo.1_Intron	NM_000145	NP_000136			follicle stimulating hormone receptor isoform 1						female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)									Gonadal_Dysgenesis_46_XX				---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50570602	50570603	+	Intron	INS	-	A	A	rs11285713		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50570602_50570603insA	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_138735	NP_620072			neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50996054	50996055	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50996054_50996055delAC	uc010fbq.2	-						NRXN1_uc002rxe.3_Intron	NM_001135659	NP_001129131			neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	51439322	51439322	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51439322delA								NRXN1 (179648 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	51653372	51653372	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51653372delA								NRXN1 (393698 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	52804117	52804117	+	IGR	DEL	T	-	-	rs71406682		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52804117delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53039111	53039111	+	IGR	DEL	A	-	-	rs74326640		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53039111delA								None (None upstream) : ASB3 (858007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53323523	53323524	+	IGR	INS	-	ACAC	ACAC	rs147944815	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53323523_53323524insACAC								None (None upstream) : ASB3 (573594 downstream)																																			---	---	---	---
EML6	400954	broad.mit.edu	37	2	54985020	54985020	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54985020delT	uc002ryb.3	+							NM_001039753	NP_001034842			echinoderm microtubule associated protein like							cytoplasm|microtubule					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	55995628	55995628	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55995628delT								PNPT1 (74617 upstream) : EFEMP1 (97475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	56292732	56292732	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56292732delA	uc002rzk.2	+											Homo sapiens, clone IMAGE:3873411, mRNA.																														---	---	---	---
VRK2	7444	broad.mit.edu	37	2	58148422	58148423	+	Intron	DEL	CA	-	-	rs72196637		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58148422_58148423delCA	uc002rzo.2	+						VRK2_uc010fcb.2_Intron	NM_001130482	NP_001123954			vaccinia related kinase 2 isoform 2							integral to membrane	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	59734452	59734452	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59734452delA								None (None upstream) : BCL11A (943851 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	60378108	60378109	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60378108_60378109insA								None (None upstream) : BCL11A (300194 downstream)																																			---	---	---	---
USP34	9736	broad.mit.edu	37	2	61580528	61580530	+	Intron	DEL	TGT	-	-	rs36102690	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61580528_61580530delTGT	uc002sbe.2	-							NM_014709	NP_055524			ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
COMMD1	150684	broad.mit.edu	37	2	62157753	62157754	+	Intron	DEL	TG	-	-	rs72277997		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62157753_62157754delTG	uc002sbp.2	+							NM_152516	NP_689729			MURR1						copper ion homeostasis|negative regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|regulation of proteasomal ubiquitin-dependent protein catabolic process	cell junction|Cul2-RING ubiquitin ligase complex|cytoplasm|nucleolus	copper ion binding|protein homodimerization activity			ovary(1)	1	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)															---	---	---	---
C2orf86	51057	broad.mit.edu	37	2	63626713	63626714	+	Intron	INS	-	GA	GA	rs150187715	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63626713_63626714insGA	uc002sch.2	-						C2orf86_uc002sce.2_Intron|C2orf86_uc002scf.2_Intron|C2orf86_uc010ypu.1_Intron|C2orf86_uc002scg.2_Intron|C2orf86_uc002sci.1_Intron	NM_015910	NP_056994			hypothetical protein LOC51057 isoform 2						cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	64500321	64500322	+	IGR	DEL	CA	-	-	rs71904998		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64500321_64500322delCA								PELI1 (128716 upstream) : HSPC159 (181005 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	65780349	65780351	+	Intron	DEL	AAC	-	-	rs113792491		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65780349_65780351delAAC	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	66123955	66123955	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66123955delT	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	67234444	67234444	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67234444delA								MEIS1 (434554 upstream) : ETAA1 (389998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	68030135	68030135	+	IGR	DEL	T	-	-	rs74756405		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68030135delT								ETAA1 (392602 upstream) : C1D (239198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	68261185	68261185	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68261185delT								ETAA1 (623652 upstream) : C1D (8148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	69491867	69491867	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69491867delG								ANTXR1 (15410 upstream) : GFPT1 (55038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	71102298	71102299	+	IGR	INS	-	TT	TT	rs11374669	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71102298_71102299insTT								CD207 (39345 upstream) : VAX2 (25421 downstream)																																			---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71863642	71863642	+	Intron	DEL	G	-	-	rs71403000		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71863642delG	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485			dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	73362426	73362427	+	IGR	INS	-	AAGG	AAGG			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73362426_73362427insAAGG								RAB11FIP5 (22280 upstream) : NOTO (66959 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	73915942	73915942	+	IGR	DEL	C	-	-	rs77246141		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73915942delC								ALMS1P (3250 upstream) : NAT8B (11694 downstream)																																			---	---	---	---
C2orf3	6936	broad.mit.edu	37	2	75919778	75919778	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75919778delA	uc002sno.2	-						C2orf3_uc010ffs.2_Intron|C2orf3_uc002snn.2_Intron|C2orf3_uc010fft.2_Intron	NM_003203	NP_003194			hypothetical protein LOC6936						negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	76656320	76656327	+	IGR	DEL	GTGTGTGT	-	-	rs66806104		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76656320_76656327delGTGTGTGT								C2orf3 (718209 upstream) : LRRTM4 (318531 downstream)																																			---	---	---	---
LRRTM4	80059	broad.mit.edu	37	2	77108595	77108595	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77108595delT	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217			leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)														---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80468347	80468347	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80468347delT	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80740924	80740924	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80740924delA	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	81187859	81187860	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:81187859_81187860insT								CTNNA2 (311955 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	82057283	82057284	+	IGR	DEL	AT	-	-	rs71386355		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82057283_82057284delAT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	83078590	83078590	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83078590delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	84117428	84117428	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84117428delA								None (None upstream) : FUNDC2P2 (400378 downstream)																																			---	---	---	---
DNAH6	1768	broad.mit.edu	37	2	85013225	85013226	+	Intron	INS	-	GAAAGAAT	GAAAGAAT	rs66953212		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85013225_85013226insGAAAGAAT	uc010fgb.2	+						DNAH6_uc002sot.2_Intron	NM_001370	NP_001361			dynein, axonemal, heavy polypeptide 6						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	85187673	85187674	+	IGR	INS	-	AC	AC	rs142762101	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85187673_85187674insAC								TMSB10 (53874 upstream) : KCMF1 (10557 downstream)																																			---	---	---	---
TCF7L1	83439	broad.mit.edu	37	2	85529267	85529268	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85529267_85529268insA	uc002soy.2	+							NM_031283	NP_112573			HMG-box transcription factor TCF-3						chromatin organization|regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	86987886	86987886	+	Intron	DEL	A	-	-	rs71377100		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86987886delA	uc010ytm.1	+						RMND5A_uc002srs.3_Intron|RMND5A_uc002srr.2_Intron	NM_022780	NP_073617			required for meiotic nuclear division 5 homolog											ovary(1)|skin(1)	2																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87641749	87641750	+	Intron	INS	-	A	A	rs145264498		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87641749_87641750insA	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	89834578	89834582	+	IGR	DEL	TTTCT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89834578_89834582delTTTCT								FLJ40330 (728453 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91769863	91769864	+	IGR	INS	-	TT	TT	rs144120667		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91769863_91769864insTT								None (None upstream) : LOC654342 (35328 downstream)																																			---	---	---	---
LOC654342	654342	broad.mit.edu	37	2	91822551	91822552	+	Intron	INS	-	A	A	rs146298710	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91822551_91822552insA	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	95859028	95859028	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95859028delG								ZNF2 (8966 upstream) : PROM2 (81173 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	96400060	96400060	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96400060delA								TRIM43 (134593 upstream) : LOC729234 (276239 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	96828369	96828370	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96828369_96828370insT								DUSP2 (17190 upstream) : STARD7 (22235 downstream)																																			---	---	---	---
TMEM131	23505	broad.mit.edu	37	2	98538017	98538017	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98538017delA	uc002syh.3	-						TMEM131_uc010yvg.1_Intron	NM_015348	NP_056163			RW1 protein							integral to membrane				ovary(4)|central_nervous_system(2)	6																		---	---	---	---
VWA3B	200403	broad.mit.edu	37	2	98804128	98804131	+	Intron	DEL	TGTG	-	-	rs147275742		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98804128_98804131delTGTG	uc002syo.2	+						VWA3B_uc010yvh.1_Intron|VWA3B_uc002syj.2_Intron|VWA3B_uc002syk.1_Intron|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Intron|VWA3B_uc002syn.1_Intron|VWA3B_uc010yvi.1_Intron	NM_144992	NP_659429			von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6																		---	---	---	---
CNGA3	1261	broad.mit.edu	37	2	98981880	98981880	+	Intron	DEL	A	-	-	rs113579392		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98981880delA	uc002syt.2	+						CNGA3_uc002syu.2_Intron	NM_001298	NP_001289			cyclic nucleotide gated channel alpha 3 isoform						signal transduction|visual perception	integral to membrane	cGMP binding			ovary(5)|upper_aerodigestive_tract(1)	6																		---	---	---	---
C2orf55	343990	broad.mit.edu	37	2	99536366	99536366	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99536366delC	uc002szf.1	-							NM_207362	NP_997245			hypothetical protein LOC343990												0																		---	---	---	---
LYG2	254773	broad.mit.edu	37	2	99867580	99867581	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99867580_99867581insA	uc002szw.1	-						MRPL30_uc002szl.1_Intron|LYG2_uc010fip.1_Intron|LYG2_uc002szx.1_Intron	NM_175735	NP_783862			lysozyme G-like 2 precursor						cell wall macromolecule catabolic process|peptidoglycan catabolic process	extracellular region	lysozyme activity			ovary(1)	1																		---	---	---	---
AFF3	3899	broad.mit.edu	37	2	100666660	100666660	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100666660delG	uc002tag.2	-						AFF3_uc002taf.2_Intron|AFF3_uc010fiq.1_Intron|AFF3_uc010yvr.1_Intron|AFF3_uc002tah.1_Intron|AFF3_uc010fir.1_Intron	NM_002285	NP_002276			AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6																		---	---	---	---
AFF3	3899	broad.mit.edu	37	2	100745724	100745724	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100745724delA	uc002tag.2	-							NM_002285	NP_002276			AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6																		---	---	---	---
TBC1D8	11138	broad.mit.edu	37	2	101739394	101739399	+	Intron	DEL	AACATC	-	-	rs74392861		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101739394_101739399delAACATC	uc010fiv.2	-						TBC1D8_uc010yvw.1_Intron	NM_001102426	NP_001095896			TBC1 domain family, member 8						blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3																		---	---	---	---
RFX8	731220	broad.mit.edu	37	2	102076779	102076779	+	Intron	DEL	T	-	-	rs151296256		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102076779delT	uc010yvx.1	-						RFX8_uc002tbb.1_Intron	NM_001145664	NP_001139136			regulatory factor X, 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	102918557	102918559	+	IGR	DEL	CTC	-	-	rs145901225		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102918557_102918559delCTC								IL1RL2 (62747 upstream) : IL1RL1 (9403 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	103154483	103154484	+	IGR	INS	-	T	T	rs148392415	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103154483_103154484insT								SLC9A4 (4053 upstream) : SLC9A2 (81682 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105150650	105150650	+	IGR	DEL	G	-	-	rs111712002		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105150650delG								LOC150568 (21436 upstream) : POU3F3 (321319 downstream)																																			---	---	---	---
TGFBRAP1	9392	broad.mit.edu	37	2	105935535	105935536	+	Intron	INS	-	GA	GA	rs111410608		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105935535_105935536insGA	uc002tcq.2	-						TGFBRAP1_uc002tcr.3_Intron	NM_004257	NP_004248			transforming growth factor, beta receptor						regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
NCK2	8440	broad.mit.edu	37	2	106424141	106424142	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106424141_106424142insT	uc002tdg.2	+						NCK2_uc002tdh.2_Intron	NM_003581	NP_003572			NCK adaptor protein 2 isoform A						axon guidance|epidermal growth factor receptor signaling pathway|negative regulation of cell proliferation|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of epidermal growth factor receptor activity|regulation of translation|signal complex assembly|T cell activation	cytosol|endoplasmic reticulum	cytoskeletal adaptor activity|receptor signaling complex scaffold activity			ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	107417072	107417073	+	IGR	INS	-	TC	TC	rs144631268	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107417072_107417073insTC								RGPD3 (332271 upstream) : ST6GAL2 (985 downstream)																																			---	---	---	---
ST6GAL2	84620	broad.mit.edu	37	2	107448366	107448366	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107448366delC	uc002tdq.2	-						ST6GAL2_uc002tdr.2_Intron|ST6GAL2_uc002tds.3_Intron	NM_001142351	NP_001135823			ST6 beta-galactosamide						growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	107694594	107694594	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107694594delT								ST6GAL2 (191031 upstream) : LOC729121 (744926 downstream)																																			---	---	---	---
CCDC138	165055	broad.mit.edu	37	2	109447275	109447276	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109447275_109447276insA	uc002ten.1	+						CCDC138_uc002teo.1_Intron|CCDC138_uc002tep.1_Intron|CCDC138_uc010fjm.1_Intron	NM_144978	NP_659415			coiled-coil domain containing 138												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	109695609	109695611	+	IGR	DEL	CCT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109695609_109695611delCCT								EDAR (89781 upstream) : SH3RF3 (50386 downstream)																																			---	---	---	---
ACOXL	55289	broad.mit.edu	37	2	111622605	111622606	+	Intron	INS	-	GTTTT	GTTTT	rs147073924	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111622605_111622606insGTTTT	uc002tgr.3	+						ACOXL_uc010fkc.2_Intron|ACOXL_uc010yxk.1_Intron	NM_001105516	NP_001098986			acyl-Coenzyme A oxidase-like 2						fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	113779361	113779361	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113779361delT								IL1F6 (13742 upstream) : IL1F8 (307 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	114177951	114177951	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114177951delA								PAX8 (141453 upstream) : CBWD2 (17317 downstream)																																			---	---	---	---
DPP10	57628	broad.mit.edu	37	2	115423484	115423484	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115423484delT	uc002tla.1	+						DPP10_uc002tlb.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	117269394	117269395	+	IGR	INS	-	A	A	rs143574588		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:117269394_117269395insA								DPP10 (667458 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	119071702	119071703	+	IGR	INS	-	C	C	rs144935817	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119071702_119071703insC								INSIG2 (204106 upstream) : EN1 (528045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	121356642	121356644	+	IGR	DEL	CTT	-	-	rs142682537		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121356642_121356644delCTT								LOC84931 (132717 upstream) : GLI2 (136555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	121919135	121919136	+	IGR	INS	-	CG	CG	rs143676541	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121919135_121919136insCG								GLI2 (168907 upstream) : TFCP2L1 (55030 downstream)																																			---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125318725	125318726	+	Intron	INS	-	T	T	rs144123147	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125318725_125318726insT	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129			contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125401067	125401067	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125401067delA	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129			contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	125743654	125743654	+	IGR	DEL	A	-	-	rs138237750		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125743654delA								CNTNAP5 (70793 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126411735	126411736	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126411735_126411736insT								CNTNAP5 (738874 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	127394639	127394639	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127394639delA								None (None upstream) : GYPC (19045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129346471	129346472	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129346471_129346472delTG								HS6ST1 (270300 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129418171	129418171	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129418171delT								HS6ST1 (342000 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129585444	129585444	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129585444delA								HS6ST1 (509273 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129955322	129955322	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129955322delC								HS6ST1 (879151 upstream) : LOC389033 (725113 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	131506952	131506952	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131506952delT								GPR148 (19043 upstream) : FAM123C (6125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	132771039	132771040	+	IGR	INS	-	TG	TG			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132771039_132771040insTG								C2orf27B (211805 upstream) : NCRNA00164 (134124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	132775777	132775779	+	IGR	DEL	TAT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132775777_132775779delTAT								C2orf27B (216543 upstream) : NCRNA00164 (129385 downstream)																																			---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	132974712	132974712	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132974712delG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	132982902	132982902	+	Intron	DEL	A	-	-	rs76618316		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132982902delA	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	132986525	132986528	+	Intron	DEL	ATAG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132986525_132986528delATAG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	133016372	133016372	+	5'Flank	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133016372delC	uc002ttj.3	-						MIR663B_hsa-mir-663b|MI0006336_5'Flank	NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133088685	133088685	+	IGR	DEL	A	-	-	rs143832872		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133088685delA								NCRNA00164 (73143 upstream) : GPR39 (85462 downstream)																																			---	---	---	---
GPR39	2863	broad.mit.edu	37	2	133335640	133335641	+	Intron	INS	-	T	T	rs143316378		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133335640_133335641insT	uc002ttl.2	+							NM_001508	NP_001499			G protein-coupled receptor 39							integral to plasma membrane	G-protein coupled receptor activity|metal ion binding				0																		---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	134003830	134003831	+	Intron	INS	-	A	A	rs112684321		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134003830_134003831insA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	134360800	134360800	+	IGR	DEL	T	-	-	rs66982015		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134360800delT								NCKAP5 (34769 upstream) : MGAT5 (651030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	134762199	134762199	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134762199delT								NCKAP5 (436168 upstream) : MGAT5 (249631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	136888831	136888838	+	IGR	DEL	TGTGTGTG	-	-	rs56319041		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136888831_136888838delTGTGTGTG								CXCR4 (13106 upstream) : THSD7B (634277 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	137322190	137322191	+	IGR	INS	-	T	T	rs150874444	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137322190_137322191insT								CXCR4 (446465 upstream) : THSD7B (200924 downstream)																																			---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	137893420	137893420	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137893420delA	uc002tva.1	+						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	138485554	138485554	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138485554delT								THSD7B (50267 upstream) : HNMT (236036 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	140023374	140023374	+	IGR	DEL	T	-	-	rs72157371		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140023374delT								NXPH2 (485563 upstream) : LRP1B (965622 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	140705775	140705778	+	IGR	DEL	AGAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140705775_140705778delAGAA								None (None upstream) : LRP1B (283218 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	143436244	143436245	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143436244_143436245delGT								LRP1B (546974 upstream) : KYNU (198950 downstream)																																			---	---	---	---
KYNU	8942	broad.mit.edu	37	2	143695223	143695223	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143695223delG	uc002tvl.2	+						KYNU_uc002tvk.2_Intron|KYNU_uc010fnm.2_Intron	NM_003937	NP_003928			kynureninase (L-kynurenine hydrolase) isoform a						anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity			skin(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.072)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)													---	---	---	---
ARHGAP15	55843	broad.mit.edu	37	2	144392627	144392628	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144392627_144392628delAC	uc002tvm.3	+						ARHGAP15_uc002tvn.2_Intron	NM_018460	NP_060930			ARHGAP15						regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)														---	---	---	---
ZEB2	9839	broad.mit.edu	37	2	145278576	145278576	+	5'Flank	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145278576delT	uc002tvu.2	-						ZEB2_uc002tvv.2_5'Flank|ZEB2_uc010zbm.1_5'Flank|ZEB2_uc010fnp.2_5'Flank|ZEB2_uc002tvw.2_5'Flank|ZEB2_uc002tvz.2_5'Flank|ZEB2_uc002twa.2_5'Flank	NM_014795	NP_055610			zinc finger homeobox 1b							cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	147778667	147778668	+	IGR	INS	-	A	A	rs145262716	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147778667_147778668insA								PABPC1P2 (430110 upstream) : ACVR2A (823418 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	148203199	148203200	+	IGR	INS	-	T	T	rs140876313		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148203199_148203200insT								PABPC1P2 (854642 upstream) : ACVR2A (398886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	148235980	148235981	+	IGR	INS	-	TTG	TTG	rs138465699	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148235980_148235981insTTG								PABPC1P2 (887423 upstream) : ACVR2A (366105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	148588356	148588356	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148588356delT								None (None upstream) : ACVR2A (13730 downstream)																																			---	---	---	---
ORC4L	5000	broad.mit.edu	37	2	148769655	148769655	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148769655delA	uc002twi.2	-						ORC4L_uc002twj.2_Intron|ORC4L_uc010zbo.1_Intron|ORC4L_uc010zbp.1_Intron|ORC4L_uc010fnr.2_Intron|ORC4L_uc010zbq.1_Intron|ORC4L_uc002twk.2_Intron|ORC4L_uc010zbr.1_Intron	NM_181741	NP_859525			origin recognition complex subunit 4						cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|nucleoside-triphosphatase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.0963)|COAD - Colon adenocarcinoma(177;0.203)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	150527230	150527231	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150527230_150527231delAC								MMADHC (82900 upstream) : RND3 (797481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	150700261	150700261	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150700261delG								MMADHC (255931 upstream) : RND3 (624451 downstream)																																			---	---	---	---
CACNB4	785	broad.mit.edu	37	2	152759874	152759874	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152759874delA	uc002tya.2	-						CACNB4_uc002txy.2_Intron|CACNB4_uc002txz.2_Intron|CACNB4_uc010fnz.2_Intron|CACNB4_uc002tyb.2_Intron	NM_000726	NP_000717			calcium channel, voltage-dependent, beta 4						axon guidance|membrane depolarization|synaptic transmission	cytosol|internal side of plasma membrane|plasma membrane|synapse|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.156)	Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	154167868	154167868	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154167868delA								ARL6IP6 (550101 upstream) : RPRM (165984 downstream)																																			---	---	---	---
GALNT13	114805	broad.mit.edu	37	2	154976596	154976597	+	Intron	INS	-	T	T	rs140047576	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154976596_154976597insT	uc002tyr.3	+						GALNT13_uc002tyt.3_Intron	NM_052917	NP_443149			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	156435260	156435261	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156435260_156435261delCA								KCNJ3 (722246 upstream) : NR4A2 (745685 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	156716086	156716086	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156716086delG								None (None upstream) : NR4A2 (464860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	157260124	157260125	+	IGR	INS	-	GT	GT	rs144742175	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157260124_157260125insGT								NR4A2 (70837 upstream) : GPD2 (31840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	158993207	158993208	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158993207_158993208insT								UPP2 (542 upstream) : CCDC148 (35271 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	161492863	161492863	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161492863delC								RBMS1 (142545 upstream) : TANK (500603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	162957991	162957992	+	IGR	INS	-	TGTG	TGTG	rs139339150	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162957991_162957992insTGTG								DPP4 (26939 upstream) : GCG (41397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	163025597	163025598	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163025597_163025598insA								GCG (16840 upstream) : FAP (1603 downstream)																																			---	---	---	---
COBLL1	22837	broad.mit.edu	37	2	165594366	165594383	+	Intron	DEL	AACCGCGGGCTTAGGCTC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165594366_165594383delAACCGCGGGCTTAGGCTC	uc010zcw.1	-						COBLL1_uc002ucp.2_Intron|COBLL1_uc002ucq.2_Intron|COBLL1_uc010zcx.1_Intron|COBLL1_uc002ucs.1_Intron	NM_014900	NP_055715			COBL-like 1											ovary(2)|pancreas(1)	3																OREG0015041	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TTC21B	79809	broad.mit.edu	37	2	166792607	166792609	+	Intron	DEL	GTG	-	-	rs76654642		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166792607_166792609delGTG	uc002udk.2	-						TTC21B_uc002udl.2_Intron|uc002udm.1_Intron	NM_024753	NP_079029			tetratricopeptide repeat domain 21B							cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	168562944	168562944	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168562944delG								XIRP2 (446685 upstream) : B3GALT1 (112238 downstream)																																			---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170185986	170185986	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170185986delC	uc002ues.2	-						LRP2_uc010zdf.1_Intron	NM_004525	NP_004516			low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170193047	170193048	+	Intron	DEL	CA	-	-	rs71844521		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170193047_170193048delCA	uc002ues.2	-						LRP2_uc010zdf.1_Intron	NM_004525	NP_004516			low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
FASTKD1	79675	broad.mit.edu	37	2	170398393	170398393	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170398393delA	uc002uev.3	-						FASTKD1_uc002uew.3_Intron|FASTKD1_uc002uex.3_Intron	NM_024622	NP_078898			FAST kinase domains 1						apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	171739375	171739379	+	IGR	DEL	GGGAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171739375_171739379delGGGAA								GAD1 (21718 upstream) : GORASP2 (45603 downstream)																																			---	---	---	---
TLK1	9874	broad.mit.edu	37	2	171877779	171877779	+	Intron	DEL	C	-	-	rs5836318		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171877779delC	uc002ugn.2	-						TLK1_uc002ugo.2_Intron|TLK1_uc002ugp.2_Intron|TLK1_uc002ugq.2_Intron|TLK1_uc010zdn.1_Intron	NM_012290	NP_036422			tousled-like kinase 1 isoform 1						cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1																		---	---	---	---
SLC25A12	8604	broad.mit.edu	37	2	172683813	172683813	+	Intron	DEL	T	-	-	rs34833030		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172683813delT	uc002uhh.2	-						SLC25A12_uc010fqh.2_Intron	NM_003705	NP_003696			solute carrier family 25, member 12						gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)													---	---	---	---
PDK1	5163	broad.mit.edu	37	2	173431286	173431286	+	Intron	DEL	A	-	-	rs74725860		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173431286delA	uc002uhr.2	+						PDK1_uc010zdz.1_Intron|PDK1_uc010zea.1_Intron|PDK1_uc002uhq.1_Intron|PDK1_uc002uhs.2_Intron|PDK1_uc010zeb.1_Intron	NM_002610	NP_002601			pyruvate dehydrogenase kinase 1 precursor						glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|small GTPase mediated signal transduction	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			lung(3)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.12)											Autosomal_Dominant_Polycystic_Kidney_Disease				---	---	---	---
Unknown	0	broad.mit.edu	37	2	174212641	174212641	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174212641delG								ZAK (79905 upstream) : CDCA7 (6920 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	174293671	174293672	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174293671_174293672insT								CDCA7 (59953 upstream) : SP3 (479587 downstream)																																			---	---	---	---
CIR1	9541	broad.mit.edu	37	2	175221331	175221332	+	Intron	INS	-	AGGA	AGGA	rs139033539	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175221331_175221332insAGGA	uc002uim.2	-						CIR1_uc002uin.2_Intron|CIR1_uc002uio.2_Intron|CIR1_uc002uip.2_Intron	NM_004882	NP_004873			CBF1 interacting corepressor						mRNA processing|negative regulation of transcription, DNA-dependent|RNA splicing	nuclear speck	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			large_intestine(1)	1																		---	---	---	---
GPR155	151556	broad.mit.edu	37	2	175318784	175318784	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175318784delC	uc002uit.2	-						GPR155_uc002uiu.2_Intron|GPR155_uc002uiv.2_Intron|GPR155_uc010fqs.2_Intron	NM_001033045	NP_001028217			G protein-coupled receptor 155 isoform 9						intracellular signal transduction|transmembrane transport	integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	176157827	176157827	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176157827delC								ATP5G3 (111337 upstream) : KIAA1715 (632583 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	176998676	176998677	+	5'Flank	INS	-	AA	AA	rs148866828	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176998676_176998677insAA	uc002ukr.2	+											Homo sapiens hypothetical gene supported by BC047605, mRNA (cDNA clone IMAGE:5589309).																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	177881640	177881641	+	IGR	INS	-	TT	TT	rs34401851		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177881640_177881641insTT								MIR1246 (415860 upstream) : HNRNPA3 (195781 downstream)																																			---	---	---	---
TTN	7273	broad.mit.edu	37	2	179508943	179508943	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179508943delT	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc010fre.1_Intron|TTN_uc002umw.1_Intron|TTN_uc002umx.1_Intron	NM_133378	NP_596869			titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
CCDC141	285025	broad.mit.edu	37	2	179825839	179825839	+	Intron	DEL	G	-	-	rs78770428		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179825839delG	uc002ung.2	-											SubName: Full=Putative uncharacterized protein CCDC141; SubName: Full=Putative uncharacterized protein FLJ39502;								protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	180251214	180251214	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180251214delG								SESTD1 (121864 upstream) : ZNF385B (55506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	184052524	184052524	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184052524delT								NUP35 (26117 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	184751702	184751702	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184751702delA								NUP35 (725295 upstream) : ZNF804A (711391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	185887288	185887289	+	IGR	INS	-	T	T	rs137938551	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185887288_185887289insT								ZNF804A (83076 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	188764969	188764969	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188764969delA								TFPI (345750 upstream) : GULP1 (391635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	193184390	193184390	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193184390delT								TMEFF2 (124746 upstream) : PCGEM1 (430181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	193319504	193319505	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193319504_193319505delCA								TMEFF2 (259860 upstream) : PCGEM1 (295066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	193380611	193380612	+	IGR	INS	-	G	G	rs35486946		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193380611_193380612insG								TMEFF2 (320967 upstream) : PCGEM1 (233959 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	193741383	193741383	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193741383delA								PCGEM1 (99762 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	195367182	195367182	+	IGR	DEL	C	-	-	rs79752047		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195367182delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	195546972	195546972	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195546972delA								None (None upstream) : SLC39A10 (974560 downstream)																																			---	---	---	---
SATB2	23314	broad.mit.edu	37	2	200330521	200330521	+	5'Flank	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200330521delC	uc002uva.1	-						FLJ32063_uc002uvd.1_5'Flank	NM_015265	NP_056080			SATB homeobox 2							cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	200489745	200489746	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200489745_200489746delAC	uc002uvf.2	+											Homo sapiens cDNA clone IMAGE:5199350, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	200743670	200743670	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200743670delA								FLJ32063 (402012 upstream) : C2orf69 (32309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	200916266	200916266	+	IGR	DEL	T	-	-	rs66503954		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200916266delT								C2orf47 (87421 upstream) : SPATS2L (254338 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	201963959	201963959	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201963959delT								NDUFB3 (13488 upstream) : CFLAR (16857 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	203442260	203442261	+	IGR	DEL	CT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203442260_203442261delCT								BMPR2 (9787 upstream) : FAM117B (57640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	203855299	203855299	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203855299delT								ALS2CR8 (4239 upstream) : NBEAL1 (24303 downstream)																																			---	---	---	---
CYP20A1	57404	broad.mit.edu	37	2	204120889	204120891	+	Intron	DEL	ATT	-	-	rs57568057		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204120889_204120891delATT	uc002uzv.3	+						CYP20A1_uc002uzx.3_Intron|CYP20A1_uc010zif.1_Intron|CYP20A1_uc002uzy.3_Intron|CYP20A1_uc002uzw.3_Intron	NM_177538	NP_803882			cytochrome P450, family 20, subfamily A,							integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	204774189	204774192	+	IGR	DEL	ACAC	-	-	rs34827694		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204774189_204774192delACAC								CTLA4 (35506 upstream) : ICOS (27279 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	205012572	205012573	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205012572_205012573delTG								ICOS (186276 upstream) : PARD3B (397943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	206510571	206510578	+	IGR	DEL	GGAGGGAG	-	-	rs138618708		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206510571_206510578delGGAGGGAG								PARD3B (30034 upstream) : NRP2 (36646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	206527373	206527374	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206527373_206527374delTC								PARD3B (46836 upstream) : NRP2 (19850 downstream)																																			---	---	---	---
MAP2	4133	broad.mit.edu	37	2	210498380	210498380	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210498380delT	uc002vde.1	+						MAP2_uc002vdc.1_Intron|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron	NM_002374	NP_002365			microtubule-associated protein 2 isoform 1						central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	213617294	213617294	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213617294delT								ERBB4 (213942 upstream) : IKZF2 (247119 downstream)																																			---	---	---	---
IKZF2	22807	broad.mit.edu	37	2	213896718	213896718	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213896718delT	uc002vem.2	-						IKZF2_uc010fuu.2_Intron|IKZF2_uc002vej.2_Intron|IKZF2_uc002vek.2_Intron|IKZF2_uc010fuv.2_Intron|IKZF2_uc002vel.2_Intron|IKZF2_uc010fuw.2_Intron|IKZF2_uc010fux.2_Intron|IKZF2_uc010fuy.2_Intron|IKZF2_uc002ven.2_Intron	NM_016260	NP_057344			helios isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)														---	---	---	---
SPAG16	79582	broad.mit.edu	37	2	214281270	214281270	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214281270delG	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808			sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)														---	---	---	---
VWC2L	402117	broad.mit.edu	37	2	215375200	215375200	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215375200delA	uc002vet.2	+						VWC2L_uc010zjl.1_Intron	NM_001080500	NP_001073969			von Willebrand factor C domain-containing							extracellular region					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	216553069	216553070	+	Intron	DEL	TC	-	-	rs34756732		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216553069_216553070delTC	uc002vfm.1	-						uc002vfn.1_Intron					Homo sapiens cDNA FLJ34546 fis, clone HLUNG2008959.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	217714753	217714753	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217714753delT								IGFBP5 (154481 upstream) : TNP1 (9431 downstream)																																			---	---	---	---
DIRC3	729582	broad.mit.edu	37	2	218460405	218460405	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218460405delA	uc002vgn.1	-						DIRC3_uc002vgo.2_Intron					Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0																		---	---	---	---
TNS1	7145	broad.mit.edu	37	2	218703791	218703792	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218703791_218703792delAC	uc002vgt.2	-						TNS1_uc002vgr.2_Intron|TNS1_uc002vgs.2_Intron|TNS1_uc010zjv.1_Intron	NM_022648	NP_072174			tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	219273336	219273337	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219273336_219273337delAC								CTDSP1 (2673 upstream) : VIL1 (10501 downstream)																																			---	---	---	---
PLCD4	84812	broad.mit.edu	37	2	219475448	219475448	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219475448delT	uc002vij.1	+						PLCD4_uc010zkj.1_Intron	NM_032726	NP_116115			phospholipase C, delta 4						intracellular signal transduction|lipid catabolic process	endoplasmic reticulum|membrane|nucleus	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)	3		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)														---	---	---	---
DNPEP	23549	broad.mit.edu	37	2	220234330	220234331	+	Intron	INS	-	ACAC	ACAC	rs141721992	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220234330_220234331insACAC	uc010zlf.1	-							NM_012100				aspartyl aminopeptidase						peptide metabolic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	221118766	221118766	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221118766delC								SLC4A3 (612065 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	222035264	222035265	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222035264_222035265delTC								None (None upstream) : EPHA4 (247484 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	223170248	223170249	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223170248_223170249delAC								CCDC140 (312 upstream) : SGPP2 (119073 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	224595133	224595133	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224595133delG								SCG2 (128012 upstream) : AP1S3 (24915 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	225176625	225176625	+	IGR	DEL	A	-	-	rs35949987		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225176625delA								SERPINE2 (272589 upstream) : FAM124B (66791 downstream)																																			---	---	---	---
CUL3	8452	broad.mit.edu	37	2	225414580	225414581	+	Intron	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225414580_225414581delCA	uc002vny.2	-						CUL3_uc010zls.1_Intron|CUL3_uc010fwy.1_Intron	NM_003590	NP_003581			cullin 3						cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)														---	---	---	---
DOCK10	55619	broad.mit.edu	37	2	225755146	225755147	+	Intron	INS	-	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225755146_225755147insG	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002vod.1_Intron	NM_014689	NP_055504			dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	226669114	226669114	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226669114delA								KIAA1486 (73643 upstream) : IRS1 (926920 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	227690635	227690636	+	IGR	DEL	AC	-	-	rs34613031		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227690635_227690636delAC								IRS1 (27129 upstream) : RHBDD1 (10137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	227695136	227695136	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227695136delT								IRS1 (31630 upstream) : RHBDD1 (5637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	228532939	228532939	+	IGR	DEL	T	-	-	rs113328999		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228532939delT								C2orf83 (34903 upstream) : SLC19A3 (16988 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	229699850	229699851	+	IGR	DEL	TG	-	-	rs68010474		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229699850_229699851delTG								SPHKAP (653489 upstream) : PID1 (188839 downstream)																																			---	---	---	---
PID1	55022	broad.mit.edu	37	2	230078992	230078995	+	Intron	DEL	CTTA	-	-	rs144573913		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230078992_230078995delCTTA	uc002vpr.3	-						PID1_uc002vps.3_Intron|PID1_uc002vpt.3_Intron|PID1_uc002vpu.3_Intron	NM_001100818	NP_001094288			phosphotyrosine interaction domain containing 1							cytoplasm				breast(3)|skin(1)	4		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)														---	---	---	---
DNER	92737	broad.mit.edu	37	2	230407872	230407872	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230407872delA	uc002vpv.2	-						DNER_uc010zly.1_Intron	NM_139072	NP_620711			delta-notch-like EGF repeat-containing						central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			lung(5)|ovary(2)|skin(1)	8		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)														---	---	---	---
TRIP12	9320	broad.mit.edu	37	2	230688391	230688391	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230688391delA	uc002vpw.1	-						TRIP12_uc002vpx.1_Intron|TRIP12_uc002vpy.1_Intron|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Intron	NM_004238	NP_004229			thyroid hormone receptor interactor 12						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)														---	---	---	---
FBXO36	130888	broad.mit.edu	37	2	230936129	230936129	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230936129delA	uc010fxi.1	+						SLC16A14_uc002vqd.1_5'Flank|SLC16A14_uc002vqe.2_5'Flank|SLC16A14_uc002vqf.2_5'Flank	NM_174899	NP_777559			F-box protein 36											ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0179)|Lung NSC(271;0.0804)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;7.56e-14)|all cancers(144;7.74e-11)|Lung(119;0.00488)|LUSC - Lung squamous cell carcinoma(224;0.008)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	231008565	231008565	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231008565delT								FBXO36 (60549 upstream) : SP110 (25080 downstream)																																			---	---	---	---
ITM2C	81618	broad.mit.edu	37	2	231743659	231743659	+	3'UTR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231743659delT	uc002vqz.2	+	6					ITM2C_uc002vra.2_3'UTR|ITM2C_uc002vrb.2_3'UTR|ITM2C_uc002vrc.2_3'UTR|ITM2C_uc002vrd.2_3'UTR	NM_030926	NP_112188			integral membrane protein 2C isoform 1						negative regulation of neuron projection development|neuron differentiation	Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	beta-amyloid binding				0		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;8.47e-12)|all cancers(144;3.44e-09)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)														---	---	---	---
GIGYF2	26058	broad.mit.edu	37	2	233702997	233702998	+	Intron	DEL	TA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233702997_233702998delTA	uc002vti.3	+						GIGYF2_uc002vtj.3_Intron|GIGYF2_uc002vtk.3_Intron|GIGYF2_uc002vth.3_Intron|GIGYF2_uc010zmk.1_Intron|GIGYF2_uc010zml.1_Intron|GIGYF2_uc002vtq.3_Intron	NM_015575	NP_056390			GRB10 interacting GYF protein 2 isoform b						cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)														---	---	---	---
NGEF	25791	broad.mit.edu	37	2	233875285	233875286	+	Intron	INS	-	T	T	rs5839464		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233875285_233875286insT	uc002vts.2	-							NM_019850	NP_062824			neuronal guanine nucleotide exchange factor						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|growth cone|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)|skin(1)	7		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)														---	---	---	---
DGKD	8527	broad.mit.edu	37	2	234294805	234294806	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234294805_234294806insT	uc002vui.1	+						DGKD_uc002vuj.1_5'Flank	NM_152879	NP_690618			diacylglycerol kinase, delta 130kDa isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	235992313	235992313	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235992313delC								SH3BP4 (27957 upstream) : AGAP1 (410423 downstream)																																			---	---	---	---
CXCR7	57007	broad.mit.edu	37	2	237478329	237478330	+	Intron	INS	-	GT	GT	rs35103670		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237478329_237478330insGT	uc010fyq.2	+						CXCR7_uc002vwd.2_5'Flank|CXCR7_uc002vwe.1_5'Flank	NM_020311	NP_064707			chemokine orphan receptor 1						interspecies interaction between organisms	integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			large_intestine(1)|central_nervous_system(1)|skin(1)	3		Breast(86;0.000182)|Renal(207;0.00339)|all_hematologic(139;0.0048)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|all_lung(227;0.147)|all_neural(83;0.223)		Epithelial(121;8.35e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.09e-11)|Kidney(56;1.11e-07)|KIRC - Kidney renal clear cell carcinoma(57;3.03e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000176)|Lung(119;0.00468)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.118)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	237508161	237508161	+	IGR	DEL	G	-	-	rs71930775		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237508161delG								CXCR7 (17169 upstream) : COPS8 (485923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237617111	237617112	+	IGR	DEL	CA	-	-	rs111251911		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237617111_237617112delCA								CXCR7 (126119 upstream) : COPS8 (376972 downstream)																																			---	---	---	---
SCLY	51540	broad.mit.edu	37	2	238895890	238895891	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238895890_238895891delGT	uc002vxm.3	+						UBE2F_uc010znn.1_Intron|UBE2F_uc002vxk.2_Intron|UBE2F_uc002vxl.2_Intron|UBE2F_uc010zno.1_Intron|UBE2F_uc010znp.1_Intron	NM_016510	NP_057594			selenocysteine lyase						cellular amino acid metabolic process	cytosol	pyridoxal phosphate binding|selenocysteine lyase activity|transferase activity			ovary(2)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	239542524	239542527	+	IGR	DEL	GCCT	-	-	rs72210726		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239542524_239542527delGCCT								ASB1 (181634 upstream) : TWIST2 (214146 downstream)																																			---	---	---	---
TWIST2	117581	broad.mit.edu	37	2	239760215	239760215	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239760215delT	uc010znx.1	+						TWIST2_uc010zny.1_Intron	NM_057179	NP_476527			twist homolog 2						negative regulation of osteoblast differentiation	cytoplasm	DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	239837943	239837947	+	IGR	DEL	AAAAC	-	-	rs71730794		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239837943_239837947delAAAAC								TWIST2 (5706 upstream) : HDAC4 (131918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	240577560	240577561	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240577560_240577561insT								HDAC4 (254214 upstream) : NDUFA10 (322597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	240861510	240861517	+	IGR	DEL	CCTTCCTC	-	-	rs111526478		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240861510_240861517delCCTTCCTC								HDAC4 (538164 upstream) : NDUFA10 (38641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	241128715	241128715	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241128715delT								OTOS (48642 upstream) : GPC1 (246400 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	241579571	241579574	+	IGR	DEL	TCCC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241579571_241579574delTCCC								GPR35 (8896 upstream) : AQP12B (36262 downstream)																																			---	---	---	---
AGXT	189	broad.mit.edu	37	2	241811618	241811620	+	Intron	DEL	GGC	-	-	rs4991359	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241811618_241811620delGGC	uc002waa.3	+						AGXT_uc010zoi.1_Intron	NM_000030	NP_000021			alanine-glyoxylate aminotransferase						glyoxylate metabolic process|protein targeting to peroxisome	mitochondrial matrix|peroxisomal matrix	alanine-glyoxylate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|serine-pyruvate transaminase activity				0		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)													---	---	---	---
ANO7	50636	broad.mit.edu	37	2	242126057	242126058	+	5'Flank	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242126057_242126058insA	uc002wax.2	+						ANO7_uc002waw.2_5'Flank	NM_001001891	NP_001001891			transmembrane protein 16G isoform NGEP long							cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3																		---	---	---	---
FARP2	9855	broad.mit.edu	37	2	242378853	242378853	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242378853delT	uc002wbi.1	+						FARP2_uc010zoq.1_Intron|FARP2_uc010zor.1_Intron|uc002wbj.2_5'Flank	NM_014808	NP_055623			FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	627167	627168	+	Intron	DEL	TT	-	-	rs34644935		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:627167_627168delTT	uc003boy.1	+											Homo sapiens cDNA FLJ44328 fis, clone TRACH3002871.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	983404	983405	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:983404_983405delAC								CHL1 (532309 upstream) : CNTN6 (151215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	1030200	1030200	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1030200delT								CHL1 (579105 upstream) : CNTN6 (104420 downstream)																																			---	---	---	---
CNTN6	27255	broad.mit.edu	37	3	1425325	1425330	+	Intron	DEL	AAAAAC	-	-	rs112591989		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1425325_1425330delAAAAAC	uc003boz.2	+						CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276			contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	1618347	1618348	+	IGR	INS	-	A	A	rs139546576	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1618347_1618348insA								CNTN6 (173070 upstream) : CNTN4 (522202 downstream)																																			---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	2309898	2309898	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2309898delG	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	3282638	3282638	+	IGR	DEL	G	-	-	rs10713562		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3282638delG								CRBN (61248 upstream) : SUMF1 (540398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	5569832	5569833	+	IGR	INS	-	TT	TT	rs145022800	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5569832_5569833insTT								EDEM1 (308183 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	8021784	8021784	+	Intron	DEL	A	-	-	rs35371896		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8021784delA	uc003bqo.1	-											Homo sapiens cDNA FLJ42867 fis, clone BRHIP2021289.																														---	---	---	---
SRGAP3	9901	broad.mit.edu	37	3	9072635	9072635	+	Intron	DEL	T	-	-	rs35661722		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9072635delT	uc003brf.1	-						SRGAP3_uc003brg.1_Intron|SRGAP3_uc003bri.1_Intron	NM_014850	NP_055665			SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)				T	RAF1	pilocytic astrocytoma								---	---	---	---
SRGAP3	9901	broad.mit.edu	37	3	9171452	9171452	+	Intron	DEL	T	-	-	rs112562712		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9171452delT	uc003brf.1	-						SRGAP3_uc003brg.1_Intron|SRGAP3_uc003bri.1_Intron|SRGAP3_uc003brk.2_Intron	NM_014850	NP_055665			SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)				T	RAF1	pilocytic astrocytoma								---	---	---	---
CPNE9	151835	broad.mit.edu	37	3	9750377	9750379	+	Intron	DEL	GGA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9750377_9750379delGGA	uc003bsd.2	+							NM_153635	NP_705899			copine-like protein											ovary(2)	2	Medulloblastoma(99;0.227)																	---	---	---	---
SLC6A11	6538	broad.mit.edu	37	3	10920089	10920090	+	Intron	INS	-	T	T	rs34982364		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10920089_10920090insT	uc003bvz.2	+							NM_014229	NP_055044			solute carrier family 6 (neurotransmitter						neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.229)														---	---	---	---
VGLL4	9686	broad.mit.edu	37	3	11744990	11744990	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11744990delC	uc003bwf.2	-						VGLL4_uc003bwg.2_Intron	NM_014667	NP_055482			vestigial like 4 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)														---	---	---	---
SYN2	6854	broad.mit.edu	37	3	12047260	12047260	+	Intron	DEL	T	-	-	rs34905752		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12047260delT	uc003bwm.2	+						SYN2_uc003bwl.1_Intron	NM_133625	NP_598328			synapsin II isoform IIa						neurotransmitter secretion	synaptic vesicle	ATP binding|ligase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	14346605	14346606	+	IGR	INS	-	T	T	rs9813759	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14346605_14346606insT								LSM3 (106769 upstream) : SLC6A6 (97500 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	14371321	14371322	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14371321_14371322insT								LSM3 (131485 upstream) : SLC6A6 (72784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	14403596	14403596	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14403596delT								LSM3 (163760 upstream) : SLC6A6 (40510 downstream)																																			---	---	---	---
C3orf20	84077	broad.mit.edu	37	3	14721155	14721155	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14721155delA	uc003byy.2	+						C3orf20_uc003byz.2_Intron|C3orf20_uc003bza.2_Intron|C3orf20_uc003byx.1_Intron	NM_032137	NP_115513			hypothetical protein LOC84077							cytoplasm|integral to membrane				ovary(3)|skin(1)	4																		---	---	---	---
FGD5	152273	broad.mit.edu	37	3	14946854	14946855	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14946854_14946855delTG	uc003bzc.2	+						FGD5_uc011avk.1_Intron|FGD5_uc003bzd.2_Intron	NM_152536	NP_689749			FYVE, RhoGEF and PH domain containing 5						actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5																		---	---	---	---
GALNTL2	117248	broad.mit.edu	37	3	16189971	16189971	+	Intron	DEL	T	-	-	rs35924120		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16189971delT	uc003caq.3	+							NM_054110	NP_473451			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1																		---	---	---	---
RFTN1	23180	broad.mit.edu	37	3	16556936	16556936	+	5'Flank	DEL	T	-	-	rs145153487		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16556936delT	uc003cay.2	-							NM_015150	NP_055965			raft-linking protein							plasma membrane				ovary(3)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	17991470	17991470	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17991470delT								TBC1D5 (207230 upstream) : SATB1 (397796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	18917852	18917853	+	IGR	DEL	TG	-	-	rs149824003		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18917852_18917853delTG								SATB1 (437600 upstream) : KCNH8 (272164 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	20637268	20637268	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20637268delT								SGOL1 (409585 upstream) : VENTXP7 (809950 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	22598742	22598742	+	IGR	DEL	C	-	-	rs11339516		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22598742delC								ZNF385D (184619 upstream) : UBE2E2 (645911 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	22675716	22675717	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22675716_22675717insA								ZNF385D (261593 upstream) : UBE2E2 (568936 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	22960074	22960074	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22960074delA								ZNF385D (545951 upstream) : UBE2E2 (284579 downstream)																																			---	---	---	---
UBE2E2	7325	broad.mit.edu	37	3	23362816	23362816	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23362816delG	uc003ccg.2	+						UBE2E2_uc010hfc.2_Intron	NM_152653	NP_689866			ubiquitin-conjugating enzyme E2E 2						ISG15-protein conjugation|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination	nucleolus	ATP binding|ISG15 ligase activity|ubiquitin-protein ligase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	24634837	24634838	+	IGR	INS	-	T	T	rs141705534	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24634837_24634838insT								THRB (98384 upstream) : RARB (580985 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	28110216	28110217	+	IGR	INS	-	AA	AA	rs141131089	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28110216_28110217insAA								EOMES (346010 upstream) : CMC1 (172907 downstream)																																			---	---	---	---
RBMS3	27303	broad.mit.edu	37	3	29829659	29829659	+	Intron	DEL	T	-	-	rs112536774		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29829659delT	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793			RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)																---	---	---	---
RBMS3	27303	broad.mit.edu	37	3	30013677	30013677	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30013677delT	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793			RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)																---	---	---	---
OSBPL10	114884	broad.mit.edu	37	3	31806700	31806701	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31806700_31806701insT	uc003cev.2	-						OSBPL10_uc003ceu.1_Intron|OSBPL10_uc011axf.1_Intron	NM_017784	NP_060254			oxysterol-binding protein-like protein 10						lipid transport		lipid binding			skin(1)	1				STAD - Stomach adenocarcinoma(1;0.00406)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	32219116	32219116	+	IGR	DEL	C	-	-	rs35060509		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32219116delC								GPD1L (8920 upstream) : CMTM8 (61055 downstream)																																	OREG0015456	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	3	32823595	32823597	+	IGR	DEL	TTG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32823595_32823597delTTG								CNOT10 (8241 upstream) : TRIM71 (35913 downstream)																																			---	---	---	---
STAC	6769	broad.mit.edu	37	3	36468359	36468360	+	Intron	INS	-	ACA	ACA	rs139479517	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36468359_36468360insACA	uc003cgh.1	+						STAC_uc010hgd.1_Intron|STAC_uc011aya.1_Intron	NM_003149	NP_003140			SH3 and cysteine rich domain						intracellular signal transduction	cytoplasm|soluble fraction	metal ion binding			skin(2)|ovary(1)|pancreas(1)	4																		---	---	---	---
STAC	6769	broad.mit.edu	37	3	36518415	36518416	+	Intron	INS	-	C	C	rs141038290	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36518415_36518416insC	uc003cgh.1	+						STAC_uc010hgd.1_Intron|STAC_uc011aya.1_Intron	NM_003149	NP_003140			SH3 and cysteine rich domain						intracellular signal transduction	cytoplasm|soluble fraction	metal ion binding			skin(2)|ovary(1)|pancreas(1)	4																		---	---	---	---
C3orf35	339883	broad.mit.edu	37	3	37450501	37450502	+	Intron	INS	-	T	T	rs57699480		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37450501_37450502insT	uc003cha.3	+						C3orf35_uc003cgy.1_Intron|C3orf35_uc003cgz.1_Intron|C3orf35_uc003chb.2_Intron	NM_178339	NP_848029			AP20 region protein isoform B							integral to membrane				central_nervous_system(1)	1																		---	---	---	---
SLC22A14	9389	broad.mit.edu	37	3	38343239	38343239	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38343239delT	uc010hhc.1	+							NM_004803	NP_004794			organic cation transporter like 4							integral to plasma membrane	organic cation transmembrane transporter activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	38856282	38856282	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38856282delT								SCN10A (20781 upstream) : SCN11A (30978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	39636387	39636388	+	IGR	INS	-	C	C	rs138412920	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39636387_39636388insC								MOBP (68532 upstream) : MYRIP (214915 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	40358458	40358458	+	IGR	DEL	A	-	-	rs113545738		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40358458delA								EIF1B (4545 upstream) : ENTPD3 (70215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	40868410	40868411	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40868410_40868411delAC								ZNF621 (287367 upstream) : CTNNB1 (367990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	40899320	40899321	+	IGR	DEL	AT	-	-	rs142641436		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40899320_40899321delAT								ZNF621 (318277 upstream) : CTNNB1 (337080 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	41212785	41212786	+	IGR	INS	-	T	T	rs149346206	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41212785_41212786insT								ZNF621 (631742 upstream) : CTNNB1 (23615 downstream)																																			---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41567132	41567132	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41567132delA	uc003ckv.3	-							NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	43857206	43857207	+	IGR	INS	-	A	A	rs111511163		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43857206_43857207insA								ABHD5 (92990 upstream) : MIR138-1 (298497 downstream)																																			---	---	---	---
KIF15	56992	broad.mit.edu	37	3	44849187	44849188	+	Intron	INS	-	GT	GT	rs143004356	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44849187_44849188insGT	uc003cnx.3	+						KIF15_uc010hiq.2_Intron|KIF15_uc003cny.1_Intron	NM_020242	NP_064627			kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	44909683	44909683	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44909683delT								TMEM42 (2531 upstream) : TGM4 (6415 downstream)																																			---	---	---	---
TGM4	7047	broad.mit.edu	37	3	44950064	44950065	+	Intron	INS	-	T	T	rs140479782	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44950064_44950065insT	uc003coc.3	+							NM_003241	NP_003232			transglutaminase 4 (prostate)						peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)													---	---	---	---
ZDHHC3	51304	broad.mit.edu	37	3	45007107	45007107	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45007107delA	uc003cod.2	-						ZDHHC3_uc003cog.2_Intron|ZDHHC3_uc011bad.1_Intron	NM_016598	NP_057682			zinc finger, DHHC-type containing 3 isoform 2							Golgi membrane|integral to membrane	zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00943)|KIRC - Kidney renal clear cell carcinoma(197;0.053)|Kidney(197;0.0665)														---	---	---	---
LTF	4057	broad.mit.edu	37	3	46520999	46521002	+	Intron	DEL	TGTT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46520999_46521002delTGTT	uc003cpr.2	-							NM_002343	NP_002334			lactotransferrin precursor						cellular iron ion homeostasis|defense response to bacterium|humoral immune response|iron ion transport	extracellular region|stored secretory granule	ferric iron binding|heparin binding|protein binding|serine-type endopeptidase activity			central_nervous_system(2)|ovary(1)|lung(1)	4				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)	Pefloxacin(DB00487)													---	---	---	---
PRKAR2A	5576	broad.mit.edu	37	3	48859643	48859644	+	Intron	INS	-	A	A	rs34189728		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48859643_48859644insA	uc010hki.1	-						PRKAR2A_uc003cux.1_Intron|PRKAR2A_uc003cuy.1_Intron	NM_004157	NP_004148			cAMP-dependent protein kinase, regulatory						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|membrane fraction	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	49199055	49199055	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49199055delG								LAMB2L (7221 upstream) : CCDC71 (914 downstream)																																			---	---	---	---
DAG1	1605	broad.mit.edu	37	3	49567388	49567388	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49567388delT	uc003cxc.3	+							NM_004393	NP_004384			dystroglycan 1 preproprotein						cytoskeletal anchoring at plasma membrane|interspecies interaction between organisms|microtubule anchoring|negative regulation of cell migration|negative regulation of MAPKKK cascade|negative regulation of protein kinase B signaling cascade	basement membrane|contractile ring|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|extracellular space|filopodium|integral to membrane|integral to membrane of membrane fraction|lamellipodium|nucleoplasm	actin binding|alpha-actinin binding|calcium ion binding|laminin-1 binding|receptor activity|structural constituent of muscle|tubulin binding|vinculin binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)														---	---	---	---
TRAIP	10293	broad.mit.edu	37	3	49886283	49886284	+	Intron	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49886283_49886284delTT	uc003cxs.1	-						TRAIP_uc010hla.1_Intron|TRAIP_uc011bcx.1_Intron	NM_005879	NP_005870			TRAF interacting protein						cell proliferation|induction of apoptosis	perinuclear region of cytoplasm	protein binding|zinc ion binding			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
WDR82	80335	broad.mit.edu	37	3	52310453	52310454	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52310453_52310454insA	uc003ddl.2	-							NM_025222	NP_079498			WD repeat domain 82						histone H3-K4 methylation	chromatin|PTW/PP1 phosphatase complex|Set1C/COMPASS complex	protein binding				0				BRCA - Breast invasive adenocarcinoma(193;2.67e-05)|Kidney(197;0.00198)|KIRC - Kidney renal clear cell carcinoma(197;0.00223)|OV - Ovarian serous cystadenocarcinoma(275;0.246)														---	---	---	---
NEK4	6787	broad.mit.edu	37	3	52798647	52798647	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52798647delA	uc003dfq.3	-						NEK4_uc011bej.1_Intron|NEK4_uc003dfr.2_Intron	NM_003157	NP_003148			NIMA-related kinase 4						cell division|mitosis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(1)	1				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)														---	---	---	---
ITIH1	3697	broad.mit.edu	37	3	52822579	52822579	+	Intron	DEL	T	-	-	rs66466287		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52822579delT	uc003dfs.2	+						ITIH1_uc010hmn.1_Intron|ITIH1_uc003dft.2_Intron|ITIH1_uc010hmo.1_Intron|ITIH1_uc003dfu.2_Intron	NM_002215	NP_002206			inter-alpha (globulin) inhibitor H1						hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	53185141	53185141	+	IGR	DEL	T	-	-	rs35347035		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53185141delT								RFT1 (20671 upstream) : PRKCD (10082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	53258708	53258709	+	IGR	INS	-	G	G	rs147865233	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53258708_53258709insG								PRKCD (31977 upstream) : TKT (15 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	56744261	56744262	+	IGR	INS	-	AAAAAC	AAAAAC	rs149804345	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56744261_56744262insAAAAAC								C3orf63 (27126 upstream) : ARHGEF3 (17184 downstream)																																			---	---	---	---
FHIT	2272	broad.mit.edu	37	3	60235417	60235418	+	Intron	INS	-	ACAC	ACAC	rs144926779	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60235417_60235418insACAC	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
SYNPR	132204	broad.mit.edu	37	3	63264536	63264536	+	Intron	DEL	C	-	-	rs34988753		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63264536delC	uc003dlp.2	+						SYNPR_uc011bfk.1_Intron|SYNPR_uc011bfl.1_Intron	NM_001130003	NP_001123475			synaptoporin isoform 1							cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	transporter activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)														---	---	---	---
SYNPR	132204	broad.mit.edu	37	3	63319012	63319013	+	Intron	INS	-	A	A	rs11369864		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63319012_63319013insA	uc003dlp.2	+						SYNPR_uc011bfk.1_Intron|SYNPR_uc011bfl.1_Intron	NM_001130003	NP_001123475			synaptoporin isoform 1							cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	transporter activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)														---	---	---	---
PRICKLE2	166336	broad.mit.edu	37	3	64186297	64186297	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64186297delT	uc003dmf.2	-							NM_198859	NP_942559			prickle-like 2							cytoplasm|nuclear membrane	zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)														---	---	---	---
ADAMTS9	56999	broad.mit.edu	37	3	64594701	64594701	+	Intron	DEL	C	-	-	rs59960639		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64594701delC	uc003dmg.2	-						ADAMTS9_uc011bfo.1_Intron|ADAMTS9_uc003dmh.1_Intron|ADAMTS9_uc011bfp.1_Intron	NM_182920	NP_891550			ADAM metallopeptidase with thrombospondin type 1						glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	64755615	64755615	+	Intron	DEL	G	-	-	rs10709752		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64755615delG	uc003dml.2	+											Homo sapiens cDNA FLJ25194 fis, clone REC04095.																														---	---	---	---
MAGI1	9223	broad.mit.edu	37	3	65531650	65531651	+	Intron	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65531650_65531651delCA	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc010hny.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229			membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)														---	---	---	---
MAGI1	9223	broad.mit.edu	37	3	65836862	65836862	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65836862delG	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc010hny.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229			membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	67976106	67976107	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67976106_67976107delAC	uc003dnc.2	+											Homo sapiens mRNA; cDNA DKFZp686F1220 (from clone DKFZp686F1220).																														---	---	---	---
MITF	4286	broad.mit.edu	37	3	69883237	69883238	+	Intron	INS	-	AT	AT	rs149011524	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69883237_69883238insAT	uc003dnz.2	+						MITF_uc011bgb.1_Intron|MITF_uc003doa.2_Intron	NM_198159	NP_937802			microphthalmia-associated transcription factor						melanocyte differentiation|multicellular organismal development|protein complex assembly	nucleus|protein complex	DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			ovary(2)	2		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)				A		melanoma 		Waardenburg syndrome type 2|Tietz syndrome						---	---	---	---
Unknown	0	broad.mit.edu	37	3	70217539	70217539	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70217539delT								MITF (200053 upstream) : FOXP1 (787198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	72046513	72046514	+	IGR	DEL	AG	-	-	rs10556679		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72046513_72046514delAG								PROK2 (212156 upstream) : RYBP (377237 downstream)																																			---	---	---	---
SHQ1	55164	broad.mit.edu	37	3	72890504	72890504	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72890504delA	uc003dpf.2	-						SHQ1_uc010hod.2_Intron	NM_018130	NP_060600			SHQ1 homolog						ribonucleoprotein complex assembly	cytosol|nucleoplasm	protein binding			ovary(2)|large_intestine(1)	3		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	73316732	73316733	+	IGR	INS	-	T	T	rs35884644		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73316732_73316733insT								PPP4R2 (201721 upstream) : PDZRN3 (114919 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	74006689	74006689	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74006689delC								PDZRN3 (332617 upstream) : CNTN3 (305033 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75878441	75878441	+	IGR	DEL	T	-	-	rs140805187	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75878441delT								ZNF717 (43771 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75878610	75878611	+	IGR	INS	-	TG	TG	rs33992378		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75878610_75878611insTG								ZNF717 (43940 upstream) : None (None downstream)																																			---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77313020	77313021	+	Intron	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77313020_77313021delCA	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933			roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	78760553	78760554	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78760553_78760554insT	uc003dqe.2	-						ROBO1_uc003dqb.2_Intron|ROBO1_uc003dqc.2_Intron|ROBO1_uc003dqd.2_Intron|ROBO1_uc003dqf.1_Intron	NM_002941	NP_002932			roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	83736955	83736955	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83736955delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	84606050	84606051	+	IGR	INS	-	A	A	rs141324522	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84606050_84606051insA								None (None upstream) : CADM2 (402082 downstream)																																			---	---	---	---
CADM2	253559	broad.mit.edu	37	3	85212704	85212704	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85212704delC	uc003dqj.2	+						CADM2_uc003dqk.2_Intron	NM_153184	NP_694854			immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)														---	---	---	---
CADM2	253559	broad.mit.edu	37	3	85576750	85576750	+	Intron	DEL	A	-	-	rs76233947		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85576750delA	uc003dqj.2	+						CADM2_uc003dqk.2_Intron	NM_153184	NP_694854			immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)														---	---	---	---
CHMP2B	25978	broad.mit.edu	37	3	87288438	87288438	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87288438delT	uc003dqp.3	+						CHMP2B_uc011bgn.1_Intron	NM_014043	NP_054762			chromatin modifying protein 2B						cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane|mitochondrion|nucleus	protein domain specific binding			skin(2)|ovary(1)	3	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	88646478	88646479	+	IGR	INS	-	T	T	rs72579105		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88646478_88646479insT								C3orf38 (439365 upstream) : EPHA3 (510195 downstream)																																			---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89175158	89175158	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89175158delA	uc003dqy.2	+						EPHA3_uc003dqx.1_Intron|EPHA3_uc010hon.1_Intron	NM_005233	NP_005224			ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89301295	89301295	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89301295delA	uc003dqy.2	+						EPHA3_uc003dqx.1_Intron|EPHA3_uc010hon.1_Intron	NM_005233	NP_005224			ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	95011126	95011126	+	IGR	DEL	C	-	-	rs113169330		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95011126delC								LOC255025 (116047 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	95270091	95270091	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95270091delT								LOC255025 (375012 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	95587955	95587955	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95587955delT								LOC255025 (692876 upstream) : EPHA6 (945470 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	96041098	96041098	+	IGR	DEL	A	-	-	rs72174711		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96041098delA								None (None upstream) : EPHA6 (492327 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	96285979	96285979	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96285979delA								None (None upstream) : EPHA6 (247446 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	96424738	96424739	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96424738_96424739insA								None (None upstream) : EPHA6 (108686 downstream)																																			---	---	---	---
C3orf26	84319	broad.mit.edu	37	3	99547459	99547459	+	Intron	DEL	T	-	-	rs78152354		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99547459delT	uc003dtl.2	+						C3orf26_uc003dtk.1_Intron	NM_032359	NP_115735			hypothetical protein LOC84319								ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	99949736	99949736	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99949736delA								TMEM30C (36710 upstream) : TBC1D23 (29950 downstream)																																			---	---	---	---
TOMM70A	9868	broad.mit.edu	37	3	100115499	100115500	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100115499_100115500insT	uc003dtw.2	-							NM_014820	NP_055635			translocase of outer mitochondrial membrane 70						protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane translocase complex	protein binding|protein transmembrane transporter activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	102307049	102307049	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102307049delA								ZPLD1 (108364 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	103163081	103163088	+	IGR	DEL	TTTCTTTC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103163081_103163088delTTTCTTTC								ZPLD1 (964396 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	103461964	103461965	+	IGR	INS	-	AT	AT	rs145471766		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103461964_103461965insAT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	103494245	103494246	+	IGR	DEL	CT	-	-	rs76848155		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103494245_103494246delCT								None (None upstream) : None (None downstream)																																			---	---	---	---
LOC100302640	100302640	broad.mit.edu	37	3	106791487	106791487	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106791487delA	uc003dwf.3	-											Homo sapiens cDNA clone IMAGE:5284861.												0																		---	---	---	---
LOC100302640	100302640	broad.mit.edu	37	3	106811847	106811847	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106811847delC	uc003dwf.3	-											Homo sapiens cDNA clone IMAGE:5284861.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	107104146	107104146	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107104146delA								CCDC54 (6665 upstream) : BBX (137637 downstream)																																			---	---	---	---
DZIP3	9666	broad.mit.edu	37	3	108320001	108320001	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108320001delT	uc003dxd.2	+						DZIP3_uc003dxf.1_5'Flank|DZIP3_uc003dxe.1_Intron	NM_014648	NP_055463			DAZ interacting protein 3, zinc finger						protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	108427161	108427161	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108427161delT								DZIP3 (13469 upstream) : RETNLB (47325 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	109332549	109332549	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109332549delC								FLJ25363 (118535 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	110482630	110482631	+	IGR	INS	-	CA	CA	rs138939772	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110482630_110482631insCA								None (None upstream) : PVRL3 (308234 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	110659711	110659712	+	IGR	INS	-	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110659711_110659712insG								None (None upstream) : PVRL3 (131153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	112498386	112498387	+	IGR	DEL	TG	-	-	rs145272035		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112498386_112498387delTG								CCDC80 (138409 upstream) : CD200R1L (36169 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	112816003	112816006	+	IGR	DEL	AGTC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112816003_112816006delAGTC								C3orf17 (77448 upstream) : BOC (114406 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	116324377	116324378	+	IGR	INS	-	T	T	rs142815827	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116324377_116324378insT								LSAMP (800359 upstream) : LOC285194 (104257 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	116588157	116588158	+	IGR	INS	-	TG	TG	rs147071516	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116588157_116588158insTG								LOC285194 (152272 upstream) : None (None downstream)																																			---	---	---	---
RABL3	285282	broad.mit.edu	37	3	120421408	120421408	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120421408delT	uc003edx.2	-							NM_173825	NP_776186			RAB, member of RAS oncogene family-like 3						small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)														---	---	---	---
ITGB5	3693	broad.mit.edu	37	3	124587139	124587140	+	Intron	INS	-	GGCTGAGAAGCT	GGCTGAGAAGCT	rs139414424	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124587139_124587140insGGCTGAGAAGCT	uc003eho.2	-							NM_002213	NP_002204			integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	125125012	125125013	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125125012_125125013delTG								ZNF148 (30814 upstream) : SNX4 (40482 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	126109730	126109731	+	IGR	INS	-	TCTC	TCTC	rs142571202	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126109730_126109731insTCTC								KLF15 (33494 upstream) : CCDC37 (4051 downstream)																																			---	---	---	---
CPNE4	131034	broad.mit.edu	37	3	131559144	131559145	+	Intron	DEL	AA	-	-	rs77168880		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131559144_131559145delAA	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720			copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
NCRNA00119	348808	broad.mit.edu	37	3	132546363	132546363	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132546363delC	uc003epg.1	+							NR_002811				Homo sapiens cDNA clone IMAGE:4826885.												0																		---	---	---	---
RAB6B	51560	broad.mit.edu	37	3	133582141	133582141	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133582141delA	uc003epy.2	-						RAB6B_uc011blu.1_Intron	NM_016577	NP_057661			RAB6B, member RAS oncogene family						protein transport|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle|Golgi membrane	GTP binding|GTPase activity|protein binding			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	133932380	133932381	+	IGR	DEL	TG	-	-	rs146850172		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133932380_133932381delTG								RYK (-37206 upstream) : RYK (-56403 downstream)																																	OREG0015812	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	3	133981533	133981533	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133981533delA								RYK (11947 upstream) : AMOTL2 (89161 downstream)																																			---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134607752	134607754	+	Intron	DEL	GGA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134607752_134607754delGGA	uc003eqt.2	+						EPHB1_uc010htz.1_Intron|EPHB1_uc011bly.1_Intron	NM_004441	NP_004432			ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134730805	134730806	+	Intron	INS	-	T	T	rs150644820	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134730805_134730806insT	uc003eqt.2	+						EPHB1_uc010htz.1_Intron|EPHB1_uc011bly.1_Intron	NM_004441	NP_004432			ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	138984774	138984775	+	IGR	INS	-	TG	TG	rs146679408	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138984774_138984775insTG								PISRT1 (32410 upstream) : MRPS22 (78023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	139018373	139018373	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139018373delC								PISRT1 (66009 upstream) : MRPS22 (44425 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	139431486	139431487	+	IGR	INS	-	T	T	rs146530800	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139431486_139431487insT								NMNAT3 (34646 upstream) : CLSTN2 (222540 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	139558042	139558042	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139558042delT								NMNAT3 (161202 upstream) : CLSTN2 (95985 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	142624336	142624336	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142624336delT								PCOLCE2 (16402 upstream) : PAQR9 (43670 downstream)																																			---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	143434040	143434041	+	Intron	INS	-	T	T	rs137862242	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143434040_143434041insT	uc003evn.2	-						SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924			solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	145253296	145253296	+	IGR	DEL	A	-	-	rs11324502		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145253296delA								None (None upstream) : PLOD2 (533932 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145399082	145399082	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145399082delT								None (None upstream) : PLOD2 (388146 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145628450	145628451	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145628450_145628451insT								None (None upstream) : PLOD2 (158777 downstream)																																			---	---	---	---
PLSCR5	389158	broad.mit.edu	37	3	146305322	146305323	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146305322_146305323delGT	uc003ewb.2	-						PLSCR5_uc010hvb.2_Intron|PLSCR5_uc010hvc.2_Intron	NM_001085420	NP_001078889			phospholipid scramblase family, member 5												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	146373118	146373118	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146373118delA								PLSCR5 (49115 upstream) : ZIC4 (730719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	147832286	147832287	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147832286_147832287insA								ZIC1 (697782 upstream) : AGTR1 (583371 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	148078586	148078587	+	IGR	DEL	AT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148078586_148078587delAT								ZIC1 (944082 upstream) : AGTR1 (337071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	148356543	148356544	+	IGR	INS	-	C	C	rs146674931	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148356543_148356544insC								None (None upstream) : AGTR1 (59114 downstream)																																			---	---	---	---
GYG1	2992	broad.mit.edu	37	3	148735557	148735558	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148735557_148735558insT	uc003ewn.2	+						GYG1_uc011bnp.1_Intron|GYG1_uc003ewo.2_Intron|GYG1_uc003ewp.2_Intron	NM_004130	NP_004121			glycogenin 1						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	glycogenin glucosyltransferase activity|metal ion binding|protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	148979158	148979158	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148979158delA								CP (39326 upstream) : TM4SF18 (59698 downstream)																																			---	---	---	---
AADACL2	344752	broad.mit.edu	37	3	151455574	151455575	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151455574_151455575insT	uc003ezc.2	+						AADACL2_uc010hvn.2_Intron	NM_207365	NP_997248			arylacetamide deacetylase-like 2 precursor							extracellular region|integral to membrane	carboxylesterase activity				0			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	151582885	151582886	+	IGR	INS	-	TGTG	TGTG	rs142878642	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151582885_151582886insTGTG								AADAC (36609 upstream) : SUCNR1 (8551 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	151773085	151773085	+	IGR	DEL	T	-	-	rs10714442		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151773085delT								SUCNR1 (173435 upstream) : LOC401093 (207328 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	153564108	153564108	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153564108delA								C3orf79 (343625 upstream) : SGEF (275041 downstream)																																			---	---	---	---
SGEF	26084	broad.mit.edu	37	3	153968752	153968753	+	Intron	DEL	AG	-	-	rs10535573		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153968752_153968753delAG	uc011bog.1	+						SGEF_uc011boh.1_Intron|SGEF_uc011boi.1_Intron	NM_015595	NP_056410			Src homology 3 domain-containing guanine						regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	154612469	154612469	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154612469delA								GPR149 (464965 upstream) : MME (129444 downstream)																																			---	---	---	---
PLCH1	23007	broad.mit.edu	37	3	155417612	155417613	+	Intron	DEL	CA	-	-	rs112242382		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155417612_155417613delCA	uc011bol.1	-							NM_014996	NP_055811			phospholipase C eta 1 isoform b						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)															---	---	---	---
C3orf33	285315	broad.mit.edu	37	3	155486010	155486011	+	Intron	INS	-	T	T	rs139922881	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155486010_155486011insT	uc003fal.1	-						C3orf33_uc003fam.1_Intron	NM_173657	NP_775928			hypothetical protein LOC285315								hydrolase activity, acting on ester bonds|nucleic acid binding				0			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)															---	---	---	---
VEPH1	79674	broad.mit.edu	37	3	157123545	157123545	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157123545delT	uc003fbj.1	-						VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	NM_024621	NP_078897			ventricular zone expressed PH domain homolog 1							plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)															---	---	---	---
RSRC1	51319	broad.mit.edu	37	3	157876728	157876728	+	Intron	DEL	A	-	-	rs11340589		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157876728delA	uc003fbt.2	+						RSRC1_uc011bou.1_Intron|RSRC1_uc003fbu.1_Intron|RSRC1_uc003fbv.2_Intron	NM_016625	NP_057709			arginine/serine-rich coiled-coil 1						nucleocytoplasmic transport	cytoplasm|nuclear speck	protein binding				0			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)															---	---	---	---
RSRC1	51319	broad.mit.edu	37	3	158220067	158220067	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158220067delG	uc003fbt.2	+						RSRC1_uc003fbv.2_Intron	NM_016625	NP_057709			arginine/serine-rich coiled-coil 1						nucleocytoplasmic transport	cytoplasm|nuclear speck	protein binding				0			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	158516418	158516419	+	IGR	DEL	AT	-	-	rs72000351		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158516418_158516419delAT								RARRES1 (66143 upstream) : MFSD1 (3493 downstream)																																			---	---	---	---
PPM1L	151742	broad.mit.edu	37	3	160672749	160672749	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160672749delT	uc003fdr.2	+						PPM1L_uc003fds.2_Intron|PPM1L_uc003fdt.2_Intron|PPM1L_uc010hwf.2_Intron	NM_139245	NP_640338			protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	160997233	160997233	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160997233delA								NMD3 (25914 upstream) : C3orf57 (65348 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	161448017	161448018	+	IGR	DEL	CC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161448017_161448018delCC								OTOL1 (226289 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	161728956	161728957	+	IGR	DEL	GT	-	-	rs111929680		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161728956_161728957delGT								OTOL1 (507228 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	161736773	161736773	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161736773delT								OTOL1 (515045 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	161808528	161808529	+	IGR	DEL	TA	-	-	rs139821921		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161808528_161808529delTA								OTOL1 (586800 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	163480028	163480037	+	IGR	DEL	TCTCTCTCTC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163480028_163480037delTCTCTCTCTC								None (None upstream) : MIR1263 (409222 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	164202032	164202032	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164202032delA								MIR720 (142794 upstream) : SI (494655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	165938288	165938291	+	IGR	DEL	TATG	-	-	rs63480863		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165938288_165938291delTATG								BCHE (383035 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166269407	166269407	+	IGR	DEL	T	-	-	rs111389058		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166269407delT								BCHE (714154 upstream) : ZBBX (688674 downstream)																																			---	---	---	---
SERPINI2	5276	broad.mit.edu	37	3	167166692	167166694	+	Intron	DEL	AAC	-	-	rs35085294		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167166692_167166694delAAC	uc003fer.1	-						SERPINI2_uc003fes.1_Intron|SERPINI2_uc003fet.1_Intron	NM_006217	NP_006208			serpin peptidase inhibitor, clade I (pancpin),						cellular component movement|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(2)|urinary_tract(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	168123647	168123654	+	IGR	DEL	ACACACAC	-	-	rs138329524		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168123647_168123654delACACACAC								GOLIM4 (310230 upstream) : MIR551B (145988 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	168410161	168410162	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168410161_168410162delGT								MIR551B (140424 upstream) : C3orf50 (117422 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	169463031	169463032	+	IGR	INS	-	TT	TT	rs56280773		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169463031_169463032insTT								MECOM (81468 upstream) : TERC (19366 downstream)																																			---	---	---	---
LOC100128164	100128164	broad.mit.edu	37	3	169664945	169664946	+	RNA	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169664945_169664946delGT	uc011bpp.1	-	2		c.2857_2858delAC				NR_027622				Homo sapiens cDNA FLJ41016 fis, clone UTERU2018784.												0																		---	---	---	---
RPL22L1	200916	broad.mit.edu	37	3	170584906	170584907	+	Intron	DEL	TT	-	-	rs10575304		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170584906_170584907delTT	uc003fhc.3	-						RPL22L1_uc003fhb.3_Intron	NM_001099645	NP_001093115			ribosomal protein L22-like 1						translation	ribosome	structural constituent of ribosome				0	all_cancers(22;1.96e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.137)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)															---	---	---	---
PLD1	5337	broad.mit.edu	37	3	171383496	171383496	+	Intron	DEL	A	-	-	rs141529744		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171383496delA	uc003fhs.2	-						PLD1_uc003fht.2_Intron|PLD1_uc003fhu.3_Intron|PLD1_uc003fhv.1_Intron	NM_002662	NP_002653			phospholipase D1 isoform a						cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)													---	---	---	---
PLD1	5337	broad.mit.edu	37	3	171387583	171387583	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171387583delA	uc003fhs.2	-						PLD1_uc003fht.2_Intron|PLD1_uc003fhu.3_Intron|PLD1_uc003fhv.1_Intron	NM_002662	NP_002653			phospholipase D1 isoform a						cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)													---	---	---	---
PLD1	5337	broad.mit.edu	37	3	171517691	171517691	+	Intron	DEL	G	-	-	rs74310675		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171517691delG	uc003fhs.2	-						PLD1_uc003fht.2_Intron	NM_002662	NP_002653			phospholipase D1 isoform a						cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)													---	---	---	---
FNDC3B	64778	broad.mit.edu	37	3	171975360	171975361	+	Intron	DEL	AC	-	-	rs112229919		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171975360_171975361delAC	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron	NM_022763	NP_073600			fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	173005149	173005150	+	IGR	INS	-	A	A	rs144030198		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173005149_173005150insA								SPATA16 (146117 upstream) : NLGN1 (111094 downstream)																																			---	---	---	---
NLGN1	22871	broad.mit.edu	37	3	173713456	173713456	+	Intron	DEL	T	-	-	rs66538676		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173713456delT	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747			neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---
NLGN1	22871	broad.mit.edu	37	3	173915542	173915543	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173915542_173915543delGT	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747			neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	175925231	175925231	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175925231delT								NAALADL2 (401805 upstream) : TBL1XR1 (813312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	176294476	176294476	+	IGR	DEL	A	-	-	rs71720254		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176294476delA								NAALADL2 (771050 upstream) : TBL1XR1 (444067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	176658310	176658310	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176658310delG								None (None upstream) : TBL1XR1 (80233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	177926152	177926152	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177926152delC								None (None upstream) : KCNMB2 (328072 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	178690556	178690556	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178690556delA								KCNMB2 (128340 upstream) : ZMAT3 (50971 downstream)																																			---	---	---	---
PEX5L	51555	broad.mit.edu	37	3	179652848	179652849	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179652848_179652849insA	uc003fki.1	-						PEX5L_uc011bqd.1_Intron|PEX5L_uc011bqe.1_Intron|PEX5L_uc011bqf.1_Intron|PEX5L_uc003fkj.1_Intron|PEX5L_uc010hxd.1_Intron|PEX5L_uc011bqg.1_Intron|PEX5L_uc011bqh.1_Intron	NM_016559	NP_057643			peroxisomal biogenesis factor 5-like						protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)															---	---	---	---
TTC14	151613	broad.mit.edu	37	3	180328587	180328587	+	3'UTR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180328587delA	uc003fkk.2	+	12					TTC14_uc003fkl.2_3'UTR|TTC14_uc003fkm.2_Intron	NM_133462	NP_597719			tetratricopeptide repeat domain 14 isoform a								RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	180526739	180526739	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180526739delA	uc003fko.2	-											Homo sapiens mRNA; cDNA DKFZp434A128 (from clone DKFZp434A128).																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	180600232	180600234	+	IGR	DEL	TCT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180600232_180600234delTCT								CCDC39 (144570 upstream) : FXR1 (30218 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	181818027	181818029	+	IGR	DEL	TGT	-	-	rs10620247		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181818027_181818029delTGT								SOX2OT (359024 upstream) : ATP11B (693262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	181955772	181955773	+	IGR	DEL	AC	-	-	rs10562272		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181955772_181955773delAC								SOX2OT (496769 upstream) : ATP11B (555518 downstream)																																			---	---	---	---
MCF2L2	23101	broad.mit.edu	37	3	183009876	183009877	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183009876_183009877delTG	uc003fli.1	-						MCF2L2_uc003flj.1_Intron|MCF2L2_uc011bqr.1_Intron|uc003fln.1_Intron	NM_015078	NP_055893			Rho family guanine-nucleotide exchange factor						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)															---	---	---	---
MCF2L2	23101	broad.mit.edu	37	3	183028451	183028451	+	Intron	DEL	A	-	-	rs113655194		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183028451delA	uc003fli.1	-						MCF2L2_uc003flj.1_Intron|MCF2L2_uc003flp.1_Intron|MCF2L2_uc011bqs.1_Intron	NM_015078	NP_055893			Rho family guanine-nucleotide exchange factor						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	183177759	183177759	+	IGR	DEL	G	-	-	rs68021603		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183177759delG								MCF2L2 (31904 upstream) : KLHL6 (27562 downstream)																																			---	---	---	---
KLHL24	54800	broad.mit.edu	37	3	183374894	183374895	+	Intron	INS	-	GCA	GCA	rs147996720	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183374894_183374895insGCA	uc003flv.2	+						KLHL24_uc003flw.2_Intron|KLHL24_uc003flx.2_Intron	NM_017644	NP_060114			DRE1 protein							axon|cytoplasm|perikaryon				ovary(1)	1	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)															---	---	---	---
DVL3	1857	broad.mit.edu	37	3	183876122	183876123	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183876122_183876123insA	uc003fms.2	+						DVL3_uc011bqw.1_Intron|DVL3_uc003fmt.2_Intron	NM_004423	NP_004414			dishevelled 3						canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity			ovary(1)|lung(1)|breast(1)	3	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	184373756	184373756	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184373756delT								EPHB3 (73561 upstream) : MAGEF1 (54400 downstream)																																			---	---	---	---
EHHADH	1962	broad.mit.edu	37	3	184958314	184958314	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184958314delT	uc003fpf.2	-						EHHADH_uc011brs.1_Intron	NM_001966	NP_001957			enoyl-Coenzyme A, hydratase/3-hydroxyacyl							peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity			ovary(3)	3	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		NADH(DB00157)													---	---	---	---
DGKG	1608	broad.mit.edu	37	3	185958597	185958597	+	Intron	DEL	A	-	-	rs11311286		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185958597delA	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337			diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	186120370	186120371	+	IGR	INS	-	A	A	rs67796718		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186120370_186120371insA								DGKG (40347 upstream) : CRYGS (135862 downstream)																																			---	---	---	---
ST6GAL1	6480	broad.mit.edu	37	3	186722848	186722849	+	Intron	INS	-	T	T	rs141692187	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186722848_186722849insT	uc003frb.2	+						ST6GAL1_uc003frc.2_Intron	NM_173216	NP_775323			ST6 beta-galactosamide						humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	187468034	187468034	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187468034delT								BCL6 (4559 upstream) : LPP (403685 downstream)																																			---	---	---	---
LPP	4026	broad.mit.edu	37	3	188035581	188035582	+	Intron	INS	-	A	A	rs141967279	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188035581_188035582insA	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
LPP	4026	broad.mit.edu	37	3	188244603	188244603	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188244603delA	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
LPP	4026	broad.mit.edu	37	3	188342524	188342524	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188342524delT	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
Unknown	0	broad.mit.edu	37	3	190049781	190049781	+	IGR	DEL	T	-	-	rs5855322		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190049781delT								CLDN1 (9566 upstream) : CLDN16 (56060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	190066125	190066126	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190066125_190066126delTG								CLDN1 (25910 upstream) : CLDN16 (39715 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	190667643	190667652	+	IGR	DEL	ACACACACAC	-	-	rs10531056		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190667643_190667652delACACACACAC								SNAR-I (71804 upstream) : OSTN (262670 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	191761456	191761456	+	IGR	DEL	G	-	-	rs11357325		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191761456delG								PYDC2 (582213 upstream) : FGF12 (98228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	191773398	191773401	+	IGR	DEL	TTCT	-	-	rs66747432		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191773398_191773401delTTCT								PYDC2 (594155 upstream) : FGF12 (86283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	192952894	192952895	+	IGR	INS	-	T	T	rs112216555		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192952894_192952895insT								C3orf59 (316944 upstream) : HRASLS (6023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	193460036	193460039	+	IGR	DEL	GTGT	-	-	rs72119801		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193460036_193460039delGTGT								OPA1 (44437 upstream) : LOC100128023 (250845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	193842837	193842838	+	IGR	DEL	GA	-	-	rs10567370		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193842837_193842838delGA								LOC100128023 (130810 upstream) : HES1 (11096 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	193993879	193993880	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193993879_193993880delCA								HES1 (137483 upstream) : LOC100131551 (23544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	194058721	194058721	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194058721delG								LOC100131551 (28128 upstream) : CPN2 (1774 downstream)																																			---	---	---	---
ATP13A3	79572	broad.mit.edu	37	3	194143552	194143552	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194143552delC	uc003fty.3	-						ATP13A3_uc003ftx.3_Intron	NM_024524	NP_078800			ATPase type 13A3						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	194197495	194197496	+	IGR	INS	-	TTT	TTT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194197495_194197496insTTT								ATP13A3 (8527 upstream) : TMEM44 (110907 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	194297970	194297970	+	IGR	DEL	T	-	-	rs79089496		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194297970delT								ATP13A3 (109002 upstream) : TMEM44 (10433 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	194664225	194664226	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194664225_194664226delCA								FAM43A (254461 upstream) : C3orf21 (124789 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	194706521	194706521	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194706521delT								FAM43A (296757 upstream) : C3orf21 (82494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	195375265	195375265	+	5'Flank	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195375265delC	uc011bsy.1	-						uc011bsz.1_5'Flank					Homo sapiens cDNA FLJ36096 fis, clone TESTI2020906.																														---	---	---	---
MUC20	200958	broad.mit.edu	37	3	195448167	195448169	+	Intron	DEL	ATC	-	-	rs71929056		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195448167_195448169delATC	uc010hzo.2	+						MUC20_uc010hzp.2_5'Flank	NM_152673	NP_689886			mucin 20 isoform L						protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)														---	---	---	---
DLG1	1739	broad.mit.edu	37	3	196991006	196991009	+	Intron	DEL	TTAG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196991006_196991009delTTAG	uc003fxo.3	-						DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron|DLG1_uc011buf.1_Intron|DLG1_uc003fxp.2_Intron|DLG1_uc010iam.1_Intron	NM_001098424	NP_001091894			discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	197130202	197130203	+	IGR	INS	-	TG	TG	rs142703979	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197130202_197130203insTG								DLG1 (104059 upstream) : BDH1 (106452 downstream)																																			---	---	---	---
IQCG	84223	broad.mit.edu	37	3	197644608	197644608	+	Intron	DEL	T	-	-	rs11351894		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197644608delT	uc003fyo.2	-						IQCG_uc003fyn.2_Intron|IQCG_uc003fyp.2_Intron|IQCG_uc003fyq.3_Intron	NM_001134435	NP_001127907			IQ motif containing G												0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)														---	---	---	---
ZNF721	170960	broad.mit.edu	37	4	483347	483347	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:483347delG	uc003gag.2	-						ZNF721_uc010ibe.2_Intron|ZNF721_uc003gah.1_Intron	NM_133474	NP_597731			zinc finger protein 721							intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
MAEA	10296	broad.mit.edu	37	4	1286998	1286999	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1286998_1286999insT	uc003gda.2	+						MAEA_uc010ibs.1_Intron|MAEA_uc003gdb.2_Intron|MAEA_uc011bvb.1_Intron|MAEA_uc003gdc.2_Intron|MAEA_uc003gdd.2_Intron	NM_001017405	NP_001017405			macrophage erythroblast attacher isoform 1						cell adhesion|cell cycle|cell division|erythrocyte maturation|negative regulation of myeloid cell apoptosis|regulation of mitotic cell cycle	actomyosin contractile ring|integral to plasma membrane|membrane fraction|nuclear matrix|spindle	actin binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(23;0.0201)															---	---	---	---
WHSC2	7469	broad.mit.edu	37	4	2007422	2007425	+	Intron	DEL	AAAC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2007422_2007425delAAAC	uc003gem.2	-						WHSC2_uc003gen.2_Intron	NM_005663	NP_005654			Wolf-Hirschhorn syndrome candidate 2 protein						multicellular organismal development|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm				skin(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.0155)															---	---	---	---
POLN	353497	broad.mit.edu	37	4	2166917	2166917	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2166917delA	uc003ger.2	-						POLN_uc010ich.1_Intron|POLN_uc011bvi.1_Intron	NM_181808	NP_861524			DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)										DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
RNF4	6047	broad.mit.edu	37	4	2484576	2484580	+	Intron	DEL	GCCTG	-	-	rs140553862	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2484576_2484580delGCCTG	uc003gfb.2	+						RNF4_uc010ici.1_Intron|RNF4_uc010icj.2_Intron|RNF4_uc003gfc.2_Intron	NM_002938	NP_002929			ring finger protein 4						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|protein K63-linked ubiquitination|regulation of kinetochore assembly|regulation of spindle assembly|response to arsenic-containing substance	cytoplasm|PML body	androgen receptor binding|DNA binding|nucleosome binding|sequence-specific DNA binding transcription factor activity|SUMO polymer binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(65;0.241)																---	---	---	---
GRK4	2868	broad.mit.edu	37	4	3026603	3026604	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3026603_3026604insA	uc003ggn.1	+						GRK4_uc003ggo.1_Intron|GRK4_uc003ggp.1_Intron|GRK4_uc003ggq.1_Intron	NM_182982	NP_892027			G protein-coupled receptor kinase 4 isoform							cell cortex	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3575391	3575392	+	IGR	INS	-	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3575391_3575392insG								LRPAP1 (41167 upstream) : ADRA2C (192683 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3607372	3607373	+	IGR	DEL	CC	-	-	rs36097846		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3607372_3607373delCC								LRPAP1 (73148 upstream) : ADRA2C (160702 downstream)																																			---	---	---	---
EVC2	132884	broad.mit.edu	37	4	5657458	5657458	+	Intron	DEL	A	-	-	rs67146324		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5657458delA	uc003gij.2	-						EVC2_uc011bwb.1_Intron|EVC2_uc003gik.2_Intron	NM_147127	NP_667338			limbin							integral to membrane				large_intestine(3)|ovary(2)	5																		---	---	---	---
MAN2B2	23324	broad.mit.edu	37	4	6607639	6607642	+	Intron	DEL	CATT	-	-	rs35778667		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6607639_6607642delCATT	uc003gjf.1	+						MAN2B2_uc003gje.1_Intron|MAN2B2_uc011bwf.1_Intron	NM_015274	NP_056089			mannosidase, alpha, class 2B, member 2						mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2																		---	---	---	---
TBC1D14	57533	broad.mit.edu	37	4	6943370	6943370	+	Intron	DEL	C	-	-	rs66534966		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6943370delC	uc011bwg.1	+						TBC1D14_uc003gjs.3_Intron|uc003gjt.1_5'Flank	NM_001113361	NP_001106832			TBC1 domain family, member 14 isoform a							intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2																		---	---	---	---
TBC1D14	57533	broad.mit.edu	37	4	6964623	6964624	+	Intron	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6964623_6964624delCA	uc011bwg.1	+						TBC1D14_uc003gjs.3_Intron	NM_001113361	NP_001106832			TBC1 domain family, member 14 isoform a							intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2																		---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7505223	7505226	+	Intron	DEL	AGAG	-	-	rs141727873		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7505223_7505226delAGAG	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SH3TC1	54436	broad.mit.edu	37	4	8240976	8240977	+	Intron	DEL	AC	-	-	rs140515536		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8240976_8240977delAC	uc003gkv.3	+						SH3TC1_uc003gkw.3_Intron|SH3TC1_uc003gkx.3_Intron|SH3TC1_uc003gky.2_Intron	NM_018986	NP_061859			SH3 domain and tetratricopeptide repeats 1								binding			large_intestine(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	8313243	8313243	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8313243delA								HTRA3 (4413 upstream) : ACOX3 (54767 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	10284300	10284300	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10284300delT								WDR1 (165727 upstream) : ZNF518B (157205 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	10958242	10958242	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10958242delA								CLNK (271856 upstream) : MIR572 (412209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	11050723	11050723	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11050723delT								CLNK (364337 upstream) : MIR572 (319728 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13359168	13359169	+	IGR	DEL	AT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13359168_13359169delAT								HSP90AB2P (19244 upstream) : RAB28 (10178 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	14861251	14861252	+	Intron	INS	-	AGG	AGG	rs71276855		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14861251_14861252insAGG	uc003gne.2	-						uc003gnf.2_Intron					Homo sapiens cDNA clone IMAGE:3604199, **** WARNING: chimeric clone ****.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	14905404	14905411	+	IGR	DEL	TCTCTCTC	-	-	rs112578734		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14905404_14905411delTCTCTCTC								None (None upstream) : CPEB2 (100111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	15119307	15119308	+	IGR	INS	-	T	T	rs143136850	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15119307_15119308insT								CPEB2 (47533 upstream) : C1QTNF7 (222252 downstream)																																			---	---	---	---
C1QTNF7	114905	broad.mit.edu	37	4	15338669	15338676	+	5'Flank	DEL	CACACACA	-	-	rs58511826		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15338669_15338676delCACACACA	uc003gno.2	+							NM_001135170	NP_001128642			C1q and tumor necrosis factor related protein 7							collagen					0																		---	---	---	---
CC2D2A	57545	broad.mit.edu	37	4	15517757	15517757	+	Intron	DEL	T	-	-	rs142208236		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15517757delT	uc010idv.2	+						CC2D2A_uc003gnx.2_Intron|CC2D2A_uc003gnv.2_Intron|uc003gny.1_5'Flank	NM_001080522	NP_001073991			coiled-coil and C2 domain containing 2A isoform						cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3																		---	---	---	---
PROM1	8842	broad.mit.edu	37	4	15971791	15971791	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15971791delC	uc003goo.2	-						PROM1_uc003gor.2_Intron|PROM1_uc003gos.2_Intron|PROM1_uc003got.2_Intron|PROM1_uc003gou.2_Intron|PROM1_uc003gop.2_Intron|PROM1_uc003goq.3_Intron	NM_006017	NP_006008			prominin 1 isoform 1						camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7																		---	---	---	---
LDB2	9079	broad.mit.edu	37	4	16662455	16662455	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16662455delG	uc003goz.2	-						LDB2_uc003gpa.2_Intron|LDB2_uc003gpb.2_Intron|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Intron|LDB2_uc011bxi.1_Intron	NM_001290	NP_001281			LIM domain binding 2 isoform a								LIM domain binding|transcription cofactor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	17394527	17394538	+	IGR	DEL	AGGGTGGAAGGA	-	-	rs71165100		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17394527_17394538delAGGGTGGAAGGA								LDB2 (494103 upstream) : QDPR (93482 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	18069018	18069018	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18069018delT								LCORL (45633 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	18848811	18848812	+	IGR	DEL	CA	-	-	rs112820408		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18848811_18848812delCA								LCORL (825426 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	20011366	20011366	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20011366delG								None (None upstream) : SLIT2 (243869 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	20119346	20119347	+	IGR	INS	-	AAC	AAC	rs146382408	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20119346_20119347insAAC								None (None upstream) : SLIT2 (135888 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	20642364	20642366	+	IGR	DEL	TAT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20642364_20642366delTAT								SLIT2 (21576 upstream) : PACRGL (55539 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	22218150	22218150	+	IGR	DEL	T	-	-	rs78121351		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22218150delT								KCNIP4 (267776 upstream) : GPR125 (170849 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	22300774	22300774	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22300774delT								KCNIP4 (350400 upstream) : GPR125 (88225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	22676736	22676739	+	IGR	DEL	CCCC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22676736_22676739delCCCC								GPR125 (159064 upstream) : GBA3 (17809 downstream)																																			---	---	---	---
CCDC149	91050	broad.mit.edu	37	4	24929393	24929394	+	Intron	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24929393_24929394delCA	uc011bxr.1	-						CCDC149_uc003gre.2_Intron	NM_173463	NP_775734			coiled-coil domain containing 149 isoform 1												0		Breast(46;0.173)																---	---	---	---
PI4K2B	55300	broad.mit.edu	37	4	25162626	25162627	+	Intron	INS	-	AC	AC	rs142250013	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25162626_25162627insAC	uc011bxs.1	+						uc003grj.2_Intron|SEPSECS_uc003gri.2_5'Flank|SEPSECS_uc003grg.2_5'Flank|SEPSECS_uc003grh.2_5'Flank	NM_018323	NP_060793			phosphatidylinositol 4-kinase type 2 beta							cytoplasm|membrane	1-phosphatidylinositol 4-kinase activity|ATP binding			ovary(2)|skin(2)	4		Breast(46;0.173)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	26844147	26844148	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26844147_26844148insT								TBC1D19 (87232 upstream) : STIM2 (18216 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	27032583	27032583	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27032583delA								STIM2 (6775 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	29733220	29733221	+	IGR	INS	-	GGTG	GGTG	rs144170087	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29733220_29733221insGGTG								None (None upstream) : PCDH7 (988816 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	30567496	30567497	+	IGR	INS	-	TT	TT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30567496_30567497insTT								None (None upstream) : PCDH7 (154540 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	31330379	31330379	+	IGR	DEL	A	-	-	rs59848516		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31330379delA								PCDH7 (181958 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	31538018	31538019	+	IGR	INS	-	GT	GT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31538018_31538019insGT								PCDH7 (389597 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	31661443	31661443	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31661443delG								PCDH7 (513022 upstream) : None (None downstream)																																			---	---	---	---
ARAP2	116984	broad.mit.edu	37	4	36200019	36200019	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36200019delC	uc003gsq.1	-						ARAP2_uc003gsr.1_Intron	NM_015230	NP_056045			ArfGAP with RhoGAP domain, ankyrin repeat and PH						regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
TBC1D1	23216	broad.mit.edu	37	4	37938613	37938613	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37938613delA	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron	NM_015173	NP_055988			TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	38324513	38324514	+	IGR	DEL	TG	-	-	rs61251470	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38324513_38324514delTG								TBC1D1 (183720 upstream) : FLJ13197 (289808 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	38787712	38787712	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38787712delC								TLR10 (3123 upstream) : TLR1 (10166 downstream)																																			---	---	---	---
TLR6	10333	broad.mit.edu	37	4	38838659	38838659	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38838659delA	uc010ifg.1	-							NM_006068	NP_006059			toll-like receptor 6 precursor						activation of NF-kappaB-inducing kinase activity|cellular response to diacyl bacterial lipopeptide|defense response to bacterium|detection of diacyl bacterial lipopeptide|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-6 biosynthetic process|positive regulation of JUN kinase activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	integral to plasma membrane|phagocytic vesicle membrane	lipopeptide binding|transmembrane receptor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	39657858	39657858	+	IGR	DEL	T	-	-	rs34185140		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39657858delT								C4orf34 (17377 upstream) : UBE2K (41806 downstream)																																			---	---	---	---
PDS5A	23244	broad.mit.edu	37	4	39907992	39907992	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39907992delA	uc003guv.3	-						PDS5A_uc010ifo.2_Intron|PDS5A_uc003guw.3_Intron	NM_001100399	NP_001093869			PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0																		---	---	---	---
RBM47	54502	broad.mit.edu	37	4	40562456	40562457	+	Intron	INS	-	A	A	rs145969065	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40562456_40562457insA	uc003gvc.2	-						RBM47_uc003gve.2_Intron|RBM47_uc011bys.1_Intron	NM_001098634	NP_001092104			RNA binding motif protein 47 isoform a							nucleus	nucleotide binding|RNA binding			breast(3)	3																		---	---	---	---
LIMCH1	22998	broad.mit.edu	37	4	41552484	41552484	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41552484delG	uc003gvu.3	+						LIMCH1_uc003gvt.1_Intron|LIMCH1_uc003gvv.3_Intron|LIMCH1_uc003gvw.3_Intron|LIMCH1_uc003gvx.3_Intron|LIMCH1_uc003gwe.3_Intron|LIMCH1_uc003gvy.3_Intron|LIMCH1_uc003gwa.3_Intron|LIMCH1_uc003gvz.3_Intron	NM_014988	NP_055803			LIM and calponin homology domains 1 isoform a						actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
SLC30A9	10463	broad.mit.edu	37	4	42027977	42027978	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42027977_42027978insT	uc003gwl.2	+						SLC30A9_uc011byx.1_Intron	NM_006345	NP_006336			solute carrier family 30 (zinc transporter),						nucleotide-excision repair|zinc ion transport	cytoskeleton|integral to membrane|nucleus	cation transmembrane transporter activity|nucleotide binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	42386138	42386139	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42386138_42386139insT								BEND4 (231243 upstream) : SHISA3 (13717 downstream)																																			---	---	---	---
ATP8A1	10396	broad.mit.edu	37	4	42599222	42599222	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42599222delC	uc003gwr.2	-						ATP8A1_uc003gws.2_Intron|ATP8A1_uc011byz.1_Intron	NM_006095	NP_006086			ATPase, aminophospholipid transporter (APLT),						ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	45150328	45150329	+	IGR	DEL	TA	-	-	rs34544463		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45150328_45150329delTA								GNPDA2 (421716 upstream) : GABRG1 (887460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	45618185	45618186	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45618185_45618186insA								GNPDA2 (889573 upstream) : GABRG1 (419603 downstream)																																			---	---	---	---
GABRB1	2560	broad.mit.edu	37	4	47106524	47106525	+	Intron	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47106524_47106525delTC	uc003gxh.2	+						GABRB1_uc011bze.1_Intron	NM_000812	NP_000803			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
GABRB1	2560	broad.mit.edu	37	4	47129548	47129548	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47129548delT	uc003gxh.2	+						GABRB1_uc011bze.1_Intron	NM_000812	NP_000803			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
FRYL	285527	broad.mit.edu	37	4	48701816	48701816	+	Intron	DEL	T	-	-	rs79243746		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48701816delT	uc003gyh.1	-						FRYL_uc003gyk.2_Intron|FRYL_uc003gym.1_Intron|FRYL_uc003gyn.3_Intron	NM_015030	NP_055845			furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	49534603	49534604	+	IGR	INS	-	T	T	rs143333563		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49534603_49534604insT								CWH43 (470510 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49553205	49553206	+	IGR	INS	-	AA	AA	rs140287535	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49553205_49553206insAA								CWH43 (489112 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49646152	49646153	+	IGR	INS	-	AATGG	AATGG	rs62642671		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49646152_49646153insAATGG								CWH43 (582059 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	53423101	53423102	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53423101_53423102delTC								SPATA18 (459644 upstream) : USP46 (34027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	53622700	53622700	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53622700delC								KIAA0114 (42395 upstream) : RASL11B (105795 downstream)																																			---	---	---	---
SCFD2	152579	broad.mit.edu	37	4	54202419	54202419	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54202419delA	uc003gzu.2	-						SCFD2_uc010igm.2_Intron	NM_152540	NP_689753			sec1 family domain containing 2						protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)															---	---	---	---
PDGFRA	5156	broad.mit.edu	37	4	55088843	55088843	+	Intron	DEL	T	-	-	rs67980234		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55088843delT	uc003haa.2	+							NM_006206	NP_006197			platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	55345263	55345263	+	IGR	DEL	T	-	-	rs35284941		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55345263delT								PDGFRA (180852 upstream) : KIT (178832 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	55610306	55610307	+	IGR	INS	-	A	A	rs138827568	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55610306_55610307insA								KIT (3427 upstream) : KDR (334120 downstream)																																			---	---	---	---
KDR	3791	broad.mit.edu	37	4	55975258	55975259	+	Intron	INS	-	T	T	rs142959257	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55975258_55975259insT	uc003has.2	-						KDR_uc003hat.1_Intron|KDR_uc011bzx.1_Intron	NM_002253	NP_002244			kinase insert domain receptor precursor						angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			---	---	---	---
AASDH	132949	broad.mit.edu	37	4	57225278	57225279	+	Intron	INS	-	T	T	rs35128813		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57225278_57225279insT	uc003hbn.2	-						AASDH_uc010ihb.2_Intron|AASDH_uc011caa.1_Intron|AASDH_uc003hbo.2_Intron|AASDH_uc011cab.1_Intron|AASDH_uc010ihc.2_Intron|AASDH_uc003hbp.2_Intron	NM_181806	NP_861522			aminoadipate-semialdehyde dehydrogenase						fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	57730834	57730835	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57730834_57730835insT								SPINK2 (42941 upstream) : REST (43207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	58792255	58792255	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58792255delG								IGFBP7 (815716 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	59183640	59183641	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59183640_59183641delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	59359009	59359010	+	IGR	INS	-	TT	TT	rs71659171		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59359009_59359010insTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	59477035	59477035	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59477035delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	60087668	60087669	+	IGR	DEL	AG	-	-	rs79988750		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:60087668_60087669delAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	60630175	60630176	+	IGR	INS	-	A	A	rs141723224	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:60630175_60630176insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	62027343	62027343	+	IGR	DEL	C	-	-	rs34382933		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62027343delC								None (None upstream) : LPHN3 (39631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	63832875	63832875	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63832875delA								LPHN3 (894708 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65285410	65285411	+	IGR	INS	-	TG	TG	rs142412352	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65285410_65285411insTG								TECRL (10232 upstream) : EPHA5 (899871 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	66108244	66108244	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66108244delC								TECRL (833066 upstream) : EPHA5 (77038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	67593227	67593227	+	IGR	DEL	T	-	-	rs71659236		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67593227delT								MIR1269 (450581 upstream) : CENPC1 (744762 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	68005802	68005803	+	IGR	INS	-	T	T	rs78608752		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68005802_68005803insT								MIR1269 (863156 upstream) : CENPC1 (332186 downstream)																																			---	---	---	---
STAP1	26228	broad.mit.edu	37	4	68454071	68454072	+	Intron	INS	-	GAT	GAT	rs112837903		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68454071_68454072insGAT	uc003hde.3	+						STAP1_uc003hdf.2_Intron	NM_012108	NP_036240			signal transducing adaptor family member 1						cellular membrane fusion|intracellular protein transport	cytoplasm					0																		---	---	---	---
TMPRSS11F	389208	broad.mit.edu	37	4	68984798	68984798	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68984798delT	uc003hdt.1	-							NM_207407	NP_997290			transmembrane protease, serine 11F						proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	69272198	69272199	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69272198_69272199insT								YTHDC1 (56374 upstream) : UGT2B15 (240117 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	69404086	69404086	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69404086delG								YTHDC1 (188262 upstream) : UGT2B15 (108230 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	69953441	69953442	+	IGR	INS	-	T	T	rs144901612	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69953441_69953442insT								UGT2A3 (135932 upstream) : UGT2B7 (8751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	70184076	70184077	+	IGR	INS	-	AC	AC	rs35708634		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70184076_70184077insAC								UGT2B28 (23309 upstream) : UGT2B4 (161807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	70417544	70417544	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70417544delC								UGT2B4 (25812 upstream) : UGT2A1 (36592 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	70419721	70419721	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70419721delA								UGT2B4 (27989 upstream) : UGT2A1 (34415 downstream)																																			---	---	---	---
UGT2A1	10941	broad.mit.edu	37	4	70509457	70509457	+	Intron	DEL	T	-	-	rs4148285	byFrequency;by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70509457delT	uc003hem.3	-						UGT2A1_uc011caq.1_Intron|UGT2A1_uc010ihu.2_Intron|UGT2A1_uc010iht.2_Intron	NM_006798	NP_006789			UDP glucuronosyltransferase 2 family,						detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	73744747	73744747	+	IGR	DEL	T	-	-	rs33929060		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73744747delT								ADAMTS3 (310231 upstream) : COX18 (175669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	74431465	74431465	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74431465delT								AFM (61748 upstream) : RASSF6 (7397 downstream)																																			---	---	---	---
AREG	374	broad.mit.edu	37	4	75334767	75334768	+	Intron	INS	-	T	T	rs144722650	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75334767_75334768insT	uc011cbl.1	+							NM_001657	NP_001648			amphiregulin preproprotein						cell proliferation|cell-cell signaling|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|positive regulation of DNA replication	cell surface|extracellular space|integral to membrane	cytokine activity|growth factor activity				0			Lung(101;0.196)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	76379691	76379691	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76379691delA								PARM1 (404368 upstream) : RCHY1 (24664 downstream)																																			---	---	---	---
CCDC158	339965	broad.mit.edu	37	4	77272457	77272457	+	Intron	DEL	A	-	-	rs112268994		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77272457delA	uc003hkb.3	-							NM_001042784	NP_001036249			coiled-coil domain containing 158											skin(3)|ovary(2)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	77719008	77719009	+	IGR	INS	-	T	T	rs147374228	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77719008_77719009insT								SHROOM3 (14605 upstream) : ANKRD56 (97074 downstream)																																			---	---	---	---
SEPT11	55752	broad.mit.edu	37	4	77888593	77888593	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77888593delA	uc003hkj.2	+						SEPT11_uc010ijh.1_Intron|SEPT11_uc011cca.1_Intron	NM_018243	NP_060713			septin 11						cell cycle|cell division|protein heterooligomerization	axon|cell junction|dendritic spine|septin complex|stress fiber|synapse	GTP binding|protein binding				0																		---	---	---	---
SEPT11	55752	broad.mit.edu	37	4	77957911	77957911	+	3'UTR	DEL	T	-	-	rs34042120		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77957911delT	uc003hkj.2	+	10					SEPT11_uc011cca.1_3'UTR	NM_018243	NP_060713			septin 11						cell cycle|cell division|protein heterooligomerization	axon|cell junction|dendritic spine|septin complex|stress fiber|synapse	GTP binding|protein binding				0																		---	---	---	---
FRAS1	80144	broad.mit.edu	37	4	79051327	79051328	+	Intron	INS	-	T	T	rs149461620	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79051327_79051328insT	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron	NM_025074	NP_079350			Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	79919702	79919702	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79919702delT	uc003hlr.1	+											Homo sapiens full length insert cDNA clone YY75G10.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	84541150	84541150	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84541150delA								AGPAT9 (14125 upstream) : NKX6-1 (873286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	84616348	84616348	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84616348delT								AGPAT9 (89323 upstream) : NKX6-1 (798088 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	85944903	85944904	+	IGR	DEL	AT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85944903_85944904delAT								C4orf12 (16735 upstream) : ARHGAP24 (451380 downstream)																																			---	---	---	---
ARHGAP24	83478	broad.mit.edu	37	4	86661378	86661378	+	Intron	DEL	T	-	-	rs35165918		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86661378delT	uc003hpk.2	+						ARHGAP24_uc003hpj.2_Intron	NM_001025616	NP_001020787			Rho GTPase activating protein 24 isoform 1						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)														---	---	---	---
MAPK10	5602	broad.mit.edu	37	4	87160943	87160943	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87160943delA	uc003hpq.2	-						MAPK10_uc010ikg.2_Intron|MAPK10_uc003hpr.2_Intron|MAPK10_uc003hps.2_Intron|MAPK10_uc003hpt.2_Intron|MAPK10_uc003hpu.2_Intron|MAPK10_uc003hpv.2_Intron|MAPK10_uc010ikh.1_Intron	NM_138982	NP_620448			mitogen-activated protein kinase 10 isoform 2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|MAP kinase kinase activity|protein binding			stomach(1)|breast(1)|central_nervous_system(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)														---	---	---	---
SLC10A6	345274	broad.mit.edu	37	4	87751384	87751384	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87751384delA	uc003hqd.2	-							NM_197965	NP_932069			sodium-dependent organic anion transporter							integral to membrane|plasma membrane	bile acid:sodium symporter activity				0		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	89253995	89253996	+	IGR	INS	-	T	T	rs143723390	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89253995_89253996insT								PPM1K (48107 upstream) : HERC6 (45895 downstream)																																			---	---	---	---
HERC3	8916	broad.mit.edu	37	4	89619053	89619053	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89619053delC	uc003hrw.1	+						HERC3_uc011cdn.1_Intron|HERC3_uc011cdo.1_Intron|NAP1L5_uc003hrx.2_5'Flank	NM_014606	NP_055421			hect domain and RLD 3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	90436608	90436608	+	IGR	DEL	A	-	-	rs34873358		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90436608delA								GPRIN3 (207447 upstream) : SNCA (208643 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	90539174	90539174	+	IGR	DEL	A	-	-	rs75406063		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90539174delA								GPRIN3 (310013 upstream) : SNCA (106077 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	93006580	93006580	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93006580delA								FAM190A (483211 upstream) : GRID2 (218970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	93051306	93051307	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93051306_93051307delAC								FAM190A (527937 upstream) : GRID2 (174243 downstream)																																			---	---	---	---
GRID2	2895	broad.mit.edu	37	4	93359339	93359339	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93359339delT	uc011cdt.1	+						GRID2_uc010ikx.2_Intron|GRID2_uc011cdu.1_Intron	NM_001510	NP_001501			glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
GRID2	2895	broad.mit.edu	37	4	94681568	94681568	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94681568delT	uc011cdt.1	+						GRID2_uc011cdu.1_Intron	NM_001510	NP_001501			glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
BMPR1B	658	broad.mit.edu	37	4	96022446	96022446	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96022446delT	uc003htm.3	+						BMPR1B_uc010ilb.2_Intron	NM_001203	NP_001194			bone morphogenetic protein receptor, type IB						BMP signaling pathway|cartilage condensation|eye development|limb morphogenesis|ovarian cumulus expansion|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	receptor complex	ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta receptor activity			lung(4)|skin(2)|stomach(1)|breast(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	99147924	99147927	+	IGR	DEL	TGTG	-	-	rs34401876		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99147924_99147927delTGTG								C4orf37 (83533 upstream) : RAP1GDS1 (34600 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	99657828	99657829	+	IGR	DEL	CA	-	-	rs71588963		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99657828_99657829delCA								TSPAN5 (78101 upstream) : EIF4E (141778 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	100954362	100954363	+	IGR	DEL	TG	-	-	rs59192775		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100954362_100954363delTG								LOC256880 (80742 upstream) : DDIT4L (152666 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	101888057	101888057	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101888057delA								EMCN (448807 upstream) : PPP3CA (56530 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	102311857	102311857	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102311857delA								PPP3CA (43229 upstream) : BANK1 (29261 downstream)																																			---	---	---	---
BANK1	55024	broad.mit.edu	37	4	102372256	102372256	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102372256delA	uc003hvx.3	+							NM_001083907	NP_001077376			B-cell scaffold protein with ankyrin repeats 1						B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	103706140	103706140	+	IGR	DEL	T	-	-	rs35590992		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103706140delT								MANBA (23989 upstream) : UBE2D3 (9407 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	104231782	104231782	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104231782delC								CENPE (112216 upstream) : TACR3 (278843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	105463634	105463635	+	Intron	INS	-	AGA	AGA	rs148147130	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105463634_105463635insAGA	uc003hxh.1	+											Homo sapiens cDNA FLJ37242 fis, clone BRAMY2004335.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	105823164	105823164	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105823164delT								CXXC4 (407106 upstream) : TET2 (244779 downstream)																																			---	---	---	---
PPA2	27068	broad.mit.edu	37	4	106328246	106328247	+	Intron	INS	-	A	A	rs11434264		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106328246_106328247insA	uc003hxl.2	-						PPA2_uc003hxm.2_Intron|PPA2_uc003hxn.2_Intron|PPA2_uc003hxo.2_Intron|PPA2_uc003hxp.2_Intron|PPA2_uc003hxq.2_Intron|PPA2_uc003hxr.2_Intron|PPA2_uc011cfa.1_Intron	NM_176869	NP_789845			inorganic pyrophosphatase 2 isoform 1 precursor						diphosphate metabolic process|tRNA aminoacylation for protein translation	mitochondrial matrix	inorganic diphosphatase activity|magnesium ion binding			pancreas(1)	1		Myeloproliferative disorder(5;0.0255)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.03e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	107469928	107469936	+	IGR	DEL	CCTTCCCTC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107469928_107469936delCCTTCCCTC								AIMP1 (199549 upstream) : DKK2 (373024 downstream)																																			---	---	---	---
DKK2	27123	broad.mit.edu	37	4	108087410	108087410	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108087410delA	uc010ilw.1	-											Homo sapiens dickkopf-2 mRNA, complete cds.						multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space				ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	116958559	116958560	+	IGR	INS	-	A	A	rs138107975	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116958559_116958560insA								NDST4 (923527 upstream) : MIR1973 (262321 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	118188039	118188040	+	IGR	INS	-	A	A	rs138626849	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118188039_118188040insA								TRAM1L1 (181303 upstream) : NDST3 (766733 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	118774571	118774573	+	IGR	DEL	CAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118774571_118774573delCAA								TRAM1L1 (767835 upstream) : NDST3 (180200 downstream)																																			---	---	---	---
SYNPO2	171024	broad.mit.edu	37	4	119890927	119890927	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119890927delT	uc003icm.3	+						SYNPO2_uc010ina.2_Intron|SYNPO2_uc010inb.2_Intron|SYNPO2_uc011cgh.1_Intron	NM_001128933	NP_001122405			synaptopodin 2 isoform b							nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	120717722	120717723	+	IGR	INS	-	CC	CC	rs150815539	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120717722_120717723insCC								PDE5A (167741 upstream) : MAD2L1 (262856 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	120903533	120903536	+	IGR	DEL	ACAC	-	-	rs35832496		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120903533_120903536delACAC								PDE5A (353552 upstream) : MAD2L1 (77043 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	122473011	122473011	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122473011delG								QRFPR (170830 upstream) : ANXA5 (116142 downstream)																																			---	---	---	---
SPATA5	166378	broad.mit.edu	37	4	124226877	124226877	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124226877delT	uc003iez.3	+							NM_145207	NP_660208			spermatogenesis associated 5						cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0																		---	---	---	---
LOC285419	285419	broad.mit.edu	37	4	124585418	124585419	+	RNA	INS	-	TT	TT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124585418_124585419insTT	uc003ifc.2	+	3		c.2693_2694insTT			LOC285419_uc011cgn.1_Intron					Homo sapiens mRNA; cDNA DKFZp686P12109 (from clone DKFZp686P12109).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	125421027	125421028	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125421027_125421028insA								LOC285419 (569509 upstream) : ANKRD50 (164440 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	126688583	126688583	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126688583delT								MIR2054 (260121 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	127977171	127977172	+	IGR	INS	-	TG	TG	rs142298069	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:127977171_127977172insTG								None (None upstream) : INTU (576948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	128321263	128321265	+	IGR	DEL	AAT	-	-	rs10588741		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128321263_128321265delAAT								None (None upstream) : INTU (232855 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	128774258	128774259	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128774258_128774259delTG								HSPA4L (19736 upstream) : PLK4 (27786 downstream)																																			---	---	---	---
LARP1B	55132	broad.mit.edu	37	4	129008132	129008133	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129008132_129008133insT	uc003iga.2	+						LARP1B_uc003ifw.1_Intron|LARP1B_uc003ifx.2_Intron|LARP1B_uc003ify.2_Intron|LARP1B_uc003ifz.1_Intron	NM_018078	NP_060548			La ribonucleoprotein domain family member 2								RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	129702776	129702776	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129702776delA								PGRMC2 (493828 upstream) : PHF17 (28003 downstream)																																			---	---	---	---
SCLT1	132320	broad.mit.edu	37	4	130011023	130011023	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130011023delT	uc003igp.2	-						SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron|SCLT1_uc003igr.2_Intron|SCLT1_uc003igs.2_Intron|SCLT1_uc003igt.3_Intron	NM_144643	NP_653244			sodium channel associated protein 1							centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
C4orf33	132321	broad.mit.edu	37	4	130026115	130026116	+	Intron	DEL	GT	-	-	rs72329477		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130026115_130026116delGT	uc003igu.3	+						C4orf33_uc010ioc.1_Intron|C4orf33_uc010iod.2_Intron	NM_173487	NP_775758			hypothetical protein LOC132321											upper_aerodigestive_tract(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	130947680	130947680	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130947680delC								C4orf33 (913838 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	131495230	131495231	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131495230_131495231insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	131716740	131716740	+	IGR	DEL	T	-	-	rs66471984		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131716740delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	135116598	135116598	+	IGR	DEL	A	-	-	rs35607878		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:135116598delA								None (None upstream) : PABPC4L (893 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	136545785	136545785	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:136545785delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	137952135	137952136	+	IGR	INS	-	A	A	rs112139026		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137952135_137952136insA								None (None upstream) : PCDH18 (487940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	138612690	138612690	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138612690delA								PCDH18 (159042 upstream) : SLC7A11 (472558 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	139375701	139375701	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139375701delA								SLC7A11 (212198 upstream) : CCRN4L (561242 downstream)																																			---	---	---	---
ELF2	1998	broad.mit.edu	37	4	140063568	140063570	+	5'Flank	DEL	GAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140063568_140063570delGAA	uc003ihp.1	-						ELF2_uc003ihq.2_Intron	NM_201999	NP_973728			E74-like factor 2 (ets domain transcription						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2	all_hematologic(180;0.162)																	---	---	---	---
MAML3	55534	broad.mit.edu	37	4	140938390	140938390	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140938390delA	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187			mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)																	---	---	---	---
INPP4B	8821	broad.mit.edu	37	4	143553406	143553407	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143553406_143553407insA	uc003iix.3	-						INPP4B_uc003iiw.3_Intron	NM_003866	NP_003857			inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	143869337	143869337	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143869337delA								INPP4B (101733 upstream) : USP38 (236733 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	144102112	144102112	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144102112delT								INPP4B (334508 upstream) : USP38 (3958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	144476723	144476723	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144476723delT								SMARCA5 (2157 upstream) : LOC441046 (3902 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	145814463	145814463	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145814463delA								HHIP (154582 upstream) : ANAPC10 (101851 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	146124187	146124187	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146124187delT								OTUD4 (23355 upstream) : SMAD1 (278764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	148358793	148358794	+	IGR	INS	-	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148358793_148358794insG								MIR548G (92924 upstream) : EDNRA (43113 downstream)																																			---	---	---	---
NR3C2	4306	broad.mit.edu	37	4	149046736	149046736	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149046736delT	uc003ilj.3	-						NR3C2_uc003ilk.3_Intron|NR3C2_uc010iph.2_Intron	NM_000901	NP_000892			nuclear receptor subfamily 3, group C, member 2						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	149407050	149407051	+	IGR	DEL	GT	-	-	rs113645251		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149407050_149407051delGT								NR3C2 (43407 upstream) : None (None downstream)																																			---	---	---	---
DCLK2	166614	broad.mit.edu	37	4	151024650	151024650	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151024650delA	uc003ilm.3	+						DCLK2_uc003iln.3_Intron|DCLK2_uc003ilo.3_Intron|DCLK2_uc003ilp.3_Intron	NM_001040260	NP_001035350			doublecortin-like kinase 2 isoform a						intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity			ovary(3)	3	all_hematologic(180;0.151)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	152221879	152221880	+	IGR	INS	-	A	A	rs138086227	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152221879_152221880insA								PRSS48 (9276 upstream) : FAM160A1 (108518 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	153459651	153459651	+	RNA	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153459651delA	uc003imv.2	+	1		c.2236delA								Homo sapiens mRNA; cDNA DKFZp434I0714 (from clone DKFZp434I0714).																														---	---	---	---
ARFIP1	27236	broad.mit.edu	37	4	153719399	153719399	+	Intron	DEL	A	-	-	rs35638428		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153719399delA	uc003imz.2	+						ARFIP1_uc003inb.2_Intron|ARFIP1_uc003ina.2_Intron|ARFIP1_uc003inc.2_Intron|ARFIP1_uc011cij.1_Intron	NM_001025595	NP_001020766			ADP-ribosylation factor interacting protein 1						intracellular protein transport|regulation of protein secretion	cytosol|Golgi membrane				ovary(1)	1	all_hematologic(180;0.093)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	153966713	153966714	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153966713_153966714insT								FHDC1 (65865 upstream) : TRIM2 (107556 downstream)																																			---	---	---	---
RNF175	285533	broad.mit.edu	37	4	154638686	154638687	+	Intron	INS	-	AC	AC	rs141108229	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154638686_154638687insAC	uc003int.2	-						RNF175_uc003inu.1_Intron	NM_173662	NP_775933			ring finger protein 175							integral to membrane	zinc ion binding			ovary(1)|pancreas(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	156362468	156362471	+	IGR	DEL	AAAG	-	-	rs143785420		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156362468_156362471delAAAG								MAP9 (64346 upstream) : GUCY1A3 (225391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	156956392	156956393	+	IGR	INS	-	A	A	rs139274083	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156956392_156956393insA								CTSO (81344 upstream) : PDGFC (726371 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	158646531	158646532	+	IGR	DEL	CT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158646531_158646532delCT								LOC340017 (149236 upstream) : FAM198B (399201 downstream)																																			---	---	---	---
C4orf45	152940	broad.mit.edu	37	4	160013239	160013239	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160013239delA	uc010iqt.1	-											Homo sapiens cDNA FLJ25371 fis, clone TST01885.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	160119528	160119529	+	IGR	INS	-	TTCC	TTCC	rs145232208	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160119528_160119529insTTCC								C4orf45 (95423 upstream) : RAPGEF2 (69469 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	161391218	161391219	+	IGR	INS	-	TTT	TTT	rs11452944		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161391218_161391219insTTT								None (None upstream) : FSTL5 (913832 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	163408364	163408365	+	IGR	INS	-	AA	AA	rs35624214		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:163408364_163408365insAA								FSTL5 (323178 upstream) : NAF1 (639495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	164018812	164018813	+	IGR	INS	-	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164018812_164018813insC								FSTL5 (933626 upstream) : NAF1 (29047 downstream)																																			---	---	---	---
NAF1	92345	broad.mit.edu	37	4	164090175	164090178	+	5'Flank	DEL	AATT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164090175_164090178delAATT	uc003iqj.2	-						NAF1_uc010iqw.1_5'Flank|NAF1_uc003iqk.2_5'Flank	NM_138386	NP_612395			nuclear assembly factor 1 homolog isoform a						rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding			ovary(2)	2	all_hematologic(180;0.166)	Prostate(90;0.109)																---	---	---	---
SPOCK3	50859	broad.mit.edu	37	4	168042625	168042625	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168042625delA	uc003iri.1	-						SPOCK3_uc011cjp.1_Intron|SPOCK3_uc011cjq.1_Intron|SPOCK3_uc011cjr.1_Intron|SPOCK3_uc003irj.1_Intron|SPOCK3_uc011cjs.1_Intron|SPOCK3_uc011cjt.1_Intron|SPOCK3_uc011cju.1_Intron|SPOCK3_uc011cjv.1_Intron|SPOCK3_uc003irk.3_Intron|SPOCK3_uc011cjw.1_Intron	NM_016950	NP_058646			testican 3 isoform 2						signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)														---	---	---	---
ANXA10	11199	broad.mit.edu	37	4	169039163	169039164	+	Intron	INS	-	TACAGGAG	TACAGGAG	rs148837288	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169039163_169039164insTACAGGAG	uc003irm.2	+							NM_007193	NP_009124			annexin A10								calcium ion binding|calcium-dependent phospholipid binding				0		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0325)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	171692959	171692960	+	IGR	INS	-	G	G	rs143718550	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:171692959_171692960insG								AADAT (681587 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	172416662	172416662	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:172416662delT								None (None upstream) : GALNTL6 (317913 downstream)																																			---	---	---	---
GALNTL6	442117	broad.mit.edu	37	4	173677790	173677790	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173677790delA	uc003isv.2	+							NM_001034845	NP_001030017			N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
SCRG1	11341	broad.mit.edu	37	4	174315345	174315345	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174315345delT	uc003ite.2	-						SCRG1_uc003itf.2_Intron	NM_007281	NP_009212			stimulator of chondrogenesis 1 precursor						nervous system development	extracellular space					0		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.15e-17)|Epithelial(43;4.33e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.62e-09)|STAD - Stomach adenocarcinoma(60;0.00278)|GBM - Glioblastoma multiforme(59;0.00659)|LUSC - Lung squamous cell carcinoma(193;0.0919)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	174365095	174365098	+	IGR	DEL	TGTG	-	-	rs72372035		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174365095_174365098delTGTG								SCRG1 (37567 upstream) : HAND2 (82554 downstream)																																			---	---	---	---
GLRA3	8001	broad.mit.edu	37	4	175666942	175666943	+	Intron	DEL	AA	-	-	rs5864289		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175666942_175666943delAA	uc003ity.1	-						GLRA3_uc003itz.1_Intron	NM_006529	NP_006520			glycine receptor, alpha 3 isoform a						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(3)	3		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)													---	---	---	---
GPM6A	2823	broad.mit.edu	37	4	176633174	176633175	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176633174_176633175delAC	uc003iuf.2	-						GPM6A_uc011ckj.1_Intron|GPM6A_uc003iug.2_Intron|GPM6A_uc003iuh.2_Intron	NM_201591	NP_963885			glycoprotein M6A isoform 2							cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)														---	---	---	---
WDR17	116966	broad.mit.edu	37	4	177013405	177013405	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177013405delC	uc003iuj.2	+						WDR17_uc003iuk.2_Intron|WDR17_uc003ium.3_Intron|WDR17_uc003iul.1_Intron	NM_170710	NP_733828			WD repeat domain 17 isoform 1											ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	177344362	177344363	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177344362_177344363delTG								SPCS3 (90968 upstream) : VEGFC (260328 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	178458320	178458321	+	Intron	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178458320_178458321delAA	uc003iux.1	+											Homo sapiens cDNA FLJ37626 fis, clone BRCOC2014748.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	181461232	181461234	+	IGR	DEL	TTG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181461232_181461234delTTG								None (None upstream) : None (None downstream)																																			---	---	---	---
DCTD	1635	broad.mit.edu	37	4	183822931	183822932	+	Intron	DEL	AA	-	-	rs33920727		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183822931_183822932delAA	uc003ivf.2	-						DCTD_uc003ivg.2_Intron|DCTD_uc010irw.2_Intron|DCTD_uc003ivh.2_Intron	NM_001921	NP_001912			dCMP deaminase isoform b						nucleotide biosynthetic process|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide metabolic process	cytosol	dCMP deaminase activity|zinc ion binding				0		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00666)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.202)		all cancers(43;1.65e-24)|Epithelial(43;3.44e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.39e-10)|Colorectal(24;4.69e-07)|COAD - Colon adenocarcinoma(29;7.07e-05)|STAD - Stomach adenocarcinoma(60;0.000118)|GBM - Glioblastoma multiforme(59;0.000472)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.0419)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	185219290	185219292	+	IGR	DEL	AAA	-	-	rs71591628		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185219290_185219292delAAA								ENPP6 (80176 upstream) : IRF2 (89586 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	186030163	186030166	+	IGR	DEL	ACAG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186030163_186030166delACAG								HELT (88205 upstream) : SLC25A4 (34232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190201182	190201182	+	IGR	DEL	T	-	-	rs66862727		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190201182delT								None (None upstream) : FRG1 (660792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190651498	190651499	+	IGR	INS	-	AT	AT	rs141849957		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190651498_190651499insAT								None (None upstream) : FRG1 (210475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190814786	190814786	+	Intron	DEL	T	-	-	rs113408955		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190814786delT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	190853199	190853200	+	Intron	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190853199_190853200delTT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																														---	---	---	---
PDCD6	10016	broad.mit.edu	37	5	301434	301434	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:301434delG	uc003jat.1	+						AHRR_uc003jav.2_5'Flank|AHRR_uc003jaw.2_5'Flank|AHRR_uc010isy.2_5'Flank|PDCD6_uc003jau.1_Intron	NM_013232	NP_037364			programmed cell death 6						induction of apoptosis by extracellular signals|response to calcium ion	endoplasmic reticulum membrane|nuclear membrane	binding, bridging|calcium ion binding|calcium-dependent protein binding			breast(1)	1			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)															---	---	---	---
SLC9A3	6550	broad.mit.edu	37	5	474871	474872	+	Intron	DEL	CT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:474871_474872delCT	uc003jbe.2	-						SLC9A3_uc011clx.1_Intron|LOC25845_uc003jbd.2_5'Flank|LOC25845_uc010itb.1_5'Flank	NM_004174	NP_004165			solute carrier family 9 (sodium/hydrogen							cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)															---	---	---	---
SLC9A3	6550	broad.mit.edu	37	5	517861	517862	+	Intron	INS	-	CCAT	CCAT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:517861_517862insCCAT	uc003jbe.2	-						SLC9A3_uc011clx.1_Intron	NM_004174	NP_004165			solute carrier family 9 (sodium/hydrogen							cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)															---	---	---	---
NKD2	85409	broad.mit.edu	37	5	1025858	1025859	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1025858_1025859insA	uc003jbt.1	+						NKD2_uc010itf.1_Intron	NM_033120	NP_149111			naked cuticle homolog 2						exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding				0	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	2566701	2566702	+	IGR	INS	-	T	T	rs147389818	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2566701_2566702insT								IRX4 (683821 upstream) : IRX2 (179579 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3088723	3088740	+	IGR	DEL	AGAGTAGAGAAACAATAG	-	-	rs11274537		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3088723_3088740delAGAGTAGAGAAACAATAG								C5orf38 (333211 upstream) : IRX1 (507428 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3349880	3349881	+	IGR	INS	-	AC	AC	rs140297722	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3349880_3349881insAC								C5orf38 (594368 upstream) : IRX1 (246287 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4382375	4382376	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4382375_4382376insA								IRX1 (780859 upstream) : LOC340094 (652096 downstream)																																			---	---	---	---
LOC255167	255167	broad.mit.edu	37	5	6585298	6585299	+	Intron	INS	-	AC	AC	rs139131469	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6585298_6585299insAC	uc003jdq.2	+						LOC255167_uc003jdr.2_Intron	NR_024423				Homo sapiens cDNA FLJ43293 fis, clone MESAN2017373.												0																		---	---	---	---
C5orf49	134121	broad.mit.edu	37	5	7853828	7853828	+	5'Flank	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7853828delC	uc003jea.3	-							NM_001089584	NP_001083053			hypothetical protein LOC134121												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	8208813	8208813	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8208813delT								MTRR (307580 upstream) : SEMA5A (826325 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	8232133	8232134	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8232133_8232134insT								MTRR (330900 upstream) : SEMA5A (803004 downstream)																																			---	---	---	---
SEMA5A	9037	broad.mit.edu	37	5	9524046	9524046	+	Intron	DEL	T	-	-	rs79953689		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9524046delT	uc003jek.2	-							NM_003966	NP_003957			semaphorin 5A precursor						cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SEMA5A	9037	broad.mit.edu	37	5	9547342	9547342	+	5'Flank	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9547342delA	uc003jek.2	-						SNORD123_uc010itp.1_5'Flank	NM_003966	NP_003957			semaphorin 5A precursor						cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	12707131	12707133	+	Intron	DEL	AAG	-	-	rs10572014		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12707131_12707133delAAG	uc003jfb.1	+						uc010itv.1_Intron					Homo sapiens TAG1 mRNA, complete sequence.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	14090044	14090045	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14090044_14090045insA								DNAH5 (145455 upstream) : TRIO (53784 downstream)																																			---	---	---	---
FBXL7	23194	broad.mit.edu	37	5	15626653	15626654	+	Intron	INS	-	TG	TG	rs147088366	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15626653_15626654insTG	uc003jfn.1	+							NM_012304	NP_036436			F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3																		---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21564551	21564554	+	Intron	DEL	AAAA	-	-	rs71706943		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21564551_21564554delAAAA	uc003jgh.3	+							NR_027026				Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	21699600	21699600	+	Intron	DEL	T	-	-	rs77966192		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21699600delT	uc003jgj.2	+											Homo sapiens, clone IMAGE:5171606, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	23573348	23573355	+	IGR	DEL	GTGTGTGT	-	-	rs10534453		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23573348_23573355delGTGTGTGT								PRDM9 (44644 upstream) : CDH10 (913855 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	29431440	29431441	+	IGR	INS	-	ACC	ACC	rs143985077	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29431440_29431441insACC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	30218288	30218288	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30218288delT								None (None upstream) : CDH6 (975508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	31129888	31129889	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31129888_31129889insT								None (None upstream) : CDH6 (63907 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	33354874	33354875	+	IGR	INS	-	AC	AC	rs61329726		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33354874_33354875insAC								C5orf23 (563055 upstream) : TARS (85927 downstream)																																			---	---	---	---
DNAJC21	134218	broad.mit.edu	37	5	34954259	34954259	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34954259delT	uc003jjc.2	+						DNAJC21_uc003jjb.2_Intron	NM_001012339	NP_001012339			DnaJ homology subfamily A member 5 isoform 2						protein folding	ribosome	heat shock protein binding|nucleic acid binding|unfolded protein binding|zinc ion binding			breast(1)|skin(1)	2	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)															---	---	---	---
SLC1A3	6507	broad.mit.edu	37	5	36676751	36676752	+	Intron	DEL	TG	-	-	rs34955617		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36676751_36676752delTG	uc003jkj.3	+						SLC1A3_uc011cox.1_Intron|SLC1A3_uc010iuy.2_Intron	NM_004172	NP_004163			solute carrier family 1 (glial high affinity						D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)													---	---	---	---
LIFR	3977	broad.mit.edu	37	5	38505270	38505270	+	Intron	DEL	A	-	-	rs34098934		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38505270delA	uc010ive.1	-						LIFR_uc003jli.2_Intron	NM_001127671	NP_001121143			leukemia inhibitory factor receptor precursor						positive regulation of cell proliferation	extracellular region|integral to plasma membrane	ciliary neurotrophic factor receptor binding|growth factor binding|leukemia inhibitory factor receptor activity			ovary(3)|large_intestine(1)	4	all_lung(31;0.00021)							T	PLAG1	salivary adenoma								---	---	---	---
OSMR	9180	broad.mit.edu	37	5	38853621	38853621	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38853621delC	uc003jln.1	+						OSMR_uc003jlm.1_Intron	NM_003999	NP_003990			oncostatin M receptor precursor						cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_lung(31;0.000365)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	39711631	39711631	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39711631delT								DAB2 (286296 upstream) : PTGER4 (968401 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	39733916	39733916	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39733916delA								DAB2 (308581 upstream) : PTGER4 (946116 downstream)																																			---	---	---	---
PLCXD3	345557	broad.mit.edu	37	5	41367091	41367092	+	Intron	DEL	AT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41367091_41367092delAT	uc003jmm.1	-							NM_001005473	NP_001005473			phosphatidylinositol-specific phospholipase C, X						intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	44680965	44680966	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44680965_44680966insT								FGF10 (292181 upstream) : MRPS30 (128061 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	46341233	46341233	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46341233delA								HCN1 (645013 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	49950223	49950223	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49950223delT								EMB (212989 upstream) : PARP8 (11510 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	50996819	50996819	+	IGR	DEL	T	-	-	rs140336676		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50996819delT								ISL1 (306262 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	51392086	51392087	+	IGR	INS	-	C	C	rs146772229	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51392086_51392087insC								ISL1 (701529 upstream) : ITGA1 (691687 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	51470406	51470406	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51470406delT								ISL1 (779849 upstream) : ITGA1 (613368 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	51703877	51703877	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51703877delA								None (None upstream) : ITGA1 (379897 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	52541537	52541538	+	IGR	INS	-	T	T	rs2650687		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52541537_52541538insT								MOCS2 (135939 upstream) : FST (235057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	53714308	53714309	+	IGR	INS	-	C	C	rs147917997	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53714308_53714309insC								ARL15 (107905 upstream) : HSPB3 (37136 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	54479431	54479431	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54479431delT								CDC20B (10428 upstream) : CCNO (47552 downstream)																																			---	---	---	---
PPAP2A	8611	broad.mit.edu	37	5	54729961	54729961	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54729961delA	uc003jqa.2	-						PPAP2A_uc003jpz.2_Intron|PPAP2A_uc003jqb.2_Intron	NM_003711	NP_003702			phosphatidic acid phosphatase type 2A isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|androgen receptor signaling pathway|germ cell migration|negative regulation of cell proliferation|phospholipid dephosphorylation|regulation of lipid metabolic process|sphingolipid metabolic process	integral to plasma membrane|membrane fraction	phosphatidate phosphatase activity|sphingosine-1-phosphate phosphatase activity			ovary(2)	2		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	54866342	54866343	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54866342_54866343delTG								PPAP2A (35469 upstream) : SLC38A9 (55333 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	55354021	55354022	+	IGR	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55354021_55354022delAA								IL6ST (63258 upstream) : ANKRD55 (41486 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	55558910	55558913	+	IGR	DEL	AAAC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55558910_55558913delAAAC								ANKRD55 (29724 upstream) : MAP3K1 (551987 downstream)																																			---	---	---	---
FLJ37543	285668	broad.mit.edu	37	5	60950277	60950277	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60950277delT	uc003jst.1	+							NM_173667	NP_775938			hypothetical protein LOC285668 precursor							extracellular region					0		Lung NSC(810;0.000468)|Prostate(74;0.0283)|Breast(144;0.237)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	61533523	61533526	+	IGR	DEL	ACAC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61533523_61533526delACAC								FLJ37543 (531161 upstream) : KIF2A (68463 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	63442800	63442800	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63442800delT								HTR1A (185254 upstream) : RNF180 (18871 downstream)																																			---	---	---	---
RNF180	285671	broad.mit.edu	37	5	63635521	63635521	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63635521delT	uc003jti.2	+							NM_001113561	NP_001107033			ring finger protein 180 isoform 1							integral to membrane|nuclear envelope	zinc ion binding				0		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)														---	---	---	---
MAST4	375449	broad.mit.edu	37	5	66162745	66162748	+	Intron	DEL	TTTG	-	-	rs112391186		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66162745_66162748delTTTG	uc003jut.1	+						MAST4_uc003jur.3_Intron|MAST4_uc010iwz.2_Intron|MAST4_uc003jus.2_Intron	NM_015183	NP_055998			microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	67626542	67626543	+	IGR	DEL	AC	-	-	rs72438474		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67626542_67626543delAC								PIK3R1 (28895 upstream) : SLC30A5 (763275 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	67707086	67707086	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67707086delT								PIK3R1 (109439 upstream) : SLC30A5 (682732 downstream)																																			---	---	---	---
RAD17	5884	broad.mit.edu	37	5	68667264	68667266	+	5'Flank	DEL	CCC	-	-	rs111561357		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68667264_68667266delCCC	uc003jwo.2	+						RAD17_uc003jwg.2_Intron|RAD17_uc003jwh.2_Intron|RAD17_uc003jwi.2_Intron|RAD17_uc003jwj.2_Intron|RAD17_uc003jwk.2_Intron|RAD17_uc003jwl.2_Intron|RAD17_uc003jwm.2_Intron|RAD17_uc003jwn.2_Intron|TAF9_uc003jwa.2_5'Flank|TAF9_uc003jwb.2_5'Flank|TAF9_uc003jwd.1_5'Flank|TAF9_uc003jwe.1_5'Flank|TAF9_uc003jwf.1_5'Flank	NM_133339	NP_579917			RAD17 homolog isoform 2						cell cycle|DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint|mitotic cell cycle checkpoint|negative regulation of DNA replication|regulation of phosphorylation	nucleoplasm	ATP binding|nucleoside-triphosphatase activity|protein binding				0		Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)									Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					---	---	---	---
OCLN	4950	broad.mit.edu	37	5	68785323	68785323	+	5'Flank	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68785323delT	uc003jwu.2	+							NM_002538	NP_002529			occludin												0		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	70575695	70575695	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70575695delT	uc010iyn.2	-						uc003kbk.3_Intron					Homo sapiens cDNA FLJ78390 complete cds.																														---	---	---	---
MRPS27	23107	broad.mit.edu	37	5	71579295	71579295	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71579295delG	uc003kbz.3	-						MRPS27_uc003kca.3_Intron|MRPS27_uc011cse.1_Intron|MRPS27_uc010iza.2_Intron	NM_015084	NP_055899			mitochondrial ribosomal protein S27							mitochondrion|ribosome					0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-53)														---	---	---	---
TNPO1	3842	broad.mit.edu	37	5	72154264	72154264	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72154264delC	uc003kck.3	+						TNPO1_uc011csi.1_Intron|TNPO1_uc011csj.1_Intron|TNPO1_uc003kch.2_Intron|TNPO1_uc003kci.3_Intron|TNPO1_uc003kcg.3_Intron	NM_002270	NP_002261			transportin 1 isoform 1						interspecies interaction between organisms|mRNA metabolic process|protein import into nucleus, translocation	cytosol|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			skin(3)|urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)	7		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	72608740	72608741	+	IGR	INS	-	CTC	CTC	rs141809889	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72608740_72608741insCTC								TMEM174 (137772 upstream) : FOXD1 (133346 downstream)																																			---	---	---	---
RGNEF	64283	broad.mit.edu	37	5	72942733	72942733	+	Intron	DEL	G	-	-	rs139736938		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72942733delG	uc003kcx.2	+							NM_001080479	NP_001073948			Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)														---	---	---	---
GFM2	84340	broad.mit.edu	37	5	74038498	74038498	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74038498delT	uc003kdh.1	-						GFM2_uc003kdi.1_Intron|GFM2_uc010izj.1_Intron|GFM2_uc010izk.1_Intron|GFM2_uc003kdj.1_Intron|GFM2_uc010izl.1_Intron	NM_032380	NP_115756			mitochondrial elongation factor G2 isoform 1						mitochondrial translation|ribosome disassembly	mitochondrion	GTP binding|GTPase activity				0		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)														---	---	---	---
SV2C	22987	broad.mit.edu	37	5	75434943	75434944	+	Intron	INS	-	A	A	rs35031412		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75434943_75434944insA	uc003kei.1	+							NM_014979	NP_055794			synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	76031697	76031697	+	IGR	DEL	C	-	-	rs58255642		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76031697delC								F2R (103 upstream) : F2RL1 (83136 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	77258373	77258374	+	IGR	INS	-	A	A	rs144431326	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77258373_77258374insA								TBCA (186188 upstream) : AP3B1 (39777 downstream)																																			---	---	---	---
SCAMP1	9522	broad.mit.edu	37	5	77678346	77678346	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77678346delG	uc003kfl.2	+						SCAMP1_uc010jaa.2_Intron|SCAMP1_uc011ctc.1_Intron|SCAMP1_uc011ctd.1_Intron	NM_004866	NP_004857			secretory carrier membrane protein 1						post-Golgi vesicle-mediated transport|protein transport	integral to membrane|recycling endosome membrane|trans-Golgi network	protein binding				0		all_lung(232;0.000397)|Lung NSC(167;0.00105)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.9e-46)|Epithelial(54;9.4e-43)|all cancers(79;1.12e-37)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	78015724	78015724	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78015724delG								LHFPL2 (71076 upstream) : ARSB (57315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	78893250	78893250	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78893250delG								HOMER1 (83550 upstream) : PAPD4 (14993 downstream)																																			---	---	---	---
CMYA5	202333	broad.mit.edu	37	5	79045834	79045835	+	Intron	DEL	TT	-	-	rs112327981		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79045834_79045835delTT	uc003kgc.2	+							NM_153610	NP_705838			cardiomyopathy associated 5							perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	81703635	81703635	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81703635delA								ATP6AP1L (89489 upstream) : TMEM167A (645032 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	81721345	81721346	+	IGR	INS	-	AGG	AGG	rs141186419	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81721345_81721346insAGG								ATP6AP1L (107199 upstream) : TMEM167A (627321 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	81907956	81907956	+	IGR	DEL	A	-	-	rs112055759		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81907956delA								ATP6AP1L (293810 upstream) : TMEM167A (440711 downstream)																																			---	---	---	---
VCAN	1462	broad.mit.edu	37	5	82842062	82842062	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82842062delA	uc003kii.3	+						VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Intron	NM_004385	NP_004376			versican isoform 1 precursor						cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	83156021	83156022	+	IGR	DEL	AC	-	-	rs113412197		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83156021_83156022delAC								HAPLN1 (139125 upstream) : EDIL3 (82104 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	84941676	84941677	+	IGR	INS	-	CT	CT	rs149417502	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84941676_84941677insCT								None (None upstream) : NBPF22P (636585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	85058820	85058820	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85058820delG								None (None upstream) : NBPF22P (519442 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	85080817	85080817	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85080817delT								None (None upstream) : NBPF22P (497445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	85460599	85460599	+	IGR	DEL	A	-	-	rs35613434		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85460599delA								None (None upstream) : NBPF22P (117663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	87232186	87232186	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87232186delG								CCNH (523350 upstream) : TMEM161B (258838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	87395592	87395592	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87395592delA								CCNH (686756 upstream) : TMEM161B (95432 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	87432432	87432433	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87432432_87432433insT								CCNH (723596 upstream) : TMEM161B (58591 downstream)																																			---	---	---	---
MEF2C	4208	broad.mit.edu	37	5	88078282	88078282	+	Intron	DEL	A	-	-	rs34338734		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88078282delA	uc003kjj.2	-						MEF2C_uc003kji.2_Intron|MEF2C_uc003kjk.2_Intron|MEF2C_uc003kjm.2_Intron|MEF2C_uc003kjl.2_Intron	NM_002397	NP_002388			myocyte enhancer factor 2C isoform 1						apoptosis|B cell proliferation|innate immune response|learning or memory|muscle cell differentiation|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|neuron development|positive regulation of muscle cell differentiation|positive regulation of survival gene product expression|positive regulation of transcription from RNA polymerase II promoter|regulation of germinal center formation|regulation of megakaryocyte differentiation|regulation of synaptic activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nuclear speck	activating transcription factor binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			lung(3)|breast(2)|ovary(1)|large_intestine(1)	7		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)											HNSCC(66;0.2)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	89108703	89108704	+	IGR	INS	-	AC	AC	rs144456800	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89108703_89108704insAC								MEF2C (908834 upstream) : CETN3 (580827 downstream)																																			---	---	---	---
POLR3G	10622	broad.mit.edu	37	5	89790376	89790376	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89790376delT	uc003kjq.2	+						POLR3G_uc011cuc.1_Intron	NM_006467	NP_006458			polymerase (RNA) III (DNA directed) polypeptide						innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA-directed RNA polymerase activity				0		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;2.74e-31)|Epithelial(54;8.2e-26)|all cancers(79;3.86e-22)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	90553001	90553001	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90553001delC								GPR98 (92969 upstream) : ARRDC3 (111540 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	91366371	91366372	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91366371_91366372delGT								LOC100129716 (649840 upstream) : None (None downstream)																																			---	---	---	---
LIX1	167410	broad.mit.edu	37	5	96451631	96451631	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96451631delC	uc003kmy.3	-							NM_153234	NP_694966			limb expression 1											ovary(1)	1		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	96609502	96609502	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96609502delC								RIOK2 (90497 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	99347122	99347122	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99347122delT								None (None upstream) : LOC100133050 (368087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	101707427	101707428	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101707427_101707428delAC								SLCO4C1 (75174 upstream) : SLCO6A1 (222 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	101875350	101875350	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101875350delA								SLCO6A1 (40630 upstream) : PAM (326177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	107804848	107804849	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107804848_107804849delCA								FBXL17 (87049 upstream) : FER (278674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	108553403	108553403	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108553403delT								FER (30030 upstream) : PJA2 (117008 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	108893669	108893669	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108893669delT								PJA2 (147994 upstream) : MAN2A1 (131487 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	110117709	110117709	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110117709delC								SLC25A46 (19227 upstream) : TSLP (288069 downstream)																																			---	---	---	---
GRAMD3	65983	broad.mit.edu	37	5	125780893	125780893	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125780893delG	uc003ktu.2	+						GRAMD3_uc011cwt.1_Intron|GRAMD3_uc011cwv.1_Intron|GRAMD3_uc011cww.1_Intron|GRAMD3_uc011cwx.1_Intron|GRAMD3_uc011cwu.1_Intron	NM_023927	NP_076416			GRAM domain containing 3 isoform 2											central_nervous_system(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)														---	---	---	---
PHAX	51808	broad.mit.edu	37	5	125945404	125945405	+	Intron	INS	-	A	A	rs113976393		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125945404_125945405insA	uc003kua.1	+							NM_032177	NP_115553			RNA U, small nuclear RNA export adaptor						ncRNA metabolic process|protein transport|snRNA export from nucleus|spliceosomal snRNP assembly	Cajal body|cytosol	RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	126496030	126496033	+	IGR	DEL	CACA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126496030_126496033delCACA								FLJ44606 (86858 upstream) : MEGF10 (130423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	126621667	126621667	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126621667delG								FLJ44606 (212495 upstream) : MEGF10 (4789 downstream)																																			---	---	---	---
FBN2	2201	broad.mit.edu	37	5	127713774	127713774	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127713774delA	uc003kuu.2	-						FBN2_uc003kuv.2_Intron	NM_001999	NP_001990			fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	128057736	128057737	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128057736_128057737insA								FBN2 (183820 upstream) : SLC27A6 (243473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	129915094	129915094	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129915094delA								CHSY3 (392768 upstream) : HINT1 (579781 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	131513294	131513294	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131513294delA								CSF2 (101436 upstream) : P4HA2 (15012 downstream)																																			---	---	---	---
FSTL4	23105	broad.mit.edu	37	5	132825825	132825826	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132825825_132825826insT	uc003kyn.1	-							NM_015082	NP_055897			follistatin-like 4 precursor							extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	135057393	135057393	+	IGR	DEL	C	-	-	rs11479073		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135057393delC								LOC340074 (67769 upstream) : LOC153328 (112972 downstream)																																			---	---	---	---
SPOCK1	6695	broad.mit.edu	37	5	136312359	136312360	+	3'UTR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136312359_136312360insA	uc003lbo.2	-	10					SPOCK1_uc003lbp.2_3'UTR	NM_004598	NP_004589			sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
SPOCK1	6695	broad.mit.edu	37	5	136539648	136539648	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136539648delC	uc003lbo.2	-						SPOCK1_uc003lbp.2_Intron	NM_004598	NP_004589			sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
SPOCK1	6695	broad.mit.edu	37	5	136566737	136566738	+	Intron	INS	-	T	T	rs142837622		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136566737_136566738insT	uc003lbo.2	-						SPOCK1_uc003lbp.2_Intron	NM_004598	NP_004589			sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
KLHL3	26249	broad.mit.edu	37	5	137009526	137009527	+	Intron	INS	-	GAA	GAA	rs146026849	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137009526_137009527insGAA	uc010jek.2	-						KLHL3_uc011cyc.1_5'Flank|KLHL3_uc003lbr.3_Intron|KLHL3_uc011cyd.1_Intron|KLHL3_uc010jel.1_5'UTR|KLHL3_uc010jem.1_Intron|KLHL3_uc010jen.1_Intron|KLHL3_uc003lbs.1_Intron	NM_017415	NP_059111			kelch-like 3							cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)														---	---	---	---
MATR3	9782	broad.mit.edu	37	5	138625870	138625871	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138625870_138625871insT	uc003ldu.2	+						MATR3_uc003lds.2_Intron|MATR3_uc010jfb.2_Intron|MATR3_uc003ldt.2_Intron|MATR3_uc003ldw.2_5'Flank	NM_199189	NP_954659			matrin 3							nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	139164819	139164820	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139164819_139164820insT								CXXC5 (102139 upstream) : PSD2 (10586 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	141686579	141686580	+	IGR	INS	-	T	T	rs111578605		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141686579_141686580insT								NDFIP1 (152573 upstream) : SPRY4 (3412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	142137009	142137010	+	IGR	DEL	GT	-	-	rs140893047		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142137009_142137010delGT								FGF1 (59374 upstream) : ARHGAP26 (13282 downstream)																																			---	---	---	---
ARHGAP26	23092	broad.mit.edu	37	5	142386760	142386761	+	Intron	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142386760_142386761delAA	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886			GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
ARHGAP26	23092	broad.mit.edu	37	5	142503529	142503530	+	Intron	INS	-	ACAC	ACAC	rs140555031	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142503529_142503530insACAC	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886			GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	142919630	142919630	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142919630delA								NR3C1 (104553 upstream) : HMHB1 (272096 downstream)																																			---	---	---	---
C5orf46	389336	broad.mit.edu	37	5	147271514	147271515	+	Intron	INS	-	ACAA	ACAA	rs148339125	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147271514_147271515insACAA	uc010jgp.2	-							NM_206966	NP_996849			hypothetical protein LOC389336 precursor							extracellular region					0																		---	---	---	---
CSNK1A1	1452	broad.mit.edu	37	5	148921534	148921536	+	Intron	DEL	AAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148921534_148921536delAAA	uc003lqx.1	-						CSNK1A1_uc011dcc.1_Intron|CSNK1A1_uc003lqv.1_Intron|CSNK1A1_uc003lqw.1_Intron|CSNK1A1_uc003lqy.1_Intron|CSNK1A1_uc010jha.1_Intron	NM_001892	NP_001883			casein kinase 1, alpha 1 isoform 2						cell division|mitosis|Wnt receptor signaling pathway	centrosome|condensed chromosome kinetochore|cytosol|nuclear speck	ATP binding|protein binding|protein binding|protein serine/threonine kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)														---	---	---	---
HMGXB3	22993	broad.mit.edu	37	5	149405067	149405068	+	Intron	INS	-	T	T	rs146609632	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149405067_149405068insT	uc003lrk.3	+							NM_014983	NP_055798			HMG box domain containing 3							nucleus	DNA binding|kinase activity			kidney(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	149685676	149685677	+	IGR	DEL	TG	-	-	rs33912135		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149685676_149685677delTG								ARSI (3151 upstream) : TCOF1 (51525 downstream)																																			---	---	---	---
ANXA6	309	broad.mit.edu	37	5	150503436	150503439	+	Intron	DEL	GAGG	-	-	rs141999749		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150503436_150503439delGAGG	uc003ltl.1	-						ANXA6_uc011dcp.1_Intron|ANXA6_uc003ltm.1_Intron|ANXA6_uc003ltn.1_Intron|ANXA6_uc003lto.1_Intron	NM_001155	NP_001146			annexin VI isoform 1							melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
GM2A	2760	broad.mit.edu	37	5	150809724	150809725	+	Intron	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150809724_150809725delTT	uc011dcs.1	+							NM_000405				GM2 ganglioside activator precursor							lysosome|nucleolus	sphingolipid activator protein activity				0		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	151728109	151728110	+	IGR	DEL	CA	-	-	rs71949985		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151728109_151728110delCA								GLRA1 (423712 upstream) : NMUR2 (42992 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	152372426	152372427	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152372426_152372427insA								NMUR2 (587586 upstream) : GRIA1 (496748 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	152857648	152857649	+	IGR	INS	-	AC	AC	rs148406447	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152857648_152857649insAC								None (None upstream) : GRIA1 (11526 downstream)																																			---	---	---	---
GRIA1	2890	broad.mit.edu	37	5	153124861	153124862	+	Intron	INS	-	AAAT	AAAT	rs78748384		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153124861_153124862insAAAT	uc003lva.3	+						GRIA1_uc003luy.3_Intron|GRIA1_uc003luz.3_Intron|GRIA1_uc011dcv.1_Intron|GRIA1_uc011dcw.1_Intron|GRIA1_uc011dcx.1_Intron|GRIA1_uc011dcy.1_Intron|GRIA1_uc011dcz.1_Intron	NM_001114183	NP_001107655			glutamate receptor, ionotropic, AMPA 1 isoform						synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)													---	---	---	---
MFAP3	4238	broad.mit.edu	37	5	153435922	153435922	+	3'UTR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153435922delT	uc003lvf.2	+	3					MFAP3_uc010jib.2_3'UTR|MFAP3_uc011ddb.1_3'UTR	NM_001135037	NP_001128509			microfibrillar-associated protein 3 isoform 2							integral to membrane|plasma membrane					0	Renal(175;0.00488)	Lung NSC(249;0.00145)|all_lung(500;0.00226)|all_neural(177;0.122)|Breast(839;0.14)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;9.69e-06)|GBM - Glioblastoma multiforme(465;0.0201)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	154585176	154585176	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154585176delA								KIF4B (187491 upstream) : SGCD (549887 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	154832858	154832860	+	IGR	DEL	TTT	-	-	rs145947080		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154832858_154832860delTTT								KIF4B (435173 upstream) : SGCD (302203 downstream)																																			---	---	---	---
CYFIP2	26999	broad.mit.edu	37	5	156716406	156716406	+	Intron	DEL	G	-	-	rs62383008		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156716406delG	uc003lwq.2	+						CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwp.2_Intron	NM_001037333	NP_001032410			cytoplasmic FMR1 interacting protein 2						apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	157536853	157536854	+	IGR	DEL	TT	-	-	rs149646288		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157536853_157536854delTT								CLINT1 (250685 upstream) : EBF1 (586070 downstream)																																			---	---	---	---
IL12B	3593	broad.mit.edu	37	5	158758081	158758082	+	5'Flank	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158758081_158758082delCA	uc003lxr.1	-						uc003lxs.1_5'Flank	NM_002187	NP_002178			interleukin 12B precursor						cell cycle arrest|cell migration|defense response to Gram-negative bacterium|interferon-gamma biosynthetic process|natural killer cell activation|negative regulation of interleukin-10 production|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of cell adhesion|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to UV-B|sexual reproduction|T-helper 1 type immune response|T-helper cell differentiation	interleukin-12 complex|interleukin-23 complex|membrane	cytokine activity|cytokine receptor activity|interleukin-12 receptor binding|protein heterodimerization activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)													OREG0016990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
FABP6	2172	broad.mit.edu	37	5	159635790	159635790	+	Intron	DEL	T	-	-	rs144540032		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159635790delT	uc003lxx.1	+						FABP6_uc003lxz.1_Intron	NM_001130958	NP_001124430			gastrotropin isoform 1						bile acid and bile salt transport|bile acid metabolic process|negative regulation of cell proliferation	cytosol	transporter activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
CCNJL	79616	broad.mit.edu	37	5	159704752	159704752	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159704752delT	uc003lyb.1	-						CCNJL_uc011dee.1_Intron|CCNJL_uc003lyc.1_Intron|CCNJL_uc011def.1_Intron	NM_024565	NP_078841			cyclin J-like							nucleus					0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	162538883	162538885	+	IGR	DEL	CTT	-	-	rs71912920		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162538883_162538885delCTT								GABRG2 (956339 upstream) : CCNG1 (325692 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	164389625	164389625	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164389625delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	165913780	165913780	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165913780delA								None (None upstream) : ODZ2 (798063 downstream)																																			---	---	---	---
ODZ2	57451	broad.mit.edu	37	5	167137354	167137354	+	Intron	DEL	A	-	-	rs11336741		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167137354delA	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)														---	---	---	---
SLIT3	6586	broad.mit.edu	37	5	168599347	168599347	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168599347delA	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053			slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169202998	169202998	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169202998delT	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron	NM_004946	NP_004937			dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169435229	169435229	+	Intron	DEL	C	-	-	rs147027601		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169435229delC	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron	NM_004946	NP_004937			dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	169521728	169521729	+	IGR	INS	-	ACAC	ACAC	rs148815406	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169521728_169521729insACAC								DOCK2 (11344 upstream) : FOXI1 (11188 downstream)																																			---	---	---	---
STK10	6793	broad.mit.edu	37	5	171472405	171472406	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171472405_171472406insT	uc003mbo.1	-							NM_005990	NP_005981			serine/threonine kinase 10								ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
STK10	6793	broad.mit.edu	37	5	171495888	171495889	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171495888_171495889insA	uc003mbo.1	-							NM_005990	NP_005981			serine/threonine kinase 10								ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	171716395	171716395	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171716395delT								UBTD2 (5600 upstream) : SH3PXD2B (44110 downstream)																																			---	---	---	---
SH3PXD2B	285590	broad.mit.edu	37	5	171835154	171835154	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171835154delT	uc003mbr.2	-						SH3PXD2B_uc003mbs.1_Intron	NM_001017995	NP_001017995			SH3 and PX domains 2B						adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
ERGIC1	57222	broad.mit.edu	37	5	172291624	172291624	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172291624delT	uc003mbw.3	+						uc003mbx.2_5'Flank	NM_001031711	NP_001026881			endoplasmic reticulum-golgi intermediate						ER to Golgi vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	173433852	173433852	+	IGR	DEL	A	-	-	rs146760943	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173433852delA								C5orf47 (710 upstream) : HMP19 (38872 downstream)																																			---	---	---	---
HMP19	51617	broad.mit.edu	37	5	173475540	173475540	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173475540delG	uc003mcx.2	+							NM_015980	NP_057064			HMP19 protein						dopamine receptor signaling pathway	cytoplasmic vesicle membrane|Golgi cisterna membrane|integral to membrane|multivesicular body membrane	dopamine receptor binding			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00925)|all_lung(126;0.0148)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	173698645	173698645	+	IGR	DEL	T	-	-	rs150219818		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173698645delT								HMP19 (162464 upstream) : MSX2 (452930 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	173919946	173919946	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173919946delG								HMP19 (383765 upstream) : MSX2 (231629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174689345	174689345	+	IGR	DEL	A	-	-	rs35468011		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174689345delA								MSX2 (531444 upstream) : DRD1 (178331 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	175354501	175354501	+	IGR	DEL	T	-	-	rs77936160		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175354501delT								CPLX2 (43478 upstream) : THOC3 (32035 downstream)																																			---	---	---	---
CDHR2	54825	broad.mit.edu	37	5	176015539	176015540	+	Intron	INS	-	GA	GA	rs142821033	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176015539_176015540insGA	uc003mem.1	+						CDHR2_uc003men.1_Intron	NM_017675	NP_060145			protocadherin LKC precursor						homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2																		---	---	---	---
LOC202181	202181	broad.mit.edu	37	5	177066960	177066961	+	Intron	DEL	CG	-	-	rs80134709		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177066960_177066961delCG	uc011dgc.1	-						LOC202181_uc011dgb.1_Intron	NM_198567	NP_940969			hypothetical protein LOC375484												0																		---	---	---	---
LOC202181	202181	broad.mit.edu	37	5	177077010	177077010	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177077010delT	uc011dgc.1	-						LOC202181_uc011dgb.1_Intron	NM_198567	NP_940969			hypothetical protein LOC375484												0																		---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	177672217	177672220	+	Intron	DEL	CATC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177672217_177672220delCATC	uc003mje.2	-						COL23A1_uc010jkt.2_Intron	NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	177930349	177930350	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177930349_177930350insA	uc003mje.2	-							NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	177938890	177938890	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177938890delA	uc003mje.2	-							NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	178926708	178926709	+	IGR	INS	-	A	A	rs5873657		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178926708_178926709insA								ADAMTS2 (154379 upstream) : RUFY1 (50862 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	179082058	179082058	+	IGR	DEL	A	-	-	rs55884618		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179082058delA								C5orf60 (10011 upstream) : CANX (43370 downstream)																																			---	---	---	---
MAPK9	5601	broad.mit.edu	37	5	179676518	179676519	+	Intron	INS	-	CTCT	CTCT	rs141492717	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179676518_179676519insCTCT	uc003mls.3	-						MAPK9_uc003mlt.3_Intron|MAPK9_uc010jlc.2_Intron|MAPK9_uc003mlv.3_Intron|MAPK9_uc011dgx.1_Intron	NM_002752	NP_002743			mitogen-activated protein kinase 9 isoform JNK2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|protein binding|protein binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)	4	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
CNOT6	57472	broad.mit.edu	37	5	179987964	179987965	+	Intron	INS	-	TCAG	TCAG	rs77077220		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179987964_179987965insTCAG	uc003mlx.2	+						CNOT6_uc010jld.2_Intron|CNOT6_uc010jle.2_Intron	NM_015455	NP_056270			CCR4-NOT transcription complex, subunit 6						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	exonuclease activity|metal ion binding|protein binding|RNA binding				0	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)														---	---	---	---
FLT4	2324	broad.mit.edu	37	5	180038679	180038680	+	Intron	DEL	CT	-	-	rs72551063		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180038679_180038680delCT	uc003mma.3	-						FLT4_uc003mlz.3_Intron	NM_002020	NP_002011			fms-related tyrosine kinase 4 isoform 2						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)									Congenital_Hereditary_Lymphedema				---	---	---	---
Unknown	0	broad.mit.edu	37	5	180704744	180704744	+	IGR	DEL	A	-	-	rs71593435		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180704744delA								TRIM52 (16625 upstream) : None (None downstream)																																			---	---	---	---
DUSP22	56940	broad.mit.edu	37	6	312552	312553	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:312552_312553insT	uc003msx.2	+						DUSP22_uc011dhn.1_Intron|DUSP22_uc003msy.1_Intron	NM_020185	NP_064570			dual specificity phosphatase 22						apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	822387	822388	+	IGR	INS	-	A	A	rs145008179	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:822387_822388insA								EXOC2 (129278 upstream) : LOC285768 (138854 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	2413913	2413914	+	Intron	INS	-	T	T	rs141342578		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2413913_2413914insT	uc003mtu.1	+											Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 1572223.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	2468012	2468012	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2468012delC	uc003mtu.1	+						uc003mtv.2_Intron					Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 1572223.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	4474498	4474499	+	IGR	INS	-	TG	TG	rs59539685		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4474498_4474499insTG								PECI (338667 upstream) : CDYL (231894 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	4649920	4649921	+	IGR	INS	-	A	A	rs71540825		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4649920_4649921insA								PECI (514089 upstream) : CDYL (56472 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	5028738	5028739	+	Intron	INS	-	AATG	AATG	rs139469833	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5028738_5028739insAATG	uc003mwn.1	+						uc011dhz.1_5'Flank|uc003mwo.2_5'Flank					Homo sapiens cDNA FLJ37615 fis, clone BRCOC2011996.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	6036802	6036804	+	IGR	DEL	CAT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6036802_6036804delCAT								NRN1 (29169 upstream) : F13A1 (107508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	6335306	6335307	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6335306_6335307insT								F13A1 (14382 upstream) : LOC285780 (11392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	6834866	6834867	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6834866_6834867delTC								LY86 (179650 upstream) : RREB1 (273321 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	7005390	7005390	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7005390delA								LY86 (350174 upstream) : RREB1 (102798 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	7424273	7424274	+	IGR	INS	-	A	A	rs115714145		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7424273_7424274insA								RIOK1 (6005 upstream) : DSP (117596 downstream)																																			---	---	---	---
TXNDC5	81567	broad.mit.edu	37	6	7985949	7985949	+	Intron	DEL	A	-	-	rs67776998		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7985949delA	uc003mxw.2	-						PIP5K1P1_uc003mxx.3_5'Flank	NM_001145549	NP_001139021			thioredoxin domain containing 5 isoform 3						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)																	---	---	---	---
TXNDC5	81567	broad.mit.edu	37	6	8017618	8017619	+	Intron	INS	-	ACAC	ACAC	rs148966945	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8017618_8017619insACAC	uc003mxw.2	-						MUTED_uc003mxy.2_Intron|MUTED_uc010joc.2_Intron|MUTED_uc010job.2_Intron	NM_001145549	NP_001139021			thioredoxin domain containing 5 isoform 3						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	8163463	8163464	+	IGR	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8163463_8163464delTT								EEF1E1 (60635 upstream) : SLC35B3 (248269 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	9570087	9570088	+	IGR	INS	-	CTT	CTT	rs141573469	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9570087_9570088insCTT								HULC (916010 upstream) : TFAP2A (826829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	9713136	9713137	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9713136_9713137insA	uc003myg.1	-						uc010jog.1_Intron|uc003myh.1_Intron					Homo sapiens clone 958LR MRDS1 protein (MRDS1) mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	11060863	11060863	+	Intron	DEL	T	-	-	rs35109183		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11060863delT	uc003mzq.1	+											Homo sapiens cDNA clone IMAGE:5269899.																														---	---	---	---
NEDD9	4739	broad.mit.edu	37	6	11211000	11211001	+	Intron	DEL	GA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11211000_11211001delGA	uc003mzv.2	-						NEDD9_uc010joz.2_Intron|NEDD9_uc003mzw.3_Intron|NEDD9_uc003mzx.2_Intron	NM_006403	NP_006394			neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	11686927	11686927	+	IGR	DEL	A	-	-	rs35778589		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11686927delA								TMEM170B (103171 upstream) : C6orf105 (26963 downstream)																																			---	---	---	---
HIVEP1	3096	broad.mit.edu	37	6	12112091	12112091	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12112091delT	uc003nac.2	+							NM_002114	NP_002105			human immunodeficiency virus type I enhancer						transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	12584198	12584199	+	IGR	DEL	AG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12584198_12584199delAG								EDN1 (286772 upstream) : PHACTR1 (132689 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	12701451	12701452	+	IGR	INS	-	CC	CC			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12701451_12701452insCC								EDN1 (404025 upstream) : PHACTR1 (15436 downstream)																																			---	---	---	---
PHACTR1	221692	broad.mit.edu	37	6	13206532	13206532	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13206532delA	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210			phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)															---	---	---	---
PHACTR1	221692	broad.mit.edu	37	6	13231502	13231503	+	Intron	INS	-	AGAA	AGAA			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13231502_13231503insAGAA	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210			phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	14168334	14168334	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14168334delG								CD83 (31188 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	15156460	15156462	+	IGR	DEL	TTG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15156460_15156462delTTG								None (None upstream) : JARID2 (89272 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	15202438	15202438	+	IGR	DEL	A	-	-	rs80271967		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15202438delA								None (None upstream) : JARID2 (43296 downstream)																																			---	---	---	---
JARID2	3720	broad.mit.edu	37	6	15366327	15366327	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15366327delT	uc003nbj.2	+						JARID2_uc011diu.1_Intron|JARID2_uc011div.1_Intron	NM_004973	NP_004964			jumonji, AT rich interactive domain 2 protein						central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)																---	---	---	---
JARID2	3720	broad.mit.edu	37	6	15470408	15470408	+	Intron	DEL	A	-	-	rs34467447		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15470408delA	uc003nbj.2	+						JARID2_uc011diu.1_Intron|JARID2_uc011div.1_Intron|JARID2_uc011diw.1_Intron	NM_004973	NP_004964			jumonji, AT rich interactive domain 2 protein						central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)																---	---	---	---
ATXN1	6310	broad.mit.edu	37	6	16356088	16356088	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16356088delC	uc003nbt.2	-						ATXN1_uc010jpi.2_Intron|ATXN1_uc010jpj.1_Intron	NM_000332	NP_000323			ataxin 1						cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)																---	---	---	---
ATXN1	6310	broad.mit.edu	37	6	16527252	16527252	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16527252delA	uc003nbt.2	-						ATXN1_uc010jpi.2_Intron|ATXN1_uc010jpj.1_Intron|ATXN1_uc003nbu.1_Intron	NM_000332	NP_000323			ataxin 1						cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)																---	---	---	---
ATXN1	6310	broad.mit.edu	37	6	16552544	16552544	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16552544delA	uc003nbt.2	-						ATXN1_uc010jpi.2_Intron|ATXN1_uc010jpj.1_Intron|ATXN1_uc003nbu.1_Intron	NM_000332	NP_000323			ataxin 1						cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	16771817	16771818	+	IGR	INS	-	A	A	rs142211280	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16771817_16771818insA								ATXN1 (10096 upstream) : RBM24 (509991 downstream)																																			---	---	---	---
CAP2	10486	broad.mit.edu	37	6	17404836	17404836	+	Intron	DEL	A	-	-	rs71536725		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17404836delA	uc003ncb.2	+						CAP2_uc010jpk.1_Intron|CAP2_uc011dja.1_Intron|CAP2_uc011djb.1_Intron|CAP2_uc011djc.1_Intron|CAP2_uc011djd.1_Intron	NM_006366	NP_006357			adenylyl cyclase-associated protein 2						activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)															---	---	---	---
CAP2	10486	broad.mit.edu	37	6	17537731	17537732	+	Intron	INS	-	TGTTT	TGTTT	rs141851337	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17537731_17537732insTGTTT	uc003ncb.2	+						CAP2_uc010jpk.1_Intron|CAP2_uc011dja.1_Intron|CAP2_uc011djb.1_Intron|CAP2_uc011djc.1_Intron|CAP2_uc011djd.1_Intron	NM_006366	NP_006357			adenylyl cyclase-associated protein 2						activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	19209842	19209842	+	IGR	DEL	T	-	-	rs138626039		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19209842delT								MIR548A1 (637731 upstream) : ID4 (627775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	19529875	19529876	+	IGR	INS	-	TGTGTGTGTG	TGTGTGTGTG	rs137960451	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19529875_19529876insTGTGTGTGTG								MIR548A1 (957764 upstream) : ID4 (307741 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	19606923	19606930	+	IGR	DEL	AGGAAGGA	-	-	rs28569373	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19606923_19606930delAGGAAGGA								None (None upstream) : ID4 (230687 downstream)																																			---	---	---	---
E2F3	1871	broad.mit.edu	37	6	20422441	20422441	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20422441delG	uc003nda.2	+						E2F3_uc003ncz.2_Intron	NM_001949	NP_001940			E2F transcription factor 3						G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|transcription initiation from RNA polymerase II promoter	transcription factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)															---	---	---	---
CDKAL1	54901	broad.mit.edu	37	6	20918625	20918625	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20918625delT	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron	NM_017774	NP_060244			CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)															---	---	---	---
CDKAL1	54901	broad.mit.edu	37	6	21109628	21109629	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21109628_21109629insA	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron|CDKAL1_uc003ndf.1_Intron	NM_017774	NP_060244			CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	21477013	21477014	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21477013_21477014delTC								CDKAL1 (244381 upstream) : SOX4 (116958 downstream)																																			---	---	---	---
FLJ22536	401237	broad.mit.edu	37	6	21801718	21801718	+	Intron	DEL	A	-	-	rs11343172		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21801718delA	uc010jpp.1	+						FLJ22536_uc003ndj.2_Intron|FLJ22536_uc011djk.1_Intron|FLJ22536_uc011djj.1_Intron					Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	23491003	23491004	+	IGR	INS	-	AACAACAACAAC	AACAACAACAAC	rs141351776	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23491003_23491004insAACAACAACAAC								HDGFL1 (920254 upstream) : NRSN1 (635410 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	23737662	23737663	+	IGR	INS	-	GT	GT	rs137932864	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23737662_23737663insGT								None (None upstream) : NRSN1 (388751 downstream)																																			---	---	---	---
NRSN1	140767	broad.mit.edu	37	6	24123637	24123637	+	5'Flank	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24123637delA	uc010jpq.1	+						NRSN1_uc003ndv.2_5'Flank	NM_080723	NP_542454			neurensin 1						nervous system development	growth cone|integral to membrane|neuronal cell body|transport vesicle					0																		---	---	---	---
DCDC2	51473	broad.mit.edu	37	6	24172198	24172198	+	3'UTR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24172198delC	uc003ndx.2	-	10					DCDC2_uc003ndy.2_3'UTR|DCDC2_uc003ndw.2_3'UTR	NM_016356	NP_057440			doublecortin domain containing 2						cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)																---	---	---	---
ACOT13	55856	broad.mit.edu	37	6	24693955	24693955	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24693955delT	uc003nek.2	+						ACOT13_uc010jpv.2_Intron	NM_018473	NP_060943			acyl-CoA thioesterase 13 isoform 1						protein homotetramerization	mitochondrion	acyl-CoA thioesterase activity				0																		---	---	---	---
FAM65B	9750	broad.mit.edu	37	6	25019817	25019817	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25019817delA	uc011dju.1	-							NM_015864	NP_056948			hypothetical protein LOC9750 isoform 2						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1																		---	---	---	---
FAM65B	9750	broad.mit.edu	37	6	25024815	25024815	+	Intron	DEL	A	-	-	rs79393004		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25024815delA	uc011dju.1	-							NM_015864	NP_056948			hypothetical protein LOC9750 isoform 2						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	26678435	26678435	+	IGR	DEL	T	-	-	rs71728565		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26678435delT								ZNF322A (18472 upstream) : GUSBL1 (160831 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	26701252	26701253	+	IGR	INS	-	T	T	rs149536845	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26701252_26701253insT								ZNF322A (41289 upstream) : GUSBL1 (138013 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	26741766	26741767	+	IGR	INS	-	AAGT	AAGT	rs150148870	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26741766_26741767insAAGT								ZNF322A (81803 upstream) : GUSBL1 (97499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	27626763	27626764	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27626763_27626764insA								ZNF184 (185866 upstream) : HIST1H2BL (148494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	27670626	27670626	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27670626delA	uc003njk.2	+											Homo sapiens cDNA clone IMAGE:5262055.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	27844800	27844800	+	IGR	DEL	A	-	-	rs74545818		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27844800delA								HIST1H4L (3511 upstream) : HIST1H3J (13294 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	28615257	28615258	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28615257_28615258delTG								SCAND3 (60145 upstream) : TRIM27 (255522 downstream)																																			---	---	---	---
GABBR1	2550	broad.mit.edu	37	6	29533067	29533067	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29533067delA	uc003nmp.3	-							NM_021903	NP_068703			gamma-aminobutyric acid (GABA) B receptor 1						gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)													---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29903143	29903143	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29903143delA	uc011dmb.1	+						HCG4P6_uc003nog.1_Intron	NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
MICA	4276	broad.mit.edu	37	6	31367309	31367310	+	5'Flank	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31367309_31367310insA	uc003rxz.1	+											SubName: Full=MHC class I polypeptide-related sequence A;												0		Ovarian(999;0.0253)																---	---	---	---
BAT5	7920	broad.mit.edu	37	6	31667906	31667907	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31667906_31667907insT	uc003nvy.1	-						BAT5_uc003nvx.1_Intron|BAT5_uc011dny.1_Intron|BAT5_uc003nvz.1_Intron|BAT5_uc011dnz.1_Intron|BAT5_uc010jtc.1_Intron|BAT5_uc011doa.1_Intron	NM_021160	NP_066983			HLA-B associated transcript 5							integral to membrane	hydrolase activity|protein binding				0																		---	---	---	---
NOTCH4	4855	broad.mit.edu	37	6	32175781	32175783	+	Intron	DEL	AAA	-	-	rs71536116		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32175781_32175783delAAA	uc003obb.2	-						NOTCH4_uc011dpu.1_Intron|NOTCH4_uc011dpv.1_Intron	NM_004557	NP_004548			notch4 preproprotein						cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22																		---	---	---	---
C6orf10	10665	broad.mit.edu	37	6	32292561	32292561	+	Intron	DEL	T	-	-	rs67108152		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32292561delT	uc011dpy.1	-							NM_006781	NP_006772			chromosome 6 open reading frame 10							integral to membrane				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	32672683	32672683	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32672683delA								HLA-DQB1 (38217 upstream) : HLA-DQA2 (36480 downstream)																																			---	---	---	---
BRD2	6046	broad.mit.edu	37	6	32943060	32943061	+	Intron	INS	-	GT	GT	rs116667762	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32943060_32943061insGT	uc003ocn.3	+						BRD2_uc003oco.2_Intron|BRD2_uc003ocq.3_Intron|BRD2_uc003ocp.3_Intron|BRD2_uc010juh.2_Intron	NM_005104	NP_005095			bromodomain containing 2						spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5																		---	---	---	---
HLA-DPA1	3113	broad.mit.edu	37	6	33033608	33033609	+	Intron	INS	-	G	G	rs138991818	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33033608_33033609insG	uc003ocs.1	-							NM_033554	NP_291032			major histocompatibility complex, class II, DP						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	33533104	33533104	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33533104delT								ZBTB9 (107786 upstream) : BAK1 (7220 downstream)																																			---	---	---	---
NUDT3	11165	broad.mit.edu	37	6	34319808	34319809	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34319808_34319809insA	uc003ojl.2	-							NM_006703	NP_006694			nudix-type motif 3						cell-cell signaling|diadenosine polyphosphate catabolic process|diphosphoinositol polyphosphate catabolic process	cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|magnesium ion binding				0																		---	---	---	---
C6orf106	64771	broad.mit.edu	37	6	34589638	34589639	+	Intron	INS	-	A	A	rs146597171	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34589638_34589639insA	uc003ojr.2	-						C6orf106_uc003ojs.2_Intron	NM_024294	NP_077270			chromosome 6 open reading frame 106 isoform a											skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	34712665	34712665	+	IGR	DEL	A	-	-	rs35723318		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34712665delA								C6orf106 (48040 upstream) : SNRPC (12647 downstream)																																			---	---	---	---
UHRF1BP1	54887	broad.mit.edu	37	6	34807116	34807119	+	Intron	DEL	TCTT	-	-	rs72363955		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34807116_34807119delTCTT	uc003oju.3	+						UHRF1BP1_uc010jvm.1_Intron|UHRF1BP1_uc010jvn.2_Intron	NM_017754	NP_060224			ICBP90 binding protein 1											ovary(3)	3																		---	---	---	---
FKBP5	2289	broad.mit.edu	37	6	35689870	35689870	+	Intron	DEL	C	-	-	rs112633560		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35689870delC	uc003oky.2	-							NM_001145775	NP_001139247			FK506 binding protein 5 isoform 1						protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1																		---	---	---	---
LHFPL5	222662	broad.mit.edu	37	6	35786539	35786539	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35786539delT	uc003olg.1	+							NM_182548	NP_872354			lipoma HMGIC fusion partner-like 5							integral to membrane				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	36155408	36155408	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36155408delT	uc003olu.2	-											Homo sapiens cDNA clone IMAGE:5269446.																														---	---	---	---
BRPF3	27154	broad.mit.edu	37	6	36192606	36192606	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36192606delA	uc003olv.3	+						BRPF3_uc010jwb.2_Intron|BRPF3_uc011dtj.1_Intron|BRPF3_uc010jwc.2_Intron|BRPF3_uc011dtk.1_Intron|BRPF3_uc010jwd.2_Intron	NM_015695	NP_056510			bromodomain and PHD finger containing, 3						histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	36378216	36378216	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36378216delA								PXT1 (9905 upstream) : KCTD20 (32328 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37109739	37109740	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37109739_37109740delGT								FGD2 (112894 upstream) : PIM1 (28182 downstream)																																			---	---	---	---
TBC1D22B	55633	broad.mit.edu	37	6	37272473	37272473	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37272473delT	uc003onn.2	+						TBC1D22B_uc010jwt.2_Intron|TBC1D22B_uc003ono.1_5'Flank|TBC1D22B_uc003onp.2_5'Flank	NM_017772	NP_060242			TBC1 domain family, member 22B							intracellular	Rab GTPase activator activity				0			OV - Ovarian serous cystadenocarcinoma(102;0.241)															---	---	---	---
TBC1D22B	55633	broad.mit.edu	37	6	37294563	37294564	+	Intron	INS	-	A	A	rs145581493	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37294563_37294564insA	uc003onn.2	+						TBC1D22B_uc010jwt.2_Intron|TBC1D22B_uc003onp.2_Intron	NM_017772	NP_060242			TBC1 domain family, member 22B							intracellular	Rab GTPase activator activity				0			OV - Ovarian serous cystadenocarcinoma(102;0.241)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	37385200	37385201	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37385200_37385201insA								RNF8 (22687 upstream) : FTSJD2 (15706 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37519243	37519243	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37519243delA								C6orf129 (51543 upstream) : MDGA1 (81041 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37732596	37732596	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37732596delG								MDGA1 (66830 upstream) : ZFAND3 (54711 downstream)																																			---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38801020	38801020	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38801020delT	uc003ooe.1	+							NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38979409	38979409	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38979409delA	uc003ooe.1	+							NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	39091252	39091253	+	IGR	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39091252_39091253delTT								C6orf64 (8387 upstream) : KCNK5 (65495 downstream)																																			---	---	---	---
KCNK5	8645	broad.mit.edu	37	6	39188832	39188836	+	Intron	DEL	AGAAG	-	-	rs143249157		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39188832_39188836delAGAAG	uc003oon.2	-							NM_003740	NP_003731			potassium channel, subfamily K, member 5						excretion	integral to plasma membrane	potassium channel activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	40593116	40593117	+	IGR	INS	-	A	A	rs140108630	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40593116_40593117insA								LRFN2 (37990 upstream) : UNC5CL (401655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	41298070	41298071	+	IGR	DEL	TG	-	-	rs138804014		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41298070_41298071delTG								TREM1 (43613 upstream) : NCR2 (5457 downstream)																																			---	---	---	---
UBR2	23304	broad.mit.edu	37	6	42635501	42635501	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42635501delT	uc011dur.1	+						UBR2_uc011dus.1_Intron|UBR2_uc003osh.2_Intron	NM_015255	NP_056070			ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	42722898	42722899	+	IGR	INS	-	TA	TA	rs150953528	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42722898_42722899insTA								TBCC (9014 upstream) : KIAA0240 (26891 downstream)																																			---	---	---	---
KIAA0240	23506	broad.mit.edu	37	6	42753779	42753780	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42753779_42753780delAC	uc003osn.1	+						KIAA0240_uc003osm.1_Intron|KIAA0240_uc011duw.1_Intron	NM_015349	NP_056164			hypothetical protein LOC23506											ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)															---	---	---	---
PTK7	5754	broad.mit.edu	37	6	43054155	43054155	+	Intron	DEL	T	-	-	rs35357864		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43054155delT	uc003oub.1	+						PTK7_uc003ouc.1_Intron|PTK7_uc003oud.1_Intron|PTK7_uc003oue.1_Intron|PTK7_uc003ouf.1_Intron|PTK7_uc003oug.1_Intron|PTK7_uc011dve.1_Intron|PTK7_uc003oua.2_Intron	NM_002821	NP_002812			PTK7 protein tyrosine kinase 7 isoform a						actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)															---	---	---	---
PTK7	5754	broad.mit.edu	37	6	43076137	43076137	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43076137delT	uc003oub.1	+						PTK7_uc003ouc.1_Intron|PTK7_uc003oud.1_Intron|PTK7_uc003oue.1_Intron|PTK7_uc003ouf.1_Intron|PTK7_uc003oug.1_Intron|PTK7_uc011dve.1_Intron|PTK7_uc003oua.2_Intron	NM_002821	NP_002812			PTK7 protein tyrosine kinase 7 isoform a						actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)															---	---	---	---
CAPN11	11131	broad.mit.edu	37	6	44149459	44149460	+	Intron	INS	-	AT	AT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44149459_44149460insAT	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989			calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
NFKBIE	4794	broad.mit.edu	37	6	44232411	44232413	+	Intron	DEL	AAG	-	-	rs35302775		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44232411_44232413delAAG	uc003oxe.1	-							NM_004556	NP_004547			nuclear factor of kappa light polypeptide gene						cytoplasmic sequestering of transcription factor		protein binding			breast(2)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	44709465	44709465	+	IGR	DEL	A	-	-	rs10709172		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44709465delA								CDC5L (294686 upstream) : SUPT3H (67589 downstream)																																			---	---	---	---
RUNX2	860	broad.mit.edu	37	6	45373532	45373533	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45373532_45373533insT	uc011dvx.1	+						RUNX2_uc011dvy.1_Intron	NM_001024630	NP_001019801			runt-related transcription factor 2 isoform a						negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3																		---	---	---	---
CLIC5	53405	broad.mit.edu	37	6	45869505	45869505	+	3'UTR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45869505delT	uc003oxv.3	-	6					CLIC5_uc003oxu.3_3'UTR	NM_001114086	NP_001107558			chloride intracellular channel 5 isoform a						female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2																		---	---	---	---
CLIC5	53405	broad.mit.edu	37	6	45872386	45872387	+	Intron	DEL	TT	-	-	rs35933771		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45872386_45872387delTT	uc003oxv.3	-						CLIC5_uc003oxu.3_Intron	NM_001114086	NP_001107558			chloride intracellular channel 5 isoform a						female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2																		---	---	---	---
GPR116	221395	broad.mit.edu	37	6	46881237	46881237	+	Intron	DEL	A	-	-	rs35172164		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46881237delA	uc003oyo.3	-						GPR116_uc003oyp.3_Intron|GPR116_uc003oyq.3_Intron|GPR116_uc003oyr.2_Intron	NM_001098518	NP_001091988			G-protein coupled receptor 116 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	48849947	48849948	+	IGR	INS	-	GATA	GATA			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48849947_48849948insGATA								C6orf138 (771004 upstream) : MUT (549046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	49157052	49157052	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49157052delA								None (None upstream) : MUT (241942 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	49535529	49535530	+	IGR	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49535529_49535530delTT								C6orf141 (5904 upstream) : RHAG (37363 downstream)																																			---	---	---	---
CRISP2	7180	broad.mit.edu	37	6	49670902	49670902	+	Intron	DEL	A	-	-	rs35037453		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49670902delA	uc003ozq.2	-						CRISP2_uc003ozl.2_Intron|CRISP2_uc003ozn.2_Intron|CRISP2_uc003ozr.2_Intron|CRISP2_uc003ozo.2_Intron|CRISP2_uc003ozm.2_Intron|CRISP2_uc003ozp.2_Intron	NM_001142408	NP_001135880			cysteine-rich secretory protein 2 precursor							extracellular space				skin(1)	1	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	50093058	50093059	+	IGR	INS	-	CA	CA	rs140918482	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50093058_50093059insCA								DEFB112 (76694 upstream) : TFAP2D (588198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	50291408	50291410	+	IGR	DEL	GAG	-	-	rs68169092		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50291408_50291410delGAG								DEFB112 (275044 upstream) : TFAP2D (389847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	50326380	50326380	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50326380delA								DEFB112 (310016 upstream) : TFAP2D (354877 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	51288358	51288359	+	IGR	INS	-	A	A	rs35445004		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51288358_51288359insA								TFAP2B (473033 upstream) : PKHD1 (191786 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	51365685	51365686	+	IGR	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs139266028	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51365685_51365686insGTGTGTGTGT								TFAP2B (550360 upstream) : PKHD1 (114459 downstream)																																			---	---	---	---
C6orf142	90523	broad.mit.edu	37	6	54048542	54048542	+	Intron	DEL	T	-	-	rs71855201		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54048542delT	uc003pcg.3	+						C6orf142_uc003pcf.2_Intron|C6orf142_uc003pch.3_Intron|C6orf142_uc011dxa.1_Intron	NM_138569	NP_612636			hypothetical protein LOC90523							nuclear envelope|PML body	protein binding				0	Lung NSC(77;0.0317)																	---	---	---	---
TINAG	27283	broad.mit.edu	37	6	54197972	54197972	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54197972delT	uc003pcj.2	+						TINAG_uc010jzt.2_Intron	NM_014464	NP_055279			tubulointerstitial nephritis antigen						cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	54280011	54280012	+	IGR	DEL	GT	-	-	rs72370219		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54280011_54280012delGT								TINAG (25061 upstream) : FAM83B (431557 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	55753839	55753839	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55753839delG								BMP5 (13464 upstream) : COL21A1 (167550 downstream)																																			---	---	---	---
COL21A1	81578	broad.mit.edu	37	6	56228584	56228584	+	Intron	DEL	G	-	-	rs67066258		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56228584delG	uc003pcu.1	-							NM_030820	NP_110447			collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)															---	---	---	---
COL21A1	81578	broad.mit.edu	37	6	56244868	56244868	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56244868delC	uc003pcu.1	-							NM_030820	NP_110447			collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	57051402	57051402	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57051402delC								BAG2 (1392 upstream) : RAB23 (2189 downstream)																																			---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57211816	57211819	+	Intron	DEL	TGTT	-	-	rs10577577		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57211816_57211819delTGTT	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57217028	57217028	+	Intron	DEL	A	-	-	rs66943114		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57217028delA	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57238018	57238019	+	Intron	INS	-	GA	GA	rs149497221		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57238018_57238019insGA	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57265090	57265091	+	Intron	INS	-	T	T	rs145763494	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57265090_57265091insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57308617	57308618	+	Intron	INS	-	A	A	rs146159570	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57308617_57308618insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57433502	57433508	+	Intron	DEL	AAAAAAG	-	-	rs5876614		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57433502_57433508delAAAAAAG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57485390	57485390	+	Intron	DEL	C	-	-	rs111507019		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57485390delC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57515335	57515336	+	IGR	INS	-	AAAAG	AAAAG	rs150958829		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57515335_57515336insAAAAG								PRIM2 (1960 upstream) : GUSBL2 (730823 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57523617	57523622	+	IGR	DEL	ATTATT	-	-	rs147467647		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57523617_57523622delATTATT								PRIM2 (10242 upstream) : GUSBL2 (722537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57544979	57544979	+	IGR	DEL	A	-	-	rs112612652		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57544979delA								PRIM2 (31604 upstream) : GUSBL2 (701180 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57549814	57549814	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57549814delC								PRIM2 (36439 upstream) : GUSBL2 (696345 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57561684	57561685	+	IGR	INS	-	A	A	rs72547925		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57561684_57561685insA								PRIM2 (48309 upstream) : GUSBL2 (684474 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57562229	57562229	+	IGR	DEL	G	-	-	rs67409233		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57562229delG								PRIM2 (48854 upstream) : GUSBL2 (683930 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57565436	57565437	+	IGR	DEL	TT	-	-	rs10570778		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57565436_57565437delTT								PRIM2 (52061 upstream) : GUSBL2 (680722 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57572995	57572995	+	IGR	DEL	C	-	-	rs113708333		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57572995delC								PRIM2 (59620 upstream) : GUSBL2 (673164 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	58199793	58199794	+	IGR	INS	-	GT	GT	rs143606694	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58199793_58199794insGT								PRIM2 (686418 upstream) : GUSBL2 (46365 downstream)																																			---	---	---	---
KHDRBS2	202559	broad.mit.edu	37	6	62486728	62486728	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62486728delA	uc003peg.2	-							NM_152688	NP_689901			KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	63296409	63296409	+	IGR	DEL	A	-	-	rs112139957		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63296409delA								KHDRBS2 (300309 upstream) : LGSN (689448 downstream)																																			---	---	---	---
EYS	346007	broad.mit.edu	37	6	65461024	65461024	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65461024delC	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	66176484	66176484	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66176484delA	uc011dxu.1	-						EYS_uc003peq.2_Intron|EYS_uc003per.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	72087631	72087632	+	5'Flank	INS	-	TTCA	TTCA	rs144044160	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72087631_72087632insTTCA	uc011dya.1	-						MIR30C2_hsa-mir-30c-2|MI0000254_5'Flank					DM004170																														---	---	---	---
OOEP	441161	broad.mit.edu	37	6	74083515	74083515	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74083515delT	uc003pgv.3	-							NM_001080507	NP_001073976			oocyte expressed protein homolog							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	77249918	77249918	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77249918delT								IMPG1 (467583 upstream) : HTR1B (922030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	80754382	80754382	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80754382delC								TTK (2145 upstream) : BCKDHB (61962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	81448187	81448188	+	IGR	INS	-	T	T	rs67469269		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81448187_81448188insT								BCKDHB (392200 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	83158360	83158360	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83158360delG								TPBG (81746 upstream) : UBE2CBP (443826 downstream)																																			---	---	---	---
UBE2CBP	90025	broad.mit.edu	37	6	83618498	83618498	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83618498delT	uc003pjp.2	-						UBE2CBP_uc011dyx.1_Intron	NM_198920	NP_944602			ubiquitin-conjugating enzyme E2C binding							cytoplasm	ligase activity			ovary(1)	1		all_cancers(76;0.000374)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0548)		BRCA - Breast invasive adenocarcinoma(397;0.0944)														---	---	---	---
PGM3	5238	broad.mit.edu	37	6	83888488	83888497	+	Intron	DEL	AATGATACTT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83888488_83888497delAATGATACTT	uc003pjv.2	-						PGM3_uc003pjw.2_Intron|PGM3_uc011dyz.1_Intron	NM_015599	NP_056414			phosphoglucomutase 3						dolichol-linked oligosaccharide biosynthetic process|embryo development ending in birth or egg hatching|glucose 1-phosphate metabolic process|hemopoiesis|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	magnesium ion binding|phosphoacetylglucosamine mutase activity|phosphoglucomutase activity				0		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	84802987	84802988	+	IGR	INS	-	AGAG	AGAG	rs145689122	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84802987_84802988insAGAG								MRAP2 (2384 upstream) : KIAA1009 (30973 downstream)																																			---	---	---	---
MDN1	23195	broad.mit.edu	37	6	90360154	90360155	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90360154_90360155insA	uc003pnn.1	-							NM_014611	NP_055426			MDN1, midasin homolog						protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	91998113	91998113	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91998113delA								MAP3K7 (701206 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	99116129	99116130	+	IGR	INS	-	A	A	rs67647232		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99116129_99116130insA								MIR2113 (643632 upstream) : POU3F2 (166450 downstream)																																			---	---	---	---
ASCC3	10973	broad.mit.edu	37	6	101109200	101109201	+	Intron	DEL	CA	-	-	rs68165695		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101109200_101109201delCA	uc003pqk.2	-						ASCC3_uc011eai.1_Intron	NM_006828	NP_006819			activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	104152370	104152370	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104152370delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	104725019	104725019	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104725019delG								None (None upstream) : HACE1 (450949 downstream)																																			---	---	---	---
SCML4	256380	broad.mit.edu	37	6	108123835	108123842	+	Intron	DEL	GAAGGAAA	-	-	rs146091396	by1000genomes;by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108123835_108123842delGAAGGAAA	uc010kdf.2	-						SCML4_uc003prz.3_Intron|SCML4_uc011eam.1_Intron	NM_198081	NP_932347			sex comb on midleg-like 4						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)														---	---	---	---
CDK19	23097	broad.mit.edu	37	6	110934428	110934429	+	3'UTR	DEL	TT	-	-	rs71698287		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110934428_110934429delTT	uc003puh.1	-	13					CDK19_uc003pui.1_3'UTR|CDK19_uc011eax.1_3'UTR	NM_015076	NP_055891			cell division cycle 2-like 6 (CDK8-like)								ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	111615555	111615556	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111615555_111615556insT								KIAA1919 (25296 upstream) : REV3L (4679 downstream)																																			---	---	---	---
HS3ST5	222537	broad.mit.edu	37	6	114404707	114404710	+	Intron	DEL	CAAA	-	-	rs68103507		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114404707_114404710delCAAA	uc003pwh.3	-						uc003pwf.2_Intron	NM_153612	NP_705840			heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	115760610	115760612	+	IGR	DEL	AAA	-	-	rs67378261		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115760610_115760612delAAA								None (None upstream) : FRK (502081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	117375856	117375857	+	IGR	INS	-	T	T	rs67007104		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117375856_117375857insT								RFX6 (122548 upstream) : VGLL2 (210864 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	118673342	118673342	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118673342delT								SLC35F1 (34505 upstream) : C6orf204 (112897 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	119848187	119848187	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119848187delT								MAN1A1 (177261 upstream) : None (None downstream)																																			---	---	---	---
C6orf170	221322	broad.mit.edu	37	6	121513956	121513957	+	Intron	INS	-	CC	CC	rs149924089	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121513956_121513957insCC	uc003pyo.1	-						C6orf170_uc003pyq.1_Intron|C6orf170_uc010kej.1_Intron|C6orf170_uc003pyp.1_Intron	NM_152730	NP_689943			hypothetical protein LOC221322						multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124766929	124766930	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124766929_124766930insA	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	135589536	135589536	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135589536delT								MIR548A2 (29142 upstream) : AHI1 (15576 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	136164304	136164304	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136164304delA								C6orf217 (127112 upstream) : PDE7B (8530 downstream)																																			---	---	---	---
PDE7B	27115	broad.mit.edu	37	6	136348927	136348927	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136348927delT	uc003qgp.2	+						uc003qgq.1_Intron	NM_018945	NP_061818			phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	140914629	140914629	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140914629delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	141167448	141167449	+	IGR	INS	-	AAAAA	AAAAA	rs147014371	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:141167448_141167449insAAAAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	143900050	143900051	+	IGR	INS	-	G	G	rs139095446	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143900050_143900051insG								LOC285740 (9574 upstream) : PHACTR2 (29266 downstream)																																			---	---	---	---
PLAGL1	5325	broad.mit.edu	37	6	144314123	144314126	+	Intron	DEL	AAAC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144314123_144314126delAAAC	uc003qjx.2	-						PLAGL1_uc003qjy.2_Intron|PLAGL1_uc010khl.2_Intron|PLAGL1_uc010khm.2_Intron|PLAGL1_uc003qjz.2_Intron|PLAGL1_uc003qka.2_Intron|PLAGL1_uc003qkb.2_Intron|PLAGL1_uc003qkc.2_Intron|PLAGL1_uc003qkd.2_Intron|PLAGL1_uc003qke.2_Intron|PLAGL1_uc003qkf.2_Intron|PLAGL1_uc003qkg.2_Intron|PLAGL1_uc003qkh.2_Intron|PLAGL1_uc003qki.2_Intron|PLAGL1_uc003qkj.2_Intron|PLAGL1_uc003qkk.2_Intron|PLAGL1_uc003qkl.2_Intron|PLAGL1_uc003qkm.2_Intron|PLAGL1_uc010khn.2_Intron|PLAGL1_uc003qkn.2_Intron|PLAGL1_uc003qko.2_Intron|PLAGL1_uc003qkp.2_Intron	NM_001080952	NP_001074421			pleiomorphic adenoma gene-like 1 isoform 2						cell cycle arrest|induction of apoptosis|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(155;5.74e-07)|GBM - Glioblastoma multiforme(68;0.0885)														---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152013652	152013652	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152013652delA	uc003qom.3	+							NM_001122742	NP_001116214			estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	153274599	153274600	+	IGR	INS	-	T	T	rs148449150		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153274599_153274600insT								VIP (193701 upstream) : FBXO5 (17060 downstream)																																			---	---	---	---
RGS17	26575	broad.mit.edu	37	6	153451619	153451620	+	Intron	DEL	AC	-	-	rs67764992		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153451619_153451620delAC	uc003qpm.2	-							NM_012419	NP_036551			regulator of G-protein signalling 17						negative regulation of signal transduction	cytoplasm|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			pancreas(1)	1		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)										Lung_Cancer_Familial_Clustering_of				---	---	---	---
TIAM2	26230	broad.mit.edu	37	6	155276453	155276453	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155276453delT	uc003qqb.2	+							NM_012454	NP_036586			T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	158699974	158699976	+	IGR	DEL	TTT	-	-	rs55928157		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158699974_158699976delTTT								GTF2H5 (79608 upstream) : TULP4 (33716 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	160136936	160136936	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160136936delA								SOD2 (22583 upstream) : WTAP (11193 downstream)																																			---	---	---	---
MAP3K4	4216	broad.mit.edu	37	6	161460572	161460572	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161460572delA	uc003qtn.2	+						MAP3K4_uc010kkc.1_Intron|MAP3K4_uc003qto.2_Intron|MAP3K4_uc011efz.1_Intron|MAP3K4_uc011ega.1_Intron	NM_005922	NP_005913			mitogen-activated protein kinase kinase kinase 4						activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)														---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162551977	162551977	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162551977delT	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162985376	162985376	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162985376delA	uc003qtx.3	-						PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	163752471	163752472	+	IGR	INS	-	A	A	rs149344926	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163752471_163752472insA								LOC285796 (6977 upstream) : QKI (83203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	164859704	164859705	+	IGR	DEL	AC	-	-	rs144377033		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164859704_164859705delAC								QKI (864812 upstream) : C6orf118 (833450 downstream)																																			---	---	---	---
PDE10A	10846	broad.mit.edu	37	6	165934465	165934466	+	Intron	INS	-	T	T	rs142431330	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165934465_165934466insT	uc003qun.2	-						PDE10A_uc011egj.1_Intron|PDE10A_uc011egk.1_Intron|PDE10A_uc003quo.2_Intron	NM_006661	NP_006652			phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	166253485	166253486	+	Intron	INS	-	T	T	rs77514822		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166253485_166253486insT	uc003qup.1	-											Homo sapiens cDNA FLJ33369 fis, clone BRACE2005904.																														---	---	---	---
RPS6KA2	6196	broad.mit.edu	37	6	167125273	167125274	+	Intron	DEL	AG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167125273_167125274delAG	uc003qvd.1	-						RPS6KA2_uc003qvc.1_Intron	NM_021135	NP_066958			ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	167688349	167688350	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167688349_167688350delCA								TCP10L2 (91954 upstream) : UNC93A (16453 downstream)																																			---	---	---	---
MLLT4	4301	broad.mit.edu	37	6	168365828	168365828	+	Intron	DEL	T	-	-	rs67602507		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168365828delT	uc003qwd.2	+							NM_001040001	NP_001035090			myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)				T	MLL	AL								---	---	---	---
Unknown	0	broad.mit.edu	37	6	169249381	169249384	+	IGR	DEL	AAAG	-	-	rs10586252		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169249381_169249384delAAAG								SMOC2 (180710 upstream) : THBS2 (366492 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	169838332	169838332	+	IGR	DEL	T	-	-	rs71782073		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169838332delT								THBS2 (184195 upstream) : WDR27 (18975 downstream)																																			---	---	---	---
WDR27	253769	broad.mit.edu	37	6	169983396	169983396	+	Intron	DEL	G	-	-	rs66567355		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169983396delG	uc003qwx.2	-						WDR27_uc003qwv.1_Intron|WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron					RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	170421464	170421465	+	IGR	DEL	TG	-	-	rs5881851		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170421464_170421465delTG								C6orf208 (218495 upstream) : LOC154449 (141957 downstream)																																			---	---	---	---
FAM120B	84498	broad.mit.edu	37	6	170625015	170625015	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170625015delA	uc003qxp.2	+						FAM120B_uc003qxo.1_Intron|FAM120B_uc011ehd.1_Intron	NM_032448	NP_115824			family with sequence similarity 120B						cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	839615	839615	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:839615delA								HEATR2 (13499 upstream) : SUN1 (16637 downstream)																																			---	---	---	---
ADAP1	11033	broad.mit.edu	37	7	945776	945776	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:945776delA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860			centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
COX19	90639	broad.mit.edu	37	7	1004503	1004503	+	3'UTR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1004503delT	uc003sjp.1	-	3					ADAP1_uc010ksc.2_Intron	NM_001031617	NP_001026788			COX19 cytochrome c oxidase assembly homolog							cytosol					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;2.15e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	1290002	1290002	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1290002delG								UNCX (13390 upstream) : MICALL2 (183994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	1446492	1446492	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1446492delT								UNCX (169880 upstream) : MICALL2 (27504 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	1802605	1802606	+	IGR	INS	-	A	A	rs144446992	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1802605_1802606insA								ELFN1 (15015 upstream) : MAD1L1 (52822 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	1854772	1854772	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1854772delC								ELFN1 (67182 upstream) : MAD1L1 (656 downstream)																																			---	---	---	---
EIF3B	8662	broad.mit.edu	37	7	2392474	2392474	+	5'Flank	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2392474delA	uc003slx.2	+						EIF3B_uc003sly.2_5'Flank|EIF3B_uc003slz.1_5'Flank	NM_003751	NP_003742			eukaryotic translation initiation factor 3,						regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	4436384	4436385	+	IGR	INS	-	T	T	rs71535109		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4436384_4436385insT								SDK1 (127755 upstream) : FOXK1 (247003 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	5513942	5513942	+	IGR	DEL	T	-	-	rs147471284		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5513942delT								TNRC18 (48897 upstream) : FBXL18 (1487 downstream)																																			---	---	---	---
COL28A1	340267	broad.mit.edu	37	7	7459135	7459135	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7459135delC	uc003src.1	-						COL28A1_uc011jxe.1_Intron|COL28A1_uc003srd.2_Intron	NM_001037763	NP_001032852			collagen, type XXVIII precursor						cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	7868376	7868378	+	Intron	DEL	CTC	-	-	rs147841701		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7868376_7868378delCTC	uc011jxf.1	+											SubName: Full=cDNA FLJ54628; SubName: Full=HCG19535; SubName: Full=Hypothetical gene supported by AK027125;																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	9117207	9117210	+	IGR	DEL	TTTG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9117207_9117210delTTTG								NXPH1 (324615 upstream) : PER4 (556690 downstream)																																			---	---	---	---
TMEM106B	54664	broad.mit.edu	37	7	12253818	12253818	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12253818delC	uc011jxk.1	+						TMEM106B_uc003ssh.2_Intron	NM_018374	NP_060844			transmembrane protein 106B							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (126;0.185)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	15101580	15101580	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15101580delA								DGKB (159030 upstream) : TMEM195 (138363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	16931817	16931817	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16931817delC								AGR3 (10204 upstream) : AHR (406459 downstream)																																			---	---	---	---
HDAC9	9734	broad.mit.edu	37	7	18630480	18630480	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18630480delA	uc003suh.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc011jyd.1_Intron|HDAC9_uc003sui.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc011jya.1_Intron|HDAC9_uc003sua.1_Intron|HDAC9_uc011jyb.1_Intron|HDAC9_uc003sud.1_Intron|HDAC9_uc011jyc.1_Intron|HDAC9_uc003suf.1_Intron|HDAC9_uc010kud.1_Intron|HDAC9_uc011jye.1_Intron|HDAC9_uc011jyf.1_Intron|HDAC9_uc010kue.1_Intron	NM_058176	NP_478056			histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	19383936	19383937	+	IGR	DEL	TT	-	-	rs144950584		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19383936_19383937delTT								FERD3L (198892 upstream) : TWISTNB (351148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	19655724	19655724	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19655724delC								FERD3L (470680 upstream) : TWISTNB (79361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	19670443	19670444	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19670443_19670444insT								FERD3L (485399 upstream) : TWISTNB (64641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	21307265	21307265	+	IGR	DEL	T	-	-	rs77590995		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21307265delT								RPL23P8 (439826 upstream) : SP4 (160424 downstream)																																			---	---	---	---
FAM126A	84668	broad.mit.edu	37	7	23014273	23014273	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23014273delA	uc003svm.3	-						FAM126A_uc003svn.3_Intron	NM_032581	NP_115970			family with sequence similarity 126, member A							cytoplasm|membrane	signal transducer activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	24161889	24161890	+	IGR	DEL	AC	-	-	rs72213745		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24161889_24161890delAC								STK31 (217524 upstream) : NPY (161919 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	25037396	25037396	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25037396delG								OSBPL3 (17636 upstream) : CYCS (120881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	27131323	27131324	+	IGR	INS	-	AGAA	AGAA	rs137944795		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27131323_27131324insAGAA								SKAP2 (96465 upstream) : HOXA1 (1292 downstream)																																			---	---	---	---
CHN2	1124	broad.mit.edu	37	7	29400145	29400145	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29400145delA	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron	NM_004067	NP_004058			beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	31427202	31427202	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31427202delT								NEUROD6 (46664 upstream) : CCDC129 (126483 downstream)																																			---	---	---	---
PDE1C	5137	broad.mit.edu	37	7	32181423	32181423	+	Intron	DEL	G	-	-	rs111307405		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32181423delG	uc003tco.1	-							NM_005020	NP_005011			phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)															---	---	---	---
AVL9	23080	broad.mit.edu	37	7	32837619	32837620	+	Intron	INS	-	T	T	rs139243541	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32837619_32837620insT	uc011kai.1	+							NM_015060	NP_055875			AVL9 homolog (S. cerevisiase)							integral to membrane					0																		---	---	---	---
BMPER	168667	broad.mit.edu	37	7	33977126	33977127	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33977126_33977127delGT	uc011kap.1	+							NM_133468	NP_597725			BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
AOAH	313	broad.mit.edu	37	7	36665071	36665071	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36665071delC	uc003tfh.3	-						AOAH_uc010kxf.2_Intron|AOAH_uc011kba.1_Intron	NM_001637	NP_001628			acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1																		---	---	---	---
ELMO1	9844	broad.mit.edu	37	7	36918082	36918082	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36918082delA	uc003tfk.1	-						ELMO1_uc003tfi.1_Intron|ELMO1_uc003tfj.1_Intron|ELMO1_uc011kbb.1_Intron|ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615			engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
VPS41	27072	broad.mit.edu	37	7	38943297	38943297	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38943297delA	uc003tgy.2	-						VPS41_uc003tgz.2_Intron|VPS41_uc010kxn.2_Intron	NM_014396	NP_055211			vacuolar protein sorting 41 isoform 1						Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4																		---	---	---	---
C7orf10	79783	broad.mit.edu	37	7	40596195	40596195	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40596195delA	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004			dermal papilla derived protein 13								transferase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	41089576	41089577	+	IGR	DEL	GG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41089576_41089577delGG								C7orf10 (189219 upstream) : INHBA (639026 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	41148974	41148975	+	IGR	INS	-	TGT	TGT	rs150381030	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41148974_41148975insTGT								C7orf10 (248617 upstream) : INHBA (579628 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	41207588	41207588	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41207588delA								C7orf10 (307231 upstream) : INHBA (521015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	41519180	41519181	+	IGR	INS	-	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41519180_41519181insC								C7orf10 (618823 upstream) : INHBA (209422 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	41878041	41878041	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41878041delT								LOC285954 (59067 upstream) : GLI3 (122509 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	41999051	41999051	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41999051delA								LOC285954 (180077 upstream) : GLI3 (1499 downstream)																																			---	---	---	---
GLI3	2737	broad.mit.edu	37	7	42224457	42224457	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42224457delG	uc011kbh.1	-							NM_000168	NP_000159			GLI-Kruppel family member GLI3						negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19														Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43476013	43476013	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43476013delA	uc003tid.1	+						HECW1_uc011kbi.1_Intron|HECW1_uc003tie.1_Intron	NM_015052	NP_055867			NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	47063730	47063730	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47063730delT								None (None upstream) : TNS3 (251023 downstream)																																			---	---	---	---
TNS3	64759	broad.mit.edu	37	7	47428905	47428906	+	Intron	INS	-	CCT	CCT	rs140267691	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47428905_47428906insCCT	uc003tnv.2	-						TNS3_uc003tnw.2_Intron	NM_022748	NP_073585			tensin 3							focal adhesion	protein binding			ovary(4)	4																		---	---	---	---
TNS3	64759	broad.mit.edu	37	7	47493626	47493626	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47493626delT	uc003tnv.2	-						TNS3_uc003tnw.2_Intron|TNS3_uc010kyo.1_Intron	NM_022748	NP_073585			tensin 3							focal adhesion	protein binding			ovary(4)	4																		---	---	---	---
ABCA13	154664	broad.mit.edu	37	7	48276477	48276477	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48276477delT	uc003toq.2	+						ABCA13_uc010kyr.2_Intron	NM_152701	NP_689914			ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	49055302	49055302	+	IGR	DEL	A	-	-	rs150973272		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49055302delA								CDC14C (88253 upstream) : VWC2 (757955 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51814286	51814287	+	IGR	INS	-	T	T	rs150895903	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51814286_51814287insT								COBL (429771 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52231065	52231065	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52231065delT								COBL (846550 upstream) : POM121L12 (872284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52339930	52339930	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52339930delG								COBL (955415 upstream) : POM121L12 (763419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52545195	52545196	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52545195_52545196delTG								None (None upstream) : POM121L12 (558153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52771615	52771615	+	IGR	DEL	G	-	-	rs1649729	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52771615delG								None (None upstream) : POM121L12 (331734 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53224720	53224720	+	IGR	DEL	C	-	-	rs112228422		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53224720delC								POM121L12 (120103 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54700516	54700517	+	IGR	DEL	AG	-	-	rs34716100		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54700516_54700517delAG								VSTM2A (62329 upstream) : SEC61G (119424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54878721	54878722	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54878721_54878722delCA								SEC61G (51782 upstream) : EGFR (208003 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	55071656	55071656	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55071656delT								SEC61G (244717 upstream) : EGFR (15069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	55846039	55846039	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55846039delT								FKBP9L (73779 upstream) : SEPT14 (15198 downstream)																																			---	---	---	---
PSPH	5723	broad.mit.edu	37	7	56086504	56086504	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56086504delA	uc003trg.2	-						PSPH_uc003trh.2_Intron|PSPH_uc003tri.2_Intron|PSPH_uc003trj.2_Intron	NM_004577	NP_004568			phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
PSPH	5723	broad.mit.edu	37	7	56174356	56174356	+	Intron	DEL	A	-	-	rs113578920		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56174356delA	uc003trj.2	-						CHCHD2_uc003tsa.2_5'Flank	NM_004577	NP_004568			phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	56403790	56403791	+	IGR	INS	-	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56403790_56403791insG								PSPH (219700 upstream) : DKFZp434L192 (160125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56778660	56778660	+	IGR	DEL	A	-	-	rs35089681		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56778660delA								DKFZp434L192 (213683 upstream) : ZNF479 (408668 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56845639	56845640	+	IGR	INS	-	G	G	rs62461817		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56845639_56845640insG								DKFZp434L192 (280662 upstream) : ZNF479 (341688 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56933687	56933688	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56933687_56933688insA								DKFZp434L192 (368710 upstream) : ZNF479 (253640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57017246	57017247	+	IGR	INS	-	CTC	CTC			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57017246_57017247insCTC								DKFZp434L192 (452269 upstream) : ZNF479 (170081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57432319	57432319	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57432319delA								ZNF479 (224748 upstream) : ZNF716 (77564 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57607910	57607910	+	IGR	DEL	G	-	-	rs77252234		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57607910delG								ZNF716 (74645 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57635123	57635123	+	IGR	DEL	C	-	-	rs78649440		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57635123delC								ZNF716 (101858 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57648800	57648800	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57648800delT								ZNF716 (115535 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57921145	57921146	+	IGR	INS	-	TAA	TAA	rs145949630	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57921145_57921146insTAA								ZNF716 (387880 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61066277	61066278	+	IGR	INS	-	AT	AT	rs149998331	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61066277_61066278insAT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61077228	61077228	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61077228delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61092374	61092374	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61092374delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61875884	61875885	+	IGR	DEL	AA	-	-	rs146082238		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61875884_61875885delAA								None (None upstream) : LOC643955 (875787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62523792	62523793	+	IGR	INS	-	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62523792_62523793insC								None (None upstream) : LOC643955 (227879 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63033168	63033176	+	IGR	DEL	GAGGAGGAG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63033168_63033176delGAGGAGGAG								LOC100287704 (221017 upstream) : ZNF727 (472645 downstream)																																			---	---	---	---
ZNF679	168417	broad.mit.edu	37	7	63711831	63711832	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63711831_63711832insA	uc003tsx.2	+							NM_153363	NP_699194			zinc finger protein 679						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	63773118	63773118	+	5'Flank	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63773118delC	uc011kdo.1	+											SubName: Full=cDNA FLJ57041, moderately similar to Zinc finger protein 92;																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	64182902	64182902	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64182902delT								ZNF107 (11503 upstream) : ZNF138 (71869 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65056885	65056886	+	IGR	DEL	CC	-	-	rs78263008		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65056885_65056886delCC								ZNF92 (190888 upstream) : INTS4L2 (55891 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65187352	65187354	+	Intron	DEL	GTC	-	-	rs113176972		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65187352_65187354delGTC	uc003tud.1	-											Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																														---	---	---	---
GUSB	2990	broad.mit.edu	37	7	65448970	65448970	+	5'Flank	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65448970delA	uc003tun.2	-						GUSB_uc011kdt.1_5'Flank|GUSB_uc010kzw.1_5'Flank	NM_000181	NP_000172			glucuronidase, beta precursor						glycosaminoglycan catabolic process	lysosome	beta-glucuronidase activity|cation binding				0																		---	---	---	---
TYW1	55253	broad.mit.edu	37	7	66644396	66644396	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66644396delC	uc003tvn.2	+						TYW1_uc010lai.2_Intron|TYW1_uc011kef.1_Intron	NM_018264	NP_060734			radical S-adenosyl methionine and flavodoxin						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	67001483	67001483	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67001483delT								STAG3L4 (214971 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67052875	67052890	+	IGR	DEL	CTCCCTCCCTCCCTCT	-	-	rs60682449	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67052875_67052890delCTCCCTCCCTCCCTCT								STAG3L4 (266363 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67159101	67159102	+	IGR	DEL	CT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67159101_67159102delCT								STAG3L4 (372589 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67317035	67317035	+	IGR	DEL	A	-	-	rs34782370		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67317035delA								STAG3L4 (530523 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67700874	67700875	+	IGR	DEL	AG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67700874_67700875delAG								STAG3L4 (914362 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	70270686	70270687	+	IGR	INS	-	TT	TT	rs34592057		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70270686_70270687insTT								AUTS2 (12802 upstream) : WBSCR17 (327102 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	70343610	70343610	+	IGR	DEL	T	-	-	rs150450584	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70343610delT								AUTS2 (85726 upstream) : WBSCR17 (254179 downstream)																																			---	---	---	---
CALN1	83698	broad.mit.edu	37	7	71271292	71271292	+	Intron	DEL	T	-	-	rs144060906		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71271292delT	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440			calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)																---	---	---	---
LIMK1	3984	broad.mit.edu	37	7	73536267	73536267	+	3'UTR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73536267delT	uc003uaa.1	+	16					RFC2_uc011kfa.1_Intron|LIMK1_uc010lbl.1_RNA|LIMK1_uc003uab.2_3'UTR	NM_002314	NP_002305			LIM domain kinase 1						actin cytoskeleton organization|axon guidance|negative regulation of ubiquitin-protein ligase activity|positive regulation of actin filament bundle assembly|positive regulation of axon extension|Rho protein signal transduction	cytosol|growth cone|nucleus	ATP binding|heat shock protein binding|protein serine/threonine kinase activity|zinc ion binding			stomach(2)|ovary(1)	3		Lung NSC(55;0.137)																---	---	---	---
GATSL1	389523	broad.mit.edu	37	7	74397717	74397718	+	Intron	DEL	AG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74397717_74397718delAG	uc003ubo.2	+							NM_001145063	NP_001138535			GATS-like protein 1												0																		---	---	---	---
ZP3	7784	broad.mit.edu	37	7	76051211	76051213	+	Intron	DEL	TTG	-	-	rs140017933		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76051211_76051213delTTG	uc003ufc.3	+							NM_007155	NP_009086			zona pellucida glycoprotein 3 isoform 2						binding of sperm to zona pellucida|blastocyst formation|egg coat formation|humoral immune response mediated by circulating immunoglobulin|intracellular protein transport|negative regulation of binding of sperm to zona pellucida|negative regulation of transcription, DNA-dependent|oocyte development|phosphatidylinositol-mediated signaling|positive regulation of acrosomal vesicle exocytosis|positive regulation of acrosome reaction|positive regulation of antral ovarian follicle growth|positive regulation of calcium ion import|positive regulation of calcium ion transport via store-operated calcium channel activity|positive regulation of humoral immune response|positive regulation of interferon-gamma production|positive regulation of interleukin-4 production|positive regulation of leukocyte migration|positive regulation of ovarian follicle development|positive regulation of phosphatidylinositol biosynthetic process|positive regulation of protein kinase activity|positive regulation of protein kinase B signaling cascade|positive regulation of T cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of type IV hypersensitivity|protein kinase C signaling cascade	endoplasmic reticulum|extracellular space|Golgi apparatus|integral to membrane|multivesicular body|outer acrosomal membrane|perinuclear region of cytoplasm|plasma membrane|proteinaceous extracellular matrix	acrosin binding|manganese ion transmembrane transporter activity|receptor activity|sugar binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	76591849	76591849	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76591849delC								POMZP3 (335229 upstream) : PMS2L11 (18290 downstream)																																			---	---	---	---
PHTF2	57157	broad.mit.edu	37	7	77518911	77518912	+	Intron	INS	-	T	T	rs150992744		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77518911_77518912insT	uc003ugs.3	+						PHTF2_uc003ugo.3_Intron|PHTF2_uc003ugp.2_Intron|PHTF2_uc003ugq.3_Intron|PHTF2_uc010ldv.2_Intron|PHTF2_uc003ugr.3_Intron|PHTF2_uc003ugt.3_Intron|PHTF2_uc003ugu.3_Intron	NM_001127357	NP_001120829			putative homeodomain transcription factor 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum|nucleus	DNA binding			ovary(1)	1																		---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	78190524	78190524	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78190524delG	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	78254032	78254032	+	Intron	DEL	G	-	-	rs113370289		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78254032delG	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
CACNA2D1	781	broad.mit.edu	37	7	81998420	81998421	+	Intron	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81998420_81998421delTC	uc003uhr.1	-							NM_000722	NP_000713			calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	82182920	82182920	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82182920delT								CACNA2D1 (109889 upstream) : PCLO (200401 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	82265796	82265796	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82265796delA								CACNA2D1 (192765 upstream) : PCLO (117525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	83929368	83929368	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83929368delG								SEMA3A (105151 upstream) : SEMA3D (695506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	86160436	86160436	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86160436delG								None (None upstream) : GRM3 (112794 downstream)																																			---	---	---	---
CROT	54677	broad.mit.edu	37	7	87025421	87025421	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87025421delA	uc003uit.2	+						CROT_uc003uiu.2_Intron	NM_021151	NP_066974			peroxisomal carnitine O-octanoyltransferase						fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity			ovary(2)|lung(1)	3	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)													---	---	---	---
ADAM22	53616	broad.mit.edu	37	7	87761451	87761452	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87761451_87761452insT	uc003ujn.2	+						ADAM22_uc003ujj.1_3'UTR|ADAM22_uc003ujk.1_Intron|ADAM22_uc003ujl.1_Intron|ADAM22_uc003ujm.2_Intron|ADAM22_uc003ujo.2_Intron|ADAM22_uc003ujp.1_Intron	NM_021723	NP_068369			ADAM metallopeptidase domain 22 isoform 1						cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
ADAM22	53616	broad.mit.edu	37	7	87772152	87772153	+	Intron	INS	-	A	A	rs78464461		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87772152_87772153insA	uc003ujn.2	+						ADAM22_uc003ujk.1_Intron|ADAM22_uc003ujl.1_Intron|ADAM22_uc003ujm.2_Intron|ADAM22_uc003ujo.2_Intron|ADAM22_uc003ujp.1_Intron	NM_021723	NP_068369			ADAM metallopeptidase domain 22 isoform 1						cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	89617912	89617931	+	IGR	DEL	CCTACCTGTTCCTCTTCCTA	-	-	rs111354489		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89617912_89617931delCCTACCTGTTCCTCTTCCTA								ZNF804B (651568 upstream) : DPY19L2P4 (130783 downstream)																																			---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90422030	90422031	+	Intron	INS	-	A	A	rs142828951	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90422030_90422031insA	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	92585225	92585225	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92585225delA								CDK6 (119284 upstream) : SAMD9 (143607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	92640986	92640986	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92640986delT								CDK6 (175045 upstream) : SAMD9 (87846 downstream)																																			---	---	---	---
CALCR	799	broad.mit.edu	37	7	93069858	93069859	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93069858_93069859delTG	uc003umv.1	-						CALCR_uc011kia.1_Intron|CALCR_uc003ums.1_Intron|CALCR_uc003umt.1_Intron|CALCR_uc003umu.1_Intron|CALCR_uc003umw.2_Intron	NM_001742	NP_001733			calcitonin receptor isoform 2 precursor						activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)													---	---	---	---
CALCR	799	broad.mit.edu	37	7	93136922	93136923	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93136922_93136923insA	uc003umv.1	-						CALCR_uc003umu.1_Intron|CALCR_uc003umw.2_Intron	NM_001742	NP_001733			calcitonin receptor isoform 2 precursor						activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)													---	---	---	---
GNGT1	2792	broad.mit.edu	37	7	93446890	93446890	+	Intron	DEL	T	-	-	rs145190332		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93446890delT	uc003umx.1	+											Homo sapiens guanine nucleotide binding protein gamma 1 (GNG1) mRNA, complete cds.						G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	94497692	94497693	+	IGR	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94497692_94497693delTT								PEG10 (198688 upstream) : PPP1R9A (39256 downstream)																																			---	---	---	---
PON1	5444	broad.mit.edu	37	7	94942931	94942934	+	Intron	DEL	TGTG	-	-	rs66788712	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94942931_94942934delTGTG	uc003uns.2	-						PON1_uc011kih.1_Intron	NM_000446	NP_000437			paraoxonase 1 precursor						aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	96562823	96562824	+	IGR	DEL	AT	-	-	rs145036259		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96562823_96562824delAT								SHFM1 (223620 upstream) : DLX6AS (35004 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	97139189	97139189	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97139189delT								ACN9 (328116 upstream) : TAC1 (222082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	97696263	97696263	+	IGR	DEL	T	-	-	rs139248510		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97696263delT								OCM2 (76847 upstream) : LMTK2 (39934 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	99593837	99593838	+	IGR	INS	-	T	T	rs36023254		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99593837_99593838insT								AZGP1 (20150 upstream) : ZKSCAN1 (19381 downstream)																																			---	---	---	---
STAG3	10734	broad.mit.edu	37	7	99784306	99784306	+	Intron	DEL	A	-	-	rs75682564		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99784306delA	uc003utx.1	+						STAG3_uc010lgs.1_Intron|STAG3_uc011kjk.1_Intron	NM_012447	NP_036579			stromal antigen 3						chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	100619155	100619155	+	IGR	DEL	G	-	-	rs111535032		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100619155delG								ACHE (124616 upstream) : MUC12 (28920 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	100715503	100715504	+	IGR	INS	-	GGAA	GGAA			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100715503_100715504insGGAA								MUC17 (13363 upstream) : TRIM56 (13282 downstream)																																			---	---	---	---
EMID2	136227	broad.mit.edu	37	7	101007526	101007526	+	Intron	DEL	T	-	-	rs34614004		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101007526delT	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714			EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)																	---	---	---	---
EMID2	136227	broad.mit.edu	37	7	101014767	101014767	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101014767delA	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714			EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	101237889	101237890	+	IGR	INS	-	A	A	rs78394152		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101237889_101237890insA								EMID2 (35585 upstream) : MYL10 (18716 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	101351541	101351541	+	IGR	DEL	A	-	-	rs34001490		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101351541delA								MYL10 (78965 upstream) : CUX1 (107751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	101410724	101410724	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101410724delA								MYL10 (138148 upstream) : CUX1 (48568 downstream)																																			---	---	---	---
ORAI2	80228	broad.mit.edu	37	7	102085745	102085745	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102085745delT	uc010lhz.1	+						ORAI2_uc003uzj.2_Intron|ORAI2_uc003uzk.2_Intron|ORAI2_uc011kks.1_Intron	NM_001126340	NP_001119812			ORAI calcium release-activated calcium modulator							integral to membrane	protein binding			ovary(1)|kidney(1)	2																		---	---	---	---
SLC26A5	375611	broad.mit.edu	37	7	103016197	103016197	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103016197delT	uc003vbz.2	-						SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_Intron|SLC26A5_uc003vbx.2_Intron|SLC26A5_uc003vby.2_Intron|SLC26A5_uc010liy.2_Intron	NM_198999	NP_945350			prestin isoform a						regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1																		---	---	---	---
SLC26A5	375611	broad.mit.edu	37	7	103068299	103068299	+	Intron	DEL	T	-	-	rs142696834		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103068299delT	uc003vbz.2	-						SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_Intron|SLC26A5_uc003vbx.2_Intron|SLC26A5_uc003vby.2_Intron|SLC26A5_uc010liy.2_Intron	NM_198999	NP_945350			prestin isoform a						regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1																		---	---	---	---
RELN	5649	broad.mit.edu	37	7	103186095	103186096	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103186095_103186096insT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036			reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	104638348	104638348	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104638348delG								LOC723809 (71256 upstream) : LOC100216545 (12641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	105064661	105064661	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105064661delC								SRPK2 (24863 upstream) : PUS7 (32301 downstream)																																			---	---	---	---
CDHR3	222256	broad.mit.edu	37	7	105597065	105597065	+	Intron	DEL	G	-	-	rs78948626		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105597065delG	uc003vdk.2	+											RecName: Full=Cadherin-like protein 28; Flags: Precursor;						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	105826885	105826886	+	IGR	INS	-	T	T	rs145809600		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105826885_105826886insT								SYPL1 (73828 upstream) : NAMPT (61848 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	105888120	105888121	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105888120_105888121insT								SYPL1 (135063 upstream) : NAMPT (613 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	106138087	106138087	+	Intron	DEL	A	-	-	rs149913196		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106138087delA	uc003vds.2	-											Homo sapiens full length insert cDNA clone ZC44D09.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	106289552	106289555	+	Intron	DEL	TCTC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106289552_106289555delTCTC	uc003vds.2	-											Homo sapiens full length insert cDNA clone ZC44D09.																														---	---	---	---
COG5	10466	broad.mit.edu	37	7	106911074	106911075	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106911074_106911075delAC	uc003ved.2	-						COG5_uc003vec.2_Intron|COG5_uc003vee.2_Intron	NM_181733	NP_859422			component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4																		---	---	---	---
COG5	10466	broad.mit.edu	37	7	107165684	107165684	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107165684delT	uc003ved.2	-						COG5_uc003vec.2_Intron|COG5_uc003vee.2_Intron	NM_181733	NP_859422			component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4																		---	---	---	---
DLD	1738	broad.mit.edu	37	7	107546542	107546542	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107546542delA	uc003vet.2	+						DLD_uc010ljm.1_Intron|DLD_uc011kmg.1_Intron|DLD_uc011kmh.1_Intron|DLD_uc011kmi.1_Intron	NM_000108	NP_000099			dihydrolipoamide dehydrogenase precursor						branched chain family amino acid catabolic process|cell redox homeostasis|lysine catabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	dihydrolipoyl dehydrogenase activity			central_nervous_system(1)	1					NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	109560979	109560981	+	IGR	DEL	GAG	-	-	rs36152754		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109560979_109560981delGAG								None (None upstream) : EIF3IP1 (38303 downstream)																																			---	---	---	---
FOXP2	93986	broad.mit.edu	37	7	113927312	113927312	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113927312delA	uc003vgu.2	+						FOXP2_uc003vgt.1_Intron|FOXP2_uc003vgv.1_5'Flank					Homo sapiens full length insert cDNA clone YX52E07.						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	115102846	115102847	+	IGR	INS	-	TCTCA	TCTCA	rs143253163	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115102846_115102847insTCTCA								MDFIC (443583 upstream) : TFEC (472355 downstream)																																			---	---	---	---
TFEC	22797	broad.mit.edu	37	7	115802847	115802848	+	5'Flank	DEL	AT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115802847_115802848delAT	uc011kmw.1	-											SubName: Full=cDNA FLJ55256, highly similar to Homo sapiens transcription factor EC (TFEC), transcript variant 1, mRNA;							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	117001033	117001033	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117001033delA								WNT2 (37690 upstream) : ASZ1 (2243 downstream)																																			---	---	---	---
CFTR	1080	broad.mit.edu	37	7	117176048	117176048	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117176048delG	uc003vjd.2	+						CFTR_uc011knq.1_Intron	NM_000492	NP_000483			cystic fibrosis transmembrane conductance						respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)									Cystic_Fibrosis				---	---	---	---
Unknown	0	broad.mit.edu	37	7	118137628	118137628	+	IGR	DEL	G	-	-	rs10714694		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118137628delG								ANKRD7 (254846 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	118400168	118400168	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118400168delT								ANKRD7 (517386 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	119236508	119236509	+	IGR	INS	-	TG	TG	rs112088481		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119236508_119236509insTG								None (None upstream) : KCND2 (677213 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	124164236	124164237	+	IGR	INS	-	TGTGCA	TGTGCA	rs146729092	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124164236_124164237insTGTGCA								TMEM229A (490713 upstream) : GPR37 (221879 downstream)																																			---	---	---	---
GRM8	2918	broad.mit.edu	37	7	126763933	126763938	+	Intron	DEL	CCTTTC	-	-	rs142144949		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126763933_126763938delCCTTTC	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron	NM_000845	NP_000836			glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)										HNSCC(24;0.065)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	128104719	128104722	+	IGR	DEL	GAGG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128104719_128104722delGAGG								C7orf68 (6248 upstream) : METTL2B (12061 downstream)																																			---	---	---	---
CCDC136	64753	broad.mit.edu	37	7	128448549	128448549	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128448549delT	uc003vnv.1	+						CCDC136_uc003vnu.1_Intron|CCDC136_uc003vnw.1_Intron|CCDC136_uc003vnx.1_Intron|CCDC136_uc010llq.1_Intron|CCDC136_uc003vny.1_Intron	NM_022742	NP_073579			coiled-coil domain containing 136							integral to membrane	protein binding			ovary(2)	2																		---	---	---	---
TSPAN33	340348	broad.mit.edu	37	7	128783057	128783057	+	5'Flank	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128783057delT	uc003vop.1	+							NM_178562	NP_848657			tetraspanin 33							integral to membrane				ovary(1)	1																		---	---	---	---
NRF1	4899	broad.mit.edu	37	7	129345780	129345781	+	Intron	INS	-	GA	GA	rs142900205	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129345780_129345781insGA	uc003voz.2	+						NRF1_uc003vpa.2_Intron|NRF1_uc011kpa.1_Intron|NRF1_uc003vpb.2_Intron	NM_005011	NP_005002			nuclear respiratory factor 1						generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	131557940	131557940	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131557940delT								PODXL (316564 upstream) : PLXNA4 (250152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	131799892	131799892	+	IGR	DEL	T	-	-	rs35222576		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131799892delT								PODXL (558516 upstream) : PLXNA4 (8200 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	132836046	132836046	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132836046delT								CHCHD3 (69218 upstream) : EXOC4 (101777 downstream)																																			---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133198920	133198920	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133198920delT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	136197318	136197318	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136197318delA								LUZP6 (535114 upstream) : CHRM2 (356081 downstream)																																			---	---	---	---
PTN	5764	broad.mit.edu	37	7	136971163	136971163	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136971163delC	uc003vtq.2	-						PTN_uc010lmx.2_Intron|PTN_uc003vtr.1_Intron	NM_002825	NP_002816			pleiotrophin						nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity			upper_aerodigestive_tract(1)|pancreas(1)	2																		---	---	---	---
ATP6V0A4	50617	broad.mit.edu	37	7	138402792	138402793	+	Intron	INS	-	A	A	rs149777134	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138402792_138402793insA	uc003vuf.2	-						ATP6V0A4_uc003vug.2_Intron|ATP6V0A4_uc003vuh.2_Intron	NM_130841	NP_570856			ATPase, H+ transporting, lysosomal V0 subunit						cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1																		---	---	---	---
JHDM1D	80853	broad.mit.edu	37	7	139854120	139854121	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139854120_139854121insA	uc003vvm.2	-							NM_030647	NP_085150			jumonji C domain containing histone demethylase						midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)																	---	---	---	---
LOC100124692	100124692	broad.mit.edu	37	7	141899281	141899281	+	Intron	DEL	A	-	-	rs67434200		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141899281delA	uc003vxa.2	+							NR_003717				Homo sapiens cDNA FLJ16351 fis, clone TESTI2039060, moderately similar to Maltase-glucoamylase, intestinal.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	142816856	142816856	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142816856delT								OR6W1P (55974 upstream) : PIP (12318 downstream)																																			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	145923647	145923647	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145923647delA	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147271728	147271729	+	Intron	INS	-	T	T	rs138129695	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147271728_147271729insT	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	148729380	148729382	+	IGR	DEL	TTT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148729380_148729382delTTT								PDIA4 (3598 upstream) : ZNF786 (37351 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	148886767	148886767	+	IGR	DEL	A	-	-	rs72472809		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148886767delA								ZNF398 (6651 upstream) : ZNF282 (5810 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	149578154	149578155	+	5'Flank	DEL	CA	-	-	rs5888370		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149578154_149578155delCA	uc003wgt.1	+											Homo sapiens cDNA clone IMAGE:40014135.																														---	---	---	---
ZNF775	285971	broad.mit.edu	37	7	150084384	150084385	+	Intron	DEL	AA	-	-	rs66522979		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150084384_150084385delAA	uc003whf.1	+							NM_173680	NP_775951			zinc finger protein 775						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.0173)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	150179630	150179631	+	IGR	INS	-	T	T	rs151163563	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150179630_150179631insT								GIMAP8 (3148 upstream) : GIMAP7 (32314 downstream)																																			---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152085813	152085814	+	Intron	DEL	TA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152085813_152085814delTA	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152108094	152108095	+	Intron	INS	-	ATAT	ATAT	rs11973694	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152108094_152108095insATAT	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	7	153191841	153191842	+	IGR	INS	-	A	A	rs111790626		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153191841_153191842insA								ACTR3B (639378 upstream) : DPP6 (392577 downstream)																																			---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154406136	154406136	+	Intron	DEL	T	-	-	rs67184731		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154406136delT	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154570966	154570989	+	Intron	DEL	CCACCACCCCTATCACCACCTCCA	-	-	rs77597139		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154570966_154570989delCCACCACCCCTATCACCACCTCCA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	157077038	157077039	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157077038_157077039insT								UBE3C (14973 upstream) : DNAJB6 (52671 downstream)																																			---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157349924	157349925	+	Intron	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157349924_157349925delCA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron|PTPRN2_uc003wnn.2_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	158055452	158055453	+	Intron	INS	-	CA	CA			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158055452_158055453insCA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
RPL23AP53	644128	broad.mit.edu	37	8	178815	178817	+	Intron	DEL	AAC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:178815_178817delAAC	uc010lra.2	-						RPL23AP53_uc003woq.3_Intron|RPL23AP53_uc010lrb.2_Intron	NR_003572				Homo sapiens cDNA FLJ45055 fis, clone BRAWH3022900.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	1046664	1046665	+	Intron	INS	-	C	C	rs142582219	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1046664_1046665insC	uc003wpj.1	+											Homo sapiens cDNA clone IMAGE:4824304.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	1152046	1152047	+	IGR	INS	-	TG	TG	rs146536480	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1152046_1152047insTG								ERICH1 (470820 upstream) : DLGAP2 (297522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	1402522	1402522	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1402522delT								ERICH1 (721296 upstream) : DLGAP2 (47047 downstream)																																			---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2847001	2847001	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2847001delT	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3305825	3305828	+	Intron	DEL	GGAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3305825_3305828delGGAA	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	4535467	4535467	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4535467delA	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	5548427	5548427	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5548427delC								CSMD1 (696099 upstream) : MCPH1 (715694 downstream)																																			---	---	---	---
MCPH1	79648	broad.mit.edu	37	8	6341379	6341383	+	Intron	DEL	AAAGA	-	-	rs112861347		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6341379_6341383delAAAGA	uc003wqi.2	+							NM_024596	NP_078872			microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	7227566	7227567	+	IGR	INS	-	T	T	rs144532470	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7227566_7227567insT								LOC349196 (14692 upstream) : DEFB103B (58924 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	8000983	8000983	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8000983delC								MIR548I3 (54372 upstream) : FLJ10661 (85109 downstream)																																			---	---	---	---
MFHAS1	9258	broad.mit.edu	37	8	8670323	8670323	+	Intron	DEL	T	-	-	rs79822483		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8670323delT	uc003wsj.1	-							NM_004225	NP_004216			malignant fibrous histiocytoma amplified												0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	8825165	8825165	+	IGR	DEL	T	-	-	rs145406770	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8825165delT								MFHAS1 (74034 upstream) : ERI1 (35149 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	8955177	8955177	+	IGR	DEL	A	-	-	rs148428330		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8955177delA								ERI1 (64328 upstream) : PPP1R3B (38597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9078017	9078017	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9078017delC								PPP1R3B (68933 upstream) : TNKS (335428 downstream)																																			---	---	---	---
MSRA	4482	broad.mit.edu	37	8	9985891	9985891	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9985891delA	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc011kwy.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463			methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)													---	---	---	---
MSRA	4482	broad.mit.edu	37	8	10194692	10194694	+	Intron	DEL	TTT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10194692_10194694delTTT	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463			methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	10420034	10420034	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10420034delC								PRSS55 (17327 upstream) : RP1L1 (43828 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	10746146	10746147	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10746146_10746147insA								SOX7 (48847 upstream) : XKR6 (7510 downstream)																																			---	---	---	---
XKR6	286046	broad.mit.edu	37	8	11054488	11054489	+	Intron	DEL	AG	-	-	rs150741942		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11054488_11054489delAG	uc003wtk.1	-							NM_173683	NP_775954			XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)														---	---	---	---
FAM167A	83648	broad.mit.edu	37	8	11297181	11297182	+	Intron	INS	-	A	A	rs140719793	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11297181_11297182insA	uc010lry.1	-						FAM167A_uc003wtw.2_Intron	NM_053279	NP_444509			hypothetical protein LOC83648												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	11742212	11742213	+	IGR	DEL	AG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11742212_11742213delAG								CTSB (16566 upstream) : DEFB136 (89235 downstream)																																			---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12401082	12401082	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12401082delG	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	14693716	14693716	+	Intron	DEL	C	-	-	rs11347184		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14693716delC	uc003wwq.2	-							NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	15019694	15019694	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15019694delT	uc003wwq.2	-							NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	16589384	16589385	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16589384_16589385insA								MSR1 (539084 upstream) : FGF20 (260949 downstream)																																			---	---	---	---
EFHA2	286097	broad.mit.edu	37	8	16936653	16936654	+	Intron	DEL	AT	-	-	rs34341847		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16936653_16936654delAT	uc003wxd.2	+							NM_181723	NP_859074			EF-hand domain family, member A2							integral to membrane	calcium ion binding			skin(1)	1				Colorectal(111;0.0686)|COAD - Colon adenocarcinoma(73;0.239)														---	---	---	---
PCM1	5108	broad.mit.edu	37	8	17873795	17873796	+	Intron	INS	-	AGAT	AGAT	rs150555183	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17873795_17873796insAGAT	uc003wyi.3	+						PCM1_uc011kyh.1_Intron|PCM1_uc003wyj.3_Intron|PCM1_uc011kyi.1_Intron|PCM1_uc011kyj.1_Intron|PCM1_uc003wyk.3_Intron|PCM1_uc011kyk.1_Intron	NM_006197	NP_006188			pericentriolar material 1						centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)				T	RET|JAK2	papillary thyroid|CML|MPD								---	---	---	---
Unknown	0	broad.mit.edu	37	8	18929220	18929221	+	IGR	INS	-	CTT	CTT	rs146085392	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18929220_18929221insCTT								PSD3 (58024 upstream) : SH2D4A (241986 downstream)																																			---	---	---	---
CSGALNACT1	55790	broad.mit.edu	37	8	19605565	19605566	+	Intron	INS	-	A	A	rs139058961	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19605565_19605566insA	uc011kyp.1	-							NM_018371	NP_060841			chondroitin sulfate						anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	19891574	19891575	+	IGR	DEL	AA	-	-	rs72308968		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19891574_19891575delAA								LPL (66805 upstream) : SLC18A1 (110792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	21325495	21325496	+	IGR	INS	-	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21325495_21325496insG								None (None upstream) : GFRA2 (224034 downstream)																																			---	---	---	---
SLC39A14	23516	broad.mit.edu	37	8	22283402	22283403	+	Intron	INS	-	T	T	rs4872491	by1000genomes;by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22283402_22283403insT	uc011kzg.1	+							NM_001135154	NP_001128626			solute carrier family 39 (zinc transporter),							endoplasmic reticulum|Golgi apparatus|integral to membrane|lamellipodium|plasma membrane	zinc ion transmembrane transporter activity				0				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	23603882	23603885	+	IGR	DEL	TCCC	-	-	rs71872636		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23603882_23603885delTCCC								NKX2-6 (39960 upstream) : STC1 (95549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	24882677	24882677	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24882677delA								NEFL (68546 upstream) : DOCK5 (159610 downstream)																																			---	---	---	---
DPYSL2	1808	broad.mit.edu	37	8	26426881	26426881	+	Intron	DEL	C	-	-	rs7815258		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26426881delC	uc003xfa.2	+							NM_001386	NP_001377			dihydropyrimidinase-like 2						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)														---	---	---	---
DPYSL2	1808	broad.mit.edu	37	8	26452664	26452665	+	Intron	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26452664_26452665delCA	uc003xfb.1	+						DPYSL2_uc003xfa.2_Intron|DPYSL2_uc011lag.1_Intron|DPYSL2_uc010luk.1_Intron|DPYSL2_uc011lah.1_Intron	NM_001386	NP_001377			dihydropyrimidinase-like 2						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	26564938	26564938	+	IGR	DEL	A	-	-	rs71553818		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26564938delA								DPYSL2 (49245 upstream) : ADRA1A (40729 downstream)																																			---	---	---	---
SCARA5	286133	broad.mit.edu	37	8	27767655	27767655	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27767655delT	uc003xgj.2	-						SCARA5_uc010luz.2_Intron|SCARA5_uc003xgk.2_Intron|SCARA5_uc003xgl.2_Intron	NM_173833	NP_776194			scavenger receptor class A, member 5						cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity			central_nervous_system(1)|skin(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)														---	---	---	---
SCARA5	286133	broad.mit.edu	37	8	27776170	27776171	+	Intron	INS	-	AGG	AGG	rs140132210	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27776170_27776171insAGG	uc003xgj.2	-						SCARA5_uc010luz.2_Intron|SCARA5_uc003xgk.2_Intron|SCARA5_uc003xgl.2_Intron	NM_173833	NP_776194			scavenger receptor class A, member 5						cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity			central_nervous_system(1)|skin(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)														---	---	---	---
FZD3	7976	broad.mit.edu	37	8	28390113	28390113	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28390113delT	uc003xgx.2	+						FZD3_uc010lvb.2_Intron	NM_017412	NP_059108			frizzled 3 precursor						canonical Wnt receptor signaling pathway|cell proliferation in midbrain|commissural neuron axon guidance|establishment of planar polarity|facial nucleus development|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|inner ear morphogenesis|neural tube closure|vasculature development	apical part of cell|axon|cytoplasm|dendrite|integral to membrane|neuron projection membrane|neuronal cell body|presynaptic active zone	G-protein coupled receptor activity|PDZ domain binding|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	28471365	28471365	+	IGR	DEL	T	-	-	rs150015829		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28471365delT								FZD3 (49406 upstream) : EXTL3 (87788 downstream)																																			---	---	---	---
KIF13B	23303	broad.mit.edu	37	8	29074477	29074478	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29074477_29074478insA	uc003xhh.3	-						KIF13B_uc003xhj.2_Intron|KIF13B_uc010lvf.1_Intron|KIF13B_uc003xhk.2_Intron	NM_015254	NP_056069			kinesin family member 13B						microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)														---	---	---	---
WRN	7486	broad.mit.edu	37	8	30949020	30949020	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30949020delT	uc003xio.3	+						WRN_uc010lvk.2_Intron	NM_000553	NP_000544			Werner syndrome protein						base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)				Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	8	31375854	31375855	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31375854_31375855insT								WRN (344578 upstream) : NRG1 (121413 downstream)																																			---	---	---	---
MAK16	84549	broad.mit.edu	37	8	33357517	33357517	+	3'UTR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33357517delT	uc003xjj.2	+	10					C8orf41_uc010lvu.1_Intron|C8orf41_uc003xjk.3_Intron|C8orf41_uc010lvv.2_Intron|C8orf41_uc003xjl.3_Intron|C8orf41_uc003xjm.3_Intron	NM_032509	NP_115898			MAK16 homolog							nucleolus				ovary(1)	1																		---	---	---	---
RNF122	79845	broad.mit.edu	37	8	33418627	33418627	+	Intron	DEL	C	-	-	rs11356110		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33418627delC	uc003xjo.1	-							NM_024787	NP_079063			ring finger protein 122							endoplasmic reticulum|Golgi apparatus|integral to membrane	zinc ion binding				0				KIRC - Kidney renal clear cell carcinoma(67;0.0966)|Kidney(114;0.116)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	34554867	34554868	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34554867_34554868insA								None (None upstream) : UNC5D (538107 downstream)																																			---	---	---	---
DDHD2	23259	broad.mit.edu	37	8	38116737	38116738	+	Intron	INS	-	T	T	rs111261604		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38116737_38116738insT	uc003xlb.2	+						DDHD2_uc003xlc.2_Intron|DDHD2_uc003xld.2_Intron	NM_015214	NP_056029			DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	39702431	39702431	+	IGR	DEL	T	-	-	rs150893300		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39702431delT								ADAM2 (6652 upstream) : IDO1 (68897 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	40247865	40247865	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40247865delT								C8orf4 (235044 upstream) : ZMAT4 (140251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	40846106	40846107	+	IGR	INS	-	CTG	CTG	rs138322644	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40846106_40846107insCTG								ZMAT4 (90763 upstream) : SFRP1 (273372 downstream)																																			---	---	---	---
ANK1	286	broad.mit.edu	37	8	41654068	41654068	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41654068delA	uc003xok.2	-						ANK1_uc003xoi.2_Intron|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron	NM_020476	NP_065209			ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	41941820	41941821	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41941820_41941821insT								MYST3 (32315 upstream) : AP3M2 (68643 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	42005233	42005233	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42005233delA								MYST3 (95728 upstream) : AP3M2 (5231 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	42082356	42082357	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42082356_42082357insA								PLAT (17162 upstream) : IKBKB (46472 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	43817353	43817353	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43817353delT								POTEA (599025 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	43826359	43826360	+	IGR	INS	-	T	T	rs150763522		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43826359_43826360insT								POTEA (608031 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	47302862	47302876	+	IGR	DEL	AAAGCCCGACGCTGT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47302862_47302876delAAAGCCCGACGCTGT								None (None upstream) : BEYLA (449632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	50172808	50172808	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50172808delT								C8orf22 (184167 upstream) : SNTG1 (649541 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	50720906	50720906	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50720906delA								C8orf22 (732265 upstream) : SNTG1 (101443 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	52183753	52183754	+	IGR	INS	-	G	G	rs140691628	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52183753_52183754insG								SNTG1 (478326 upstream) : PXDNL (48390 downstream)																																			---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52438897	52438898	+	Intron	INS	-	TT	TT	rs139109962	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52438897_52438898insTT	uc003xqu.3	-							NM_144651	NP_653252			peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)														OREG0018765	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52458213	52458213	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52458213delG	uc003xqu.3	-							NM_144651	NP_653252			peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	53434300	53434300	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53434300delA								ST18 (111861 upstream) : FAM150A (12298 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	54231470	54231470	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54231470delT								OPRK1 (67276 upstream) : ATP6V1H (396646 downstream)																																			---	---	---	---
RGS20	8601	broad.mit.edu	37	8	54782823	54782824	+	Intron	DEL	AC	-	-	rs112678663		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54782823_54782824delAC	uc003xrp.2	+						RGS20_uc003xrq.2_Intron|RGS20_uc010lye.2_Intron|RGS20_uc010lyf.2_Intron	NM_170587	NP_733466			regulator of G-protein signaling 20 isoform a						negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|nucleus|plasma membrane	GTPase activator activity|protein binding|signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	55102352	55102352	+	IGR	DEL	A	-	-	rs80188011		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55102352delA								MRPL15 (41278 upstream) : SOX17 (268143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	55127611	55127613	+	IGR	DEL	AAC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55127611_55127613delAAC								MRPL15 (66537 upstream) : SOX17 (242882 downstream)																																			---	---	---	---
XKR4	114786	broad.mit.edu	37	8	56084771	56084771	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56084771delA	uc003xsf.2	+							NM_052898	NP_443130			XK, Kell blood group complex subunit-related							integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	57840684	57840685	+	IGR	INS	-	GA	GA	rs142615099	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57840684_57840685insGA								PENK (481402 upstream) : IMPAD1 (29806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	58740590	58740590	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58740590delG								C8orf71 (543302 upstream) : FAM110B (166523 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	58871529	58871530	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58871529_58871530insA								C8orf71 (674241 upstream) : FAM110B (35583 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	60264313	60264314	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60264313_60264314insA								TOX (232546 upstream) : CA8 (837109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	60684990	60684991	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60684990_60684991insT								TOX (653223 upstream) : CA8 (416432 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	60814241	60814242	+	IGR	INS	-	TG	TG			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60814241_60814242insTG								TOX (782474 upstream) : CA8 (287181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	61253438	61253438	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61253438delA								CA8 (59484 upstream) : RAB2A (176121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	61914544	61914545	+	IGR	INS	-	T	T	rs139036188		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61914544_61914545insT								CHD7 (135081 upstream) : CLVS1 (285980 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	62684978	62684979	+	IGR	INS	-	T	T	rs34689577		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62684978_62684979insT								ASPH (57779 upstream) : NKAIN3 (476522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	62867192	62867193	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62867192_62867193delTC								ASPH (239993 upstream) : NKAIN3 (294308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	66043475	66043476	+	IGR	DEL	CT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66043475_66043476delCT								CYP7B1 (332127 upstream) : ARMC1 (471596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	66899587	66899588	+	IGR	INS	-	TT	TT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66899587_66899588insTT								PDE7A (145832 upstream) : DNAJC5B (34203 downstream)																																			---	---	---	---
SGK3	23678	broad.mit.edu	37	8	67600477	67600477	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67600477delG	uc003xwp.2	+							NM_013257	NP_037389			serum/glucocorticoid regulated kinase 3 isoform						cell communication|response to stress	cytoplasmic membrane-bounded vesicle|early endosome	ATP binding|phosphatidylinositol binding|protein serine/threonine kinase activity			ovary(1)|large_intestine(1)|lung(1)|breast(1)	4	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	68758525	68758525	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68758525delA								CPA6 (99905 upstream) : PREX2 (105823 downstream)																																			---	---	---	---
SLCO5A1	81796	broad.mit.edu	37	8	70697181	70697182	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70697181_70697182insA	uc003xyl.2	-						SLCO5A1_uc010lzb.2_Intron|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Intron|SLCO5A1_uc010lzc.2_Intron	NM_030958	NP_112220			solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	72621745	72621746	+	IGR	INS	-	T	T	rs141055450	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72621745_72621746insT								EYA1 (347278 upstream) : MSC (132031 downstream)																																			---	---	---	---
KCNB2	9312	broad.mit.edu	37	8	73481869	73481869	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73481869delA	uc003xzb.2	+							NM_004770	NP_004761			potassium voltage-gated channel, Shab-related						regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	74139473	74139475	+	IGR	DEL	TCT	-	-	rs147397010		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74139473_74139475delTCT								C8orf84 (133966 upstream) : RPL7 (63400 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	75134646	75134646	+	IGR	DEL	T	-	-	rs34690576		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75134646delT								LY96 (193341 upstream) : JPH1 (12295 downstream)																																			---	---	---	---
HNF4G	3174	broad.mit.edu	37	8	76396634	76396635	+	Intron	INS	-	T	T	rs147139171	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76396634_76396635insT	uc003yaq.2	+						HNF4G_uc003yap.1_Intron	NM_004133	NP_004124			hepatocyte nuclear factor 4, gamma						endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	76671989	76671989	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76671989delT								HNF4G (192930 upstream) : LOC100192378 (851126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78048698	78048698	+	IGR	DEL	T	-	-	rs143400048		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78048698delT								PEX2 (136174 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78454656	78454656	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78454656delA								PEX2 (542132 upstream) : PKIA (973680 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78769368	78769369	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78769368_78769369delTC								PEX2 (856844 upstream) : PKIA (658967 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	80811433	80811434	+	IGR	DEL	AG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80811433_80811434delAG								HEY1 (131335 upstream) : MRPS28 (19662 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81163765	81163766	+	IGR	DEL	GA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81163765_81163766delGA								TPD52 (79929 upstream) : ZBTB10 (234088 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81338255	81338256	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81338255_81338256insA								TPD52 (254419 upstream) : ZBTB10 (59598 downstream)																																			---	---	---	---
CHMP4C	92421	broad.mit.edu	37	8	82671243	82671243	+	3'UTR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82671243delA	uc003ycl.2	+	5						NM_152284	NP_689497			chromatin modifying protein 4C						cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	84944104	84944104	+	IGR	DEL	G	-	-	rs74750053		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84944104delG								None (None upstream) : RALYL (151349 downstream)																																			---	---	---	---
CA13	377677	broad.mit.edu	37	8	86319688	86319688	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86319688delT	uc003ydf.1	+											Homo sapiens cDNA FLJ36434 fis, clone THYMU2012002.						one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	87259356	87259356	+	IGR	DEL	G	-	-	rs59741649		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87259356delG								SLC7A13 (16747 upstream) : WWP1 (95638 downstream)																																			---	---	---	---
FAM82B	51115	broad.mit.edu	37	8	87515618	87515619	+	Intron	DEL	AC	-	-	rs72059042		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87515618_87515619delAC	uc003ydu.2	-						FAM82B_uc011lfz.1_Intron|FAM82B_uc011lga.1_Intron	NM_016033	NP_057117			regulator of microtubule dynamics 1							microtubule|spindle pole	binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	89661281	89661282	+	IGR	DEL	AC	-	-	rs72225327		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89661281_89661282delAC								MMP16 (321564 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	90497301	90497301	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90497301delA								None (None upstream) : RIPK2 (272674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	96457086	96457089	+	IGR	DEL	AAAC	-	-	rs34956127		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96457086_96457089delAAAC								C8orf37 (175649 upstream) : GDF6 (697471 downstream)																																			---	---	---	---
MATN2	4147	broad.mit.edu	37	8	98893238	98893238	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98893238delC	uc003yic.2	+						MATN2_uc003yib.1_Intron|MATN2_uc010mbh.1_Intron|MATN2_uc003yid.2_Intron	NM_002380	NP_002371			matrilin 2 isoform a precursor							proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	101341400	101341400	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101341400delA								RNF19A (19073 upstream) : ANKRD46 (180587 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	102033389	102033391	+	IGR	DEL	AAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102033389_102033391delAAA								YWHAZ (67766 upstream) : ZNF706 (175877 downstream)																																			---	---	---	---
C8orf56	157556	broad.mit.edu	37	8	104152674	104152677	+	Intron	DEL	GGAT	-	-	rs36196806		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104152674_104152677delGGAT	uc011lhm.1	-						BAALC_uc003yld.2_5'Flank|BAALC_uc003yle.2_5'Flank	NR_027071				RecName: Full=Putative uncharacterized protein C8orf34;												0																		---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104794662	104794663	+	Intron	DEL	GT	-	-	rs75323947		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104794662_104794663delGT	uc003ylp.2	+							NM_001100117	NP_001093587			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	105621639	105621639	+	IGR	DEL	T	-	-	rs141382492		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105621639delT								LRP12 (20419 upstream) : ZFPM2 (709508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	105655590	105655591	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105655590_105655591delTC								LRP12 (54370 upstream) : ZFPM2 (675556 downstream)																																			---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106431086	106431087	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106431086_106431087insA	uc003ymd.2	+							NM_012082	NP_036214			zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
TTC35	9694	broad.mit.edu	37	8	109474440	109474442	+	Intron	DEL	TTT	-	-	rs112965921	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109474440_109474442delTTT	uc003ymw.1	+							NM_014673	NP_055488			tetratricopeptide repeat domain 35							endoplasmic reticulum|nucleus	binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(57;2.34e-10)															---	---	---	---
PKHD1L1	93035	broad.mit.edu	37	8	110422693	110422693	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110422693delA	uc003yne.2	+							NM_177531	NP_803875			fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)												HNSCC(38;0.096)			---	---	---	---
PKHD1L1	93035	broad.mit.edu	37	8	110453391	110453392	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110453391_110453392insT	uc003yne.2	+							NM_177531	NP_803875			fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)												HNSCC(38;0.096)			---	---	---	---
SYBU	55638	broad.mit.edu	37	8	110631459	110631460	+	Intron	INS	-	T	T	rs142578497		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110631459_110631460insT	uc003ynj.3	-						SYBU_uc003yni.3_Intron|SYBU_uc003ynk.3_Intron|SYBU_uc010mco.2_Intron|SYBU_uc003ynl.3_Intron|SYBU_uc010mcp.2_Intron|SYBU_uc010mcq.2_Intron|SYBU_uc003yno.3_Intron|SYBU_uc010mcr.2_Intron|SYBU_uc003ynm.3_Intron|SYBU_uc003ynn.3_Intron|SYBU_uc010mcs.2_Intron|SYBU_uc010mct.2_Intron|SYBU_uc010mcu.2_Intron|SYBU_uc003ynp.3_Intron|SYBU_uc010mcv.2_Intron	NM_001099754	NP_001093224			Golgi-localized syntaphilin-related protein							cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1																		---	---	---	---
SYBU	55638	broad.mit.edu	37	8	110706531	110706535	+	5'Flank	DEL	ACAAC	-	-	rs71564053		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110706531_110706535delACAAC	uc010mcv.2	-						SYBU_uc010mcu.2_5'Flank|SYBU_uc003ynp.3_5'Flank	NM_001099744	NP_001093214			Golgi-localized syntaphilin-related protein							cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	110872085	110872085	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110872085delA								SYBU (168065 upstream) : KCNV1 (107150 downstream)																																			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	114248779	114248779	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114248779delT	uc003ynu.2	-						CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron|CSMD3_uc010mcx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	115206541	115206543	+	IGR	DEL	AAA	-	-	rs72074482		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:115206541_115206543delAAA								CSMD3 (757299 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	118610933	118610934	+	IGR	DEL	CT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118610933_118610934delCT								MED30 (58434 upstream) : EXT1 (200668 downstream)																																			---	---	---	---
EXT1	2131	broad.mit.edu	37	8	119064010	119064011	+	Intron	INS	-	G	G	rs147894979	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119064010_119064011insG	uc003yok.1	-							NM_000127	NP_000118			exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)					Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				---	---	---	---
EXT1	2131	broad.mit.edu	37	8	119119525	119119525	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119119525delT	uc003yok.1	-							NM_000127	NP_000118			exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)					Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	8	119171959	119171959	+	IGR	DEL	T	-	-	rs111324422		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119171959delT								EXT1 (47901 upstream) : SAMD12 (29736 downstream)																																			---	---	---	---
SAMD12	401474	broad.mit.edu	37	8	119533906	119533907	+	Intron	INS	-	GTGT	GTGT	rs145249190	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119533906_119533907insGTGT	uc003yom.2	-						SAMD12_uc010mda.1_Intron|SAMD12_uc010mdb.1_Intron	NM_207506	NP_997389			sterile alpha motif domain containing 12 isoform											ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)															---	---	---	---
DEPDC6	64798	broad.mit.edu	37	8	120985184	120985185	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120985184_120985185insT	uc003yow.3	+						DEPDC6_uc011lid.1_Intron	NM_022783	NP_073620			DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	122007548	122007549	+	IGR	DEL	TG	-	-	rs5894549		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122007548_122007549delTG								SNTB1 (183239 upstream) : HAS2 (617722 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	123601560	123601560	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123601560delT								HAS2AS (944627 upstream) : ZHX2 (192341 downstream)																																			---	---	---	---
ZHX2	22882	broad.mit.edu	37	8	123967490	123967490	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123967490delG	uc003ypk.1	+							NM_014943	NP_055758			zinc fingers and homeoboxes 2							cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	124303040	124303040	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124303040delA								ZHX1 (15259 upstream) : ATAD2 (29053 downstream)																																			---	---	---	---
WDYHV1	55093	broad.mit.edu	37	8	124433934	124433935	+	Intron	INS	-	TT	TT	rs141083947		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124433934_124433935insTT	uc003yqn.1	+						WDYHV1_uc011lij.1_Intron	NM_018024	NP_060494			WDYHV motif containing 1						protein modification process	cytosol|nucleus	protein binding|protein N-terminal glutamine amidohydrolase activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	124494134	124494135	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124494134_124494135delGT								WDYHV1 (39874 upstream) : FBXO32 (21224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	125261813	125261813	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125261813delA								FER1L6 (129512 upstream) : TMEM65 (61348 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	125290753	125290753	+	IGR	DEL	A	-	-	rs113521878		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125290753delA								FER1L6 (158452 upstream) : TMEM65 (32408 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	125765601	125765616	+	IGR	DEL	CTCTTCCTTGCAGGGG	-	-	rs72236924		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125765601_125765616delCTCTTCCTTGCAGGGG								MTSS1 (24871 upstream) : LOC157381 (186268 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	127201292	127201295	+	IGR	DEL	TTAA	-	-	rs67565266		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127201292_127201295delTTAA								TRIB1 (750650 upstream) : FAM84B (363392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	127346679	127346680	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127346679_127346680delCA								TRIB1 (896037 upstream) : FAM84B (218007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129696067	129696068	+	IGR	INS	-	A	A	rs150561110	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129696067_129696068insA								MIR1208 (533633 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	130564223	130564224	+	IGR	INS	-	GT	GT	rs137982385	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130564223_130564224insGT								None (None upstream) : GSDMC (196219 downstream)																																			---	---	---	---
ASAP1	50807	broad.mit.edu	37	8	131135834	131135837	+	Intron	DEL	AAAC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131135834_131135837delAAAC	uc003yta.1	-						ASAP1_uc003ysz.1_Intron|ASAP1_uc011liw.1_Intron	NM_018482	NP_060952			development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	131584383	131584384	+	IGR	INS	-	AA	AA	rs148161929	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131584383_131584384insAA								ASAP1 (170167 upstream) : ADCY8 (208164 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	131694987	131694988	+	IGR	INS	-	GATCT	GATCT	rs138387082	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131694987_131694988insGATCT								ASAP1 (280771 upstream) : ADCY8 (97560 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	132198140	132198141	+	IGR	DEL	TT	-	-	rs150452398		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132198140_132198141delTT								ADCY8 (145305 upstream) : EFR3A (718218 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	132517840	132517841	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132517840_132517841insT								ADCY8 (465005 upstream) : EFR3A (398518 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	132714101	132714101	+	IGR	DEL	T	-	-	rs35561156		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132714101delT								ADCY8 (661266 upstream) : EFR3A (202258 downstream)																																			---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133195130	133195131	+	Intron	DEL	CA	-	-	rs72408873		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133195130_133195131delCA	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133488478	133488479	+	Intron	DEL	TG	-	-	rs34661435		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133488478_133488479delTG	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
PHF20L1	51105	broad.mit.edu	37	8	133826225	133826226	+	Intron	INS	-	T	T	rs137863501	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133826225_133826226insT	uc003ytt.2	+						PHF20L1_uc003yts.2_Intron|PHF20L1_uc011lja.1_Intron|PHF20L1_uc003ytu.1_Intron	NM_016018	NP_057102			PHD finger protein 20-like 1 isoform 1								nucleic acid binding|zinc ion binding			ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	134633904	134633905	+	IGR	INS	-	ACAA	ACAA	rs147744155	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134633904_134633905insACAA								ST3GAL1 (49721 upstream) : ZFAT (856128 downstream)																																			---	---	---	---
ZFAT	57623	broad.mit.edu	37	8	135516190	135516191	+	Intron	INS	-	AC	AC	rs148680395	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135516190_135516191insAC	uc003yup.2	-						ZFAT_uc011ljj.1_Intron|ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron	NM_020863	NP_065914			zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	135864894	135864896	+	IGR	DEL	AAA	-	-	rs113165985		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135864894_135864896delAAA								MIR30D (47706 upstream) : LOC286094 (381478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135883081	135883084	+	IGR	DEL	CTTC	-	-	rs74275857		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135883081_135883084delCTTC								MIR30D (65893 upstream) : LOC286094 (363290 downstream)																																			---	---	---	---
KHDRBS3	10656	broad.mit.edu	37	8	136505325	136505326	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136505325_136505326insT	uc003yuv.2	+						KHDRBS3_uc003yuw.2_Intron	NM_006558	NP_006549			KH domain containing, RNA binding, signal						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	137362354	137362355	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137362354_137362355delAC								KHDRBS3 (702508 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	137448949	137448949	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137448949delA								KHDRBS3 (789103 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	137702981	137702983	+	IGR	DEL	ACA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137702981_137702983delACA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	137717999	137717999	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137717999delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	137784128	137784129	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137784128_137784129delAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	138357619	138357620	+	IGR	DEL	AT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138357619_138357620delAT								None (None upstream) : FAM135B (784648 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	138405107	138405108	+	IGR	INS	-	T	T	rs149032003	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138405107_138405108insT								None (None upstream) : FAM135B (737160 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	138487617	138487617	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138487617delC								None (None upstream) : FAM135B (654651 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	139043098	139043099	+	IGR	INS	-	T	T	rs141923021	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139043098_139043099insT								None (None upstream) : FAM135B (99169 downstream)																																			---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139187962	139187963	+	Intron	INS	-	TAGTCA	TAGTCA	rs143656293	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139187962_139187963insTAGTCA	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996			hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139465668	139465669	+	Intron	INS	-	A	A	rs73717270		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139465668_139465669insA	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996			hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139642020	139642021	+	Intron	INS	-	ATGCCCTTTGCAC	ATGCCCTTTGCAC	rs149111205	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139642020_139642021insATGCCCTTTGCAC	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139735310	139735310	+	Intron	DEL	A	-	-	rs112806790		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139735310delA	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	140532820	140532822	+	IGR	DEL	AGA	-	-	rs149788863		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140532820_140532822delAGA								COL22A1 (606584 upstream) : KCNK9 (80260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	140609257	140609257	+	IGR	DEL	T	-	-	rs76387013		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140609257delT								COL22A1 (683021 upstream) : KCNK9 (3825 downstream)																																			---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	140883449	140883449	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140883449delT	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141035678	141035678	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141035678delG	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141097036	141097037	+	Intron	INS	-	A	A	rs146514633	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141097036_141097037insA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
EIF2C2	27161	broad.mit.edu	37	8	141639032	141639032	+	Intron	DEL	A	-	-	rs11354705		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141639032delA	uc003yvn.2	-						EIF2C2_uc010men.2_Intron|EIF2C2_uc010meo.2_Intron	NM_012154	NP_036286			argonaute 2 isoform 1						mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)															---	---	---	---
PTK2	5747	broad.mit.edu	37	8	142000009	142000010	+	Intron	INS	-	A	A	rs11400792		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142000009_142000010insA	uc003yvu.2	-						PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560			PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	142207554	142207555	+	IGR	INS	-	G	G	rs151068537	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142207554_142207555insG								DENND3 (1648 upstream) : SLC45A4 (9719 downstream)																																			---	---	---	---
SLC45A4	57210	broad.mit.edu	37	8	142251667	142251677	+	Intron	DEL	AAAGAAAAAAA	-	-	rs66652725		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142251667_142251677delAAAGAAAAAAA	uc010meq.1	-											SubName: Full=SLC45A4 protein;						transport	integral to membrane				ovary(2)	2	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)															---	---	---	---
FLJ43860	389690	broad.mit.edu	37	8	142468308	142468309	+	Intron	INS	-	A	A	rs150516334	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142468308_142468309insA	uc003ywi.2	-						FLJ43860_uc011ljs.1_Intron|FLJ43860_uc010meu.1_Intron	NM_207414	NP_997297			hypothetical protein LOC389690								binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	142935415	142935416	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142935415_142935416delAC								MIR1302-7 (67741 upstream) : NCRNA00051 (344301 downstream)																																			---	---	---	---
TSNARE1	203062	broad.mit.edu	37	8	143453128	143453129	+	Intron	INS	-	A	A	rs35801989		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143453128_143453129insA	uc003ywk.2	-						TSNARE1_uc003ywl.3_Intron	NM_145003	NP_659440			t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	144247140	144247141	+	IGR	INS	-	AA	AA	rs76999245		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144247140_144247141insAA								LY6H (5087 upstream) : GPIHBP1 (47927 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144258184	144258187	+	IGR	DEL	TGTT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144258184_144258187delTGTT								LY6H (16131 upstream) : GPIHBP1 (36881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	145076042	145076043	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145076042_145076043delGT								GRINA (8459 upstream) : SPATC1 (10539 downstream)																																			---	---	---	---
ZNF34	80778	broad.mit.edu	37	8	146009548	146009549	+	Intron	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146009548_146009549delAA	uc003zdy.3	-						ZNF34_uc003zdx.3_Intron	NM_030580	NP_085057			zinc finger protein 34						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)														---	---	---	---
ZNF252	286101	broad.mit.edu	37	8	146206280	146206293	+	Intron	DEL	TGGTTGCCAGGGGT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146206280_146206293delTGGTTGCCAGGGGT	uc011llo.1	-						ZNF252_uc003zew.3_Intron					SubName: Full=cDNA FLJ52642, weakly similar to Zinc finger protein 3;												0																		---	---	---	---
KANK1	23189	broad.mit.edu	37	9	685397	685398	+	Intron	DEL	GA	-	-	rs5895858		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:685397_685398delGA	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgo.1_Intron|KANK1_uc003zgp.1_Intron|KANK1_uc003zgq.2_Intron|KANK1_uc003zgr.1_5'Flank	NM_015158	NP_055973			KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)														---	---	---	---
KANK1	23189	broad.mit.edu	37	9	687021	687022	+	Intron	INS	-	TTTCT	TTTCT	rs140432651	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:687021_687022insTTTCT	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgo.1_Intron|KANK1_uc003zgp.1_Intron|KANK1_uc003zgq.2_Intron|KANK1_uc003zgr.1_Intron	NM_015158	NP_055973			KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)														---	---	---	---
DMRT1	1761	broad.mit.edu	37	9	900687	900687	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:900687delT	uc003zgv.2	+							NM_021951	NP_068770			doublesex and mab-3 related transcription factor						cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	1012032	1012032	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1012032delA								DMRT3 (20300 upstream) : DMRT2 (37826 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	1139425	1139425	+	IGR	DEL	T	-	-	rs79588782		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1139425delT								DMRT2 (81872 upstream) : SMARCA2 (875917 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	1975825	1975825	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1975825delT								DMRT2 (918272 upstream) : SMARCA2 (39517 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	1996224	1996224	+	IGR	DEL	A	-	-	rs113688830		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1996224delA								DMRT2 (938671 upstream) : SMARCA2 (19118 downstream)																																			---	---	---	---
SMARCA2	6595	broad.mit.edu	37	9	2036391	2036391	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2036391delC	uc003zhc.2	+						SMARCA2_uc003zhd.2_Intron|SMARCA2_uc010mha.2_Intron	NM_003070	NP_003061			SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	2694396	2694401	+	IGR	DEL	GTGTGT	-	-	rs5895991		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2694396_2694401delGTGTGT								VLDLR (39911 upstream) : KCNV2 (23125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	2740738	2740738	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2740738delA								KCNV2 (10981 upstream) : KIAA0020 (63417 downstream)																																			---	---	---	---
GLIS3	169792	broad.mit.edu	37	9	4283270	4283270	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4283270delT	uc003zhx.1	-						GLIS3_uc003zic.1_Intron|GLIS3_uc003zie.1_Intron|GLIS3_uc010mhh.1_Intron|GLIS3_uc003zid.1_Intron|GLIS3_uc010mhi.1_Intron|GLIS3_uc003zif.1_Intron|GLIS3_uc003zig.1_Intron|GLIS3_uc003zih.1_Intron	NM_001042413	NP_001035878			GLIS family zinc finger 3 isoform a						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)														---	---	---	---
AK3	50808	broad.mit.edu	37	9	4713915	4713916	+	Intron	INS	-	AC	AC			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4713915_4713916insAC	uc003ziq.1	-						AK3_uc003zip.1_Intron|AK3_uc011lma.1_Intron|AK3_uc003zir.1_Intron	NM_016282	NP_057366			adenylate kinase 3						blood coagulation	mitochondrial matrix	ATP binding|GTP binding|nucleoside triphosphate adenylate kinase activity			ovary(2)	2	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)														---	---	---	---
RCL1	10171	broad.mit.edu	37	9	4810645	4810646	+	Intron	INS	-	G	G	rs139678777	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4810645_4810646insG	uc003zis.2	+						RCL1_uc003zit.2_Intron|RCL1_uc010mhk.1_Intron	NM_005772	NP_005763			RNA terminal phosphate cyclase-like 1						ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	5273689	5273690	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5273689_5273690insA								INSL4 (39723 upstream) : RLN2 (26178 downstream)																																			---	---	---	---
ERMP1	79956	broad.mit.edu	37	9	5779278	5779279	+	Intron	INS	-	A	A	rs139335636	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5779278_5779279insA	uc011lme.1	-							NM_024896				aminopeptidase Fxna						proteolysis	endoplasmic reticulum membrane|integral to membrane	metal ion binding|metallopeptidase activity			ovary(1)	1		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	6091302	6091303	+	IGR	INS	-	A	A	rs146438425	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6091302_6091303insA								RANBP6 (75662 upstream) : IL33 (124504 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	6652085	6652086	+	IGR	INS	-	A	A	rs112678973		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6652085_6652086insA								GLDC (6393 upstream) : KDM4C (64409 downstream)																																			---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	6789047	6789047	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6789047delT	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc010mhw.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron|KDM4C_uc010mhv.2_Intron	NM_015061	NP_055876			jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	6870822	6870826	+	Intron	DEL	CTTAG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6870822_6870826delCTTAG	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc010mhw.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron	NM_015061	NP_055876			jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	6904895	6904896	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6904895_6904896insA	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron	NM_015061	NP_055876			jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	7026208	7026208	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7026208delA	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron|KDM4C_uc011lml.1_Intron	NM_015061	NP_055876			jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	8123933	8123933	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8123933delT								C9orf123 (324134 upstream) : PTPRD (190314 downstream)																																			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8331407	8331416	+	Intron	DEL	TTATTTTCAC	-	-	rs10976963		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8331407_8331416delTTATTTTCAC	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8332544	8332544	+	Intron	DEL	A	-	-	rs111565108		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8332544delA	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8750460	8750461	+	Intron	INS	-	T	T	rs139055539	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8750460_8750461insT	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8962538	8962539	+	Intron	INS	-	AG	AG	rs141780282	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8962538_8962539insAG	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	9710787	9710788	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9710787_9710788delAC	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	9	10653315	10653316	+	IGR	INS	-	AA	AA	rs147651947		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:10653315_10653316insAA								PTPRD (40592 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	11161559	11161560	+	IGR	INS	-	A	A	rs140796683	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11161559_11161560insA								PTPRD (548836 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	11652100	11652100	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11652100delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	11941965	11941970	+	IGR	DEL	CCTTCG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11941965_11941970delCCTTCG								None (None upstream) : TYRP1 (751416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13078087	13078087	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13078087delT								C9orf150 (255029 upstream) : MPDZ (27622 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13625187	13625187	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13625187delC								MPDZ (345624 upstream) : NFIB (456661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13665932	13665933	+	IGR	INS	-	AG	AG	rs142483513	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13665932_13665933insAG								MPDZ (386369 upstream) : NFIB (415915 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13974502	13974509	+	IGR	DEL	TTTTGTTT	-	-	rs111349721		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13974502_13974509delTTTTGTTT								MPDZ (694939 upstream) : NFIB (107339 downstream)																																			---	---	---	---
FREM1	158326	broad.mit.edu	37	9	14843494	14843497	+	Intron	DEL	TAGG	-	-	rs150770228		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14843494_14843497delTAGG	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403			FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)														---	---	---	---
TTC39B	158219	broad.mit.edu	37	9	15255586	15255587	+	Intron	INS	-	A	A	rs112365728		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15255586_15255587insA	uc003zlr.1	-						TTC39B_uc010mie.1_Intron|TTC39B_uc011lmq.1_Intron|TTC39B_uc011lmr.1_Intron|TTC39B_uc010mif.1_Intron|TTC39B_uc010mig.1_Intron|TTC39B_uc011lms.1_Intron	NM_152574	NP_689787			tetratricopeptide repeat domain 39B								binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	15342876	15342876	+	IGR	DEL	A	-	-	rs144894457		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15342876delA								TTC39B (35632 upstream) : SNAPC3 (79906 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	15371770	15371770	+	IGR	DEL	G	-	-	rs80015822		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15371770delG								TTC39B (64526 upstream) : SNAPC3 (51012 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	15375340	15375341	+	IGR	INS	-	T	T	rs59656699		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15375340_15375341insT								TTC39B (68096 upstream) : SNAPC3 (47441 downstream)																																			---	---	---	---
C9orf93	203238	broad.mit.edu	37	9	15886753	15886754	+	Intron	INS	-	AC	AC	rs138604856	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15886753_15886754insAC	uc003zmd.2	+						C9orf93_uc003zme.2_Intron|C9orf93_uc011lmu.1_Intron|uc003zmg.2_5'Flank	NM_173550	NP_775821			hypothetical protein LOC203238												0				GBM - Glioblastoma multiforme(50;4.84e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	16155328	16155331	+	IGR	DEL	GTGT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16155328_16155331delGTGT								C9orf93 (183433 upstream) : BNC2 (254171 downstream)																																			---	---	---	---
BNC2	54796	broad.mit.edu	37	9	16785806	16785806	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16785806delA	uc003zml.2	-						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc003zmq.1_Intron|BNC2_uc003zmr.1_Intron|BNC2_uc003zmp.1_Intron|BNC2_uc010mij.1_Intron|BNC2_uc003zmu.1_Intron|BNC2_uc010mim.1_Intron|BNC2_uc010min.1_Intron	NM_017637	NP_060107			basonuclin 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)														---	---	---	---
CNTLN	54875	broad.mit.edu	37	9	17164837	17164837	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17164837delT	uc003zmz.2	+						CNTLN_uc003zmx.3_Intron|CNTLN_uc003zmy.2_Intron|CNTLN_uc003zmw.1_Intron	NM_017738	NP_060208			centlein isoform 1							centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	18147553	18147553	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18147553delG								SH3GL2 (350433 upstream) : ADAMTSL1 (326551 downstream)																																			---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18681361	18681361	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18681361delT	uc003zne.3	+						ADAMTSL1_uc003znb.2_3'UTR|ADAMTSL1_uc003znc.3_Intron	NM_001040272	NP_001035362			ADAMTS-like 1 isoform 4 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	23884858	23884858	+	IGR	DEL	T	-	-	rs113834775		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23884858delT								ELAVL2 (58795 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	24308185	24308187	+	IGR	DEL	TCA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:24308185_24308187delTCA								ELAVL2 (482122 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	25035792	25035794	+	IGR	DEL	AAC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25035792_25035794delAAC								None (None upstream) : TUSC1 (640600 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	27672350	27672351	+	IGR	INS	-	TT	TT	rs11329056		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27672350_27672351insTT								C9orf72 (98508 upstream) : LINGO2 (276177 downstream)																																			---	---	---	---
LINGO2	158038	broad.mit.edu	37	9	28463097	28463097	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28463097delT	uc010mjf.1	-						LINGO2_uc003zqv.1_Intron	NM_152570	NP_689783			leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	29488666	29488666	+	IGR	DEL	G	-	-	rs5897372		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29488666delG								MIR873 (599713 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	30366941	30366942	+	IGR	INS	-	T	T	rs143372521	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30366941_30366942insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	31833037	31833037	+	IGR	DEL	A	-	-	rs112956826		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31833037delA								None (None upstream) : ACO1 (551564 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	33527307	33527308	+	IGR	INS	-	TTTGTTTG	TTTGTTTG	rs144444981	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33527307_33527308insTTTGTTTG								SUGT1P1 (16260 upstream) : ANXA2P2 (96915 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	34083573	34083573	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34083573delT								UBAP2 (34626 upstream) : DCAF12 (2808 downstream)																																			---	---	---	---
KIF24	347240	broad.mit.edu	37	9	34240868	34240868	+	Intron	DEL	G	-	-	rs113467602		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34240868delG	uc010mkb.2	-						UBAP1_uc010mka.1_Intron|UBAP1_uc003ztx.2_Intron|UBAP1_uc003zty.2_Intron|UBAP1_uc011loi.1_Intron|UBAP1_uc011loj.1_Intron|UBAP1_uc003ztz.2_Intron	NM_194313	NP_919289			kinesin family member 24						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0107)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	34807435	34807435	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34807435delA								C9orf144B (77900 upstream) : C9orf144 (22830 downstream)																																			---	---	---	---
UNC13B	10497	broad.mit.edu	37	9	35226351	35226352	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35226351_35226352delGT	uc003zwq.2	+						UNC13B_uc010mkl.1_Intron|UNC13B_uc003zwr.2_Intron	NM_006377	NP_006368			UNC13 (C. elegans)-like						excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
UNC13B	10497	broad.mit.edu	37	9	35349345	35349347	+	Intron	DEL	AAA	-	-	rs113544895		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35349345_35349347delAAA	uc003zwq.2	+						UNC13B_uc010mkl.1_Intron|UNC13B_uc003zwr.2_Intron	NM_006377	NP_006368			UNC13 (C. elegans)-like						excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
RNF38	152006	broad.mit.edu	37	9	36395324	36395325	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36395324_36395325insT	uc003zzh.2	-						RNF38_uc003zzi.2_Intron|RNF38_uc003zzj.2_Intron|RNF38_uc003zzk.2_Intron|RNF38_uc003zzl.2_Intron|RNF38_uc003zzm.2_Intron	NM_022781	NP_073618			ring finger protein 38 isoform 1								zinc ion binding			central_nervous_system(1)	1			STAD - Stomach adenocarcinoma(86;0.228)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	37792507	37792508	+	Intron	DEL	AC	-	-	rs112834780		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37792507_37792508delAC	uc004aan.1	-											Homo sapiens cDNA FLJ40944 fis, clone UTERU2008705.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	38174240	38174240	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38174240delT								SHB (105030 upstream) : ALDH1B1 (218462 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	40415332	40415333	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40415332_40415333insA								FAM74A1 (508092 upstream) : FAM75A3 (284958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66683209	66683210	+	IGR	INS	-	T	T	rs140091316		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66683209_66683210insT								LOC442421 (180182 upstream) : AQP7P1 (571057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66825983	66825983	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66825983delT								LOC442421 (322956 upstream) : AQP7P1 (428284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	67301383	67301384	+	IGR	INS	-	G	G	rs144184994		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67301383_67301384insG								AQP7P1 (11891 upstream) : FAM27B (491546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68380234	68380234	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68380234delC								FAM27B (586045 upstream) : MIR1299 (622005 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69056460	69056461	+	IGR	INS	-	A	A	rs145372655		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69056460_69056461insA								MIR1299 (54139 upstream) : PGM5P2 (23784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69511231	69511232	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69511231_69511232insT								ANKRD20A4 (86123 upstream) : LOC100133920 (140129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	70839396	70839396	+	IGR	DEL	A	-	-	rs55766796		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70839396delA								CBWD3 (339333 upstream) : FOXD4L3 (78387 downstream)																																			---	---	---	---
PIP5K1B	8395	broad.mit.edu	37	9	71376628	71376628	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71376628delC	uc004agu.2	+						PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_003558	NP_003549			phosphatidylinositol-4-phosphate 5-kinase, type							endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	72543570	72543570	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72543570delT								C9orf135 (22423 upstream) : MAMDC2 (114927 downstream)																																			---	---	---	---
KLF9	687	broad.mit.edu	37	9	73021641	73021641	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73021641delT	uc004aht.2	-							NM_001206	NP_001197			Kruppel-like factor 9						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
TMEM2	23670	broad.mit.edu	37	9	74344537	74344537	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74344537delA	uc011lsa.1	-						TMEM2_uc010mos.2_Intron|TMEM2_uc011lsb.1_Intron	NM_013390	NP_037522			transmembrane protein 2 isoform a							integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)														---	---	---	---
ANXA1	301	broad.mit.edu	37	9	75774521	75774521	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75774521delT	uc004ajf.1	+						ANXA1_uc004aje.1_Intron|ANXA1_uc004ajg.1_Intron	NM_000700	NP_000691			annexin I						alpha-beta T cell differentiation|anti-apoptosis|cell surface receptor linked signaling pathway|cellular component movement|inflammatory response|keratinocyte differentiation|lipid metabolic process|peptide cross-linking|positive regulation of vesicle fusion	basolateral plasma membrane|cilium|cornified envelope|cytoplasm|extracellular region|nucleus	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity|protein binding, bridging|receptor binding|structural molecule activity			breast(1)|central_nervous_system(1)	2		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Clobetasol(DB01013)|Clocortolone(DB00838)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Flumethasone Pivalate(DB00663)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol Etabonate(DB00873)|Methylprednisolone(DB00959)|Mometasone(DB00764)|Prednicarbate(DB01130)|Prednisone(DB00635)|Rimexolone(DB00896)|Triamcinolone(DB00620)													---	---	---	---
C9orf40	55071	broad.mit.edu	37	9	77565032	77565033	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77565032_77565033insT	uc004ajo.3	-						uc004ajp.2_5'Flank	NM_017998	NP_060468			hypothetical protein LOC55071												0																		---	---	---	---
PCSK5	5125	broad.mit.edu	37	9	78580178	78580179	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78580178_78580179delTG	uc004ajz.2	+						PCSK5_uc004ajy.2_Intron|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191			proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	79652261	79652264	+	IGR	DEL	TGTG	-	-	rs147896269		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79652261_79652264delTGTG								FOXB2 (16392 upstream) : VPS13A (140097 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	80779980	80779980	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80779980delG								GNAQ (133788 upstream) : CEP78 (71011 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	81943053	81943054	+	IGR	INS	-	GA	GA			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81943053_81943054insGA								PSAT1 (998046 upstream) : TLE4 (243824 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	85721691	85721692	+	IGR	INS	-	CTC	CTC	rs34363602		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85721691_85721692insCTC								RASEF (43648 upstream) : FRMD3 (136213 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	89066269	89066270	+	IGR	INS	-	T	T	rs141715805	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89066269_89066270insT								ZCCHC6 (96891 upstream) : GAS1 (493009 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	89942252	89942253	+	IGR	INS	-	AAG	AAG	rs141533190	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89942252_89942253insAAG								C9orf170 (167611 upstream) : DAPK1 (170405 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	89974172	89974173	+	IGR	DEL	AT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89974172_89974173delAT								C9orf170 (199531 upstream) : DAPK1 (138485 downstream)																																			---	---	---	---
SEMA4D	10507	broad.mit.edu	37	9	92089045	92089045	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92089045delG	uc004aqo.1	-						SEMA4D_uc011ltm.1_Intron|SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqp.1_Intron	NM_006378	NP_006369			semaphorin 4D isoform 1						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
PHF2	5253	broad.mit.edu	37	9	96411662	96411663	+	Intron	INS	-	CC	CC	rs71278074		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96411662_96411663insCC	uc004aub.2	+						PHF2_uc011lug.1_Intron	NM_005392	NP_005383			PHD finger protein 2						liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	98825687	98825687	+	5'Flank	DEL	C	-	-	rs35459998		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98825687delC	uc004avy.3	+											Homo sapiens cDNA clone IMAGE:3638298.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	99977769	99977769	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99977769delG	uc010msl.1	-											Homo sapiens cDNA, FLJ99517.																														---	---	---	---
TBC1D2	55357	broad.mit.edu	37	9	100978146	100978147	+	Intron	INS	-	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100978146_100978147insC	uc011lvb.1	-						TBC1D2_uc004ayp.2_5'Flank|TBC1D2_uc004ayq.2_Intron|TBC1D2_uc004ayr.2_Intron|TBC1D2_uc004ayo.3_Intron	NM_018421	NP_060891			TBC1 domain family, member 2							cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)														---	---	---	---
GABBR2	9568	broad.mit.edu	37	9	101221901	101221901	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101221901delA	uc004ays.2	-							NM_005458	NP_005449			G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	102291990	102291990	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102291990delA								SEC61B (299090 upstream) : NR4A3 (292147 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	104116730	104116731	+	IGR	INS	-	T	T	rs138260248	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104116730_104116731insT								LPPR1 (29314 upstream) : BAAT (5969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	106100304	106100304	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106100304delA								CYLC2 (319534 upstream) : SMC2 (756237 downstream)																																			---	---	---	---
SLC44A1	23446	broad.mit.edu	37	9	108038086	108038087	+	Intron	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108038086_108038087delTT	uc004bcn.2	+						SLC44A1_uc010mtk.1_Intron	NM_080546	NP_536856			CDW92 antigen							integral to membrane|mitochondrial outer membrane|plasma membrane	choline transmembrane transporter activity			breast(3)|ovary(1)	4					Choline(DB00122)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	110593356	110593356	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110593356delA								KLF4 (341309 upstream) : None (None downstream)																																			---	---	---	---
LPAR1	1902	broad.mit.edu	37	9	113796688	113796689	+	Intron	INS	-	A	A	rs148046898	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113796688_113796689insA	uc011lwo.1	-						LPAR1_uc004bfb.2_Intron|LPAR1_uc004bfc.2_Intron|LPAR1_uc011lwn.1_Intron|LPAR1_uc010mub.2_Intron	NM_057159	NP_476500			lysophosphatidic acid receptor 1						positive regulation of I-kappaB kinase/NF-kappaB cascade	cell surface|integral to plasma membrane				ovary(2)	2																		---	---	---	---
TNFSF8	944	broad.mit.edu	37	9	117692251	117692252	+	Intron	INS	-	AGAG	AGAG	rs147427714		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117692251_117692252insAGAG	uc004bji.1	-							NM_001244	NP_001235			tumor necrosis factor (ligand) superfamily,						cell proliferation|cell-cell signaling|immune response|induction of apoptosis|signal transduction	extracellular space|integral to plasma membrane	cytokine activity|tumor necrosis factor receptor binding			lung(3)|skin(2)|ovary(1)	6																		---	---	---	---
OLFML2A	169611	broad.mit.edu	37	9	127574708	127574708	+	3'UTR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127574708delG	uc004bov.2	+	8					OLFML2A_uc004bow.2_3'UTR	NM_182487	NP_872293			olfactomedin-like 2A precursor												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	128853805	128853806	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128853805_128853806delGT								PBX3 (124152 upstream) : FAM125B (235322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	129563440	129563441	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129563440_129563441insT								LMX1B (100129 upstream) : ZBTB43 (3844 downstream)																																			---	---	---	---
SLC2A8	29988	broad.mit.edu	37	9	130162446	130162446	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130162446delT	uc004bqu.2	+						SLC2A8_uc010mxj.2_Intron	NM_014580	NP_055395			solute carrier family 2 (facilitated glucose							cytoplasmic vesicle membrane|integral to plasma membrane	D-glucose transmembrane transporter activity			ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2																		---	---	---	---
NUP188	23511	broad.mit.edu	37	9	131717136	131717136	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131717136delT	uc004bws.1	+						NUP188_uc004bwq.1_Intron	NM_015354	NP_056169			nucleoporin 188kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7																		---	---	---	---
PPP2R4	5524	broad.mit.edu	37	9	131907611	131907611	+	Intron	DEL	A	-	-	rs11323429		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131907611delA	uc004bxm.1	+						PPP2R4_uc004bxl.1_Intron|PPP2R4_uc010myr.1_Intron|PPP2R4_uc004bxn.1_Intron|PPP2R4_uc004bxo.1_Intron|PPP2R4_uc011mbp.1_Intron|PPP2R4_uc010mys.1_Intron|PPP2R4_uc004bxp.2_Intron|PPP2R4_uc004bxq.2_Intron	NM_178001	NP_821068			protein phosphatase 2A, regulatory subunit B'						ATP catabolic process|negative regulation of phosphoprotein phosphatase activity|negative regulation of protein dephosphorylation|positive regulation of apoptosis|positive regulation of phosphoprotein phosphatase activity|positive regulation of protein dephosphorylation	calcium channel complex|cytoplasm|nucleus|protein phosphatase type 2A complex|soluble fraction	ATP binding|peptidyl-prolyl cis-trans isomerase activity|protein heterodimerization activity|protein homodimerization activity|protein phosphatase 2A binding|protein phosphatase type 2A regulator activity|protein tyrosine phosphatase activator activity|receptor binding			ovary(1)|lung(1)|pancreas(1)	3		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)														---	---	---	---
BAT2L1	84726	broad.mit.edu	37	9	134284408	134284408	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134284408delT	uc004cam.1	+											SubName: Full=BAT2L protein;								protein binding				0																		---	---	---	---
RAPGEF1	2889	broad.mit.edu	37	9	134597093	134597094	+	Intron	INS	-	A	A	rs111325703		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134597093_134597094insA	uc004cbc.2	-						RAPGEF1_uc010mzn.2_Intron|RAPGEF1_uc004cbd.2_Intron	NM_005312	NP_005303			guanine nucleotide-releasing factor 2 isoform a						activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)														---	---	---	---
RALGDS	5900	broad.mit.edu	37	9	136016844	136016845	+	Intron	INS	-	G	G	rs143737752	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136016844_136016845insG	uc011mcw.1	-						RALGDS_uc004ccs.2_Intron	NM_001042368	NP_001035827			ral guanine nucleotide dissociation stimulator						nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	Ral guanyl-nucleotide exchange factor activity			large_intestine(1)|lung(1)|ovary(1)	3				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)				T	CIITA	PMBL|Hodgkin Lymphona|								---	---	---	---
DBH	1621	broad.mit.edu	37	9	136519045	136519045	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136519045delG	uc004cel.2	+							NM_000787	NP_000778			dopamine beta hydroxylase precursor						hormone biosynthetic process	chromaffin granule lumen|chromaffin granule membrane|extracellular region|integral to membrane|membrane fraction|soluble fraction|transport vesicle membrane	dopamine beta-monooxygenase activity|L-ascorbic acid binding			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Dopamine(DB00988)|Vitamin C(DB00126)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	138286882	138286885	+	IGR	DEL	TGGA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138286882_138286885delTGGA								OLFM1 (273851 upstream) : KIAA0649 (84763 downstream)																																			---	---	---	---
ANAPC2	29882	broad.mit.edu	37	9	140078544	140078544	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140078544delC	uc004clr.1	-						ANAPC2_uc004clq.1_Intron	NM_013366	NP_037498			anaphase-promoting complex subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cyclin catabolic process|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of cyclin-dependent protein kinase activity	anaphase-promoting complex|cytosol|nucleoplasm	ubiquitin protein ligase binding|ubiquitin-protein ligase activity			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)														---	---	---	---
ADARB2	105	broad.mit.edu	37	10	1412744	1412744	+	Intron	DEL	A	-	-	rs151180870		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1412744delA	uc009xhq.2	-							NM_018702	NP_061172			adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	2434694	2434697	+	IGR	DEL	TGTC	-	-	rs113123321		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2434694_2434697delTGTC								ADARB2 (654976 upstream) : PFKP (675055 downstream)																																			---	---	---	---
LOC100216001	100216001	broad.mit.edu	37	10	4629184	4629184	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4629184delT	uc001ihe.3	-											Homo sapiens, clone IMAGE:4450067, mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	6046698	6046699	+	IGR	INS	-	CTTT	CTTT	rs144445211	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6046698_6046699insCTTT								IL15RA (26556 upstream) : IL2RA (6807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	7085496	7085497	+	IGR	DEL	TT	-	-	rs149000515		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7085496_7085497delTT								PRKCQ (463258 upstream) : SFMBT2 (118752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	7107522	7107522	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7107522delT								PRKCQ (485284 upstream) : SFMBT2 (96727 downstream)																																			---	---	---	---
CELF2	10659	broad.mit.edu	37	10	11325868	11325869	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11325868_11325869delTG	uc001iki.3	+						CELF2_uc010qbi.1_Intron|CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron|CELF2_uc010qbk.1_Intron|CELF2_uc010qbl.1_Intron|CELF2_uc010qbm.1_Intron|CELF2_uc001iko.3_Intron|CELF2_uc001ikp.3_Intron|CELF2_uc010qbn.1_Intron|CELF2_uc010qbo.1_Intron|CELF2_uc010qbp.1_Intron	NM_001025077	NP_001020248			CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	14026003	14026003	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14026003delA	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497			FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
APBB1IP	54518	broad.mit.edu	37	10	26735821	26735824	+	Intron	DEL	ATAG	-	-	rs67785093		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26735821_26735824delATAG	uc001iss.2	+						APBB1IP_uc001isr.2_Intron|APBB1IP_uc009xks.1_Intron	NM_019043	NP_061916			amyloid beta (A4) precursor protein-binding,						blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	29129262	29129262	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29129262delT								BAMBI (157394 upstream) : LYZL1 (448728 downstream)																																			---	---	---	---
ZNF438	220929	broad.mit.edu	37	10	31317070	31317070	+	Intron	DEL	A	-	-	rs79405440		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31317070delA	uc010qdz.1	-						ZNF438_uc010qdy.1_Intron|ZNF438_uc001ivo.3_Intron|ZNF438_uc009xlg.2_Intron|ZNF438_uc001ivp.3_Intron|ZNF438_uc010qea.1_Intron|ZNF438_uc010qeb.1_Intron|ZNF438_uc010qec.1_Intron	NM_182755	NP_877432			zinc finger protein 438 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	32268351	32268352	+	IGR	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32268351_32268352delAA								ARHGAP12 (50581 upstream) : KIF5B (29588 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	33386434	33386435	+	IGR	DEL	TA	-	-	rs150406042		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33386434_33386435delTA								ITGB1 (139141 upstream) : NRP1 (79985 downstream)																																			---	---	---	---
PARD3	56288	broad.mit.edu	37	10	34928784	34928785	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34928784_34928785delAC	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565			partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)																---	---	---	---
CUL2	8453	broad.mit.edu	37	10	35344670	35344670	+	Intron	DEL	T	-	-	rs144478245		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35344670delT	uc001ixv.2	-						CUL2_uc009xma.2_Intron|CUL2_uc010qer.1_Intron|CUL2_uc001ixw.2_Intron|CUL2_uc010qes.1_Intron	NM_003591	NP_003582			cullin 2						cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding			ovary(3)	3																		---	---	---	---
CCNY	219771	broad.mit.edu	37	10	35754890	35754891	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35754890_35754891delTG	uc001iyw.3	+						CCNY_uc001iyu.3_Intron|CCNY_uc001iyv.3_Intron|CCNY_uc001iyx.3_Intron|CCNY_uc009xmb.2_Intron|CCNY_uc010qet.1_Intron	NM_145012	NP_659449			cyclin Y isoform 1						cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	37101746	37101747	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37101746_37101747delGT								None (None upstream) : ANKRD30A (313038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38962434	38962434	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38962434delT								LOC399744 (221354 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39089197	39089198	+	IGR	DEL	GC	-	-	rs151163078		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39089197_39089198delGC								LOC399744 (348117 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42424794	42424794	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42424794delA								None (None upstream) : LOC441666 (402521 downstream)																																			---	---	---	---
BMS1	9790	broad.mit.edu	37	10	43295974	43295974	+	Intron	DEL	T	-	-	rs71533043		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43295974delT	uc001jaj.2	+							NM_014753	NP_055568			BMS1-like, ribosome assembly protein						ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3																		---	---	---	---
HNRNPF	3185	broad.mit.edu	37	10	43890579	43890580	+	Intron	INS	-	G	G	rs140055790	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43890579_43890580insG	uc009xmh.1	-						HNRNPF_uc001jar.2_Intron|HNRNPF_uc001jas.2_Intron|HNRNPF_uc001jat.2_Intron|HNRNPF_uc001jav.2_Intron|HNRNPF_uc001jau.2_Intron	NM_001098208	NP_001091678			heterogeneous nuclear ribonucleoprotein F						regulation of RNA splicing	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding				0																		---	---	---	---
HNRNPF	3185	broad.mit.edu	37	10	43903094	43903094	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43903094delA	uc001jas.2	-						HNRNPF_uc001jat.2_Intron|HNRNPF_uc001jav.2_Intron|HNRNPF_uc001jau.2_Intron	NM_001098206	NP_001091676			heterogeneous nuclear ribonucleoprotein F						regulation of RNA splicing	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	44219676	44219676	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44219676delC								ZNF32 (75350 upstream) : HNRNPA3P1 (63184 downstream)																																			---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47053467	47053468	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47053467_47053468insA	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47059046	47059047	+	Intron	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47059046_47059047delCA	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
WDFY4	57705	broad.mit.edu	37	10	49952846	49952847	+	Intron	INS	-	T	T	rs148597141	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49952846_49952847insT	uc001jha.3	+							NM_020945	NP_065996			WDFY family member 4							integral to membrane	binding				0																		---	---	---	---
PARG	8505	broad.mit.edu	37	10	51488628	51488629	+	Intron	INS	-	A	A	rs149702583	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51488628_51488629insA	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|AGAP7_uc001jio.2_5'Flank	NM_003631	NP_003622			poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	55416500	55416501	+	IGR	INS	-	A	A	rs863754		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55416500_55416501insA								MBL2 (885040 upstream) : PCDH15 (146034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	55450240	55450240	+	IGR	DEL	T	-	-	rs34205928		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55450240delT								MBL2 (918780 upstream) : PCDH15 (112295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58003378	58003379	+	IGR	INS	-	AT	AT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58003378_58003379insAT								PCDH15 (615676 upstream) : ZWINT (113820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58020697	58020697	+	IGR	DEL	T	-	-	rs35064790		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58020697delT								PCDH15 (632995 upstream) : ZWINT (96502 downstream)																																			---	---	---	---
BICC1	80114	broad.mit.edu	37	10	60357938	60357938	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60357938delA	uc001jki.1	+							NM_001080512	NP_001073981			bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	60688804	60688805	+	IGR	INS	-	TA	TA	rs140747827	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60688804_60688805insTA								BICC1 (99959 upstream) : PHYHIPL (247543 downstream)																																			---	---	---	---
SLC16A9	220963	broad.mit.edu	37	10	61459660	61459663	+	Intron	DEL	ACAC	-	-	rs148641065		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61459660_61459663delACAC	uc010qig.1	-							NM_194298	NP_919274			solute carrier family 16 (monocarboxylic acid						urate metabolic process	integral to membrane|plasma membrane	symporter activity			skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	62778112	62778112	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62778112delG								RHOBTB1 (16914 upstream) : TMEM26 (388289 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	63220527	63220528	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63220527_63220528delGT	uc001jlr.2	+											Homo sapiens, clone IMAGE:5222445, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	66903984	66903984	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66903984delT								ANXA2P3 (317350 upstream) : CTNNA3 (775741 downstream)																																			---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68133933	68133933	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68133933delG	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68840694	68840695	+	Intron	INS	-	A	A	rs111514189		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68840694_68840695insA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmz.1_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
DNA2	1763	broad.mit.edu	37	10	70214698	70214698	+	Intron	DEL	T	-	-	rs113945256		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70214698delT	uc001jof.2	-						DNA2_uc001jog.1_Intron|DNA2_uc001joh.1_Intron	NM_001080449	NP_001073918			DNA replication helicase 2 homolog						base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	71909936	71909936	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71909936delA								TYSND1 (3440 upstream) : SAR1A (31 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	72223968	72223969	+	IGR	INS	-	T	T	rs143477475		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72223968_72223969insT								NODAL (22503 upstream) : KIAA1274 (14595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	72356484	72356484	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72356484delG								KIAA1274 (28279 upstream) : PRF1 (621 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	72557485	72557486	+	IGR	INS	-	AG	AG	rs140398190		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72557485_72557486insAG								C10orf27 (12328 upstream) : SGPL1 (18218 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	72720802	72720803	+	IGR	INS	-	GTGA	GTGA	rs138195163	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72720802_72720803insGTGA								PCBD1 (72261 upstream) : UNC5B (251495 downstream)																																			---	---	---	---
CHST3	9469	broad.mit.edu	37	10	73765041	73765042	+	Intron	INS	-	TG	TG	rs10625888		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73765041_73765042insTG	uc001jsn.2	+							NM_004273	NP_004264			chondroitin 6-sulfotransferase 3						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	73815577	73815578	+	IGR	INS	-	GA	GA	rs141035841	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73815577_73815578insGA								CHST3 (42256 upstream) : SPOCK2 (3215 downstream)																																			---	---	---	---
TTC18	118491	broad.mit.edu	37	10	75102042	75102042	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75102042delA	uc009xrc.2	-						TTC18_uc001jty.2_Intron|TTC18_uc009xrd.1_Intron	NM_145170	NP_660153			tetratricopeptide repeat domain 18								binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)																	---	---	---	---
VCL	7414	broad.mit.edu	37	10	75810481	75810482	+	Intron	DEL	TG	-	-	rs74146310		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75810481_75810482delTG	uc001jwd.2	+						VCL_uc009xrr.2_Intron|VCL_uc010qky.1_Intron|VCL_uc001jwe.2_Intron|VCL_uc010qkz.1_Intron	NM_014000	NP_054706			vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	77008342	77008343	+	IGR	INS	-	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77008342_77008343insG								COMTD1 (12572 upstream) : ZNF503 (149262 downstream)																																			---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	78912037	78912038	+	Intron	DEL	TG	-	-	rs112908122		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78912037_78912038delTG	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	81209467	81209468	+	IGR	INS	-	AC	AC	rs142440293		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81209467_81209468insAC								ZCCHC24 (4084 upstream) : EIF5AL1 (62889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	81414810	81414811	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81414810_81414811insT								SFTPA1 (39609 upstream) : LOC650623 (27920 downstream)																																			---	---	---	---
ANXA11	311	broad.mit.edu	37	10	81928138	81928138	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81928138delA	uc001kbq.1	-						ANXA11_uc010qlx.1_Intron|ANXA11_uc001kbr.1_Intron|ANXA11_uc001kbs.1_Intron|ANXA11_uc001kbt.1_Intron|ANXA11_uc010qly.1_Intron|ANXA11_uc009xsq.1_Intron|ANXA11_uc001kbu.1_Intron	NM_145869	NP_665876			annexin A11						cell cycle|cytokinesis, completion of separation|phagocytosis|response to calcium ion	azurophil granule|melanosome|midbody|nuclear envelope|nucleoplasm|phagocytic vesicle|specific granule|spindle	calcium-dependent phospholipid binding|calcium-dependent protein binding|S100 alpha binding			ovary(1)	1	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	83492494	83492495	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83492494_83492495insA								None (None upstream) : NRG3 (142575 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	85149376	85149376	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85149376delA								NRG3 (402441 upstream) : GHITM (749809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	85422352	85422352	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85422352delC								NRG3 (675417 upstream) : GHITM (476833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	85578679	85578682	+	IGR	DEL	TCTC	-	-	rs111472210		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85578679_85578682delTCTC								NRG3 (831744 upstream) : GHITM (320503 downstream)																																			---	---	---	---
GRID1	2894	broad.mit.edu	37	10	87587434	87587435	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87587434_87587435insA	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021			glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
GRID1	2894	broad.mit.edu	37	10	87737429	87737429	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87737429delC	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021			glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
GRID1	2894	broad.mit.edu	37	10	87800729	87800730	+	Intron	INS	-	T	T	rs149136097	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87800729_87800730insT	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021			glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
PAPSS2	9060	broad.mit.edu	37	10	89438348	89438348	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89438348delA	uc001kex.2	+						PAPSS2_uc001kew.2_Intron|PAPSS2_uc009xtg.1_Intron	NM_004670	NP_004661			3'-phosphoadenosine 5'-phosphosulfate synthase 2						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|protein binding|sulfate adenylyltransferase (ATP) activity			central_nervous_system(1)|skin(1)	2		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)														---	---	---	---
FAS	355	broad.mit.edu	37	10	90755600	90755601	+	Intron	INS	-	A	A	rs145786118	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90755600_90755601insA	uc001kfr.2	+						FAS_uc010qna.1_Intron|FAS_uc001kfs.2_Intron|FAS_uc001kft.2_Intron|FAS_uc010qnb.1_Intron|FAS_uc010qnc.1_Intron|FAS_uc001kfw.2_Intron|FAS_uc010qnd.1_Intron|FAS_uc010qne.1_Intron|FAS_uc009xtp.2_Intron	NM_000043	NP_000034			tumor necrosis factor receptor superfamily,						activation of caspase activity|activation of pro-apoptotic gene products|anti-apoptosis|cellular response to mechanical stimulus|positive regulation of necrotic cell death	cytosol|extracellular region|integral to membrane|soluble fraction	identical protein binding|kinase binding			upper_aerodigestive_tract(1)|breast(1)	2		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)										Autoimmune_Lymphoproliferative_syndrome_type_I				---	---	---	---
FAS	355	broad.mit.edu	37	10	90755830	90755830	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90755830delC	uc001kfr.2	+						FAS_uc010qna.1_Intron|FAS_uc001kfs.2_Intron|FAS_uc001kft.2_Intron|FAS_uc010qnb.1_Intron|FAS_uc010qnc.1_Intron|FAS_uc001kfw.2_Intron|FAS_uc010qnd.1_Intron|FAS_uc010qne.1_Intron|FAS_uc009xtp.2_Intron	NM_000043	NP_000034			tumor necrosis factor receptor superfamily,						activation of caspase activity|activation of pro-apoptotic gene products|anti-apoptosis|cellular response to mechanical stimulus|positive regulation of necrotic cell death	cytosol|extracellular region|integral to membrane|soluble fraction	identical protein binding|kinase binding			upper_aerodigestive_tract(1)|breast(1)	2		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)										Autoimmune_Lymphoproliferative_syndrome_type_I				---	---	---	---
RPP30	10556	broad.mit.edu	37	10	92658663	92658663	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92658663delG	uc009xtx.2	+						RPP30_uc001khd.2_Intron	NM_006413	NP_006404			ribonuclease P/MRP 30kDa subunit isoform b						tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity				0																		---	---	---	---
PCGF5	84333	broad.mit.edu	37	10	93037320	93037320	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93037320delC	uc001khh.2	+						PCGF5_uc010qnk.1_Intron|PCGF5_uc001khi.2_Intron	NM_032373	NP_115749			polycomb group ring finger 5						regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|PcG protein complex	zinc ion binding			lung(1)	1																		---	---	---	---
HECTD2	143279	broad.mit.edu	37	10	93172425	93172426	+	Intron	INS	-	TG	TG	rs141854224	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93172425_93172426insTG	uc001khl.2	+						LOC100188947_uc010qnl.1_Intron|HECTD2_uc001khk.2_Intron|HECTD2_uc010qnm.1_Intron|HECTD2_uc001khm.2_Intron	NM_182765	NP_877497			HECT domain containing 2 isoform a						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	93505528	93505532	+	IGR	DEL	AAGAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93505528_93505532delAAGAA								PPP1R3C (112670 upstream) : TNKS2 (52619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	93634655	93634656	+	IGR	INS	-	T	T	rs145170827	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93634655_93634656insT								TNKS2 (9424 upstream) : FGFBP3 (31690 downstream)																																			---	---	---	---
CPEB3	22849	broad.mit.edu	37	10	93865985	93865985	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93865985delT	uc001khw.1	-						CPEB3_uc001khu.1_Intron|CPEB3_uc001khv.1_Intron|CPEB3_uc010qnn.1_Intron	NM_014912	NP_055727			cytoplasmic polyadenylation element binding								nucleotide binding|RNA binding				0		Colorectal(252;0.0869)																---	---	---	---
MARCH5	54708	broad.mit.edu	37	10	94065164	94065165	+	Intron	INS	-	A	A	rs11415965		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94065164_94065165insA	uc001khx.1	+						MARCH5_uc010qno.1_Intron	NM_017824	NP_060294			membrane-associated ring finger (C3HC4) 5						cell aging|protein autoubiquitination|protein localization in mitochondrion|protein polyubiquitination|regulation of mitochondrial fission	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	GTPase binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	95644240	95644241	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95644240_95644241insA								LGI1 (86318 upstream) : TMEM20 (9489 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	95745073	95745073	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95745073delT								PIPSL (23401 upstream) : PLCE1 (8673 downstream)																																			---	---	---	---
NOC3L	64318	broad.mit.edu	37	10	96110309	96110309	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96110309delA	uc001kjq.1	-						NOC3L_uc009xuk.1_Intron	NM_022451	NP_071896			nucleolar complex associated 3 homolog							nuclear speck|nucleolus	binding			ovary(1)	1		Colorectal(252;0.0897)																---	---	---	---
C10orf131	100127889	broad.mit.edu	37	10	97683006	97683007	+	Intron	INS	-	TG	TG	rs138330203	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97683006_97683007insTG	uc010qoo.1	+						uc001klg.1_Intron|uc001klj.1_Intron	NM_001130446	NP_001123918			hypothetical protein LOC100127889												0																		---	---	---	---
C10orf131	100127889	broad.mit.edu	37	10	97695242	97695242	+	Intron	DEL	T	-	-	rs142591108		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97695242delT	uc010qoo.1	+						uc001klg.1_Intron|uc001klj.1_Intron	NM_001130446	NP_001123918			hypothetical protein LOC100127889												0																		---	---	---	---
C10orf12	26148	broad.mit.edu	37	10	98661888	98661889	+	Intron	INS	-	A	A	rs113778435		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98661888_98661889insA	uc009xvg.1	+						LCOR_uc001kmr.2_Intron|LCOR_uc001kms.1_Intron|LCOR_uc001kmt.1_Intron|LCOR_uc001kmu.1_Intron	NM_015652	NP_056467			hypothetical protein LOC26148											skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)														---	---	---	---
UBTD1	80019	broad.mit.edu	37	10	99317106	99317106	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99317106delT	uc001knv.1	+							NM_024954	NP_079230			ubiquitin domain containing 1												0		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)														---	---	---	---
DNMBP	23268	broad.mit.edu	37	10	101645272	101645272	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101645272delA	uc001kqj.2	-						DNMBP_uc010qpl.1_Intron|DNMBP_uc001kqg.2_Intron|DNMBP_uc001kqh.2_Intron	NM_015221	NP_056036			dynamin binding protein						intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)														---	---	---	---
BTRC	8945	broad.mit.edu	37	10	103232965	103232965	+	Intron	DEL	T	-	-	rs34197747		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103232965delT	uc001kta.2	+						BTRC_uc001ksz.1_Intron|BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Intron	NM_033637	NP_378663			beta-transducin repeat containing protein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)														---	---	---	---
BTRC	8945	broad.mit.edu	37	10	103238699	103238699	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103238699delA	uc001kta.2	+						BTRC_uc001ksz.1_Intron|BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Intron	NM_033637	NP_378663			beta-transducin repeat containing protein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)														---	---	---	---
SUFU	51684	broad.mit.edu	37	10	104321424	104321425	+	Intron	INS	-	T	T	rs78621259		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104321424_104321425insT	uc001kvy.1	+						SUFU_uc001kvw.1_Intron|SUFU_uc001kvx.2_Intron	NM_016169	NP_057253			suppressor of fused						negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)				D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				---	---	---	---
Unknown	0	broad.mit.edu	37	10	110445834	110445835	+	IGR	DEL	GA	-	-	rs58978980		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110445834_110445835delGA								None (None upstream) : None (None downstream)																																			---	---	---	---
SMC3	9126	broad.mit.edu	37	10	112340975	112340975	+	Intron	DEL	T	-	-	rs67616631		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112340975delT	uc001kze.2	+							NM_005445	NP_005436			structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	114123916	114123917	+	IGR	INS	-	T	T	rs140259506	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114123916_114123917insT								GUCY2GP (7563 upstream) : ACSL5 (9999 downstream)																																			---	---	---	---
C10orf81	79949	broad.mit.edu	37	10	115526835	115526835	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115526835delA	uc001lat.1	+						C10orf81_uc001lar.1_Intron|C10orf81_uc009xyc.1_Intron|C10orf81_uc001las.1_Intron	NM_024889	NP_079165			hypothetical protein LOC79949											central_nervous_system(1)	1		Colorectal(252;0.175)		Epithelial(162;0.0181)|all cancers(201;0.0204)														---	---	---	---
AFAP1L2	84632	broad.mit.edu	37	10	116065184	116065195	+	Intron	DEL	GCAGGAGGGGAC	-	-	rs61461562		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116065184_116065195delGCAGGAGGGGAC	uc001lbn.2	-						AFAP1L2_uc001lbo.2_Intron|AFAP1L2_uc010qse.1_Intron|AFAP1L2_uc001lbp.2_Intron|AFAP1L2_uc001lbr.1_Intron|AFAP1L2_uc010qsd.1_5'Flank	NM_001001936	NP_001001936			KIAA1914 protein isoform 1						inflammatory response|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of transcription, DNA-dependent|regulation of interleukin-6 production|regulation of mitotic cell cycle	cytoplasm	protein tyrosine kinase activator activity|SH2 domain binding|SH3 domain binding			ovary(1)|breast(1)	2		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	116743664	116743665	+	IGR	DEL	TT	-	-	rs66463544		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116743664_116743665delTT								TRUB1 (6226 upstream) : ATRNL1 (109459 downstream)																																			---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117286045	117286046	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117286045_117286046insT	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186			attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
GFRA1	2674	broad.mit.edu	37	10	117953217	117953217	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117953217delC	uc001lcj.2	-						GFRA1_uc001lci.2_Intron|GFRA1_uc009xyr.2_Intron	NM_005264	NP_005255			GDNF family receptor alpha 1 isoform a						axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity			ovary(1)|pancreas(1)	2		Lung NSC(174;0.21)		all cancers(201;0.0337)														---	---	---	---
GFRA1	2674	broad.mit.edu	37	10	117996124	117996124	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117996124delA	uc001lcj.2	-						GFRA1_uc001lci.2_Intron|GFRA1_uc009xyr.2_Intron	NM_005264	NP_005255			GDNF family receptor alpha 1 isoform a						axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity			ovary(1)|pancreas(1)	2		Lung NSC(174;0.21)		all cancers(201;0.0337)														---	---	---	---
C10orf96	374355	broad.mit.edu	37	10	118090966	118090966	+	Intron	DEL	C	-	-	rs112995764		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118090966delC	uc001lck.2	+							NM_198515	NP_940917			hypothetical protein LOC374355											ovary(2)	2		Lung NSC(174;0.204)|all_lung(145;0.248)		all cancers(201;0.014)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	120252193	120252194	+	IGR	INS	-	T	T	rs139393892	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120252193_120252194insT								C10orf84 (150354 upstream) : PRLHR (100722 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	120333171	120333172	+	IGR	DEL	CT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120333171_120333172delCT								C10orf84 (231332 upstream) : PRLHR (19744 downstream)																																			---	---	---	---
SFXN4	119559	broad.mit.edu	37	10	120902895	120902895	+	Intron	DEL	C	-	-	rs11198802		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120902895delC	uc001leb.2	-						SFXN4_uc001ldy.2_Intron|SFXN4_uc001ldz.2_Intron|SFXN4_uc001lea.2_Intron	NM_213649	NP_998814			sideroflexin 4						iron ion homeostasis	integral to membrane|mitochondrial membrane	cation transmembrane transporter activity			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	122484436	122484436	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122484436delA								PPAPDC1A (135069 upstream) : WDR11 (126259 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122701160	122701161	+	IGR	DEL	CC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122701160_122701161delCC								WDR11 (32125 upstream) : FGFR2 (536684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	123116311	123116311	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123116311delA								WDR11 (447276 upstream) : FGFR2 (121534 downstream)																																			---	---	---	---
ATE1	11101	broad.mit.edu	37	10	123608246	123608247	+	Intron	INS	-	AGTTGGTA	AGTTGGTA	rs71022873		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123608246_123608247insAGTTGGTA	uc001lfp.2	-						ATE1_uc001lfq.2_Intron|ATE1_uc010qtr.1_Intron|ATE1_uc010qts.1_Intron|ATE1_uc010qtt.1_Intron|ATE1_uc001lfr.2_Intron|ATE1_uc009xzu.2_Intron	NM_007041	NP_008972			arginyltransferase 1 isoform 2						protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity				0		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)																---	---	---	---
ATE1	11101	broad.mit.edu	37	10	123677848	123677848	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123677848delA	uc001lfp.2	-						ATE1_uc001lfq.2_Intron|ATE1_uc010qtr.1_Intron|ATE1_uc010qts.1_Intron|ATE1_uc010qtt.1_Intron|ATE1_uc001lfr.2_Intron|ATE1_uc009xzu.2_Intron	NM_007041	NP_008972			arginyltransferase 1 isoform 2						protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity				0		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)																---	---	---	---
NSMCE4A	54780	broad.mit.edu	37	10	123717745	123717745	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123717745delA	uc001lfs.2	-						NSMCE4A_uc009xzv.2_Intron|NSMCE4A_uc001lft.2_Intron	NM_017615	NP_060085			non-SMC element 4 homolog A												0		all_neural(114;0.138)|Glioma(114;0.222)																---	---	---	---
GPR26	2849	broad.mit.edu	37	10	125433437	125433438	+	Intron	INS	-	TCT	TCT	rs145117660	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125433437_125433438insTCT	uc001lhh.2	+							NM_153442	NP_703143			G protein-coupled receptor 26						activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	126594814	126594814	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126594814delG								FAM175B (69576 upstream) : ZRANB1 (34158 downstream)																																			---	---	---	---
CTBP2	1488	broad.mit.edu	37	10	126749033	126749034	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126749033_126749034delGT	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron	NM_001329	NP_001320			C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)														---	---	---	---
DHX32	55760	broad.mit.edu	37	10	127578794	127578795	+	Intron	DEL	AT	-	-	rs5788723		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127578794_127578795delAT	uc001ljg.1	-							NM_018180	NP_060650			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)																---	---	---	---
DHX32	55760	broad.mit.edu	37	10	127582669	127582670	+	Intron	DEL	AT	-	-	rs141033053		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127582669_127582670delAT	uc001ljg.1	-						FANK1_uc010quk.1_5'Flank|FANK1_uc001ljh.3_5'Flank|FANK1_uc009yan.2_5'Flank	NM_018180	NP_060650			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)																---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	129108143	129108143	+	Intron	DEL	T	-	-	rs72268371		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129108143delT	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	129289149	129289150	+	IGR	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129289149_129289150delTT								DOCK1 (38368 upstream) : NPS (58463 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	129293115	129293116	+	IGR	INS	-	TTAA	TTAA	rs146685551	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129293115_129293116insTTAA								DOCK1 (42334 upstream) : NPS (54497 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	129413706	129413706	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129413706delA								NPS (62771 upstream) : FOXI2 (121832 downstream)																																			---	---	---	---
PTPRE	5791	broad.mit.edu	37	10	129750607	129750607	+	Intron	DEL	T	-	-	rs71035509		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129750607delT	uc001lkb.2	+						PTPRE_uc009yat.2_Intron	NM_006504	NP_006495			protein tyrosine phosphatase, receptor type, E						negative regulation of insulin receptor signaling pathway|protein phosphorylation	cytoplasm|integral to membrane|intermediate filament cytoskeleton|nucleus|plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(1)	1		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)																---	---	---	---
PTPRE	5791	broad.mit.edu	37	10	129865396	129865397	+	Intron	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129865396_129865397delCA	uc001lkb.2	+						PTPRE_uc009yat.2_Intron|PTPRE_uc010qup.1_Intron|PTPRE_uc009yau.2_Intron|PTPRE_uc001lkd.2_Intron|PTPRE_uc010quq.1_Intron	NM_006504	NP_006495			protein tyrosine phosphatase, receptor type, E						negative regulation of insulin receptor signaling pathway|protein phosphorylation	cytoplasm|integral to membrane|intermediate filament cytoskeleton|nucleus|plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(1)	1		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	130243449	130243449	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130243449delC								MKI67 (318981 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	130593225	130593228	+	IGR	DEL	GGAT	-	-	rs72162505		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130593225_130593228delGGAT								MKI67 (668757 upstream) : MGMT (672226 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	130948220	130948221	+	IGR	INS	-	G	G	rs72515706	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130948220_130948221insG								None (None upstream) : MGMT (317233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132214575	132214575	+	IGR	DEL	T	-	-	rs72125752		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132214575delT								GLRX3 (231791 upstream) : TCERG1L (676081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132335713	132335714	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132335713_132335714insA								GLRX3 (352929 upstream) : TCERG1L (554942 downstream)																																			---	---	---	---
TCERG1L	256536	broad.mit.edu	37	10	133052245	133052247	+	Intron	DEL	AGA	-	-	rs141202788		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133052245_133052247delAGA	uc001lkp.2	-						TCERG1L_uc009yax.1_Intron	NM_174937	NP_777597			transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	133577496	133577519	+	IGR	DEL	GGAGCACAGGAAGAAGGGAGGATA	-	-	rs76136012		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133577496_133577519delGGAGCACAGGAAGAAGGGAGGATA								TCERG1L (467512 upstream) : PPP2R2D (170441 downstream)																																			---	---	---	---
INPP5A	3632	broad.mit.edu	37	10	134379224	134379225	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134379224_134379225delTG	uc001llp.2	+						INPP5A_uc001llo.1_Intron	NM_005539	NP_005530			inositol polyphosphate-5-phosphatase A						cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	134820734	134820735	+	IGR	INS	-	C	C	rs144827430	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134820734_134820735insC								C10orf93 (64670 upstream) : GPR123 (63698 downstream)																																			---	---	---	---
GPR123	84435	broad.mit.edu	37	10	134887060	134887060	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134887060delA	uc001llw.2	+											RecName: Full=Probable G-protein coupled receptor 123;							integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)														---	---	---	---
ODF3	113746	broad.mit.edu	37	11	194850	194851	+	5'Flank	INS	-	CACT	CACT	rs143036825		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:194850_194851insCACT	uc001lob.2	+						ODF3_uc010qvk.1_5'Flank|ODF3_uc001loc.2_5'Flank	NM_053280	NP_444510			outer dense fiber of sperm tails 3						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm				ovary(1)	1		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)														---	---	---	---
PTDSS2	81490	broad.mit.edu	37	11	475137	475138	+	Intron	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:475137_475138delTT	uc001lpj.2	+						PTDSS2_uc009ybv.1_Intron	NM_030783	NP_110410			phosphatidylserine synthase 2							integral to membrane					0		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;2.76e-26)|Epithelial(43;2.56e-25)|OV - Ovarian serous cystadenocarcinoma(40;7.54e-20)|BRCA - Breast invasive adenocarcinoma(625;8.76e-05)|Lung(200;0.0407)|LUSC - Lung squamous cell carcinoma(625;0.0735)	Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	2199944	2199945	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2199944_2199945delGT								TH (6909 upstream) : ASCL2 (89784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	2243443	2243443	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2243443delT								TH (50408 upstream) : ASCL2 (46286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	4918348	4918349	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4918348_4918349delAC								OR51T1 (14236 upstream) : OR51A7 (10251 downstream)																																			---	---	---	---
OR10A5	144124	broad.mit.edu	37	11	6864113	6864113	+	5'Flank	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6864113delA	uc001met.1	+							NM_178168	NP_835462			olfactory receptor, family 10, subfamily A,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)														---	---	---	---
PPFIBP2	8495	broad.mit.edu	37	11	7561480	7561481	+	Intron	INS	-	T	T	rs143296049	by1000genomes;by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7561480_7561481insT	uc001mfj.3	+							NM_003621	NP_003612			PTPRF interacting protein, binding protein 2						cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)														---	---	---	---
STK33	65975	broad.mit.edu	37	11	8498686	8498687	+	5'Flank	INS	-	AC	AC	rs146828395	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8498686_8498687insAC	uc001mgi.1	-						STK33_uc001mgj.1_Intron|STK33_uc001mgk.1_Intron|STK33_uc010rbn.1_Intron|STK33_uc001mgl.3_Intron|STK33_uc009yfp.2_Intron	NM_030906	NP_112168			serine/threonine kinase 33							Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|pancreas(1)|central_nervous_system(1)|skin(1)	7				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	9346988	9346988	+	IGR	DEL	A	-	-	rs35855666		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9346988delA								TMEM41B (10692 upstream) : IPO7 (59181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	11268518	11268519	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11268518_11268519delGT								ZBED5 (388898 upstream) : GALNTL4 (23902 downstream)																																			---	---	---	---
GALNTL4	374378	broad.mit.edu	37	11	11599547	11599548	+	Intron	INS	-	CTTCAAAT	CTTCAAAT	rs150834751	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11599547_11599548insCTTCAAAT	uc001mjo.2	-							NM_198516	NP_940918			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)														---	---	---	---
SPON1	10418	broad.mit.edu	37	11	14044939	14044942	+	Intron	DEL	ACTG	-	-	rs143926041		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14044939_14044942delACTG	uc001mle.2	+							NM_006108	NP_006099			spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)														---	---	---	---
SPON1	10418	broad.mit.edu	37	11	14263444	14263444	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14263444delT	uc001mle.2	+							NM_006108	NP_006099			spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)														---	---	---	---
PDE3B	5140	broad.mit.edu	37	11	14854498	14854498	+	Intron	DEL	T	-	-	rs80137325		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14854498delT	uc001mln.2	+						PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913			phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0																		---	---	---	---
INSC	387755	broad.mit.edu	37	11	15134193	15134194	+	Intron	INS	-	G	G	rs148001480	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15134193_15134194insG	uc001mly.2	+						INSC_uc001mlz.2_5'Flank	NM_001031853	NP_001027024			inscuteable isoform a						cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5																		---	---	---	---
INSC	387755	broad.mit.edu	37	11	15192818	15192818	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15192818delG	uc001mly.2	+						INSC_uc001mlz.2_Intron|INSC_uc001mma.2_Intron|INSC_uc010rcs.1_Intron|INSC_uc001mmb.2_Intron|INSC_uc001mmc.2_Intron	NM_001031853	NP_001027024			inscuteable isoform a						cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5																		---	---	---	---
SERGEF	26297	broad.mit.edu	37	11	17885154	17885155	+	Intron	INS	-	ATTC	ATTC	rs150695737	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17885154_17885155insATTC	uc001mnm.2	-						SERGEF_uc009yhd.2_Intron|SERGEF_uc001mnn.2_Intron|SERGEF_uc010rcz.1_Intron	NM_012139	NP_036271			deafness locus associated putative guanine						negative regulation of protein secretion|signal transduction	cytoplasm|nucleus	protein binding|Ran guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1																		---	---	---	---
UEVLD	55293	broad.mit.edu	37	11	18558443	18558443	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18558443delT	uc001mot.2	-						UEVLD_uc001mou.2_Intron|UEVLD_uc010rde.1_Intron|UEVLD_uc010rdf.1_Intron|UEVLD_uc010rdg.1_Intron|UEVLD_uc001mov.2_Intron	NM_001040697	NP_001035787			ubiquitin-conjugating enzyme E2-like isoform a						cellular carbohydrate metabolic process|protein modification process|protein transport		binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor				0																		---	---	---	---
IGSF22	283284	broad.mit.edu	37	11	18736574	18736594	+	Intron	DEL	ACTGTGGGATACATACATACA	-	-	rs57000427		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18736574_18736594delACTGTGGGATACATACATACA	uc009yht.2	-						IGSF22_uc001mpa.2_Intron	NM_173588	NP_775859			immunoglobulin superfamily, member 22											ovary(4)|large_intestine(2)|kidney(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	19014061	19014061	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19014061delT								MRGPRX1 (57512 upstream) : MRGPRX2 (61944 downstream)																																			---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19825658	19825659	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19825658_19825659delGT	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron	NM_145117	NP_660093			neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	20219409	20219411	+	IGR	DEL	TTG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20219409_20219411delTTG								DBX1 (37539 upstream) : HTATIP2 (165820 downstream)																																			---	---	---	---
NELL1	4745	broad.mit.edu	37	11	21566810	21566810	+	Intron	DEL	G	-	-	rs34355530		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21566810delG	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron|NELL1_uc001mqh.2_Intron	NM_006157	NP_006148			nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	22013153	22013154	+	IGR	INS	-	T	T	rs35439304		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22013153_22013154insT								NELL1 (415926 upstream) : ANO5 (201568 downstream)																																			---	---	---	---
GAS2	2620	broad.mit.edu	37	11	22754316	22754317	+	Intron	INS	-	ATC	ATC	rs67937021		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22754316_22754317insATC	uc009yie.2	+						GAS2_uc001mqm.2_Intron|GAS2_uc001mqn.2_Intron|GAS2_uc001mqo.2_Intron	NM_001143830	NP_001137302			growth arrest-specific 2						cell cycle arrest|cellular component disassembly involved in apoptosis|regulation of cell shape	actin filament|cytosol|membrane				ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	27055098	27055098	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27055098delA								FIBIN (36468 upstream) : BBOX1 (7411 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29709927	29709927	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29709927delA								None (None upstream) : KCNA4 (321839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	30673463	30673466	+	IGR	DEL	AGGC	-	-	rs117177827	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30673463_30673466delAGGC								MPPED2 (65533 upstream) : DCDC1 (291283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	31062993	31062993	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31062993delT	uc009yjk.1	-						uc009yjl.1_Intron|DCDC1_uc001msu.1_Intron					RecName: Full=Doublecortin domain-containing protein 5;																														---	---	---	---
C11orf41	25758	broad.mit.edu	37	11	33673271	33673271	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33673271delG	uc001mup.3	+							NM_012194	NP_036326			hypothetical protein LOC25758							integral to membrane				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	34881717	34881718	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34881717_34881718insA								EHF (198636 upstream) : APIP (14996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	36897972	36897972	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36897972delG								C11orf74 (201582 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	38776870	38776871	+	IGR	INS	-	TT	TT	rs3029900		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38776870_38776871insTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	40074519	40074519	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40074519delT								None (None upstream) : LRRC4C (61234 downstream)																																			---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40143873	40143873	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40143873delC	uc001mxa.1	-						LRRC4C_uc001mxc.1_Intron|LRRC4C_uc001mxd.1_Intron|LRRC4C_uc001mxb.1_Intron	NM_020929	NP_065980			netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	42969518	42969518	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42969518delA								None (None upstream) : API5 (363987 downstream)																																			---	---	---	---
EXT2	2132	broad.mit.edu	37	11	44105635	44105635	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44105635delC	uc010rfo.1	+							NM_207122	NP_997005			exostosin 2 isoform 2						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity			lung(2)|breast(2)|skin(1)	5								Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses				---	---	---	---
EXT2	2132	broad.mit.edu	37	11	44180896	44180897	+	Intron	INS	-	T	T	rs142006509	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44180896_44180897insT	uc001mxz.2	+						EXT2_uc010rfo.1_Intron|EXT2_uc001mxy.2_Intron|EXT2_uc009ykt.2_Intron|EXT2_uc001mya.2_Intron	NM_207122	NP_997005			exostosin 2 isoform 2						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity			lung(2)|breast(2)|skin(1)	5								Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses				---	---	---	---
Unknown	0	broad.mit.edu	37	11	44508866	44508867	+	IGR	INS	-	A	A	rs142835622	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44508866_44508867insA								ALX4 (177150 upstream) : CD82 (78274 downstream)																																			---	---	---	---
AMBRA1	55626	broad.mit.edu	37	11	46611177	46611177	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46611177delT	uc010rgu.1	-						AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron	NM_017749	NP_060219			activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	46871687	46871687	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46871687delA	uc001ndl.2	+											full-length cDNA clone CS0DB008YO18 of Neuroblastoma Cot 10-normalized of Homo sapiens (human).																														---	---	---	---
DDB2	1643	broad.mit.edu	37	11	47249818	47249818	+	Intron	DEL	A	-	-	rs78615445		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47249818delA	uc001neb.2	+						DDB2_uc001nec.2_Intron|DDB2_uc009yli.1_Intron|DDB2_uc001ned.2_Intron|DDB2_uc001nee.2_Intron|DDB2_uc001nef.2_Intron|DDB2_uc001neg.2_Intron|DDB2_uc001neh.2_Intron	NM_000107	NP_000098			damage-specific DNA binding protein 2						nucleotide-excision repair, DNA damage removal|protein autoubiquitination|protein polyubiquitination|response to UV	nucleoplasm|protein complex	damaged DNA binding|protein binding			kidney(2)|ovary(1)	3								Mis|N			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				---	---	---	---
Unknown	0	broad.mit.edu	37	11	48527889	48527889	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48527889delG								OR4A47 (16617 upstream) : FOLH1 (640299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48720351	48720352	+	IGR	INS	-	CTTT	CTTT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48720351_48720352insCTTT								OR4A47 (209079 upstream) : FOLH1 (447836 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50112186	50112186	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50112186delA								OR4C12 (108149 upstream) : LOC441601 (126814 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50325228	50325228	+	IGR	DEL	A	-	-	rs143410455		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50325228delA								LOC441601 (67605 upstream) : LOC646813 (43090 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	51369130	51369130	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51369130delT								LOC646813 (989327 upstream) : OR4A5 (42318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	56683717	56683717	+	IGR	DEL	G	-	-	rs114421786	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56683717delG								OR9G4 (172430 upstream) : OR5AK2 (72672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	57342560	57342560	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57342560delA								UBE2L6 (7107 upstream) : SERPING1 (22467 downstream)																																			---	---	---	---
CLP1	10978	broad.mit.edu	37	11	57426556	57426557	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57426556_57426557insT	uc001nkw.2	+						CLP1_uc010rjw.1_Intron|CLP1_uc009yml.2_Intron	NM_006831	NP_006822			ATP/GTP-binding protein isoform 1						mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|siRNA loading onto RISC involved in RNA interference|targeting of mRNA for destruction involved in RNA interference|termination of RNA polymerase II transcription|tRNA splicing, via endonucleolytic cleavage and ligation	nucleoplasm|tRNA-intron endonuclease complex	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|ATP-dependent polyribonucleotide 5'-hydroxyl-kinase activity			ovary(1)	1																		---	---	---	---
MED19	219541	broad.mit.edu	37	11	57478172	57478173	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57478172_57478173insT	uc001nla.1	-						CTNND1_uc001nlf.1_5'Flank|MED19_uc001nlb.2_Intron|TMX2_uc001nlc.1_5'Flank|TMX2_uc001nld.1_5'Flank|TMX2_uc001nle.1_5'Flank	NM_153450	NP_703151			mediator complex subunit 19						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	57598719	57598720	+	IGR	DEL	AC	-	-	rs36020242		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57598719_57598720delAC								CTNND1 (12068 upstream) : OR9Q1 (192633 downstream)																																			---	---	---	---
OR9Q1	219956	broad.mit.edu	37	11	57937800	57937801	+	Intron	INS	-	T	T	rs138680256	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57937800_57937801insT	uc001nmj.2	+							NM_001005212	NP_001005212			olfactory receptor, family 9, subfamily Q,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.222)																---	---	---	---
GLYATL2	219970	broad.mit.edu	37	11	58611061	58611061	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58611061delC	uc001nnd.3	-						GLYATL2_uc009ymq.2_Intron	NM_145016	NP_659453			glycine-N-acyltransferase-like 2							mitochondrion	glycine N-acyltransferase activity			ovary(1)|skin(1)	2		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	59500845	59500845	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59500845delA								OR10V1 (19527 upstream) : STX3 (22044 downstream)																																			---	---	---	---
STX3	6809	broad.mit.edu	37	11	59549278	59549280	+	Intron	DEL	AGC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59549278_59549280delAGC	uc001nog.2	+						STX3_uc010rkx.1_Intron|STX3_uc010rky.1_Intron	NM_004177	NP_004168			syntaxin 3						cellular response to oxidative stress|intracellular protein transport|neuron projection development|neurotransmitter transport	apical plasma membrane|azurophil granule|cell-cell junction|growth cone|integral to membrane|plasma membrane enriched fraction|SNARE complex|specific granule	arachidonic acid binding|SNAP receptor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	63699911	63699912	+	IGR	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63699911_63699912delTT								RCOR2 (15595 upstream) : NAA40 (6530 downstream)																																			---	---	---	---
FRMD8	83786	broad.mit.edu	37	11	65166466	65166469	+	Intron	DEL	TTTT	-	-	rs33928334		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65166466_65166469delTTTT	uc001odu.3	+						FRMD8_uc009yqj.2_Intron|FRMD8_uc010rof.1_Intron	NM_031904	NP_114110			FERM domain containing 8							cytoskeleton	binding			lung(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	65458263	65458264	+	IGR	INS	-	G	G	rs142391228	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65458263_65458264insG								RELA (27820 upstream) : KAT5 (21225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	65458309	65458310	+	IGR	INS	-	T	T	rs150496328	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65458309_65458310insT								RELA (27866 upstream) : KAT5 (21179 downstream)																																			---	---	---	---
LOC100130987	100130987	broad.mit.edu	37	11	67146715	67146716	+	Intron	DEL	GT	-	-	rs66494684		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67146715_67146716delGT	uc010rpo.1	+							NR_024469				Homo sapiens cDNA FLJ38836 fis, clone MESAN2002519, weakly similar to Mus musculus cell cycle checkpoint control protein Mrad9 gene.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	67452779	67452780	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67452779_67452780insT								ALDH3B2 (4094 upstream) : LOC645332 (106460 downstream)																																			---	---	---	---
CHKA	1119	broad.mit.edu	37	11	67845160	67845161	+	Intron	DEL	GA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67845160_67845161delGA	uc001onj.2	-						CHKA_uc001onk.2_Intron	NM_001277	NP_001268			choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)													---	---	---	---
SUV420H1	51111	broad.mit.edu	37	11	67973090	67973091	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67973090_67973091insT	uc001onm.1	-						SUV420H1_uc001onn.1_Intron|SUV420H1_uc009ysf.2_Intron|SUV420H1_uc001ono.1_Intron|SUV420H1_uc001onp.2_Intron|SUV420H1_uc010rqa.1_Intron|SUV420H1_uc001onq.2_Intron	NM_017635	NP_060105			suppressor of variegation 4-20 homolog 1 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(2)|kidney(1)	3																		---	---	---	---
LRP5	4041	broad.mit.edu	37	11	68196565	68196565	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68196565delA	uc001ont.2	+						LRP5_uc009ysg.2_Intron	NM_002335	NP_002326			low density lipoprotein receptor-related protein						adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7																		---	---	---	---
ANO1	55107	broad.mit.edu	37	11	69941319	69941320	+	Intron	DEL	AG	-	-	rs34635415		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69941319_69941320delAG	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron	NM_018043	NP_060513			anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2																		---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70436875	70436875	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70436875delA	uc001oqc.2	-						SHANK2_uc010rqn.1_Intron|SHANK2_uc001opz.2_Intron|uc009ysn.1_Intron|SHANK2_uc010rqp.1_Intron	NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	71370371	71370372	+	IGR	INS	-	A	A	rs150131488		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71370371_71370372insA								KRTAP5-11 (76450 upstream) : FAM86C (128185 downstream)																																			---	---	---	---
FAM168A	23201	broad.mit.edu	37	11	73225933	73225933	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73225933delA	uc001otz.1	-						FAM168A_uc001oty.1_Intron|FAM168A_uc009ytp.1_Intron	NM_015159	NP_055974			hypothetical protein LOC23201												0																		---	---	---	---
RAB6A	5870	broad.mit.edu	37	11	73390985	73390986	+	Intron	INS	-	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73390985_73390986insC	uc001oue.2	-						RAB6A_uc001ouf.2_Intron|RAB6A_uc009yts.2_Intron	NM_002869	NP_002860			RAB6A, member RAS oncogene family isoform a						minus-end-directed organelle transport along microtubule|peptidyl-cysteine methylation|protein targeting to Golgi|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic vesicle|cytosol|Golgi membrane|trans-Golgi network	GTP binding|GTPase activity|protein domain specific binding				0																		---	---	---	---
RAB6A	5870	broad.mit.edu	37	11	73400170	73400170	+	Intron	DEL	A	-	-	rs111664897		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73400170delA	uc001oue.2	-						RAB6A_uc001ouf.2_Intron|RAB6A_uc009yts.2_Intron	NM_002869	NP_002860			RAB6A, member RAS oncogene family isoform a						minus-end-directed organelle transport along microtubule|peptidyl-cysteine methylation|protein targeting to Golgi|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic vesicle|cytosol|Golgi membrane|trans-Golgi network	GTP binding|GTPase activity|protein domain specific binding				0																		---	---	---	---
PGM2L1	283209	broad.mit.edu	37	11	74084070	74084071	+	Intron	INS	-	A	A	rs140707605	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74084070_74084071insA	uc001ovb.1	-							NM_173582	NP_775853			phosphoglucomutase 2-like 1						glucose 1-phosphate metabolic process	cytosol	glucose-1,6-bisphosphate synthase activity|phosphoglucomutase activity			ovary(1)	1	Breast(11;3.32e-06)																	---	---	---	---
KCNE3	10008	broad.mit.edu	37	11	74181301	74181301	+	5'Flank	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74181301delA	uc001ovc.2	-							NM_005472	NP_005463			potassium voltage-gated channel, Isk-related							integral to membrane	voltage-gated potassium channel activity			ovary(1)	1	Breast(11;2.86e-06)																	---	---	---	---
GDPD5	81544	broad.mit.edu	37	11	75204414	75204415	+	5'Flank	DEL	TC	-	-	rs144835414		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75204414_75204415delTC	uc001owo.3	-						GDPD5_uc001owp.3_Intron|GDPD5_uc001owq.3_Intron	NM_030792	NP_110419			glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process|nervous system development	endomembrane system|growth cone|integral to membrane|perinuclear region of cytoplasm	glycerophosphodiester phosphodiesterase activity			ovary(1)	1																		---	---	---	---
UVRAG	7405	broad.mit.edu	37	11	75641656	75641656	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75641656delA	uc001oxc.2	+						UVRAG_uc010rrw.1_Intron|UVRAG_uc009yuh.1_5'Flank	NM_003369	NP_003360			UV radiation resistance associated						DNA repair|positive regulation of autophagy	early endosome|late endosome|lysosome	protein binding			skin(4)|lung(2)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	76133643	76133645	+	IGR	DEL	TTG	-	-	rs111342713		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76133643_76133645delTTG								PRKRIR (41763 upstream) : C11orf30 (22424 downstream)																																			---	---	---	---
C11orf67	28971	broad.mit.edu	37	11	77578359	77578359	+	Intron	DEL	T	-	-	rs5792780		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77578359delT	uc001oyq.2	+						C11orf67_uc001oyp.2_Intron|C11orf67_uc001oyr.1_Intron	NM_024684	NP_078960			hypothetical protein LOC28971												0	all_cancers(14;5.69e-19)|all_epithelial(13;2.15e-21)|Breast(9;1.16e-15)|Ovarian(111;0.152)		Epithelial(5;1.37e-49)|all cancers(3;5.58e-46)|BRCA - Breast invasive adenocarcinoma(5;7.26e-31)															---	---	---	---
INTS4	92105	broad.mit.edu	37	11	77637858	77637858	+	Intron	DEL	A	-	-	rs111635521		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77637858delA	uc001oys.2	-						INTS4_uc001oyt.2_Intron|INTS4_uc001oyu.1_Intron	NM_033547	NP_291025			integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)															---	---	---	---
INTS4	92105	broad.mit.edu	37	11	77657806	77657807	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77657806_77657807insA	uc001oys.2	-						INTS4_uc001oyt.2_Intron|INTS4_uc001oyu.1_Intron	NM_033547	NP_291025			integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	77738414	77738415	+	IGR	INS	-	TTT	TTT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77738414_77738415insTTT								KCTD14 (4094 upstream) : THRSP (36492 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	77768739	77768739	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77768739delG								KCTD14 (34419 upstream) : THRSP (6168 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	80037624	80037624	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80037624delG								ODZ4 (885929 upstream) : None (None downstream)																																			---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83953454	83953454	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83953454delT	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
DLG2	1740	broad.mit.edu	37	11	85026916	85026916	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85026916delG	uc001pak.2	-							NM_001142699	NP_001136171			chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
DLG2	1740	broad.mit.edu	37	11	85191522	85191522	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85191522delA	uc001pak.2	-							NM_001142699	NP_001136171			chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
DLG2	1740	broad.mit.edu	37	11	85288433	85288433	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85288433delA	uc001pak.2	-							NM_001142699	NP_001136171			chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	85789857	85789857	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85789857delG								PICALM (8957 upstream) : EED (165958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	85869999	85870006	+	IGR	DEL	TGTGTGTT	-	-	rs144042054	by1000genomes;by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85869999_85870006delTGTGTGTT								PICALM (89099 upstream) : EED (85809 downstream)																																			---	---	---	---
PRSS23	11098	broad.mit.edu	37	11	86636338	86636341	+	Intron	DEL	GTGT	-	-	rs5793226		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86636338_86636341delGTGT	uc001pcc.1	+						uc001pcd.2_Intron					Homo sapiens serine protease mRNA, complete cds.						proteolysis	extracellular region|nucleus	serine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)																---	---	---	---
TMEM135	65084	broad.mit.edu	37	11	86829441	86829441	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86829441delC	uc001pch.2	+						TMEM135_uc010rtt.1_Intron|TMEM135_uc001pci.2_Intron|TMEM135_uc001pcg.1_Intron	NM_022918	NP_075069			transmembrane protein 135							integral to membrane					0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)																---	---	---	---
TMEM135	65084	broad.mit.edu	37	11	86842451	86842452	+	Intron	INS	-	GT	GT	rs144841542	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86842451_86842452insGT	uc001pch.2	+						TMEM135_uc010rtt.1_Intron|TMEM135_uc001pci.2_Intron|TMEM135_uc001pcg.1_Intron	NM_022918	NP_075069			transmembrane protein 135							integral to membrane					0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)																---	---	---	---
GRM5	2915	broad.mit.edu	37	11	88319275	88319276	+	Intron	INS	-	AC	AC	rs140549003	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88319275_88319276insAC	uc001pcq.2	-						GRM5_uc009yvm.2_Intron	NM_001143831	NP_001137303			glutamate receptor, metabotropic 5 isoform a						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)													---	---	---	---
NAALAD2	10003	broad.mit.edu	37	11	89911839	89911839	+	Intron	DEL	A	-	-	rs144229213		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89911839delA	uc001pdf.3	+						NAALAD2_uc009yvx.2_Intron|NAALAD2_uc009yvy.2_Intron	NM_005467	NP_005458			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	90223154	90223164	+	IGR	DEL	GTCTGGGGCAT	-	-	rs112041299		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90223154_90223164delGTCTGGGGCAT								CHORDC1 (266622 upstream) : MIR1261 (379125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	90436240	90436241	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90436240_90436241insT								CHORDC1 (479708 upstream) : MIR1261 (166048 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	91284419	91284419	+	IGR	DEL	A	-	-	rs75668854		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91284419delA								MIR1261 (682049 upstream) : FAT3 (800843 downstream)																																			---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92470713	92470714	+	Intron	DEL	GA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92470713_92470714delGA	uc001pdj.3	+							NM_001008781	NP_001008781			FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
CCDC67	159989	broad.mit.edu	37	11	93071571	93071571	+	Intron	DEL	T	-	-	rs68186868		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93071571delT	uc001pdq.2	+						CCDC67_uc001pdo.1_Intron|CCDC67_uc001pdp.2_Intron	NM_181645	NP_857596			coiled-coil domain containing 67											ovary(1)	1		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	93682884	93682884	+	IGR	DEL	T	-	-	rs112745460		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93682884delT								C11orf90 (99216 upstream) : HEPHL1 (71494 downstream)																																			---	---	---	---
HEPHL1	341208	broad.mit.edu	37	11	93795808	93795809	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93795808_93795809insT	uc001pep.2	+							NM_001098672	NP_001092142			hephaestin-like 1 precursor						copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	95110555	95110555	+	IGR	DEL	T	-	-	rs34736393		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95110555delT								SESN3 (144850 upstream) : FAM76B (391551 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	95263935	95263938	+	IGR	DEL	ACAC	-	-	rs5793726		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95263935_95263938delACAC								SESN3 (298230 upstream) : FAM76B (238168 downstream)																																			---	---	---	---
MAML2	84441	broad.mit.edu	37	11	95836095	95836095	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95836095delA	uc001pfw.1	-							NM_032427	NP_115803			mastermind-like 2						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)						T	MECT1|CRTC3	salivary gland mucoepidermoid								---	---	---	---
Unknown	0	broad.mit.edu	37	11	96222167	96222167	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96222167delC								JRKL (95440 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	98163771	98163772	+	IGR	INS	-	C	C	rs76334585		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98163771_98163772insC								None (None upstream) : CNTN5 (728099 downstream)																																			---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	100152235	100152235	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100152235delT	uc001pga.2	+						CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron|CNTN5_uc010ruk.1_Intron	NM_014361	NP_055176			contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	103687945	103687945	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103687945delT								DYNC2H1 (337354 upstream) : PDGFD (89970 downstream)																																			---	---	---	---
GRIA4	2893	broad.mit.edu	37	11	105566205	105566206	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105566205_105566206delTG	uc001pix.2	+						GRIA4_uc001piu.1_Intron|GRIA4_uc001piw.2_Intron|GRIA4_uc001piv.2_Intron|GRIA4_uc009yxk.1_Intron	NM_000829	NP_000820			glutamate receptor, ionotrophic, AMPA 4 isoform						glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	108856264	108856264	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108856264delT								DDX10 (44618 upstream) : C11orf87 (436611 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	114243479	114243480	+	IGR	INS	-	A	A	rs35243966		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114243479_114243480insA								NNMT (60241 upstream) : C11orf71 (18690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	118788973	118788974	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118788973_118788974delTG								BCL9L (7360 upstream) : UPK2 (38052 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	121809497	121809498	+	IGR	DEL	CT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121809497_121809498delCT								SORL1 (305026 upstream) : LOC399959 (150313 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	122500490	122500490	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122500490delT								LOC399959 (262023 upstream) : UBASH3B (25908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	131230683	131230684	+	IGR	INS	-	AT	AT	rs79463893		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131230683_131230684insAT								SNX19 (444301 upstream) : NTM (9687 downstream)																																			---	---	---	---
NTM	50863	broad.mit.edu	37	11	131275326	131275326	+	Intron	DEL	A	-	-	rs35188711		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131275326delA	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530			neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
NTM	50863	broad.mit.edu	37	11	131959489	131959489	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131959489delG	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606			neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
LOC100288778	100288778	broad.mit.edu	37	12	86941	86941	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86941delA	uc010scy.1	+						uc010scx.1_Intron|LOC100288778_uc010scz.1_Intron|LOC100288778_uc010sdb.1_Intron|LOC100288778_uc010sdc.1_5'Flank|LOC100288778_uc010sdd.1_5'Flank|LOC100288778_uc010sde.1_5'Flank|LOC100288778_uc010sdf.1_5'Flank|LOC100288778_uc010sdg.1_5'Flank|LOC100288778_uc010sdh.1_5'Flank					SubName: Full=Actin nucleation promoting factor; Flags: Fragment;												0																		---	---	---	---
CCDC77	84318	broad.mit.edu	37	12	502704	502704	+	Intron	DEL	T	-	-	rs112822377		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:502704delT	uc009zdk.2	+						CCDC77_uc010sdp.1_Intron	NM_001130147	NP_001123619			coiled-coil domain containing 77 isoform b							centrosome				ovary(1)	1	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)															---	---	---	---
ADIPOR2	79602	broad.mit.edu	37	12	1873775	1873782	+	Intron	DEL	GATAGTCT	-	-	rs146024022		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1873775_1873782delGATAGTCT	uc001qjm.2	+						ADIPOR2_uc001qjn.2_Intron	NM_024551	NP_078827			adiponectin receptor 2						fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane	hormone binding|receptor activity				0	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)															---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2547561	2547563	+	Intron	DEL	ATG	-	-	rs57242774		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2547561_2547563delATG	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
TULP3	7289	broad.mit.edu	37	12	3006636	3006636	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3006636delA	uc010seh.1	+						TULP3_uc010sef.1_Intron|TULP3_uc009zec.1_Intron|TULP3_uc010seg.1_Intron|TULP3_uc001qlj.2_Intron|TULP3_uc010sei.1_Intron	NM_003324	NP_003315			tubby like protein 3 isoform 1						G-protein coupled receptor protein signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|extracellular region|nucleus|plasma membrane	phosphatidylinositol-4,5-bisphosphate binding				0			OV - Ovarian serous cystadenocarcinoma(31;0.000818)															---	---	---	---
EFCAB4B	84766	broad.mit.edu	37	12	3855519	3855520	+	Intron	DEL	CT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3855519_3855520delCT	uc001qmj.2	-						EFCAB4B_uc010sen.1_Intron|EFCAB4B_uc010seo.1_Intron	NM_032680	NP_116069			EF-hand calcium binding domain 4B isoform c						activation of store-operated calcium channel activity|store-operated calcium entry	cytoplasm	calcium ion binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)															---	---	---	---
DYRK4	8798	broad.mit.edu	37	12	4695895	4695896	+	Intron	INS	-	AG	AG	rs28366517		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4695895_4695896insAG	uc009zeh.1	+							NM_003845	NP_003836			dual-specificity tyrosine-(Y)-phosphorylation							Golgi apparatus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|skin(1)	3			Colorectal(7;0.103)															---	---	---	---
KCNA6	3742	broad.mit.edu	37	12	4941516	4941517	+	Intron	INS	-	C	C	rs143882037	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4941516_4941517insC	uc001qng.2	+							NM_002235	NP_002226			potassium voltage-gated channel, shaker-related							voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(2)|ovary(1)	3															HNSCC(72;0.22)			---	---	---	---
KCNA6	3742	broad.mit.edu	37	12	4944262	4944263	+	Intron	INS	-	AAATGT	AAATGT	rs147604097	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4944262_4944263insAAATGT	uc001qng.2	+							NM_002235	NP_002226			potassium voltage-gated channel, shaker-related							voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(2)|ovary(1)	3															HNSCC(72;0.22)			---	---	---	---
ANO2	57101	broad.mit.edu	37	12	5731017	5731017	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5731017delG	uc001qnm.2	-							NM_020373	NP_065106			anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	7312812	7312812	+	IGR	DEL	T	-	-	rs111682673		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7312812delT								CLSTN3 (1284 upstream) : PEX5 (28947 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	7842295	7842296	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7842295_7842296delTG								APOBEC1 (17507 upstream) : GDF3 (86 downstream)																																			---	---	---	---
CLEC6A	93978	broad.mit.edu	37	12	8617839	8617840	+	Intron	INS	-	T	T	rs113101559		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8617839_8617840insT	uc001qum.1	+							NM_001007033	NP_001007034			dectin-2						defense response to fungus|innate immune response|positive regulation of cytokine secretion|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	sugar binding			breast(1)	1	Lung SC(5;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	9391908	9391909	+	5'Flank	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9391908_9391909insT	uc001qvm.1	+											Homo sapiens cDNA FLJ44260 fis, clone TLIVE2000979.																														---	---	---	---
CLEC2D	29121	broad.mit.edu	37	12	9850138	9850139	+	3'UTR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9850138_9850139delTG	uc001qwg.1	+	5					CLEC2D_uc001qwf.1_3'UTR|CLEC2D_uc009zgs.1_RNA|CLEC2D_uc001qwh.1_RNA|CLEC2D_uc009zgt.1_RNA|CLEC2D_uc009zgu.1_3'UTR	NM_013269	NP_037401			osteoclast inhibitory lectin isoform 1						cell surface receptor linked signaling pathway	cell surface|endoplasmic reticulum|integral to plasma membrane|membrane fraction	sugar binding|transmembrane receptor activity				0																		---	---	---	---
C12orf59	120939	broad.mit.edu	37	12	10333616	10333616	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10333616delG	uc001qxr.2	+						C12orf59_uc001qxq.2_Intron					RecName: Full=Uncharacterized protein C12orf59; Flags: Precursor;							integral to membrane				ovary(1)	1																		---	---	---	---
CREBL2	1389	broad.mit.edu	37	12	12763896	12763897	+	5'Flank	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12763896_12763897insT	uc001rap.1	+							NM_001310	NP_001301			cAMP responsive element binding protein-like 2						cell cycle|signal transduction	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		Prostate(47;0.0684)		BRCA - Breast invasive adenocarcinoma(232;0.0503)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	13016198	13016198	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13016198delG								DDX47 (33289 upstream) : RPL13AP20 (12213 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	13296667	13296668	+	IGR	INS	-	GAAG	GAAG	rs147034253	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13296667_13296668insGAAG								GSG1 (40048 upstream) : EMP1 (52934 downstream)																																			---	---	---	---
EMP1	2012	broad.mit.edu	37	12	13364128	13364128	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13364128delT	uc001rbr.2	+						EMP1_uc009zhy.2_Intron|EMP1_uc010shr.1_Intron	NM_001423	NP_001414			epithelial membrane protein 1						cell growth|cell proliferation|epidermis development	integral to membrane|membrane fraction					0		Prostate(47;0.194)		BRCA - Breast invasive adenocarcinoma(232;0.153)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	14441092	14441092	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14441092delT								GRIN2B (308070 upstream) : ATF7IP (77519 downstream)																																			---	---	---	---
RERG	85004	broad.mit.edu	37	12	15294087	15294087	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15294087delT	uc001rcs.2	-						RERG_uc001rct.2_Intron|RERG_uc010shu.1_Intron	NM_032918	NP_116307			RAS-like, estrogen-regulated, growth inhibitor						negative regulation of cell growth|negative regulation of cell proliferation|response to hormone stimulus|small GTPase mediated signal transduction	cytosol|membrane|nucleus	estrogen receptor binding|GDP binding|GTP binding|GTPase activity			lung(1)	1																		---	---	---	---
PTPRO	5800	broad.mit.edu	37	12	15546563	15546563	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15546563delT	uc001rcv.1	+						PTPRO_uc001rcw.1_Intron|PTPRO_uc001rcu.1_Intron	NM_030667	NP_109592			receptor-type protein tyrosine phosphatase O							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	17512613	17512613	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17512613delT								LMO3 (749855 upstream) : RERGL (721191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	18920313	18920313	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18920313delA								CAPZA3 (28192 upstream) : PLEKHA5 (362335 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	19679979	19679980	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19679979_19679980insA								AEBP2 (4806 upstream) : PDE3A (842217 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	23095225	23095225	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23095225delC								ETNK1 (251618 upstream) : SOX5 (590007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	24838517	24838517	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24838517delA								SOX5 (123137 upstream) : BCAT1 (125764 downstream)																																			---	---	---	---
BCAT1	586	broad.mit.edu	37	12	25097269	25097269	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25097269delG	uc001rgd.3	-						BCAT1_uc010siy.1_Intron|BCAT1_uc001rge.3_Intron	NM_005504	NP_005495			branched chain aminotransferase 1, cytosolic						branched chain family amino acid biosynthetic process|branched chain family amino acid catabolic process|cell proliferation|G1/S transition of mitotic cell cycle	cytosol	L-isoleucine transaminase activity|L-leucine transaminase activity|L-valine transaminase activity			lung(1)|breast(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Glutamic Acid(DB00142)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)|Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	26315965	26315966	+	Intron	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs138827156	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26315965_26315966insGTGTGTGTGT	uc001rhc.2	+											Homo sapiens cDNA clone IMAGE:5300499.																														---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26943634	26943635	+	Intron	DEL	TT	-	-	rs34154120		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26943634_26943635delTT	uc001rhg.2	-						ITPR2_uc001rhh.1_Intron|ITPR2_uc001rhi.1_Intron	NM_002223	NP_002214			inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
C12orf70	341346	broad.mit.edu	37	12	27651634	27651634	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27651634delA	uc010sjq.1	+							NM_001145010	NP_001138482			hypothetical protein LOC341346							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	30408115	30408116	+	IGR	INS	-	A	A	rs113256400		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30408115_30408116insA								TMTC1 (470423 upstream) : IPO8 (373807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	30526695	30526697	+	IGR	DEL	GTT	-	-	rs75373189		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30526695_30526697delGTT								TMTC1 (589003 upstream) : IPO8 (255226 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	31074583	31074583	+	IGR	DEL	G	-	-	rs35393582		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31074583delG								CAPRIN2 (167135 upstream) : TSPAN11 (4779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	31795344	31795345	+	IGR	DEL	CT	-	-	rs141057080		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31795344_31795345delCT								DENND5B (51392 upstream) : C12orf72 (4749 downstream)																																			---	---	---	---
AMN1	196394	broad.mit.edu	37	12	31854262	31854262	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31854262delC	uc001rkq.3	-						AMN1_uc001rko.3_Intron|AMN1_uc010skc.1_Intron|AMN1_uc001rkp.3_Intron|AMN1_uc009zjs.2_Intron|AMN1_uc009zjt.1_Intron	NM_001113402	NP_001106873			antagonist of mitotic exit network 1 homolog												0	all_cancers(9;7.41e-12)|all_epithelial(9;1.18e-11)|all_lung(12;1.14e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.162)		OV - Ovarian serous cystadenocarcinoma(6;0.0014)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	32216903	32216906	+	IGR	DEL	ACAA	-	-	rs35632938	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32216903_32216906delACAA								C12orf35 (70872 upstream) : BICD1 (43279 downstream)																																			---	---	---	---
BICD1	636	broad.mit.edu	37	12	32499888	32499888	+	Intron	DEL	T	-	-	rs78275620		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32499888delT	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705			bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)															---	---	---	---
DNM1L	10059	broad.mit.edu	37	12	32855911	32855912	+	Intron	INS	-	ACTA	ACTA	rs142546982	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32855911_32855912insACTA	uc001rld.2	+						DNM1L_uc010skf.1_Intron|DNM1L_uc010skg.1_Intron|DNM1L_uc001rle.2_Intron|DNM1L_uc001rlf.2_Intron|DNM1L_uc010skh.1_Intron|DNM1L_uc001rlg.2_Intron|DNM1L_uc001rlh.2_Intron|DNM1L_uc010ski.1_Intron	NM_012062	NP_036192			dynamin 1-like isoform 1						cellular component disassembly involved in apoptosis|mitochondrial fragmentation involved in apoptosis|mitochondrial membrane organization|positive regulation of mitochondrial fission	cis-Golgi network|cytosol|endomembrane system|endoplasmic reticulum|mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)																	---	---	---	---
YARS2	51067	broad.mit.edu	37	12	32901737	32901738	+	Intron	INS	-	AAC	AAC	rs147509033	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32901737_32901738insAAC	uc001rli.2	-							NM_001040436	NP_001035526			tyrosyl-tRNA synthetase 2, mitochondrial						tyrosyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|RNA binding|tyrosine-tRNA ligase activity				0	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	33101266	33101277	+	IGR	DEL	GGTGCCTAGCAC	-	-	rs67471533		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33101266_33101277delGGTGCCTAGCAC								PKP2 (51486 upstream) : SYT10 (427071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	33662796	33662800	+	IGR	DEL	AAAAC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33662796_33662800delAAAAC								SYT10 (70042 upstream) : ALG10 (512416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	33741743	33741744	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33741743_33741744delGT								SYT10 (148989 upstream) : ALG10 (433472 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	33759469	33759470	+	IGR	INS	-	CAG	CAG	rs148432306	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33759469_33759470insCAG								SYT10 (166715 upstream) : ALG10 (415746 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	34061560	34061561	+	IGR	INS	-	TA	TA	rs148014961	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34061560_34061561insTA								SYT10 (468806 upstream) : ALG10 (113655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	34499923	34499923	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34499923delT								ALG10 (318689 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	37988648	37988649	+	IGR	INS	-	T	T	rs140557201	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:37988648_37988649insT								None (None upstream) : ALG10B (721908 downstream)																																			---	---	---	---
CPNE8	144402	broad.mit.edu	37	12	39178992	39178992	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39178992delA	uc001rls.1	-							NM_153634	NP_705898			copine VIII											pancreas(1)	1	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	39391026	39391026	+	IGR	DEL	A	-	-	rs67906277		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39391026delA								CPNE8 (91606 upstream) : KIF21A (296005 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	39907753	39907753	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39907753delA								KIF21A (70835 upstream) : ABCD2 (37269 downstream)																																			---	---	---	---
SLC2A13	114134	broad.mit.edu	37	12	40312654	40312654	+	Intron	DEL	A	-	-	rs35663368		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40312654delA	uc010skm.1	-							NM_052885	NP_443117			solute carrier family 2 (facilitated glucose							integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)													HNSCC(50;0.14)			---	---	---	---
ARID2	196528	broad.mit.edu	37	12	46240719	46240738	+	Splice_Site	DEL	TGGTAAGTGGTTTATTTCTA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46240719_46240738delTGGTAAGTGGTTTATTTCTA	uc001ros.1	+	12	1580	c.1580_splice	c.e12+1	p.W527_splice	ARID2_uc001ror.2_Splice_Site_p.W527_splice|ARID2_uc009zkg.1_Splice_Site|ARID2_uc009zkh.1_Splice_Site_p.W154_splice	NM_152641	NP_689854			AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	48338905	48338905	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48338905delC								VDR (40091 upstream) : TMEM106C (18425 downstream)																																			---	---	---	---
COL2A1	1280	broad.mit.edu	37	12	48380331	48380332	+	Intron	INS	-	G	G	rs144941834	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48380331_48380332insG	uc001rqu.2	-						COL2A1_uc009zkw.2_Intron|COL2A1_uc001rqv.2_Intron	NM_001844	NP_001835			collagen, type II, alpha 1 isoform 1 precursor						axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)													---	---	---	---
C12orf54	121273	broad.mit.edu	37	12	48883509	48883509	+	Intron	DEL	T	-	-	rs34855520		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48883509delT	uc001rrr.2	+						C12orf54_uc009zky.1_Intron	NM_152319	NP_689532			hypothetical protein LOC121273												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	48898462	48898463	+	IGR	INS	-	TG	TG	rs141384912	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48898462_48898463insTG								C12orf54 (8297 upstream) : OR8S1 (20952 downstream)																																			---	---	---	---
RND1	27289	broad.mit.edu	37	12	49262606	49262606	+	5'Flank	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49262606delT	uc001rsn.2	-							NM_014470	NP_055285			GTP-binding protein RHO6 precursor						actin filament organization|axon guidance|negative regulation of cell adhesion|neuron remodeling|small GTPase mediated signal transduction	adherens junction|cytoskeleton|cytosol	GTP binding|GTPase activity|receptor binding			ovary(1)	1																		---	---	---	---
CCDC65	85478	broad.mit.edu	37	12	49299918	49299918	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49299918delG	uc001rso.2	+							NM_033124	NP_149115			coiled-coil domain containing 65											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	49387956	49387956	+	IGR	DEL	T	-	-	rs35717336		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49387956delT								WNT1 (11561 upstream) : DDN (977 downstream)																																			---	---	---	---
C1QL4	338761	broad.mit.edu	37	12	49731547	49731550	+	5'Flank	DEL	GAGA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49731547_49731550delGAGA	uc001rtz.1	-							NM_001008223	NP_001008224			complement component 1, q subcomponent-like 4							collagen					0																OREG0021793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
LARP4	113251	broad.mit.edu	37	12	50794256	50794257	+	5'Flank	INS	-	T	T	rs144623603	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50794256_50794257insT	uc001rwp.1	+						LARP4_uc001rwo.1_5'Flank|LARP4_uc001rwq.1_5'Flank|LARP4_uc001rwr.1_5'Flank|LARP4_uc001rws.1_5'Flank|LARP4_uc001rwm.2_5'Flank|LARP4_uc001rwn.2_5'Flank	NM_052879	NP_443111			c-Mpl binding protein isoform a								nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
ATF1	466	broad.mit.edu	37	12	51166460	51166461	+	Intron	DEL	TC	-	-	rs112360014		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51166460_51166461delTC	uc001rww.3	+						ATF1_uc010smu.1_Intron	NM_005171	NP_005162			activating transcription factor 1						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway				EWSR1/ATF1(323)|FUS/ATF1(4)	soft_tissue(321)|ovary(2)|NS(2)|bone(2)|skin(2)	329								T	EWSR1|FUS	malignant melanoma of soft parts |angiomatoid fibrous histiocytoma 								---	---	---	---
ATF1	466	broad.mit.edu	37	12	51172379	51172380	+	Intron	INS	-	T	T	rs113035498		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51172379_51172380insT	uc001rww.3	+						ATF1_uc010smu.1_Intron	NM_005171	NP_005162			activating transcription factor 1						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway				EWSR1/ATF1(323)|FUS/ATF1(4)	soft_tissue(321)|ovary(2)|NS(2)|bone(2)|skin(2)	329								T	EWSR1|FUS	malignant melanoma of soft parts |angiomatoid fibrous histiocytoma 								---	---	---	---
METTL7A	25840	broad.mit.edu	37	12	51324058	51324058	+	3'UTR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51324058delT	uc001rxb.2	+	2					METTL7A_uc010smv.1_3'UTR	NM_014033	NP_054752			methyltransferase like 7A precursor							endoplasmic reticulum|lipid particle|membrane	methyltransferase activity				0																		---	---	---	---
SLC11A2	4891	broad.mit.edu	37	12	51387284	51387284	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51387284delT	uc001rxe.3	-						SLC11A2_uc001rxd.3_Intron|SLC11A2_uc001rxc.3_Intron|SLC11A2_uc001rxf.2_Intron|SLC11A2_uc001rxg.1_Intron|SLC11A2_uc010smx.1_Intron|SLC11A2_uc001rxh.1_Intron|SLC11A2_uc001rxj.1_Intron|SLC11A2_uc001rxi.2_Intron|SLC11A2_uc001rxk.1_Intron|SLC11A2_uc010smy.1_Intron	NM_000617	NP_000608			solute carrier family 11 (proton-coupled						activation of caspase activity|cellular iron ion homeostasis|cellular response to oxidative stress|detection of oxygen|ferrous iron import|multicellular organismal iron ion homeostasis|response to hypoxia|response to iron ion	apical plasma membrane|basal part of cell|cell surface|cytoplasmic vesicle|early endosome|late endosome|late endosome membrane|lysosomal membrane|lysosome|nucleus|paraferritin complex|perinuclear region of cytoplasm|perinuclear region of cytoplasm|plasma membrane|recycling endosome|trans-Golgi network	cadmium ion transmembrane transporter activity|cadmium ion transmembrane transporter activity|cobalt ion transmembrane transporter activity|copper ion transmembrane transporter activity|ferrous iron transmembrane transporter activity|ferrous iron transmembrane transporter activity|lead ion transmembrane transporter activity|lead ion transmembrane transporter activity|manganese ion transmembrane transporter activity|manganese ion transmembrane transporter activity|nickel ion transmembrane transporter activity|protein binding|solute:hydrogen symporter activity|vanadium ion transmembrane transporter activity|zinc ion transmembrane transporter activity			large_intestine(1)	1																		---	---	---	---
SMAGP	57228	broad.mit.edu	37	12	51644296	51644297	+	Intron	INS	-	G	G	rs11169783		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51644296_51644297insG	uc001ryc.1	-						SMAGP_uc001ryd.1_Intron|SMAGP_uc001rye.1_Intron|SMAGP_uc001ryf.1_Intron	NM_001033873	NP_001029045			small trans-membrane and glycosylated protein							cytoplasmic vesicle membrane|integral to membrane|plasma membrane					0																		---	---	---	---
SLC4A8	9498	broad.mit.edu	37	12	51793765	51793765	+	Intron	DEL	A	-	-	rs34506551		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51793765delA	uc001ryo.2	+						SLC4A8_uc010sni.1_Intron|SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryp.1_Intron	NM_001039960	NP_001035049			solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	52493600	52493600	+	Intron	DEL	G	-	-	rs35634130		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52493600delG	uc009zme.1	+											Homo sapiens olfactory receptor, family 7, subfamily E, member 47 pseudogene, mRNA (cDNA clone IMAGE:5590288).																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	52555711	52555712	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52555711_52555712delTG								C12orf44 (84433 upstream) : KRT80 (7069 downstream)																																			---	---	---	---
KRT81	3887	broad.mit.edu	37	12	52700831	52700832	+	5'UTR	INS	-	T	T	rs150068067	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52700831_52700832insT	uc001sac.2	-	2					KRT86_uc010snq.1_Intron|KRT86_uc009zmg.2_Intron|KRT86_uc001sad.2_Intron	NM_002281	NP_002272			keratin, hair, basic, 1							keratin filament	protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.189)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	53023189	53023189	+	IGR	DEL	C	-	-	rs35517098		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53023189delC								KRT73 (10846 upstream) : KRT2 (15154 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	53036816	53036817	+	IGR	INS	-	A	A	rs10634699		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53036816_53036817insA								KRT73 (24473 upstream) : KRT2 (1526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	53269583	53269608	+	IGR	DEL	CACACACACACACACACACACACACA	-	-	rs67455261		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53269583_53269608delCACACACACACACACACACACACACA								KRT78 (26805 upstream) : KRT8 (21363 downstream)																																			---	---	---	---
FLJ12825	440101	broad.mit.edu	37	12	54505850	54505851	+	Intron	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54505850_54505851delTT	uc001sey.2	+							NR_026655				Homo sapiens cDNA FLJ12825 fis, clone NT2RP2002800.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	55047066	55047067	+	IGR	DEL	GC	-	-	rs150811764	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55047066_55047067delGC								DCD (4917 upstream) : MUCL1 (201232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	56261536	56261536	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56261536delA								MMP19 (24801 upstream) : WIBG (33661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	57048295	57048295	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57048295delT								ATP5B (8443 upstream) : PTGES3 (8832 downstream)																																			---	---	---	---
PRIM1	5557	broad.mit.edu	37	12	57144376	57144377	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57144376_57144377insT	uc001smd.2	-						PRIM1_uc001sme.1_Intron|PRIM1_uc009zoz.1_Intron|PRIM1_uc001smf.2_Intron	NM_000946	NP_000937			DNA primase polypeptide 1						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	DNA primase activity|metal ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	58065357	58065358	+	IGR	INS	-	AAAG	AAAG	rs150140755		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58065357_58065358insAAAG								B4GALNT1 (38372 upstream) : OS9 (22528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	58919653	58919653	+	IGR	DEL	T	-	-	rs35936146		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58919653delT								XRCC6BP1 (568602 upstream) : LRIG3 (346285 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	59773785	59773785	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59773785delT								LRIG3 (459523 upstream) : SLC16A7 (216063 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	60302438	60302439	+	IGR	INS	-	AAACAAAACAAAACA	AAACAAAACAAAACA	rs149555457	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60302438_60302439insAAACAAAACAAAACA								SLC16A7 (127031 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	60647947	60647948	+	IGR	INS	-	T	T	rs148108621	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60647947_60647948insT								SLC16A7 (472540 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	61101860	61101860	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61101860delT								SLC16A7 (926453 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	61664347	61664347	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61664347delA								None (None upstream) : FAM19A2 (437696 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	61850705	61850705	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61850705delA								None (None upstream) : FAM19A2 (251338 downstream)																																			---	---	---	---
FAM19A2	338811	broad.mit.edu	37	12	62236057	62236058	+	Intron	INS	-	T	T	rs148775694	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62236057_62236058insT	uc001sqw.2	-						FAM19A2_uc001sqx.2_Intron|FAM19A2_uc001sqy.2_Intron	NM_178539	NP_848634			family with sequence similarity 19 (chemokine							cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)														---	---	---	---
PPM1H	57460	broad.mit.edu	37	12	63057773	63057773	+	Intron	DEL	A	-	-	rs140662559		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63057773delA	uc001srk.3	-							NM_020700	NP_065751			protein phosphatase 1H (PP2C domain containing)								phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	63405975	63405976	+	IGR	INS	-	G	G	rs145560054	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63405975_63405976insG								PPM1H (77060 upstream) : AVPR1A (134240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	63932036	63932036	+	IGR	DEL	A	-	-	rs11311201		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63932036delA								AVPR1A (385446 upstream) : DPY19L2 (20657 downstream)																																			---	---	---	---
SRGAP1	57522	broad.mit.edu	37	12	64453986	64453987	+	Intron	DEL	TT	-	-	rs66491269		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64453986_64453987delTT	uc010ssp.1	+						SRGAP1_uc001srt.2_Intron|SRGAP1_uc001srv.2_Intron	NM_020762	NP_065813			SLIT-ROBO Rho GTPase activating protein 1						axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	64552557	64552557	+	IGR	DEL	G	-	-	rs10878112	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64552557delG								SRGAP1 (10944 upstream) : C12orf66 (33863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	65558924	65558924	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65558924delT								WIF1 (43808 upstream) : LEMD3 (4447 downstream)																																			---	---	---	---
LEMD3	23592	broad.mit.edu	37	12	65596153	65596154	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65596153_65596154insT	uc001ssl.1	+						LEMD3_uc009zqo.1_Intron	NM_014319	NP_055134			LEM domain containing 3						negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)														---	---	---	---
MSRB3	253827	broad.mit.edu	37	12	65815032	65815032	+	Intron	DEL	A	-	-	rs36064372		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65815032delA	uc001ssn.2	+						MSRB3_uc001ssm.2_Intron|MSRB3_uc009zqp.2_Intron	NM_198080	NP_932346			methionine sulfoxide reductase B3 isoform 1						protein repair	endoplasmic reticulum|mitochondrion	peptide-methionine-(S)-S-oxide reductase activity|protein-methionine-R-oxide reductase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	66096627	66096628	+	IGR	DEL	CC	-	-	rs2358937	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66096627_66096628delCC								MSRB3 (235947 upstream) : RPSAP52 (55175 downstream)																																			---	---	---	---
HELB	92797	broad.mit.edu	37	12	66725748	66725748	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66725748delA	uc001sti.2	+						HELB_uc010ssz.1_Intron|HELB_uc009zqt.1_Intron	NM_033647	NP_387467			helicase (DNA) B						DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	68333497	68333497	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68333497delA								DYRK2 (277054 upstream) : IFNG (215053 downstream)																																			---	---	---	---
MDM1	56890	broad.mit.edu	37	12	68711189	68711190	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68711189_68711190insA	uc001stz.2	-						MDM1_uc010stc.1_Intron|MDM1_uc009zqv.1_Intron	NM_017440	NP_059136			mouse Mdm1 nuclear protein homolog isoform 1							nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	68822484	68822485	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68822484_68822485insA								MDM1 (96323 upstream) : RAP1B (182167 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	70272023	70272023	+	IGR	DEL	A	-	-	rs66499062		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70272023delA								RAB3IP (55041 upstream) : CNOT2 (364754 downstream)																																			---	---	---	---
TSPAN8	7103	broad.mit.edu	37	12	71818212	71818213	+	Intron	INS	-	T	T	rs138523376	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71818212_71818213insT	uc001swk.1	-							NM_004616	NP_004607			transmembrane 4 superfamily member 3						protein glycosylation	integral to membrane|lysosome	signal transducer activity			skin(2)|lung(1)|central_nervous_system(1)	4			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	72191587	72191588	+	IGR	INS	-	A	A	rs147903544	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72191587_72191588insA								RAB21 (10438 upstream) : TBC1D15 (41899 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	72518380	72518380	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72518380delA								TPH2 (92159 upstream) : LOC283392 (137948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	73782551	73782552	+	IGR	INS	-	AAG	AAG	rs149526170	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73782551_73782552insAAG								TRHDE (723130 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	74316771	74316771	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74316771delT								None (None upstream) : ATXN7L3B (614780 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	75230696	75230696	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75230696delG								ATXN7L3B (295473 upstream) : KCNC2 (203201 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	76114209	76114210	+	IGR	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76114209_76114210delAA								KRR1 (208791 upstream) : PHLDA1 (305018 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	76695571	76695571	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76695571delC								NAP1L1 (216833 upstream) : BBS10 (42695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77879630	77879630	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77879630delT								E2F7 (420270 upstream) : NAV3 (345439 downstream)																																			---	---	---	---
SYT1	6857	broad.mit.edu	37	12	79538016	79538016	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79538016delA	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron|SYT1_uc001syv.2_Intron	NM_001135805	NP_001129277			synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	79915230	79915230	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79915230delA								SYT1 (69443 upstream) : PAWR (70517 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	80764205	80764206	+	Intron	DEL	TT	-	-	rs150207533		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80764205_80764206delTT	uc009zsg.1	+						uc001szd.2_Intron					RecName: Full=Uncharacterized protein C12orf64;																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	82157944	82157945	+	IGR	INS	-	A	A	rs143123325	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82157944_82157945insA								PPFIA2 (4835 upstream) : CCDC59 (588145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	82513486	82513487	+	IGR	INS	-	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82513486_82513487insC								PPFIA2 (360377 upstream) : CCDC59 (232603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	83719011	83719012	+	IGR	INS	-	TA	TA	rs142040769	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83719011_83719012insTA								TMTC2 (190948 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	83902630	83902633	+	IGR	DEL	TATC	-	-	rs145397055		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83902630_83902633delTATC								TMTC2 (374567 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	84086176	84086177	+	IGR	INS	-	A	A	rs139361549	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84086176_84086177insA								TMTC2 (558113 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	85318854	85318854	+	IGR	DEL	T	-	-	rs63605963		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85318854delT								SLC6A15 (12248 upstream) : TSPAN19 (89241 downstream)																																			---	---	---	---
LRRIQ1	84125	broad.mit.edu	37	12	85529968	85529969	+	Intron	INS	-	CA	CA	rs142662115	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85529968_85529969insCA	uc001tac.2	+							NM_001079910	NP_001073379			leucine-rich repeats and IQ motif containing 1											ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	86324423	86324423	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86324423delA								NTS (47660 upstream) : MGAT4C (48616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	86347367	86347368	+	IGR	INS	-	T	T	rs142087195	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86347367_86347368insT								NTS (70604 upstream) : MGAT4C (25671 downstream)																																			---	---	---	---
MGAT4C	25834	broad.mit.edu	37	12	86589926	86589927	+	Intron	DEL	CT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86589926_86589927delCT	uc001tai.3	-						MGAT4C_uc001tal.3_Intron|MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron|MGAT4C_uc010sum.1_Intron|MGAT4C_uc001tah.3_Intron	NM_013244	NP_037376			alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3																		---	---	---	---
MGAT4C	25834	broad.mit.edu	37	12	86705258	86705259	+	Intron	INS	-	T	T	rs147840660	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86705258_86705259insT	uc001tal.3	-						MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron	NM_013244	NP_037376			alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3																		---	---	---	---
MGAT4C	25834	broad.mit.edu	37	12	86727410	86727410	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86727410delT	uc001tal.3	-						MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron	NM_013244	NP_037376			alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3																		---	---	---	---
MGAT4C	25834	broad.mit.edu	37	12	87010480	87010481	+	Intron	INS	-	T	T	rs77672597		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:87010480_87010481insT	uc001tal.3	-						MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron	NM_013244	NP_037376			alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3																		---	---	---	---
CEP290	80184	broad.mit.edu	37	12	88454342	88454342	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88454342delA	uc001tar.2	-						CEP290_uc001taq.2_Intron	NM_025114	NP_079390			centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7																		---	---	---	---
TMTC3	160418	broad.mit.edu	37	12	88538185	88538186	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88538185_88538186insT	uc001tau.2	+						CEP290_uc001tar.2_5'Flank|TMTC3_uc009zsm.2_Intron	NM_181783	NP_861448			transmembrane and tetratricopeptide repeat							integral to membrane	binding			skin(1)	1																		---	---	---	---
KITLG	4254	broad.mit.edu	37	12	88896684	88896685	+	Intron	INS	-	A	A	rs143563877	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88896684_88896685insA	uc001tav.2	-						KITLG_uc009zsn.2_Intron|KITLG_uc001taw.2_Intron	NM_000899	NP_000890			KIT ligand isoform b precursor						cell adhesion|cell proliferation|hemopoiesis|male gonad development|positive regulation of DNA replication|signal transduction	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	growth factor activity|identical protein binding|stem cell factor receptor binding			ovary(1)	1														Testicular_Cancer_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	12	89598126	89598126	+	IGR	DEL	A	-	-	rs77863415		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89598126delA								KITLG (623888 upstream) : DUSP6 (143713 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	90195418	90195419	+	IGR	INS	-	G	G	rs145073556	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90195418_90195419insG								LOC338758 (89690 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	90212994	90212994	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90212994delT								LOC338758 (107266 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	90351335	90351335	+	IGR	DEL	T	-	-	rs34926932		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90351335delT								LOC338758 (245607 upstream) : C12orf12 (994658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	91198395	91198395	+	IGR	DEL	T	-	-	rs74548277		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91198395delT								None (None upstream) : C12orf12 (147598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	91217375	91217376	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91217375_91217376insT								None (None upstream) : C12orf12 (128617 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	92753020	92753020	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92753020delG								BTG1 (213347 upstream) : CLLU1OS (60850 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	92787763	92787763	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92787763delG								BTG1 (248090 upstream) : CLLU1OS (26107 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	94037538	94037539	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94037538_94037539delAC								SOCS2 (67560 upstream) : CRADD (33612 downstream)																																			---	---	---	---
TMCC3	57458	broad.mit.edu	37	12	95047162	95047163	+	5'Flank	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95047162_95047163insA	uc001tdj.2	-							NM_020698	NP_065749			transmembrane and coiled-coil domain family 3							integral to membrane				ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	95156972	95156973	+	IGR	INS	-	CT	CT	rs146200860	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95156972_95156973insCT								TMCC3 (112648 upstream) : MIR492 (71201 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	95811945	95811948	+	IGR	DEL	AAAC	-	-	rs71893289		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95811945_95811948delAAAC								MIR331 (109656 upstream) : METAP2 (55874 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	96004037	96004038	+	IGR	INS	-	A	A	rs148320859		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96004037_96004038insA								USP44 (58774 upstream) : NTN4 (47546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	96219679	96219679	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96219679delA								NTN4 (34749 upstream) : SNRPF (33030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	97493244	97493244	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97493244delA								NEDD1 (145783 upstream) : RMST (365555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98867019	98867019	+	IGR	DEL	A	-	-	rs139071968		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98867019delA								RMST (908226 upstream) : LOC100128191 (39734 downstream)																																			---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	99461657	99461658	+	Intron	DEL	TG	-	-	rs142348428		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99461657_99461658delTG	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc001tgk.2_Intron|ANKS1B_uc001tgd.1_Intron|ANKS1B_uc001tgi.2_Intron|ANKS1B_uc009ztr.2_Intron|ANKS1B_uc001tgj.2_Intron|ANKS1B_uc001tgg.3_Intron|ANKS1B_uc010svg.1_Intron|ANKS1B_uc009zts.1_Intron|ANKS1B_uc001tgm.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
ANO4	121601	broad.mit.edu	37	12	101354381	101354381	+	Intron	DEL	A	-	-	rs113871862		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101354381delA	uc010svm.1	+						ANO4_uc010svl.1_Intron|ANO4_uc001thw.2_Intron|ANO4_uc001thx.2_Intron	NM_178826	NP_849148			anoctamin 4							chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6															HNSCC(74;0.22)			---	---	---	---
Unknown	0	broad.mit.edu	37	12	101913547	101913547	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101913547delT								SPIC (32773 upstream) : MYBPC1 (75200 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	102712173	102712174	+	IGR	INS	-	TG	TG	rs148545411	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102712173_102712174insTG								PMCH (120559 upstream) : IGF1 (77471 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	103345562	103345562	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103345562delC								PAH (34181 upstream) : ASCL1 (5890 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	103543361	103543361	+	IGR	DEL	C	-	-	rs142315067		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103543361delC								ASCL1 (189074 upstream) : C12orf42 (88009 downstream)																																			---	---	---	---
C12orf42	374470	broad.mit.edu	37	12	103809812	103809813	+	Intron	INS	-	TT	TT	rs3065787		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103809812_103809813insTT	uc001tjt.2	-						C12orf42_uc001tjs.2_Intron|C12orf42_uc009zuf.1_Intron|C12orf42_uc001tju.2_Intron	NM_198521	NP_940923			hypothetical protein LOC374470											ovary(1)|central_nervous_system(1)	2																		---	---	---	---
C12orf42	374470	broad.mit.edu	37	12	103887500	103887500	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103887500delC	uc001tjt.2	-						C12orf42_uc001tjs.2_Intron|C12orf42_uc009zuf.1_Intron|C12orf42_uc001tju.2_Intron	NM_198521	NP_940923			hypothetical protein LOC374470											ovary(1)|central_nervous_system(1)	2																		---	---	---	---
LOC253724	253724	broad.mit.edu	37	12	104300971	104300973	+	Intron	DEL	AAG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104300971_104300973delAAG	uc010swf.1	-							NR_027249				Homo sapiens cDNA FLJ56788 complete cds, moderately similar to Mus musculus 5'-nucleotidase domain containing 3 (Nt5dc3), transcript variant 2, mRNA.												0																		---	---	---	---
CHST11	50515	broad.mit.edu	37	12	104940135	104940136	+	Intron	DEL	AC	-	-	rs150946821		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104940135_104940136delAC	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883			carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0																		---	---	---	---
CHST11	50515	broad.mit.edu	37	12	105021556	105021557	+	Intron	INS	-	GAT	GAT	rs145998746	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105021556_105021557insGAT	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883			carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	105393455	105393456	+	IGR	INS	-	C	C	rs151065486	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105393455_105393456insC								C12orf45 (4951 upstream) : ALDH1L2 (20108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	105855493	105855494	+	IGR	INS	-	T	T	rs111932875		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105855493_105855494insT								C12orf75 (90198 upstream) : NUAK1 (601631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	106261836	106261836	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106261836delA								C12orf75 (496541 upstream) : NUAK1 (195289 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	106574777	106574778	+	IGR	INS	-	TT	TT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106574777_106574778insTT								NUAK1 (40966 upstream) : CKAP4 (56882 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	108206154	108206154	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108206154delA								ASCL4 (35734 upstream) : WSCD2 (317357 downstream)																																			---	---	---	---
ACACB	32	broad.mit.edu	37	12	109565226	109565227	+	Intron	INS	-	A	A	rs35642033		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109565226_109565227insA	uc001tob.2	+							NM_001093	NP_001084			acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	110099308	110099311	+	IGR	DEL	ATTA	-	-	rs146364635		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110099308_110099311delATTA								MVK (64238 upstream) : C12orf34 (52879 downstream)																																			---	---	---	---
MGC14436	84983	broad.mit.edu	37	12	110213572	110213572	+	5'Flank	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110213572delA	uc010sxs.1	-						MGC14436_uc001tpe.2_5'Flank	NR_026661				Homo sapiens hypothetical LOC84983, mRNA (cDNA clone IMAGE:4303416).												0																OREG0022109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	12	110849025	110849026	+	IGR	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110849025_110849026delTT								ANAPC7 (7490 upstream) : ARPC3 (23681 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	111186951	111186951	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111186951delT								PPP1CC (6194 upstream) : CCDC63 (97860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	111243761	111243764	+	IGR	DEL	TTTC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111243761_111243764delTTTC								PPP1CC (63004 upstream) : CCDC63 (41047 downstream)																																			---	---	---	---
CUX2	23316	broad.mit.edu	37	12	111667089	111667089	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111667089delT	uc001tsa.1	+						CUX2_uc001tsb.1_Intron	NM_015267	NP_056082			cut-like 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6																		---	---	---	---
NAA25	80018	broad.mit.edu	37	12	112529507	112529508	+	Intron	INS	-	A	A	rs78263591		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112529507_112529508insA	uc001ttm.2	-						NAA25_uc001ttn.3_Intron|NAA25_uc009zvz.1_Intron|NAA25_uc009zwa.1_Intron	NM_024953	NP_079229			mitochondrial distribution and morphology 20							cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3																		---	---	---	---
SDS	10993	broad.mit.edu	37	12	113842382	113842382	+	5'Flank	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113842382delG	uc001tvg.2	-						SDS_uc001tvh.1_5'Flank	NM_006843	NP_006834			serine dehydratase						gluconeogenesis|L-serine catabolic process|pyruvate biosynthetic process	cytoplasm	L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|protein homodimerization activity|pyridoxal phosphate binding			pancreas(1)	1					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	114226038	114226041	+	IGR	DEL	AGAG	-	-	rs71443060		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114226038_114226041delAGAG								LHX5 (316161 upstream) : RBM19 (28502 downstream)																																			---	---	---	---
RBM19	9904	broad.mit.edu	37	12	114278551	114278551	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114278551delG	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171			RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)																	---	---	---	---
RBM19	9904	broad.mit.edu	37	12	114304117	114304117	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114304117delA	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171			RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	114876624	114876624	+	IGR	DEL	A	-	-	rs5801056		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114876624delA								TBX5 (30377 upstream) : TBX3 (231435 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	116818614	116818615	+	IGR	DEL	AG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116818614_116818615delAG								MED13L (103623 upstream) : NCRNA00173 (152612 downstream)																																			---	---	---	---
RNFT2	84900	broad.mit.edu	37	12	117256125	117256126	+	Intron	INS	-	A	A	rs11380244		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117256125_117256126insA	uc009zwn.2	+						RNFT2_uc001twb.3_Intron|RNFT2_uc001twa.3_Intron|RNFT2_uc001twc.3_Intron	NM_001109903	NP_001103373			transmembrane protein 118 isoform 1							integral to membrane	zinc ion binding				0	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)														---	---	---	---
FBXW8	26259	broad.mit.edu	37	12	117375658	117375659	+	Intron	INS	-	T	T	rs113196889		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117375658_117375659insT	uc001twg.1	+						FBXW8_uc001twf.1_Intron|FBXW8_uc009zwp.1_Intron	NM_153348	NP_699179			F-box and WD repeat domain containing 8 isoform								protein binding			ovary(2)|pancreas(1)	3	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)														---	---	---	---
FBXW8	26259	broad.mit.edu	37	12	117387987	117387988	+	Intron	INS	-	T	T	rs75764851		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117387987_117387988insT	uc001twg.1	+						FBXW8_uc001twf.1_Intron|FBXW8_uc009zwp.1_Intron	NM_153348	NP_699179			F-box and WD repeat domain containing 8 isoform								protein binding			ovary(2)|pancreas(1)	3	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)														---	---	---	---
TESC	54997	broad.mit.edu	37	12	117496551	117496552	+	Intron	DEL	AA	-	-	rs112596604		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117496551_117496552delAA	uc001twh.2	-						TESC_uc001twi.2_Intron	NM_017899	NP_060369			tescalcin						negative regulation of cell proliferation|positive regulation of megakaryocyte differentiation|positive regulation of transcription, DNA-dependent|regulation of cell adhesion mediated by integrin	cytoplasm|lamellipodium|nucleus|plasma membrane|ruffle	calcium ion binding|magnesium ion binding|phosphatase inhibitor activity|protein binding				0	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0297)														---	---	---	---
NOS1	4842	broad.mit.edu	37	12	117713080	117713081	+	Intron	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117713080_117713081delTC	uc001twm.1	-							NM_000620	NP_000611			nitric oxide synthase 1, neuronal						multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)													---	---	---	---
KSR2	283455	broad.mit.edu	37	12	118201133	118201133	+	Intron	DEL	A	-	-	rs34345104		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118201133delA	uc001two.2	-							NM_173598	NP_775869			kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
TAOK3	51347	broad.mit.edu	37	12	118615304	118615305	+	Intron	INS	-	AA	AA			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118615304_118615305insAA	uc001twx.2	-						TAOK3_uc001twv.2_Intron|TAOK3_uc001tww.2_Intron|TAOK3_uc001twy.3_Intron	NM_016281	NP_057365			TAO kinase 3						MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
TAOK3	51347	broad.mit.edu	37	12	118811038	118811038	+	5'Flank	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118811038delC	uc001twy.3	-							NM_016281	NP_057365			TAO kinase 3						MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	119746579	119746580	+	IGR	DEL	TT	-	-	rs67796287		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119746579_119746580delTT								LOC144742 (5394 upstream) : CCDC60 (25937 downstream)																																			---	---	---	---
CCDC60	160777	broad.mit.edu	37	12	119957207	119957208	+	Intron	DEL	TG	-	-	rs66854208		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119957207_119957208delTG	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594			coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)														---	---	---	---
SPPL3	121665	broad.mit.edu	37	12	121259794	121259795	+	Intron	INS	-	A	A	rs150267855	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121259794_121259795insA	uc001tzd.2	-						SPPL3_uc009zwz.2_Intron	NM_139015	NP_620584			signal peptide peptidase 3							integral to membrane	aspartic-type endopeptidase activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	121557090	121557093	+	IGR	DEL	AGAA	-	-	rs67421306		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121557090_121557093delAGAA								OASL (80310 upstream) : P2RX7 (13585 downstream)																																			---	---	---	---
KDM2B	84678	broad.mit.edu	37	12	121900820	121900821	+	Intron	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121900820_121900821delAA	uc001uat.2	-						KDM2B_uc001uaq.2_Intron|KDM2B_uc010szy.1_Intron|KDM2B_uc001uar.2_Intron|KDM2B_uc001uas.2_Intron|KDM2B_uc001uau.2_Intron	NM_032590	NP_115979			F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	122088737	122088737	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122088737delA								ORAI1 (8791 upstream) : MORN3 (557 downstream)																																			---	---	---	---
MORN3	283385	broad.mit.edu	37	12	122104088	122104089	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122104088_122104089insT	uc001uax.2	-						MORN3_uc001uay.2_Intron	NM_173855	NP_776254			MORN repeat containing 3												0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000409)|Epithelial(86;0.00145)														---	---	---	---
KNTC1	9735	broad.mit.edu	37	12	123011834	123011834	+	5'UTR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123011834delG	uc001ucv.2	+	1					KNTC1_uc010taf.1_5'UTR|RSRC2_uc001ucp.2_5'Flank|RSRC2_uc001ucr.2_5'Flank|RSRC2_uc001ucq.2_5'Flank|RSRC2_uc001ucs.2_5'Flank|RSRC2_uc001uct.2_5'Flank|RSRC2_uc001ucu.2_5'Flank	NM_014708	NP_055523			Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)														---	---	---	---
PITPNM2	57605	broad.mit.edu	37	12	123533684	123533685	+	Intron	INS	-	AC	AC	rs139630021	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123533684_123533685insAC	uc001uej.1	-						PITPNM2_uc001uek.1_Intron|PITPNM2_uc009zxu.1_Intron	NM_020845	NP_065896			phosphatidylinositol transfer protein,						metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)														---	---	---	---
MPHOSPH9	10198	broad.mit.edu	37	12	123654530	123654530	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123654530delT	uc001uel.2	-						MPHOSPH9_uc010tal.1_Intron|MPHOSPH9_uc010tam.1_Intron|MPHOSPH9_uc001uem.2_Intron	NM_022782	NP_073619			M-phase phosphoprotein 9						M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)														---	---	---	---
MPHOSPH9	10198	broad.mit.edu	37	12	123682631	123682631	+	Intron	DEL	A	-	-	rs72059632		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123682631delA	uc001uel.2	-						MPHOSPH9_uc010tal.1_Intron|MPHOSPH9_uc010tam.1_Intron|MPHOSPH9_uc001uem.2_Intron	NM_022782	NP_073619			M-phase phosphoprotein 9						M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	123775289	123775290	+	IGR	INS	-	T	T	rs112885602		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123775289_123775290insT								CDK2AP1 (18602 upstream) : SBNO1 (5166 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	124054642	124054642	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124054642delA								RILPL1 (36377 upstream) : TMED2 (14434 downstream)																																			---	---	---	---
ZNF664	144348	broad.mit.edu	37	12	124487946	124487946	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124487946delT	uc001ufz.2	+						ZNF664_uc001uga.2_Intron|ZNF664_uc001ugb.2_Intron	NM_152437	NP_689650			zinc finger protein 664						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.000239)|OV - Ovarian serous cystadenocarcinoma(86;0.000247)|all cancers(50;0.00155)|BRCA - Breast invasive adenocarcinoma(302;0.249)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	124761015	124761018	+	IGR	DEL	ATAG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124761015_124761018delATAG								ZNF664 (261048 upstream) : FAM101A (12692 downstream)																																			---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	124811840	124811840	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124811840delA	uc010tay.1	-						NCOR2_uc010taz.1_Intron|NCOR2_uc010tax.1_Intron	NM_006312	NP_006303			nuclear receptor co-repressor 2 isoform 1						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	124936495	124936496	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124936495_124936496insT	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron	NM_001077261	NP_001070729			nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	125423964	125423964	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125423964delT								UBC (24387 upstream) : DHX37 (7409 downstream)																																			---	---	---	---
DHX37	57647	broad.mit.edu	37	12	125471256	125471257	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125471256_125471257insA	uc001ugy.2	-							NM_032656	NP_116045			DEAH (Asp-Glu-Ala-His) box polypeptide 37								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	125527026	125527026	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125527026delT								BRI3BP (16677 upstream) : AACS (22899 downstream)																																			---	---	---	---
TMEM132B	114795	broad.mit.edu	37	12	125928479	125928480	+	Intron	INS	-	T	T	rs75716200		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125928479_125928480insT	uc001uhe.1	+							NM_052907	NP_443139			transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	126227595	126227596	+	IGR	INS	-	T	T	rs151028890		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126227595_126227596insT								TMEM132B (84006 upstream) : LOC100128554 (699431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	126243640	126243641	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126243640_126243641delTG								TMEM132B (100051 upstream) : LOC100128554 (683386 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	126433390	126433390	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126433390delC								TMEM132B (289801 upstream) : LOC100128554 (493637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	126841766	126841767	+	IGR	DEL	CA	-	-	rs111960350		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126841766_126841767delCA								TMEM132B (698177 upstream) : LOC100128554 (85260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	127003420	127003421	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127003420_127003421delAC								LOC100128554 (46090 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	127261079	127261079	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127261079delT								LOC100128554 (303749 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	127941706	127941706	+	IGR	DEL	T	-	-	rs35512182		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127941706delT								LOC100128554 (984376 upstream) : TMEM132C (957585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	127997344	127997344	+	IGR	DEL	A	-	-	rs146255241		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127997344delA								None (None upstream) : TMEM132C (901947 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	128866586	128866586	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128866586delT								None (None upstream) : TMEM132C (32705 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	128880444	128880445	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128880444_128880445insA								None (None upstream) : TMEM132C (18846 downstream)																																			---	---	---	---
GLT1D1	144423	broad.mit.edu	37	12	129406708	129406709	+	Intron	DEL	TG	-	-	rs35378796		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129406708_129406709delTG	uc010tbh.1	+						GLT1D1_uc001uhx.1_Intron|GLT1D1_uc001uhy.1_Intron	NM_144669	NP_653270			glycosyltransferase 1 domain containing 1						biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	130497958	130497959	+	IGR	INS	-	T	T	rs144311756	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130497958_130497959insT								TMEM132D (109746 upstream) : LOC100190940 (20040 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	130666829	130666832	+	IGR	DEL	CTCT	-	-	rs149543617		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130666829_130666832delCTCT								FZD10 (16545 upstream) : PIWIL1 (155782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	131890428	131890428	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131890428delC								LOC116437 (192953 upstream) : SFRS8 (305207 downstream)																																			---	---	---	---
GALNT9	50614	broad.mit.edu	37	12	132811499	132811499	+	Intron	DEL	C	-	-	rs77799724		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132811499delC	uc001ukc.3	-						GALNT9_uc009zyr.2_Frame_Shift_Del_p.R86fs|GALNT9_uc001ukb.2_Intron	NM_001122636	NP_001116108			UDP-N-acetyl-alpha-D-galactosamine:polypeptide						protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	133040630	133040632	+	IGR	DEL	CAT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133040630_133040632delCAT								GALNT9 (134725 upstream) : FBRSL1 (26525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	133047524	133047525	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133047524_133047525delAC								GALNT9 (141619 upstream) : FBRSL1 (19632 downstream)																																			---	---	---	---
FBRSL1	57666	broad.mit.edu	37	12	133153200	133153201	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133153200_133153201insT	uc001ukf.2	+							NM_001142641	NP_001136113			fibrosin-like 1											central_nervous_system(2)	2																		---	---	---	---
GOLGA3	2802	broad.mit.edu	37	12	133371223	133371224	+	Intron	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133371223_133371224delAA	uc001ukz.1	-						GOLGA3_uc001ula.1_Intron|GOLGA3_uc001ulb.2_Intron	NM_005895	NP_005886			Golgi autoantigen, golgin subfamily a, 3						intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)														---	---	---	---
GOLGA3	2802	broad.mit.edu	37	12	133386825	133386825	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133386825delC	uc001ukz.1	-						GOLGA3_uc001ula.1_Intron|GOLGA3_uc001ulb.2_Intron	NM_005895	NP_005886			Golgi autoantigen, golgin subfamily a, 3						intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	19369591	19369592	+	IGR	DEL	TA	-	-	rs148221753	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19369591_19369592delTA								None (None upstream) : LOC284232 (38951 downstream)																																			---	---	---	---
DKFZp686A1627	266695	broad.mit.edu	37	13	19641870	19641871	+	Intron	INS	-	AC	AC	rs140275803	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19641870_19641871insAC	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	19773149	19773151	+	IGR	DEL	AGA	-	-	rs138525012		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19773149_19773151delAGA								TUBA3C (17213 upstream) : LOC100101938 (63790 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	19976036	19976036	+	IGR	DEL	A	-	-	rs76853083		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19976036delA								LOC100101938 (56923 upstream) : TPTE2 (20985 downstream)																																			---	---	---	---
TPTE2	93492	broad.mit.edu	37	13	20119075	20119082	+	Intron	DEL	CACACACA	-	-	rs71198915		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20119075_20119082delCACACACA	uc010tcm.1	-											Homo sapiens mRNA for TPIP alpha lipid phosphatase (TPIP gene).							endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)														---	---	---	---
EFHA1	221154	broad.mit.edu	37	13	22099733	22099733	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22099733delT	uc001uof.2	-							NM_152726	NP_689939			EF-hand domain family, member A1								calcium ion binding				0		all_cancers(29;1.24e-15)|all_epithelial(30;5.4e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000171)|Epithelial(112;0.000398)|OV - Ovarian serous cystadenocarcinoma(117;0.00641)|Lung(94;0.189)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	22390701	22390701	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22390701delG								FGF9 (112061 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22620063	22620064	+	Intron	INS	-	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22620063_22620064insC	uc001uoi.2	+											Homo sapiens cDNA FLJ30283 fis, clone BRACE2002807.																														---	---	---	---
SPATA13	221178	broad.mit.edu	37	13	24655966	24655966	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24655966delC	uc001upd.1	+						C1QTNF9_uc001upe.2_Intron	NM_153023	NP_694568			spermatogenesis associated 13						cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	26631416	26631416	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26631416delG								SHISA2 (6218 upstream) : RNF6 (74837 downstream)																																			---	---	---	---
RNF6	6049	broad.mit.edu	37	13	26781054	26781054	+	Intron	DEL	A	-	-	rs71188716		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26781054delA	uc001uqn.1	-											SubName: Full=RNF6 protein;						negative regulation of axon extension|positive regulation of transcription, DNA-dependent|protein K27-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|regulation of androgen receptor signaling pathway|ubiquitin-dependent protein catabolic process	axon|cytoplasm|PML body	androgen receptor binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)														---	---	---	---
WASF3	10810	broad.mit.edu	37	13	27202191	27202204	+	Intron	DEL	GGAAATGTGTTTCA	-	-	rs11273643		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27202191_27202204delGGAAATGTGTTTCA	uc001uqv.2	+						WASF3_uc001uqw.2_Intron	NM_006646	NP_006637			WAS protein family, member 3						actin filament polymerization	cytoplasm|cytoskeleton	actin binding			pancreas(1)	1	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)														---	---	---	---
USP12	219333	broad.mit.edu	37	13	27671304	27671304	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27671304delA	uc001uqy.2	-							NM_182488	NP_872294			ubiquitin thiolesterase 12						protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)	1		Lung SC(185;0.0161)		all cancers(112;0.0508)|GBM - Glioblastoma multiforme(144;0.168)|Epithelial(112;0.244)|OV - Ovarian serous cystadenocarcinoma(117;0.246)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	27880467	27880468	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27880467_27880468delGT								RASL11A (32640 upstream) : GTF3A (118213 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	30255760	30255760	+	IGR	DEL	A	-	-	rs35880937		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30255760delA								SLC7A1 (85935 upstream) : UBL3 (82786 downstream)																																			---	---	---	---
KATNAL1	84056	broad.mit.edu	37	13	30777305	30777305	+	3'UTR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30777305delA	uc001uss.2	-	11					KATNAL1_uc001ust.2_3'UTR	NM_001014380	NP_001014402			katanin p60 subunit A-like 1							cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity				0		Lung SC(185;0.0257)		all cancers(112;0.114)|OV - Ovarian serous cystadenocarcinoma(117;0.213)														---	---	---	---
KATNAL1	84056	broad.mit.edu	37	13	30779770	30779775	+	3'UTR	DEL	TGTGAG	-	-	rs113722190		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30779770_30779775delTGTGAG	uc001uss.2	-	11					KATNAL1_uc001ust.2_3'UTR	NM_001014380	NP_001014402			katanin p60 subunit A-like 1							cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity				0		Lung SC(185;0.0257)		all cancers(112;0.114)|OV - Ovarian serous cystadenocarcinoma(117;0.213)														---	---	---	---
HMGB1	3146	broad.mit.edu	37	13	31092849	31092849	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31092849delT	uc001usz.2	-							NM_002128	NP_002119			high-mobility group box 1						base-excision repair, DNA ligation|dendritic cell chemotaxis|DNA fragmentation involved in apoptotic nuclear change|DNA topological change|inflammatory response to antigenic stimulus|innate immune response|myeloid dendritic cell activation|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|neuron projection development|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|V(D)J recombination	cell surface|condensed chromosome|extracellular space|nucleolus|nucleoplasm	chemoattractant activity|cytokine activity|damaged DNA binding|DNA bending activity|double-stranded DNA binding|RAGE receptor binding|repressing transcription factor binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(1)	1		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	31379214	31379215	+	IGR	INS	-	AT	AT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31379214_31379215insAT								ALOX5AP (40658 upstream) : C13orf33 (101097 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	31643847	31643847	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31643847delC								C13orf26 (94696 upstream) : HSPH1 (66918 downstream)																																			---	---	---	---
RXFP2	122042	broad.mit.edu	37	13	32373356	32373357	+	Intron	INS	-	A	A	rs66998436		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32373356_32373357insA	uc001utt.2	+						RXFP2_uc010aba.2_Intron	NM_130806	NP_570718			relaxin/insulin-like family peptide receptor 2							integral to membrane|plasma membrane					0		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)														---	---	---	---
PDS5B	23047	broad.mit.edu	37	13	33315050	33315050	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33315050delT	uc010abf.2	+						PDS5B_uc010abg.2_Intron	NM_015032	NP_055847			PDS5, regulator of cohesion maintenance, homolog						cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	33533918	33533921	+	IGR	DEL	GTGT	-	-	rs10544865		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33533918_33533921delGTGT								PDS5B (181763 upstream) : KL (56280 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	33671499	33671499	+	IGR	DEL	T	-	-	rs35167401		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33671499delT								KL (31218 upstream) : STARD13 (5774 downstream)																																			---	---	---	---
STARD13	90627	broad.mit.edu	37	13	34139126	34139126	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34139126delA	uc001uux.2	-							NM_052851	NP_443083			StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)														---	---	---	---
RFC3	5983	broad.mit.edu	37	13	34491631	34491631	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34491631delT	uc001uva.2	+							NM_181558	NP_853536			replication factor C 3 isoform 2						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|response to organophosphorus|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding				0		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	35135688	35135688	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35135688delC								RFC3 (594994 upstream) : NBEA (380768 downstream)																																			---	---	---	---
NBEA	26960	broad.mit.edu	37	13	36205130	36205130	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36205130delC	uc001uvb.2	+						NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_Intron|NBEA_uc001uvd.2_Intron	NM_015678	NP_056493			neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)												OREG0022362	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36346387	36346387	+	3'UTR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36346387delC	uc001uvf.2	-	18					DCLK1_uc001uve.3_3'UTR|DCLK1_uc010teh.1_3'UTR|DCLK1_uc010abk.2_3'UTR	NM_004734	NP_004725			doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36348007	36348007	+	3'UTR	DEL	C	-	-	rs3833804		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36348007delC	uc001uvf.2	-	18					DCLK1_uc001uve.3_3'UTR|DCLK1_uc010teh.1_3'UTR|DCLK1_uc010abk.2_3'UTR	NM_004734	NP_004725			doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	37136817	37136817	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37136817delC								CCNA1 (119799 upstream) : C13orf36 (111232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	37772926	37772926	+	IGR	DEL	C	-	-	rs77113729		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37772926delC								CSNK1A1L (93125 upstream) : POSTN (363794 downstream)																																			---	---	---	---
KIAA0564	23078	broad.mit.edu	37	13	42425815	42425815	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42425815delT	uc001uyj.2	-						KIAA0564_uc001uyk.2_Intron	NM_015058	NP_055873			hypothetical protein LOC23078 isoform a							extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)														---	---	---	---
DGKH	160851	broad.mit.edu	37	13	42675908	42675909	+	Intron	INS	-	GA	GA	rs139902625	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42675908_42675909insGA	uc001uyl.1	+						DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron	NM_178009	NP_821077			diacylglycerol kinase, eta isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)														---	---	---	---
ENOX1	55068	broad.mit.edu	37	13	44237033	44237033	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44237033delC	uc001uzb.3	-						ENOX1_uc001uzc.3_Intron	NM_017993	NP_060463			ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	45656810	45656811	+	IGR	INS	-	G	G	rs142752178	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45656810_45656811insG								KIAA1704 (49068 upstream) : GTF2F2 (37820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	46525458	46525459	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46525458_46525459insA								SIAH3 (99612 upstream) : ZC3H13 (4346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	46528308	46528309	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46528308_46528309insA								SIAH3 (102462 upstream) : ZC3H13 (1496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	48325957	48325958	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48325957_48325958delTC								HTR2A (854907 upstream) : SUCLA2 (190834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	50435949	50435949	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50435949delA								KPNA3 (68892 upstream) : LOC220429 (28596 downstream)																																			---	---	---	---
TRIM13	10206	broad.mit.edu	37	13	50581624	50581625	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50581624_50581625insA	uc001vdq.1	+						DLEU2_uc001vdn.1_Intron|DLEU2_uc001vdo.1_Intron|TRIM13_uc001vdp.1_Intron|TRIM13_uc001vdr.1_Intron|TRIM13_uc001vds.1_Intron	NM_052811	NP_434698			ret finger protein 2 isoform 1						anatomical structure morphogenesis|ER-associated protein catabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination	cytoplasm|endoplasmic reticulum membrane|integral to membrane	protein binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)														---	---	---	---
DLEU1	10301	broad.mit.edu	37	13	50737457	50737458	+	Intron	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50737457_50737458delTT	uc010adl.1	+						DLEU1_uc001vee.1_Intron|DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0																		---	---	---	---
DLEU1	10301	broad.mit.edu	37	13	51001134	51001134	+	Intron	DEL	A	-	-	rs34939030		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51001134delA	uc001vee.1	+						DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron|uc001vel.1_Intron|uc001vem.1_Intron|uc001veq.1_Intron|uc001ver.2_Intron|uc001ves.1_Intron|uc001vet.1_Intron|uc001veu.2_Intron|uc001vev.2_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0																		---	---	---	---
DLEU1	10301	broad.mit.edu	37	13	51017971	51017971	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51017971delT	uc001vee.1	+						DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron|uc001vel.1_Intron|uc001vem.1_Intron|uc001veq.1_Intron|uc001ver.2_Intron|uc001ves.1_Intron|uc001vet.1_Intron|uc001veu.2_Intron|uc001vev.2_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0																		---	---	---	---
NEK3	4752	broad.mit.edu	37	13	52717452	52717453	+	Intron	INS	-	A	A	rs67547527		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52717452_52717453insA	uc001vgi.2	-						NEK3_uc001vgg.2_Intron|NEK3_uc001vgh.2_Intron|NEK3_uc010tgx.1_Intron|NEK3_uc010tgy.1_Intron	NM_152720	NP_689933			NIMA-related kinase 3 isoform a						cell division|mitosis	nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)														---	---	---	---
LECT1	11061	broad.mit.edu	37	13	53309505	53309505	+	Intron	DEL	T	-	-	rs34830171		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53309505delT	uc001vhf.2	-						LECT1_uc001vhg.2_Intron|LECT1_uc001vhh.2_Intron	NM_007015	NP_008946			leukocyte cell derived chemotaxin 1 isoform 1						cartilage development|proteoglycan metabolic process	endomembrane system|extracellular region|integral to membrane				ovary(2)	2		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.38e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	53773957	53773957	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53773957delG								OLFM4 (147771 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	55042005	55042005	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55042005delC								MIR1297 (155822 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	55732885	55732887	+	IGR	DEL	ATA	-	-	rs34265114		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55732885_55732887delATA								MIR1297 (846702 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	55889226	55889226	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55889226delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59452669	59452669	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59452669delT								None (None upstream) : DIAPH3 (787056 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	61896409	61896409	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61896409delT								TDRD3 (748397 upstream) : PCDH20 (87412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63621717	63621718	+	IGR	INS	-	G	G	rs111276312		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63621717_63621718insG								None (None upstream) : OR7E156P (689850 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	64610541	64610541	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64610541delT	uc001vii.1	-						uc001vij.1_5'Flank					Homo sapiens cDNA FLJ32909 fis, clone TESTI2006007.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	68033308	68033309	+	IGR	INS	-	T	T	rs35550639		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:68033308_68033309insT								PCDH9 (228840 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	68034591	68034592	+	IGR	INS	-	A	A	rs71211568		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:68034591_68034592insA								PCDH9 (230123 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	68146187	68146188	+	IGR	INS	-	CA	CA	rs147183085	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:68146187_68146188insCA								PCDH9 (341719 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	71013872	71013873	+	IGR	DEL	CT	-	-	rs11842233		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:71013872_71013873delCT								ATXN8OS (299987 upstream) : DACH1 (998225 downstream)																																			---	---	---	---
PIBF1	10464	broad.mit.edu	37	13	73498551	73498551	+	Intron	DEL	A	-	-	rs35898890		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73498551delA	uc001vjc.2	+						PIBF1_uc001vjb.2_Intron|PIBF1_uc010aep.2_Intron	NM_006346	NP_006337			progesterone-induced blocking factor 1							centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)														---	---	---	---
KLF12	11278	broad.mit.edu	37	13	74654422	74654423	+	Intron	INS	-	T	T	rs148662238	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74654422_74654423insT	uc001vjf.2	-						KLF12_uc010aeq.2_Intron|KLF12_uc001vjg.3_Intron	NM_007249	NP_009180			Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	75054134	75054134	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75054134delA								KLF12 (345740 upstream) : LOC647288 (757756 downstream)																																			---	---	---	---
LMO7	4008	broad.mit.edu	37	13	76266531	76266532	+	Intron	INS	-	T	T	rs35029342		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76266531_76266532insT	uc010thv.1	+						LMO7_uc001vjt.1_Intron	NM_005358	NP_005349			LIM domain only 7 isoform 1							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)														---	---	---	---
RNF219	79596	broad.mit.edu	37	13	79221961	79221962	+	Intron	INS	-	CT	CT	rs142603596	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79221961_79221962insCT	uc001vkw.1	-						RNF219_uc010afb.1_Intron|RNF219_uc010afc.2_Intron	NM_024546	NP_078822			ring finger protein 219								zinc ion binding			large_intestine(2)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)														---	---	---	---
RBM26	64062	broad.mit.edu	37	13	79963355	79963355	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79963355delT	uc001vkz.2	-						RBM26_uc001vky.2_Intron|RBM26_uc001vla.2_Intron|RBM26_uc001vlc.1_Intron	NM_022118	NP_071401			RNA binding motif protein 26						mRNA processing		nucleotide binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	82265214	82265214	+	IGR	DEL	A	-	-	rs34280872		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82265214delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	82825203	82825204	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82825203_82825204delCA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	83001942	83001945	+	IGR	DEL	AAAC	-	-	rs68092667		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83001942_83001945delAAAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	84051353	84051360	+	IGR	DEL	GAAAGAAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84051353_84051360delGAAAGAAA								None (None upstream) : SLITRK1 (399984 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	84890531	84890532	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84890531_84890532delAC								SLITRK1 (434003 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	84995611	84995612	+	IGR	INS	-	AG	AG	rs147459133	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84995611_84995612insAG								SLITRK1 (539083 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	86322589	86322590	+	IGR	INS	-	T	T	rs142827968	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86322589_86322590insT								None (None upstream) : SLITRK6 (44332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	91709896	91709897	+	IGR	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91709896_91709897delAA								LOC144776 (131045 upstream) : MIR17HG (290177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	91755863	91755864	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91755863_91755864insA								LOC144776 (177012 upstream) : MIR17HG (244210 downstream)																																			---	---	---	---
GPC5	2262	broad.mit.edu	37	13	92602521	92602521	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92602521delT	uc010tif.1	+							NM_004466	NP_004457			glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
GPC6	10082	broad.mit.edu	37	13	93947753	93947754	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93947753_93947754delTG	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
ABCC4	10257	broad.mit.edu	37	13	95783881	95783881	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95783881delA	uc001vmd.3	-						ABCC4_uc010afk.2_Intron|ABCC4_uc001vme.2_Intron|ABCC4_uc010tih.1_Intron	NM_005845	NP_005836			ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)													---	---	---	---
HS6ST3	266722	broad.mit.edu	37	13	96781109	96781109	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96781109delT	uc001vmw.2	+							NM_153456	NP_703157			heparan sulfate 6-O-sulfotransferase 3							integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	100700432	100700432	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100700432delA								ZIC2 (61414 upstream) : PCCA (40905 downstream)																																			---	---	---	---
SLC10A2	6555	broad.mit.edu	37	13	103714903	103714903	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103714903delA	uc001vpy.3	-							NM_000452	NP_000443			solute carrier family 10 (sodium/bile acid						bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(3)|skin(1)	4	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	103954456	103954457	+	IGR	INS	-	AGAA	AGAA	rs139212496	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103954456_103954457insAGAA								SLC10A2 (235260 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	106344464	106344465	+	IGR	INS	-	A	A	rs5806515		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106344464_106344465insA								DAOA (201082 upstream) : EFNB2 (797633 downstream)																																			---	---	---	---
FAM155A	728215	broad.mit.edu	37	13	108333221	108333222	+	Intron	INS	-	GT	GT	rs142358682	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108333221_108333222insGT	uc001vql.2	-							NM_001080396	NP_001073865			family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	110358659	110358660	+	IGR	DEL	TT	-	-	rs146869406		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110358659_110358660delTT								MYO16 (498304 upstream) : IRS2 (47526 downstream)																																			---	---	---	---
RASA3	22821	broad.mit.edu	37	13	114749397	114749398	+	Intron	DEL	TG	-	-	rs35352983		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114749397_114749398delTG	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron	NM_007368	NP_031394			RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)															---	---	---	---
Unknown	0	broad.mit.edu	37	14	19055685	19055686	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19055685_19055686delGT								None (None upstream) : OR11H12 (321908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19088477	19088478	+	IGR	INS	-	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19088477_19088478insC								None (None upstream) : OR11H12 (289116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20066163	20066163	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20066163delG								P704P (45891 upstream) : OR4Q3 (149424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20096834	20096835	+	IGR	INS	-	A	A	rs149889226	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20096834_20096835insA								P704P (76562 upstream) : OR4Q3 (118752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20282001	20282001	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20282001delT								OR4M1 (32579 upstream) : OR4N2 (13607 downstream)																																			---	---	---	---
MRPL52	122704	broad.mit.edu	37	14	23296719	23296719	+	5'Flank	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23296719delA	uc001wgw.3	+						MRPL52_uc001wgx.3_5'Flank|MRPL52_uc001wgy.3_5'Flank|MRPL52_uc001wgz.3_5'Flank|MRPL52_uc001wha.3_5'Flank|MRPL52_uc001whb.3_5'Flank	NM_178336	NP_848026			mitochondrial ribosomal protein L52 isoform a						translation	mitochondrial large ribosomal subunit	structural constituent of ribosome				0	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)														---	---	---	---
HOMEZ	57594	broad.mit.edu	37	14	23764730	23764730	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23764730delC	uc001wjb.2	-							NM_020834	NP_065885			homeodomain leucine zipper protein							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	24238651	24238652	+	IGR	INS	-	A	A	rs145679423	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24238651_24238652insA								DHRS2 (123805 upstream) : C14orf165 (152807 downstream)																																			---	---	---	---
STXBP6	29091	broad.mit.edu	37	14	25286933	25286934	+	Intron	INS	-	CT	CT	rs149279848	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25286933_25286934insCT	uc001wpu.2	-						STXBP6_uc001wpv.2_Intron|STXBP6_uc001wpw.2_Intron|STXBP6_uc001wpx.1_RNA|STXBP6_uc001wpt.2_Intron	NM_014178	NP_054897			amisyn						vesicle-mediated transport	cytoplasm|integral to membrane					0				GBM - Glioblastoma multiforme(265;0.0296)												OREG0022633	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	14	25524914	25524914	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25524914delA								STXBP6 (5743 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	25867682	25867682	+	IGR	DEL	T	-	-	rs71451414		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25867682delT								STXBP6 (348511 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	27141076	27141076	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27141076delA								NOVA1 (74116 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	27987190	27987190	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27987190delT	uc010amc.1	-											Homo sapiens cDNA clone IMAGE:40107853.																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	29391661	29391662	+	IGR	DEL	TT	-	-	rs72448903		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29391661_29391662delTT								C14orf23 (127662 upstream) : PRKD1 (654027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	29485096	29485103	+	IGR	DEL	TGTGTGTA	-	-	rs138213116	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29485096_29485103delTGTGTGTA								C14orf23 (221097 upstream) : PRKD1 (560586 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	31291081	31291082	+	IGR	INS	-	A	A	rs111525555		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31291081_31291082insA								SCFD1 (86063 upstream) : COCH (52659 downstream)																																			---	---	---	---
AP4S1	11154	broad.mit.edu	37	14	31530097	31530097	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31530097delT	uc001wqy.3	+						AP4S1_uc001wqw.3_Intron|AP4S1_uc001wqx.3_Intron|AP4S1_uc010amh.2_Intron|AP4S1_uc001wqz.3_Intron	NM_001128126	NP_001121598			adaptor-related protein complex 4, sigma 1							coated pit|Golgi apparatus	protein transporter activity				0	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.221)	GBM - Glioblastoma multiforme(265;0.00553)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	31935326	31935326	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31935326delC								HEATR5A (8646 upstream) : NUBPL (95265 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	34640416	34640416	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34640416delT								EGLN3 (220129 upstream) : C14orf147 (261729 downstream)																																			---	---	---	---
SNX6	58533	broad.mit.edu	37	14	35052729	35052729	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35052729delA	uc001wsf.1	-						SNX6_uc001wse.1_Intron|SNX6_uc010tpm.1_Intron|SNX6_uc010amm.1_Intron	NM_152233	NP_689419			sorting nexin 6 isoform b						cell communication|intracellular protein transport|negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent|negative regulation of transforming growth factor beta receptor signaling pathway|retrograde transport, endosome to Golgi	cytoplasmic vesicle membrane|early endosome membrane|nucleus	phosphatidylinositol binding|protein homodimerization activity				0	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)														---	---	---	---
KIAA0391	9692	broad.mit.edu	37	14	35599691	35599691	+	Intron	DEL	T	-	-	rs112124095		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35599691delT	uc001wsy.1	+						KIAA0391_uc010tps.1_Intron|KIAA0391_uc001wsz.1_Intron|KIAA0391_uc001wta.2_Intron|KIAA0391_uc001wtb.1_Intron|KIAA0391_uc001wtc.1_Intron	NM_014672	NP_055487			mitochondrial RNase P protein 3 precursor						tRNA processing	mitochondrion					0	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)														---	---	---	---
RALGAPA1	253959	broad.mit.edu	37	14	36175821	36175822	+	Intron	DEL	TT	-	-	rs76298979		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36175821_36175822delTT	uc001wti.2	-						RALGAPA1_uc001wtj.2_Intron|RALGAPA1_uc010tpv.1_Intron|RALGAPA1_uc010tpw.1_Intron|RALGAPA1_uc001wtk.1_Intron	NM_014990	NP_055805			Ral GTPase activating protein, alpha subunit 1						activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4																		---	---	---	---
BRMS1L	84312	broad.mit.edu	37	14	36308820	36308820	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36308820delT	uc001wtl.2	+						BRMS1L_uc010tpx.1_Intron	NM_032352	NP_115728			breast cancer metastasis-suppressor 1-like						regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				skin(1)	1	Breast(36;0.137)|Hepatocellular(127;0.158)		Lung(8;1.7e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.00467)|all cancers(34;0.0157)|BRCA - Breast invasive adenocarcinoma(188;0.158)	GBM - Glioblastoma multiforme(112;0.0333)														---	---	---	---
SLC25A21	89874	broad.mit.edu	37	14	37149502	37149503	+	3'UTR	DEL	TT	-	-	rs113632055		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37149502_37149503delTT	uc001wtz.1	-	10						NM_030631	NP_085134			solute carrier family 25 (mitochondrial						lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)														---	---	---	---
SLC25A21	89874	broad.mit.edu	37	14	37540260	37540261	+	Intron	INS	-	A	A	rs141603918	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37540260_37540261insA	uc001wtz.1	-							NM_030631	NP_085134			solute carrier family 25 (mitochondrial						lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	38338656	38338657	+	Intron	DEL	AG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38338656_38338657delAG	uc001wug.2	+											Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	38781890	38781890	+	IGR	DEL	A	-	-	rs79660021		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38781890delA								CLEC14A (56316 upstream) : SEC23A (719233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	39114109	39114110	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39114109_39114110delAC								CLEC14A (388535 upstream) : SEC23A (387013 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	41006197	41006198	+	IGR	INS	-	AA	AA	rs140462568	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:41006197_41006198insAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	43407442	43407443	+	IGR	INS	-	TGTT	TGTT	rs150423358	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43407442_43407443insTGTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	45276121	45276122	+	IGR	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45276121_45276122delAA								FSCB (299622 upstream) : C14orf28 (90385 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	46090421	46090422	+	IGR	INS	-	TG	TG	rs151189470	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46090421_46090422insTG								C14orf106 (367816 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	46585710	46585711	+	IGR	INS	-	A	A	rs141984067	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46585710_46585711insA								C14orf106 (863105 upstream) : RPL10L (534511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	48161119	48161127	+	IGR	DEL	TTTCTCTTT	-	-	rs57327577		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48161119_48161127delTTTCTCTTT								MDGA2 (17131 upstream) : None (None downstream)																																			---	---	---	---
SOS2	6655	broad.mit.edu	37	14	50611265	50611265	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50611265delC	uc001wxs.3	-						SOS2_uc010tql.1_Intron|SOS2_uc010tqm.1_Intron	NM_006939	NP_008870			son of sevenless homolog 2						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	51430387	51430388	+	IGR	INS	-	G	G	rs146217928	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51430387_51430388insG								PYGL (19139 upstream) : TRIM9 (11594 downstream)																																			---	---	---	---
TRIM9	114088	broad.mit.edu	37	14	51497304	51497305	+	Intron	INS	-	GT	GT	rs138440055	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51497304_51497305insGT	uc001wyx.3	-						TRIM9_uc001wyy.2_Intron|TRIM9_uc001wyz.3_Intron	NM_015163	NP_055978			tripartite motif protein 9 isoform 1						proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			skin(2)|lung(1)	3	all_epithelial(31;0.00418)|Breast(41;0.148)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	51589802	51589803	+	IGR	INS	-	GTGT	GTGT	rs144829702	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51589802_51589803insGTGT								TRIM9 (27380 upstream) : TMX1 (117083 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	52296564	52296564	+	IGR	DEL	T	-	-	rs147037442		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52296564delT								FRMD6 (99122 upstream) : GNG2 (17388 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	52581720	52581720	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52581720delT								NID2 (45774 upstream) : PTGDR (152711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	53976545	53976545	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53976545delT								DDHD1 (356499 upstream) : BMP4 (439912 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	54918593	54918594	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54918593_54918594insA								CNIH (10445 upstream) : GMFB (22615 downstream)																																			---	---	---	---
CGRRF1	10668	broad.mit.edu	37	14	55002078	55002079	+	Intron	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55002078_55002079delCA	uc001xay.2	+						CGRRF1_uc010tra.1_Intron|CGRRF1_uc001xaz.2_Intron	NM_006568	NP_006559			cell growth regulator with ring finger domain 1						cell cycle arrest|negative regulation of cell proliferation|response to stress		zinc ion binding			ovary(1)	1																		---	---	---	---
SAMD4A	23034	broad.mit.edu	37	14	55123682	55123682	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55123682delT	uc001xbb.2	+						SAMD4A_uc001xba.2_Intron|SAMD4A_uc001xbc.2_Intron	NM_015589	NP_056404			sterile alpha motif domain containing 4 isoform						positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	55282255	55282256	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55282255_55282256insT								SAMD4A (22222 upstream) : GCH1 (26468 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	56564668	56564668	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56564668delT								C14orf34 (301276 upstream) : PELI2 (20425 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	56774993	56774993	+	IGR	DEL	T	-	-	rs34508185		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56774993delT								PELI2 (6963 upstream) : C14orf101 (271345 downstream)																																			---	---	---	---
RTN1	6252	broad.mit.edu	37	14	60096966	60096966	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60096966delA	uc001xen.1	-						RTN1_uc001xem.1_Intron|RTN1_uc001xek.1_Intron|RTN1_uc001xel.1_Intron|RTN1_uc010apl.1_Intron	NM_021136	NP_066959			reticulon 1 isoform A						neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)														---	---	---	---
KCNH5	27133	broad.mit.edu	37	14	63289387	63289387	+	Intron	DEL	A	-	-	rs72107631		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63289387delA	uc001xfx.2	-						KCNH5_uc001xfy.2_Intron|KCNH5_uc001xfz.1_Intron	NM_139318	NP_647479			potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	63762689	63762690	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63762689_63762690insA								RHOJ (4130 upstream) : GPHB5 (16953 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	64031722	64031722	+	IGR	DEL	A	-	-	rs112786151		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64031722delA								PPP2R5E (21643 upstream) : WDR89 (32036 downstream)																																			---	---	---	---
ESR2	2100	broad.mit.edu	37	14	64732011	64732011	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64732011delA	uc001xha.1	-						ESR2_uc001xgu.2_Intron|ESR2_uc001xgv.2_Intron|ESR2_uc001xgw.2_Intron|ESR2_uc001xgx.2_Intron|ESR2_uc001xgy.1_Intron|ESR2_uc001xgz.1_Intron|ESR2_uc010aqb.1_Intron|ESR2_uc010aqc.1_Intron	NM_001437	NP_001428			estrogen receptor beta isoform 1						cell-cell signaling|negative regulation of cell growth|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	mitochondrion|nucleoplasm	enzyme binding|estrogen receptor activity|receptor antagonist activity|sequence-specific DNA binding transcription factor activity|steroid binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Bicalutamide(DB01128)|Estradiol(DB00783)|Estramustine(DB01196)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)													---	---	---	---
SPTB	6710	broad.mit.edu	37	14	65241594	65241598	+	Intron	DEL	AAAGT	-	-	rs1033697		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65241594_65241598delAAAGT	uc001xht.2	-						SPTB_uc001xhr.2_Intron|SPTB_uc001xhs.2_Intron|SPTB_uc001xhu.2_Intron|SPTB_uc010aqi.2_Intron	NM_000347	NP_000338			spectrin beta isoform b						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	66334279	66334279	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66334279delG								FUT8 (124318 upstream) : C14orf53 (618830 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	66499822	66499822	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66499822delC								FUT8 (289861 upstream) : C14orf53 (453287 downstream)																																			---	---	---	---
MPP5	64398	broad.mit.edu	37	14	67757951	67757952	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67757951_67757952insT	uc001xjc.2	+						MPP5_uc001xjd.2_Intron	NM_022474	NP_071919			membrane protein, palmitoylated 5						tight junction assembly	cytoplasm|endomembrane system|tight junction	protein domain specific binding			ovary(1)	1				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)														---	---	---	---
RAD51L1	5890	broad.mit.edu	37	14	68889670	68889670	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68889670delT	uc001xkf.1	+						RAD51L1_uc001xkd.2_Intron|RAD51L1_uc010aqr.2_Intron|RAD51L1_uc001xke.2_Intron|RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193			RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)				T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
PCNX	22990	broad.mit.edu	37	14	71459447	71459447	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71459447delA	uc001xmo.2	+						PCNX_uc001xmn.3_Intron|PCNX_uc010are.1_Intron	NM_014982	NP_055797			pecanex-like 1							integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)														---	---	---	---
SIPA1L1	26037	broad.mit.edu	37	14	72088497	72088497	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72088497delC	uc001xms.2	+						SIPA1L1_uc001xmt.2_Intron|SIPA1L1_uc001xmu.2_Intron|SIPA1L1_uc001xmv.2_Intron|SIPA1L1_uc010ttm.1_Intron	NM_015556	NP_056371			signal-induced proliferation-associated 1 like						actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)														---	---	---	---
SIPA1L1	26037	broad.mit.edu	37	14	72129483	72129483	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72129483delG	uc001xms.2	+						SIPA1L1_uc001xmt.2_Intron|SIPA1L1_uc001xmu.2_Intron|SIPA1L1_uc001xmv.2_Intron|SIPA1L1_uc010ttm.1_Intron	NM_015556	NP_056371			signal-induced proliferation-associated 1 like						actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)														---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72944526	72944526	+	Intron	DEL	A	-	-	rs113709507		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72944526delA	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron|RGS6_uc010ttp.1_Intron|RGS6_uc001xmz.1_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	73517189	73517193	+	IGR	DEL	TTTTG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73517189_73517193delTTTTG								ZFYVE1 (23350 upstream) : RBM25 (8028 downstream)																																			---	---	---	---
PAPLN	89932	broad.mit.edu	37	14	73736003	73736003	+	Intron	DEL	G	-	-	rs142260905		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73736003delG	uc010ttx.1	+						PAPLN_uc001xnw.3_Intron|PAPLN_uc010arl.2_Intron|PAPLN_uc010ttw.1_Intron|PAPLN_uc010tty.1_Intron|PAPLN_uc010arm.2_Intron|PAPLN_uc010arn.2_Intron	NM_173462	NP_775733			papilin							proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)														---	---	---	---
C14orf43	91748	broad.mit.edu	37	14	74186658	74186658	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74186658delT	uc001xot.2	-						C14orf43_uc001xos.2_Intron|C14orf43_uc001xou.2_Intron|C14orf43_uc010tud.1_Intron|C14orf43_uc010arw.2_Intron	NM_194278	NP_919254			hypothetical protein LOC91748						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00358)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)|OV - Ovarian serous cystadenocarcinoma(108;0.115)														---	---	---	---
PGF	5228	broad.mit.edu	37	14	75411626	75411626	+	Intron	DEL	T	-	-	rs144374139		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75411626delT	uc001xqz.2	-						PGF_uc001xra.2_Intron|PGF_uc001xrb.2_Intron	NM_002632	NP_002623			placental growth factor, vascular endothelial						angiogenesis|cell differentiation|cell-cell signaling|positive regulation of cell division|positive regulation of cell proliferation|vascular endothelial growth factor receptor signaling pathway	extracellular region|membrane	growth factor activity|heparin binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00668)														---	---	---	---
MLH3	27030	broad.mit.edu	37	14	75502552	75502552	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75502552delA	uc001xrd.1	-						MLH3_uc001xre.1_Intron|MLH3_uc010tuy.1_Intron	NM_001040108	NP_001035197			mutL homolog 3 isoform 1						mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)									MMR					---	---	---	---
BATF	10538	broad.mit.edu	37	14	75989552	75989552	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75989552delA	uc001xrr.2	+							NM_006399	NP_006390			basic leucine zipper transcription factor,							nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.028)														---	---	---	---
TTLL5	23093	broad.mit.edu	37	14	76390387	76390388	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76390387_76390388insT	uc001xrx.2	+						TTLL5_uc001xsa.2_Intron	NM_015072	NP_055887			tubulin tyrosine ligase-like family, member 5						protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	77633561	77633561	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77633561delT								ZDHHC22 (25427 upstream) : TMEM63C (14541 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	78243214	78243221	+	IGR	DEL	ACACACAC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78243214_78243221delACACACAC								C14orf178 (7129 upstream) : ADCK1 (23205 downstream)																																			---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79989318	79989318	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79989318delT	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc001xup.2_Intron|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	80545548	80545550	+	IGR	DEL	ACT	-	-	rs5809980		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80545548_80545550delACT								NRXN3 (214790 upstream) : DIO2 (118320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	80581247	80581247	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80581247delT								NRXN3 (250489 upstream) : DIO2 (82623 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	81635492	81635492	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81635492delA								TSHR (22846 upstream) : GTF2A1 (10902 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	82110804	82110804	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82110804delT								SEL1L (110599 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	82572143	82572147	+	IGR	DEL	CCAGA	-	-	rs71107139		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82572143_82572147delCCAGA								SEL1L (571938 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84606240	84606241	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84606240_84606241insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85365832	85365835	+	IGR	DEL	TGTG	-	-	rs35834085		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85365832_85365835delTGTG								None (None upstream) : FLRT2 (630653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85919705	85919708	+	IGR	DEL	AGAG	-	-	rs67932926		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85919705_85919708delAGAG								None (None upstream) : FLRT2 (76780 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	86140653	86140654	+	IGR	INS	-	T	T	rs140445525	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86140653_86140654insT								FLRT2 (46384 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	87364788	87364788	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87364788delA								None (None upstream) : GALC (939376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	87768805	87768806	+	IGR	INS	-	A	A	rs35951723		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87768805_87768806insA								None (None upstream) : GALC (535358 downstream)																																			---	---	---	---
EML5	161436	broad.mit.edu	37	14	89164610	89164610	+	Intron	DEL	T	-	-	rs72044555		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89164610delT	uc001xxg.2	-						EML5_uc001xxh.1_Intron	NM_183387	NP_899243			echinoderm microtubule associated protein like							cytoplasm|microtubule				ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	89576201	89576203	+	IGR	DEL	TGT	-	-	rs148156223		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89576201_89576203delTGT								TTC8 (231867 upstream) : FOXN3 (46314 downstream)																																			---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89671136	89671137	+	Intron	INS	-	TCCA	TCCA	rs142220885	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89671136_89671137insTCCA	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89706623	89706624	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89706623_89706624insA	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	90208800	90208800	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90208800delT								FOXN3 (123306 upstream) : C14orf143 (54671 downstream)																																			---	---	---	---
C14orf143	90141	broad.mit.edu	37	14	90304788	90304788	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90304788delA	uc001xxt.2	-						C14orf143_uc001xxs.2_Intron|C14orf143_uc001xxv.1_Intron|uc001xxu.2_5'Flank	NM_145231	NP_660274			hypothetical protein LOC90141								calcium ion binding				0		all_cancers(154;0.136)		Epithelial(152;0.194)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	92038465	92038465	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92038465delT								SMEK1 (61652 upstream) : C14orf184 (323 downstream)																																			---	---	---	---
C14orf184	650662	broad.mit.edu	37	14	92043350	92043351	+	5'Flank	INS	-	T	T	rs146471576	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92043350_92043351insT	uc010aua.1	-							NM_001080113	NP_001073582			hypothetical protein LOC650662												0																		---	---	---	---
RIN3	79890	broad.mit.edu	37	14	93078647	93078648	+	Intron	DEL	AG	-	-	rs10541590		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93078647_93078648delAG	uc001yap.2	+						RIN3_uc010auk.2_Intron|RIN3_uc001yaq.2_Intron	NM_024832	NP_079108			Ras and Rab interactor 3						endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)																---	---	---	---
RIN3	79890	broad.mit.edu	37	14	93112297	93112297	+	Intron	DEL	A	-	-	rs35439699		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93112297delA	uc001yap.2	+						RIN3_uc010auk.2_Intron|RIN3_uc001yaq.2_Intron	NM_024832	NP_079108			Ras and Rab interactor 3						endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	93367549	93367550	+	IGR	INS	-	A	A	rs35494853		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93367549_93367550insA								GOLGA5 (61245 upstream) : CHGA (21895 downstream)																																			---	---	---	---
ITPK1	3705	broad.mit.edu	37	14	93441138	93441138	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93441138delA	uc001ybg.2	-						ITPK1_uc001ybe.2_Intron|ITPK1_uc001ybf.2_Intron|ITPK1_uc001ybh.2_Intron	NM_014216	NP_055031			inositol 1,3,4-triphosphate 5/6 kinase isoform						blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)														---	---	---	---
KIAA1409	57578	broad.mit.edu	37	14	93813872	93813872	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93813872delG	uc001ybs.1	+						COX8C_uc001ybt.1_Intron	NM_020818	NP_065869			hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)														---	---	---	---
PPP4R4	57718	broad.mit.edu	37	14	94730248	94730249	+	Intron	DEL	AA	-	-	rs59755509		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94730248_94730249delAA	uc001ycs.1	+							NM_058237	NP_478144			HEAT-like repeat-containing protein isoform 1							cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	95222917	95222917	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95222917delA								SERPINA13 (109587 upstream) : GSC (11644 downstream)																																			---	---	---	---
FLJ45244	400242	broad.mit.edu	37	14	95629304	95629306	+	Intron	DEL	AAA	-	-	rs138292360	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95629304_95629306delAAA	uc010twt.1	+						FLJ45244_uc001yed.1_Intron	NR_015415				Homo sapiens mRNA; cDNA DKFZp686C1548 (from clone DKFZp686C1548).												0																		---	---	---	---
CLMN	79789	broad.mit.edu	37	14	95665498	95665498	+	Intron	DEL	T	-	-	rs142168204		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95665498delT	uc001yef.2	-							NM_024734	NP_079010			calmin							integral to membrane	actin binding				0				Epithelial(152;0.193)														---	---	---	---
CLMN	79789	broad.mit.edu	37	14	95667903	95667904	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95667903_95667904insT	uc001yef.2	-							NM_024734	NP_079010			calmin							integral to membrane	actin binding				0				Epithelial(152;0.193)														---	---	---	---
CLMN	79789	broad.mit.edu	37	14	95731578	95731579	+	Intron	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95731578_95731579delAA	uc001yef.2	-							NM_024734	NP_079010			calmin							integral to membrane	actin binding				0				Epithelial(152;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	96100150	96100150	+	IGR	DEL	C	-	-	rs11318714		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96100150delC								GLRX5 (89095 upstream) : TCL6 (16685 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	96311838	96311839	+	IGR	INS	-	CA	CA	rs28376688	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96311838_96311839insCA								TCL1A (131305 upstream) : C14orf132 (193823 downstream)																																			---	---	---	---
BDKRB1	623	broad.mit.edu	37	14	96733376	96733379	+	Intron	DEL	AGAG	-	-	rs3073020		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96733376_96733379delAGAG	uc010avn.2	+											SubName: Full=Bradykinin receptor B1; SubName: Full=cDNA FLJ75760, highly similar to Homo sapiens bradykinin receptor B1 (BDKRB1), mRNA;						elevation of cytosolic calcium ion concentration	endoplasmic reticulum|integral to plasma membrane	bradykinin receptor activity			ovary(3)	3		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	97175279	97175280	+	IGR	DEL	GC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97175279_97175280delGC								PAPOLA (141833 upstream) : VRK1 (88404 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	97724952	97724952	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97724952delG								VRK1 (377002 upstream) : C14orf64 (666995 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98778729	98778730	+	IGR	INS	-	AA	AA	rs150205073	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98778729_98778730insAA								C14orf64 (334268 upstream) : C14orf177 (399220 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98804779	98804780	+	IGR	INS	-	A	A	rs145555894	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98804779_98804780insA								C14orf64 (360318 upstream) : C14orf177 (373170 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98824813	98824814	+	IGR	INS	-	T	T	rs112084327		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98824813_98824814insT								C14orf64 (380352 upstream) : C14orf177 (353136 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99118365	99118366	+	IGR	INS	-	A	A	rs143551970	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99118365_99118366insA								C14orf64 (673904 upstream) : C14orf177 (59584 downstream)																																			---	---	---	---
C14orf177	283598	broad.mit.edu	37	14	99180832	99180832	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99180832delA	uc001yfz.1	+							NM_182560	NP_872366			hypothetical protein LOC283598												0		Melanoma(154;0.128)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	99360226	99360226	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99360226delT								C14orf177 (176129 upstream) : BCL11B (275401 downstream)																																			---	---	---	---
CCDC85C	317762	broad.mit.edu	37	14	100045162	100045162	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100045162delC	uc010avr.2	-							NM_001144995	NP_001138467			coiled-coil domain containing 85C												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	102016724	102016727	+	IGR	DEL	GATG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102016724_102016727delGATG								MIR656 (483586 upstream) : DIO3OS (1833 downstream)																																			---	---	---	---
PPP2R5C	5527	broad.mit.edu	37	14	102322575	102322575	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102322575delC	uc001yko.2	+						PPP2R5C_uc010txr.1_Intron|PPP2R5C_uc001ykk.2_Intron|PPP2R5C_uc010txt.1_Intron|PPP2R5C_uc001ykn.2_Intron|PPP2R5C_uc001ykp.2_Intron|PPP2R5C_uc010txs.1_Intron	NM_002719	NP_002710			gamma isoform of regulatory subunit B56, protein						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of cell proliferation|proteasomal ubiquitin-dependent protein catabolic process|signal transduction	chromosome, centromeric region|nucleus|protein phosphatase type 2A complex	protein binding|protein binding|protein phosphatase type 2A regulator activity|protein phosphatase type 2A regulator activity			ovary(1)|breast(1)	2																		---	---	---	---
DYNC1H1	1778	broad.mit.edu	37	14	102513136	102513136	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102513136delT	uc001yks.2	+							NM_001376	NP_001367			cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10																		---	---	---	---
ZNF839	55778	broad.mit.edu	37	14	102796043	102796044	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102796043_102796044delTG	uc001ylo.2	+						ZNF839_uc010awk.1_Intron|ZNF839_uc001ylp.2_Intron|ZNF839_uc001ylq.1_Intron|ZNF839_uc001ylr.2_Intron|ZNF839_uc001yls.2_5'Flank	NM_018335	NP_060805			zinc finger protein 839							intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	103732998	103732999	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103732998_103732999insT								TNFAIP2 (129222 upstream) : EIF5 (67494 downstream)																																			---	---	---	---
TDRD9	122402	broad.mit.edu	37	14	104400369	104400370	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104400369_104400370insT	uc001yom.3	+							NM_153046	NP_694591			tudor domain containing 9						cell differentiation|DNA methylation involved in gamete generation|fertilization|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	nucleus|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	104721189	104721190	+	IGR	INS	-	G	G	rs139134779	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104721189_104721190insG								KIF26A (73955 upstream) : C14orf180 (324866 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	105475577	105475577	+	IGR	DEL	A	-	-	rs150090875		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105475577delA								C14orf79 (13722 upstream) : CDCA4 (333 downstream)																																			---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106807075	106807075	+	Intron	DEL	T	-	-	rs11333938		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106807075delT	uc010tyt.1	-						uc001ysw.1_5'Flank					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	107028032	107028032	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107028032delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	107157560	107157561	+	Intron	INS	-	T	T	rs72527153	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107157560_107157561insT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	107254886	107254887	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107254886_107254887insT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	107278989	107278989	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107278989delG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20043090	20043090	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20043090delA								None (None upstream) : GOLGA6L6 (694004 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20515099	20515101	+	IGR	DEL	GAG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20515099_20515101delGAG								None (None upstream) : GOLGA6L6 (221993 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20560992	20560993	+	IGR	INS	-	G	G	rs138749934		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20560992_20560993insG								None (None upstream) : GOLGA6L6 (176101 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20631337	20631337	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20631337delC	uc001ytg.2	-						uc010tyx.1_Intron|uc001yth.3_Intron					RecName: Full=Putative HERC2-like protein 3;																														---	---	---	---
BCL8	606	broad.mit.edu	37	15	20871723	20871723	+	RNA	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20871723delA	uc010tzd.1	-	4		c.1364delT								Homo sapiens mRNA; cDNA DKFZp686P1536 (from clone DKFZp686P1536).												0																		---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22339339	22339341	+	Intron	DEL	GAG	-	-	rs137952800	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22339339_22339341delGAG	uc001yuc.1	+						LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	22412840	22412841	+	IGR	INS	-	A	A	rs144900878	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22412840_22412841insA								OR4N4 (29025 upstream) : OR4N3P (861 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22465081	22465081	+	IGR	DEL	C	-	-	rs35419975		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22465081delC								OR4N3P (50696 upstream) : MIR1268 (48148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	24022815	24022815	+	IGR	DEL	T	-	-	rs144851053		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24022815delT								NDN (90365 upstream) : PWRN2 (387111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	24313016	24313016	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24313016delA								NDN (380566 upstream) : PWRN2 (96910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	26670066	26670066	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26670066delT								ATP10A (559749 upstream) : GABRB3 (118629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	26754303	26754303	+	IGR	DEL	C	-	-	rs146769421		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26754303delC								ATP10A (643986 upstream) : GABRB3 (34392 downstream)																																			---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27234201	27234201	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27234201delG	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27371051	27371051	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27371051delA	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27374861	27374861	+	Intron	DEL	T	-	-	rs144545389		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27374861delT	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27633441	27633442	+	Intron	INS	-	GGAG	GGAG	rs139979267	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27633441_27633442insGGAG	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
TJP1	7082	broad.mit.edu	37	15	30110874	30110874	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30110874delT	uc001zcr.2	-						TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248			tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	30305079	30305079	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30305079delT								TJP1 (190373 upstream) : FAM7A3 (90856 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	31714336	31714338	+	IGR	DEL	AAA	-	-	rs72041709		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31714336_31714338delAAA								KLF13 (44235 upstream) : OTUD7A (60992 downstream)																																			---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33773680	33773680	+	Intron	DEL	T	-	-	rs34269008		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33773680delT	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027			ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	36692087	36692088	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36692087_36692088delTC								ATPBD4 (853683 upstream) : C15orf41 (179724 downstream)																																			---	---	---	---
TTBK2	146057	broad.mit.edu	37	15	43082899	43082900	+	Intron	INS	-	TTTG	TTTG	rs148521209	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43082899_43082900insTTTG	uc001zqo.2	-						TTBK2_uc010bcy.2_Intron|TTBK2_uc001zqp.2_Intron|TTBK2_uc010bcz.1_Intron	NM_173500	NP_775771			tau tubulin kinase 2						cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)														---	---	---	---
TTBK2	146057	broad.mit.edu	37	15	43152639	43152641	+	Intron	DEL	AAC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43152639_43152641delAAC	uc001zqo.2	-						TTBK2_uc010bcy.2_Intron|TTBK2_uc001zqp.2_Intron|TTBK2_uc010bcz.1_Intron	NM_173500	NP_775771			tau tubulin kinase 2						cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)														---	---	---	---
UBR1	197131	broad.mit.edu	37	15	43291069	43291069	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43291069delC	uc001zqq.2	-							NM_174916	NP_777576			ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	51156651	51156651	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51156651delT								SPPL2A (98741 upstream) : AP4E1 (44295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	51163263	51163263	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51163263delT								SPPL2A (105353 upstream) : AP4E1 (37683 downstream)																																			---	---	---	---
CYP19A1	1588	broad.mit.edu	37	15	51549957	51549957	+	Intron	DEL	T	-	-	rs11307432		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51549957delT	uc001zyz.3	-						CYP19A1_uc001zza.3_Intron|CYP19A1_uc001zzb.2_Intron|CYP19A1_uc010bey.1_Intron|CYP19A1_uc001zze.1_Intron	NM_031226	NP_112503			cytochrome P450, family 19						estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(3)	3				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	51704587	51704588	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51704587_51704588insT								GLDN (4380 upstream) : DMXL2 (35352 downstream)																																			---	---	---	---
RFX7	64864	broad.mit.edu	37	15	56394538	56394539	+	Intron	INS	-	A	A	rs142841844	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56394538_56394539insA	uc010bfn.2	-						RFX7_uc010ugk.1_5'Flank|RFX7_uc002adn.1_5'Flank	NM_022841	NP_073752			regulatory factor X domain containing 2						regulation of transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	58679808	58679810	+	IGR	DEL	AGA	-	-	rs71884092		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58679808_58679810delAGA								ALDH1A2 (108346 upstream) : LIPC (22965 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	60694659	60694660	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60694659_60694660insT								ANXA2 (4474 upstream) : NARG2 (17149 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	62633608	62633608	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62633608delT								C2CD4B (176126 upstream) : MGC15885 (295763 downstream)																																			---	---	---	---
DAPK2	23604	broad.mit.edu	37	15	64284710	64284710	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64284710delT	uc002amr.2	-						DAPK2_uc010uim.1_Intron|DAPK2_uc010bgu.1_Intron	NM_014326	NP_055141			death-associated kinase 2						apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			stomach(1)|central_nervous_system(1)	2				LUAD - Lung adenocarcinoma(2;0.215)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	70575364	70575365	+	IGR	INS	-	ATGG	ATGG			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70575364_70575365insATGG								TLE3 (185108 upstream) : UACA (371530 downstream)																																			---	---	---	---
NPTN	27020	broad.mit.edu	37	15	73872578	73872578	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73872578delG	uc002avs.2	-						NPTN_uc010bjc.2_Intron|NPTN_uc002avt.2_Intron|NPTN_uc002avr.2_Intron|NPTN_uc010ula.1_Intron	NM_012428	NP_036560			neuroplastin isoform b precursor						elevation of cytosolic calcium ion concentration|homophilic cell adhesion|long-term synaptic potentiation|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of long-term neuronal synaptic plasticity|positive regulation of neuron projection development|positive regulation of protein phosphorylation	integral to membrane|plasma membrane|presynaptic membrane	cell adhesion molecule binding|type 1 fibroblast growth factor receptor binding				0																		---	---	---	---
C15orf59	388135	broad.mit.edu	37	15	74033545	74033545	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74033545delC	uc002avy.2	-							NM_001039614	NP_001034703			hypothetical protein LOC388135											pancreas(1)	1																		---	---	---	---
RASGRF1	5923	broad.mit.edu	37	15	79305865	79305865	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79305865delT	uc002beq.2	-						RASGRF1_uc002bep.2_Intron|RASGRF1_uc010blm.1_Intron|RASGRF1_uc002ber.3_Intron|RASGRF1_uc010unh.1_Intron	NM_002891	NP_002882			Ras protein-specific guanine						activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6																		---	---	---	---
CPEB1	64506	broad.mit.edu	37	15	83250072	83250075	+	Intron	DEL	CATC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83250072_83250075delCATC	uc002bit.2	-						CPEB1_uc002biu.2_Intron|CPEB1_uc010uof.1_Intron|CPEB1_uc002biv.2_Intron	NM_001079533	NP_001073001			cytoplasmic polyadenylation element binding						mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(143;0.229)															---	---	---	---
HOMER2	9455	broad.mit.edu	37	15	83562819	83562820	+	Intron	INS	-	G	G	rs72535645	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83562819_83562820insG	uc002bjg.2	-						HOMER2_uc002bjh.2_Intron|HOMER2_uc002bjj.2_Intron|HOMER2_uc002bji.2_Intron	NM_199330	NP_955362			homer 2 isoform 2						metabotropic glutamate receptor signaling pathway	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane					0																		---	---	---	---
C15orf40	123207	broad.mit.edu	37	15	83676943	83676944	+	Intron	INS	-	A	A	rs113081534		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83676943_83676944insA	uc010uoo.1	-						C15orf40_uc010uon.1_Intron|C15orf40_uc002bjm.2_Intron|C15orf40_uc010uop.1_Intron|C15orf40_uc010uoq.1_Intron|C15orf40_uc010uor.1_3'UTR	NM_001160115	NP_001153587			hypothetical protein LOC123207 isoform d											skin(1)	1																		---	---	---	---
SH3GL3	6457	broad.mit.edu	37	15	84282373	84282376	+	Intron	DEL	ATCT	-	-	rs71453208		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84282373_84282376delATCT	uc002bjw.2	+						SH3GL3_uc002bjx.2_Intron|SH3GL3_uc002bju.2_Intron|SH3GL3_uc002bjv.2_Intron	NM_003027	NP_003018			SH3-domain GRB2-like 3						central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding			pancreas(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	85897303	85897304	+	IGR	INS	-	T	T	rs146865466	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85897303_85897304insT								PDE8A (214933 upstream) : AKAP13 (26567 downstream)																																			---	---	---	---
KLHL25	64410	broad.mit.edu	37	15	86314432	86314433	+	Intron	INS	-	AA	AA	rs55642980		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86314432_86314433insAA	uc002bly.2	-						MIR1276_hsa-mir-1276|MI0006416_5'Flank	NM_022480	NP_071925			BTB/POZ KELCH domain protein							cytoplasm				ovary(2)	2																		---	---	---	---
KLHL25	64410	broad.mit.edu	37	15	86334425	86334426	+	Intron	INS	-	A	A	rs111276143		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86334425_86334426insA	uc002bly.2	-							NM_022480	NP_071925			BTB/POZ KELCH domain protein							cytoplasm				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	86609896	86609896	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86609896delA								KLHL25 (271707 upstream) : AGBL1 (75346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	87714163	87714163	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87714163delT								AGBL1 (141880 upstream) : NCRNA00052 (405997 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	88259286	88259286	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88259286delC								NCRNA00052 (136369 upstream) : NTRK3 (160702 downstream)																																			---	---	---	---
NTRK3	4916	broad.mit.edu	37	15	88711969	88711969	+	Intron	DEL	A	-	-	rs75966271		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88711969delA	uc002bme.1	-						NTRK3_uc002bmh.2_Intron|NTRK3_uc002bmf.1_Intron|NTRK3_uc010upl.1_Intron|NTRK3_uc010bnh.1_Intron|NTRK3_uc002bmg.2_Intron	NM_001012338	NP_001012338			neurotrophic tyrosine kinase, receptor, type 3						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)					T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			---	---	---	---
Unknown	0	broad.mit.edu	37	15	90001649	90001650	+	IGR	INS	-	ACACAC	ACACAC	rs10637336		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90001649_90001650insACACAC								LOC254559 (59931 upstream) : RHCG (12988 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	90298276	90298277	+	IGR	DEL	CG	-	-	rs61138257		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90298276_90298277delCG								MESP1 (3736 upstream) : MESP2 (5545 downstream)																																			---	---	---	---
ANPEP	290	broad.mit.edu	37	15	90357488	90357489	+	Intron	DEL	TG	-	-	rs72472450		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90357488_90357489delTG	uc002bop.3	-							NM_001150	NP_001141			membrane alanine aminopeptidase precursor						angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	90659833	90659834	+	IGR	INS	-	TTCCT	TTCCT	rs148768420	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90659833_90659834insTTCCT								IDH2 (14125 upstream) : SEMA4B (68318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	90700963	90700964	+	IGR	INS	-	GAAG	GAAG	rs140102808	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90700963_90700964insGAAG								IDH2 (55255 upstream) : SEMA4B (27188 downstream)																																			---	---	---	---
SEMA4B	10509	broad.mit.edu	37	15	90755751	90755751	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90755751delC	uc002boy.2	+						SEMA4B_uc002boz.2_Intron|SEMA4B_uc010uqd.1_Intron	NM_020210	NP_064595			semaphorin 4B precursor											ovary(1)|breast(1)|kidney(1)	3	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)															---	---	---	---
SV2B	9899	broad.mit.edu	37	15	91646015	91646016	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91646015_91646016insT	uc010uqv.1	+						SV2B_uc002bqt.2_Intron|SV2B_uc002bqu.3_Intron	NM_014848	NP_055663			synaptic vesicle protein 2B homolog						neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)															---	---	---	---
SV2B	9899	broad.mit.edu	37	15	91730891	91730891	+	Intron	DEL	T	-	-	rs150365460		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91730891delT	uc010uqv.1	+						SV2B_uc002bqt.2_Intron|SV2B_uc002bqu.3_Intron	NM_014848	NP_055663			synaptic vesicle protein 2B homolog						neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)															---	---	---	---
SLCO3A1	28232	broad.mit.edu	37	15	92613873	92613880	+	Intron	DEL	TTTTTTTT	-	-	rs71465731		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92613873_92613880delTTTTTTTT	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404			solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)															---	---	---	---
FAM174B	400451	broad.mit.edu	37	15	93262638	93262638	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93262638delA	uc002bsl.3	-											Homo sapiens cDNA PSEC0264 fis, clone NT2RP3002337.							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	93336610	93336610	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93336610delA								FAM174B (59306 upstream) : CHD2 (92823 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	94186108	94186108	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94186108delA								RGMA (553675 upstream) : MCTP2 (588693 downstream)																																			---	---	---	---
MCTP2	55784	broad.mit.edu	37	15	94794593	94794593	+	Intron	DEL	T	-	-	rs67961545		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94794593delT	uc010boj.2	+						MCTP2_uc010urg.1_Intron|MCTP2_uc002bti.2_Intron|MCTP2_uc002btg.3_Intron|MCTP2_uc002bth.3_Intron	NM_018349	NP_060819			multiple C2 domains, transmembrane 2 isoform 1						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)															---	---	---	---
MCTP2	55784	broad.mit.edu	37	15	94817413	94817413	+	Intron	DEL	A	-	-	rs35530286		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94817413delA	uc010boj.2	+						MCTP2_uc010urg.1_Intron|MCTP2_uc002bti.2_Intron|MCTP2_uc002btg.3_Intron|MCTP2_uc002bth.3_Intron	NM_018349	NP_060819			multiple C2 domains, transmembrane 2 isoform 1						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)															---	---	---	---
MCTP2	55784	broad.mit.edu	37	15	94911324	94911325	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94911324_94911325delTG	uc002btj.2	+						MCTP2_uc002bti.2_Intron|MCTP2_uc010boj.2_Intron|MCTP2_uc010bok.2_Intron|MCTP2_uc002btk.3_Intron|MCTP2_uc002btl.2_Intron	NM_018349	NP_060819			multiple C2 domains, transmembrane 2 isoform 1						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	95214290	95214290	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95214290delA								MCTP2 (187110 upstream) : LOC145820 (762032 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	95334231	95334232	+	IGR	INS	-	T	T	rs144518444	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95334231_95334232insT								MCTP2 (307051 upstream) : LOC145820 (642090 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96145536	96145537	+	IGR	INS	-	A	A	rs112503353		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96145536_96145537insA								LOC145820 (94462 upstream) : NR2F2 (723620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96841806	96841806	+	Intron	DEL	A	-	-	rs34935427		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96841806delA	uc010bol.1	-						uc002bto.1_Intron					Homo sapiens cDNA FLJ10010 fis, clone HEMBA1000302.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	97262214	97262214	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97262214delT								NR2F2 (378724 upstream) : SPATA8 (64465 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97300161	97300162	+	IGR	INS	-	AGG	AGG	rs141710206	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97300161_97300162insAGG								NR2F2 (416671 upstream) : SPATA8 (26517 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97486525	97486526	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97486525_97486526delAC								SPATA8 (157681 upstream) : LOC91948 (799320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97668382	97668382	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97668382delA								SPATA8 (339538 upstream) : LOC91948 (617464 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97926067	97926068	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97926067_97926068delTC								SPATA8 (597223 upstream) : LOC91948 (359778 downstream)																																			---	---	---	---
LOC91948	91948	broad.mit.edu	37	15	98347482	98347483	+	Intron	INS	-	C	C	rs144544331	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98347482_98347483insC	uc002buh.1	-						LOC91948_uc002bug.1_Intron	NR_024173				SubName: Full=Putative uncharacterized protein ENSP00000381347;												0																		---	---	---	---
LOC91948	91948	broad.mit.edu	37	15	98378879	98378880	+	Intron	INS	-	AC	AC	rs138315618	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98378879_98378880insAC	uc002buh.1	-						LOC91948_uc002bug.1_Intron	NR_024173				SubName: Full=Putative uncharacterized protein ENSP00000381347;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	98545809	98545810	+	IGR	DEL	AT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98545809_98545810delAT								ARRDC4 (28742 upstream) : FAM169B (434581 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	98661645	98661645	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98661645delT								ARRDC4 (144578 upstream) : FAM169B (318746 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	99626410	99626410	+	IGR	DEL	T	-	-	rs35654456		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99626410delT								PGPEP1L (75386 upstream) : SYNM (18876 downstream)																																			---	---	---	---
MEF2A	4205	broad.mit.edu	37	15	100148359	100148359	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100148359delT	uc002bve.2	+						MEF2A_uc010urv.1_Intron|MEF2A_uc010bos.2_Intron|MEF2A_uc002bvf.2_Intron|MEF2A_uc002bvg.2_Intron|MEF2A_uc002bvi.2_Intron	NM_001130926	NP_001124398			myocyte enhancer factor 2A isoform 2						apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)															---	---	---	---
ADAMTS17	170691	broad.mit.edu	37	15	100729546	100729547	+	Intron	DEL	GA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100729546_100729547delGA	uc002bvv.1	-						ADAMTS17_uc002bvx.1_Intron	NM_139057	NP_620688			ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	101347051	101347051	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101347051delT								ASB7 (155149 upstream) : ALDH1A3 (72958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	102291158	102291158	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102291158delA	uc010usj.1	+						uc002bxp.3_5'Flank|uc002bxt.2_5'Flank					RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	102426482	102426482	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102426482delA								OR4F15 (67156 upstream) : OR4F4 (35863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	234791	234792	+	IGR	INS	-	A	A	rs142664888	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:234791_234792insA								HBQ1 (3614 upstream) : LUC7L (4178 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	1314535	1314538	+	IGR	DEL	TGTA	-	-	rs10578636		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1314535_1314538delTGTA								TPSD1 (6041 upstream) : UBE2I (44642 downstream)																																			---	---	---	---
NOXO1	124056	broad.mit.edu	37	16	2032919	2032920	+	5'Flank	DEL	AA	-	-	rs112768417		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2032919_2032920delAA	uc002cnx.2	-						NOXO1_uc002cnz.2_5'Flank|NOXO1_uc002coa.2_5'Flank|NOXO1_uc002cny.2_5'Flank|GFER_uc002cob.2_5'Flank|GFER_uc002coc.2_5'Flank	NM_172168	NP_751908			NADPH oxidase organizer 1 isoform c						cell communication|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst	NADPH oxidase complex	enzyme binding|phosphatidylinositol binding|superoxide-generating NADPH oxidase activator activity				0																		---	---	---	---
TSC2	7249	broad.mit.edu	37	16	2101321	2101321	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2101321delA	uc002con.2	+						TSC2_uc010uvu.1_Intron|TSC2_uc010bsd.2_Intron|TSC2_uc002coo.2_Intron|TSC2_uc010uvv.1_Intron|TSC2_uc010uvw.1_Intron|TSC2_uc002cop.2_Intron	NM_000548	NP_000539			tuberous sclerosis 2 isoform 1						cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)						D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				---	---	---	---
ABCA3	21	broad.mit.edu	37	16	2346237	2346237	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2346237delT	uc002cpy.1	-						ABCA3_uc010bsk.1_Intron|ABCA3_uc010bsl.1_Intron	NM_001089	NP_001080			ATP-binding cassette, sub-family A member 3						response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	2714800	2714801	+	Intron	INS	-	ATAA	ATAA	rs71394742		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2714800_2714801insATAA	uc002crb.2	-						uc010bsr.1_Intron|uc010bss.1_Intron					Homo sapiens cDNA FLJ34475 fis, clone HLUNG2003716, moderately similar to RETROVIRUS-RELATED ENV POLYPROTEIN.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	3425965	3425973	+	IGR	DEL	CTTTCCTTT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3425965_3425973delCTTTCCTTT								OR2C1 (19041 upstream) : ZNF434 (6113 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	3478815	3478815	+	IGR	DEL	T	-	-	rs111628342		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3478815delT								ZNF174 (19453 upstream) : ZNF597 (7296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	3994172	3994172	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3994172delG								CREBBP (64051 upstream) : ADCY9 (18481 downstream)																																			---	---	---	---
ALG1	56052	broad.mit.edu	37	16	5126794	5126795	+	Intron	DEL	TT	-	-	rs5815229		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5126794_5126795delTT	uc002cym.2	+						ALG1_uc002cyj.2_Intron|ALG1_uc002cyn.2_Intron|ALG1_uc010bue.2_Intron|ALG1_uc010uxy.1_Intron	NM_019109	NP_061982			beta-1,4-mannosyltransferase						dolichol-linked oligosaccharide biosynthetic process|lipopolysaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	chitobiosyldiphosphodolichol beta-mannosyltransferase activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(90;0.0164)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	5418411	5418411	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5418411delC	uc002cyq.1	+											Homo sapiens cDNA clone IMAGE:5244947, **** WARNING: chimeric clone ****.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	5933523	5933524	+	IGR	INS	-	AC	AC	rs150687699	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5933523_5933524insAC								FAM86A (785734 upstream) : A2BP1 (135608 downstream)																																			---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	6627821	6627822	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6627821_6627822insA	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	8007013	8007014	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8007013_8007014delTG								A2BP1 (243673 upstream) : TMEM114 (612489 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	8452077	8452078	+	IGR	INS	-	A	A	rs146686658		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8452077_8452078insA								A2BP1 (688737 upstream) : TMEM114 (167425 downstream)																																			---	---	---	---
ABAT	18	broad.mit.edu	37	16	8837175	8837176	+	Intron	INS	-	TG	TG	rs138379113	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8837175_8837176insTG	uc002czc.3	+						ABAT_uc002czd.3_Intron|ABAT_uc010buh.2_Intron|ABAT_uc010bui.2_Intron	NM_020686	NP_065737			4-aminobutyrate aminotransferase precursor						behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	9373792	9373792	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9373792delG								C16orf72 (160247 upstream) : GRIN2A (473475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	10329431	10329431	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10329431delA								GRIN2A (52820 upstream) : ATF7IP2 (150481 downstream)																																			---	---	---	---
FAM18A	780776	broad.mit.edu	37	16	10889109	10889109	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10889109delT	uc010buo.1	-						FAM18A_uc010uyr.1_Intron|FAM18A_uc010uys.1_Intron|FAM18A_uc010uyt.1_Intron|FAM18A_uc010bun.2_Intron|FAM18A_uc010uyu.1_Intron|FAM18A_uc002dad.3_Intron|FAM18A_uc002daf.1_Intron	NM_001079512	NP_001072980			hypothetical protein LOC780776							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	13390074	13390075	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13390074_13390075insT								SHISA9 (55802 upstream) : ERCC4 (623939 downstream)																																			---	---	---	---
ERCC4	2072	broad.mit.edu	37	16	14030756	14030756	+	Intron	DEL	T	-	-	rs149352909		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14030756delT	uc002dce.2	+						ERCC4_uc010uyz.1_Intron	NM_005236	NP_005227			excision repair cross-complementing rodent						double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity			lung(4)|ovary(3)|skin(2)|pancreas(1)	10								Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				---	---	---	---
PARN	5073	broad.mit.edu	37	16	14652354	14652354	+	Intron	DEL	A	-	-	rs67957479		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14652354delA	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron	NM_002582	NP_002573			poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2																		---	---	---	---
NPIP	9284	broad.mit.edu	37	16	15037018	15037019	+	Intron	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15037018_15037019delTC	uc002dcy.3	+						NPIP_uc002dcx.3_Intron	NM_006985	NP_008916			nuclear pore complex interacting protein						mRNA transport|protein transport|transmembrane transport	nuclear membrane|nuclear pore					0																		---	---	---	---
C16orf45	89927	broad.mit.edu	37	16	15611703	15611716	+	Intron	DEL	TGTGGATGTGTGTG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15611703_15611716delTGTGGATGTGTGTG	uc002ddo.2	+						C16orf45_uc002ddp.2_Intron	NM_033201	NP_149978			hypothetical protein LOC89927 isoform 1											ovary(1)	1																		---	---	---	---
ABCC1	4363	broad.mit.edu	37	16	16227229	16227230	+	Intron	INS	-	TTTTTG	TTTTTG	rs138994210	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16227229_16227230insTTTTTG	uc010bvi.2	+						ABCC1_uc010bvj.2_Intron|ABCC1_uc010bvk.2_Intron|ABCC1_uc010bvl.2_Intron|ABCC1_uc010bvm.2_Intron|ABCC1_uc002del.3_Intron	NM_004996	NP_004987			ATP-binding cassette, sub-family C, member 1						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	16464606	16464606	+	5'Flank	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16464606delT	uc002dey.2	+											SubName: Full=cDNA FLJ42525 fis, clone BRACE3001391, highly similar to Polycystin;																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	16729678	16729685	+	IGR	DEL	TTTTTTTA	-	-	rs111666135		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16729678_16729685delTTTTTTTA								LOC339047 (285241 upstream) : XYLT1 (466498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	16846764	16846765	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16846764_16846765insT								LOC339047 (402327 upstream) : XYLT1 (349418 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	17882993	17882994	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17882993_17882994delTC								XYLT1 (318255 upstream) : NOMO2 (628189 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	17937533	17937534	+	IGR	INS	-	A	A	rs146219978	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17937533_17937534insA								XYLT1 (372795 upstream) : NOMO2 (573649 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	18970978	18970978	+	IGR	DEL	T	-	-	rs112774116		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18970978delT								SMG1 (33252 upstream) : TMC7 (24278 downstream)																																			---	---	---	---
TMC7	79905	broad.mit.edu	37	16	19058155	19058155	+	Intron	DEL	A	-	-	rs34279699		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19058155delA	uc002dfq.2	+						TMC7_uc002dfp.2_Intron|TMC7_uc010vap.1_Intron	NM_024847	NP_079123			transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	20244858	20244858	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20244858delC								GPR139 (159758 upstream) : GP2 (76954 downstream)																																			---	---	---	---
OTOA	146183	broad.mit.edu	37	16	21749219	21749220	+	Intron	INS	-	C	C	rs143827339	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21749219_21749220insC	uc002djh.2	+						uc002diq.3_Intron|OTOA_uc010vbj.1_Intron|OTOA_uc002dji.2_Intron|OTOA_uc010vbk.1_Intron	NM_144672	NP_653273			otoancorin isoform 1						sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	22642299	22642300	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22642299_22642300insA								LOC653786 (54113 upstream) : HS3ST2 (183560 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	22715164	22715165	+	IGR	INS	-	T	T	rs141142911	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22715164_22715165insT								LOC653786 (126978 upstream) : HS3ST2 (110695 downstream)																																			---	---	---	---
HS3ST2	9956	broad.mit.edu	37	16	22855330	22855331	+	Intron	DEL	AC	-	-	rs71876208		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22855330_22855331delAC	uc002dli.2	+						HS3ST2_uc002dlj.2_Intron	NM_006043	NP_006034			heparan sulfate D-glucosaminyl							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(48;0.0299)														---	---	---	---
COG7	91949	broad.mit.edu	37	16	23441788	23441789	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23441788_23441789insT	uc002dlo.2	-							NM_153603	NP_705831			component of oligomeric golgi complex 7						intracellular protein transport|protein glycosylation|protein localization in Golgi apparatus|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0				GBM - Glioblastoma multiforme(48;0.0401)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	24927918	24927919	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24927918_24927919delAC								SLC5A11 (4975 upstream) : ARHGAP17 (2795 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	25366667	25366668	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25366667_25366668insA								ZKSCAN2 (97812 upstream) : HS3ST4 (336679 downstream)																																			---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	25914100	25914100	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25914100delA	uc002dof.2	+							NM_006040	NP_006031			heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
XPO6	23214	broad.mit.edu	37	16	28190086	28190087	+	Intron	DEL	AA	-	-	rs147431485		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28190086_28190087delAA	uc002dpa.1	-						XPO6_uc002dpb.1_Intron|XPO6_uc010vcp.1_Intron	NM_015171	NP_055986			exportin 6						protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
SH2B1	25970	broad.mit.edu	37	16	28862500	28862500	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28862500delA	uc002dri.2	+						uc010vct.1_Intron	NM_001145795	NP_001139267			SH2B adaptor protein 1 isoform 1						blood coagulation|intracellular signal transduction	cytosol|membrane|nucleus	signal transducer activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	29402195	29402195	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29402195delA	uc010vct.1	-						RUNDC2C_uc010bys.1_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
BOLA2	552900	broad.mit.edu	37	16	29737655	29737655	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29737655delT	uc010bzb.1	-						uc002dtf.2_Intron					SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	30590152	30590153	+	Intron	INS	-	T	T	rs138000864		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30590152_30590153insT	uc002dyu.2	+											Homo sapiens cDNA clone IMAGE:4906981, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	32364541	32364543	+	IGR	DEL	AGA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32364541_32364543delAGA								HERC2P4 (200667 upstream) : TP53TG3B (320298 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32502369	32502370	+	IGR	INS	-	T	T	rs139729549	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32502369_32502370insT								HERC2P4 (338495 upstream) : TP53TG3B (182471 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32828380	32828381	+	IGR	INS	-	T	T	rs148268914	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32828380_32828381insT								TP53TG3B (139502 upstream) : SLC6A10P (60416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32855992	32855992	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32855992delT								TP53TG3B (167114 upstream) : SLC6A10P (32805 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33037494	33037494	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33037494delG								SLC6A10P (141031 upstream) : MIR1826 (928014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33343560	33343564	+	IGR	DEL	TCATC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33343560_33343564delTCATC								SLC6A10P (447097 upstream) : MIR1826 (621944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33523582	33523582	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33523582delG								SLC6A10P (627119 upstream) : MIR1826 (441926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33543042	33543046	+	IGR	DEL	CACAC	-	-	rs80034619	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33543042_33543046delCACAC								SLC6A10P (646579 upstream) : MIR1826 (422462 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33545619	33545622	+	IGR	DEL	TAAA	-	-	rs113410307		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33545619_33545622delTAAA								SLC6A10P (649156 upstream) : MIR1826 (419886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33937348	33937349	+	IGR	DEL	TT	-	-	rs111232160		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33937348_33937349delTT								None (None upstream) : MIR1826 (28159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33951065	33951074	+	IGR	DEL	CTGTGACCCA	-	-	rs77472351	by1000genomes;by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33951065_33951074delCTGTGACCCA								None (None upstream) : MIR1826 (14434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33997732	33997733	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33997732_33997733delCA								MIR1826 (32140 upstream) : UBE2MP1 (406069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34180461	34180461	+	IGR	DEL	T	-	-	rs80312899		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34180461delT								MIR1826 (214869 upstream) : UBE2MP1 (223341 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46436580	46436581	+	IGR	INS	-	G	G	rs145448555	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46436580_46436581insG								None (None upstream) : ANKRD26P1 (66668 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46449434	46449435	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46449434_46449435insA								None (None upstream) : ANKRD26P1 (53814 downstream)																																			---	---	---	---
GPT2	84706	broad.mit.edu	37	16	46958837	46958837	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46958837delT	uc002eel.2	+						GPT2_uc002eem.2_Intron|GPT2_uc002een.2_Intron	NM_133443	NP_597700			glutamic pyruvate transaminase 2 isoform 1						2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	47742190	47742191	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47742190_47742191insA								PHKB (6757 upstream) : ABCC12 (374693 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	49232584	49232585	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49232584_49232585delCA								N4BP1 (588464 upstream) : CBLN1 (79626 downstream)																																			---	---	---	---
BRD7	29117	broad.mit.edu	37	16	50387671	50387672	+	Intron	DEL	TT	-	-	rs67549696		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50387671_50387672delTT	uc002egf.1	-						BRD7_uc002ege.1_Intron	NM_013263	NP_037395			bromodomain containing 7						cell cycle|negative regulation of cell proliferation|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of histone acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|nucleus	histone acetyl-lysine binding|p53 binding|transcription coactivator activity|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding				0		all_cancers(37;0.0127)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	51283975	51283975	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51283975delC								SALL1 (98792 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51544106	51544106	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51544106delC								SALL1 (358923 upstream) : TOX3 (927812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52391279	52391279	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52391279delT								None (None upstream) : TOX3 (80639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52878846	52878847	+	IGR	INS	-	TG	TG	rs139296890	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52878846_52878847insTG								TOX3 (297132 upstream) : CHD9 (210098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	53018136	53018136	+	IGR	DEL	A	-	-	rs34126900		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53018136delA								TOX3 (436422 upstream) : CHD9 (70809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	54728589	54728589	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54728589delT								IRX3 (408211 upstream) : IRX5 (236522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	55005838	55005841	+	IGR	DEL	TCTT	-	-	rs71146776		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55005838_55005841delTCTT								IRX5 (37445 upstream) : IRX6 (352630 downstream)																																			---	---	---	---
AMFR	267	broad.mit.edu	37	16	56403927	56403928	+	Intron	INS	-	GGGGAGGGGAGTC	GGGGAGGGGAGTC	rs146334085	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56403927_56403928insGGGGAGGGGAGTC	uc002eiy.2	-						AMFR_uc002eix.2_Intron	NM_001144	NP_001135			autocrine motility factor receptor						endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein oligomerization|protein polyubiquitination	integral to endoplasmic reticulum membrane|integral to membrane of membrane fraction	protein binding|protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding			breast(2)	2																		---	---	---	---
MT4	84560	broad.mit.edu	37	16	56600438	56600445	+	Intron	DEL	GAAGGAAA	-	-	rs141989399		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56600438_56600445delGAAGGAAA	uc002eje.1	+							NM_032935	NP_116324			metallothionein 4							cytoplasm	copper ion binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	57422497	57422498	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57422497_57422498insA								CX3CL1 (3543 upstream) : CCL17 (16181 downstream)																																			---	---	---	---
KATNB1	10300	broad.mit.edu	37	16	57778630	57778631	+	Intron	INS	-	GT	GT	rs145456395	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57778630_57778631insGT	uc002eml.1	+							NM_005886	NP_005877			katanin p80 subunit B 1						cell division|mitosis|negative regulation of microtubule depolymerization|positive regulation of microtubule depolymerization|protein targeting	katanin complex|microtubule|spindle pole	microtubule binding|protein heterodimerization activity				0		all_neural(199;0.223)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	58866958	58866958	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58866958delT								GOT2 (98712 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59159230	59159231	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59159230_59159231insT								GOT2 (390984 upstream) : None (None downstream)																																			---	---	---	---
CDH8	1006	broad.mit.edu	37	16	61779499	61779500	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61779499_61779500insT	uc002eog.1	-						CDH8_uc002eoh.2_Intron	NM_001796	NP_001787			cadherin 8, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	62426476	62426477	+	IGR	INS	-	G	G	rs143981050	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62426476_62426477insG								CDH8 (356440 upstream) : None (None downstream)																																			---	---	---	---
LOC283867	283867	broad.mit.edu	37	16	65576877	65576877	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65576877delT	uc010cdp.1	-						LOC283867_uc002eol.1_Intron					Homo sapiens cDNA clone IMAGE:5276218.												0				OV - Ovarian serous cystadenocarcinoma(108;0.17)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	66101520	66101520	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66101520delT								LOC283867 (491317 upstream) : CDH5 (299005 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	66286519	66286520	+	IGR	INS	-	A	A	rs144334666	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66286519_66286520insA								LOC283867 (676316 upstream) : CDH5 (114005 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	66892399	66892399	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66892399delT								CA7 (4352 upstream) : PDP2 (22037 downstream)																																			---	---	---	---
NFATC3	4775	broad.mit.edu	37	16	68243753	68243754	+	Intron	INS	-	AC	AC	rs149664233	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68243753_68243754insAC	uc002evo.1	+						NFATC3_uc010vkm.1_Intron|NFATC3_uc010vkn.1_Intron|NFATC3_uc010vkp.1_Intron|NFATC3_uc010vkq.1_Intron|NFATC3_uc002evm.1_Intron|NFATC3_uc002evn.1_Intron|NFATC3_uc010vks.1_Intron|NFATC3_uc010vkt.1_Intron|NFATC3_uc010vkv.1_Intron|NFATC3_uc010vkw.1_Intron|NFATC3_uc010vky.1_Intron|NFATC3_uc010vkz.1_Intron|NFATC3_uc010vlb.1_Intron|NFATC3_uc010vlc.1_Intron	NM_173165	NP_775188			nuclear factor of activated T-cells,						inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)														---	---	---	---
TMCO7	79613	broad.mit.edu	37	16	68979595	68979595	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68979595delT	uc002ewi.3	+							NM_024562	NP_078838			transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)														---	---	---	---
SF3B3	23450	broad.mit.edu	37	16	70575213	70575214	+	Intron	DEL	TA	-	-	rs4985532	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70575213_70575214delTA	uc002ezf.2	+							NM_012426	NP_036558			splicing factor 3b, subunit 3						protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	71546934	71546935	+	IGR	INS	-	A	A	rs140186868	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71546934_71546935insA								ZNF19 (23680 upstream) : CHST4 (13126 downstream)																																			---	---	---	---
ZNF821	55565	broad.mit.edu	37	16	71896620	71896620	+	Intron	DEL	T	-	-	rs67943008		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71896620delT	uc010vmj.1	-						ATXN1L_uc010vmi.1_Intron|ZNF821_uc002fbe.2_Intron|ZNF821_uc002fbf.2_Intron|ZNF821_uc002fbg.3_Intron|ZNF821_uc002fbh.3_Intron|ZNF821_uc002fbi.3_Intron	NM_017530	NP_060000			zinc finger protein 821						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
ZFHX3	463	broad.mit.edu	37	16	72968571	72968572	+	Intron	INS	-	CTGTCGACTTGG	CTGTCGACTTGG	rs146942384	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72968571_72968572insCTGTCGACTTGG	uc002fck.2	-						ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816			zinc finger homeobox 3 isoform A						muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	73651290	73651290	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73651290delG								HTA (523620 upstream) : PSMD7 (679391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	74203835	74203835	+	IGR	DEL	T	-	-	rs66727353		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74203835delT								None (None upstream) : PSMD7 (126846 downstream)																																			---	---	---	---
CTRB1	1504	broad.mit.edu	37	16	75253880	75253891	+	Intron	DEL	TTTTGGTTTTGG	-	-	rs144469812		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75253880_75253891delTTTTGGTTTTGG	uc002fds.2	+							NM_001906	NP_001897			chymotrypsin B1 precursor												0				BRCA - Breast invasive adenocarcinoma(221;0.166)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	77256163	77256164	+	IGR	INS	-	AC	AC	rs140079742	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77256163_77256164insAC								SYCE1L (9187 upstream) : ADAMTS18 (59862 downstream)																																			---	---	---	---
WWOX	51741	broad.mit.edu	37	16	78491807	78491807	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78491807delA	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457			WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)														---	---	---	---
PKD1L2	114780	broad.mit.edu	37	16	81143084	81143084	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81143084delG	uc002fgh.1	-						PKD1L2_uc002fgf.1_Intron|PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124			polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
PKD1L2	114780	broad.mit.edu	37	16	81253526	81253527	+	Intron	INS	-	TTATT	TTATT	rs141224532	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81253526_81253527insTTATT	uc002fgh.1	-						PKD1L2_uc002fgj.2_Intron	NM_052892	NP_443124			polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	81325040	81325040	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81325040delA								BCMO1 (293 upstream) : GAN (23531 downstream)																																			---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83692646	83692646	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83692646delT	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	83861145	83861145	+	IGR	DEL	A	-	-	rs10719516		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83861145delA								HSBP1 (14551 upstream) : MLYCD (71585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	84233700	84233701	+	IGR	INS	-	CTCCGTC	CTCCGTC	rs147791434	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84233700_84233701insCTCCGTC								ADAD2 (2928 upstream) : KCNG4 (22124 downstream)																																			---	---	---	---
ATP2C2	9914	broad.mit.edu	37	16	84411498	84411498	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84411498delC	uc002fhx.2	+						ATP2C2_uc010chj.2_Intron	NM_014861	NP_055676			ATPase, Ca++ transporting, type 2C, member 2						ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2																		---	---	---	---
CRISPLD2	83716	broad.mit.edu	37	16	84886396	84886396	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84886396delC	uc010voh.1	+						CRISPLD2_uc010vog.1_Intron|CRISPLD2_uc002fio.2_Intron|CRISPLD2_uc002fim.2_Intron|CRISPLD2_uc002fin.3_Intron	NM_031476	NP_113664			cysteine-rich secretory protein LCCL domain							extracellular region|transport vesicle					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	85381903	85381906	+	IGR	DEL	CATC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85381903_85381906delCATC								FAM92B (235789 upstream) : KIAA0182 (263123 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	85519919	85519920	+	IGR	INS	-	CT	CT	rs151061174	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85519919_85519920insCT								FAM92B (373805 upstream) : KIAA0182 (125109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	89075006	89075006	+	IGR	DEL	G	-	-	rs11346058		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89075006delG								CBFA2T3 (31605 upstream) : ACSF3 (85248 downstream)																																			---	---	---	---
MC1R	4157	broad.mit.edu	37	16	89981345	89981346	+	5'Flank	INS	-	TG	TG	rs145110534	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89981345_89981346insTG	uc002fpe.3	+						uc010ciy.1_RNA	NM_002386	NP_002377			melanocortin 1 receptor						G-protein signaling, coupled to cyclic nucleotide second messenger|intracellular protein kinase cascade|multicellular organismal development|negative regulation of tumor necrosis factor production|pigmentation|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|positive regulation of protein kinase B signaling cascade|positive regulation of protein kinase C signaling cascade|positive regulation of transcription from RNA polymerase II promoter|UV protection|UV-damage excision repair	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|ubiquitin protein ligase binding				0		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)										Melanoma_Familial_Clustering_of				---	---	---	---
DBNDD1	79007	broad.mit.edu	37	16	90073923	90073923	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90073923delG	uc002fqf.1	-						DBNDD1_uc002fqe.1_Intron|DBNDD1_uc002fqg.1_Intron	NM_001042610	NP_001036075			dysbindin (dystrobrevin binding protein 1)							cytoplasm					0		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0275)														---	---	---	---
C17orf85	55421	broad.mit.edu	37	17	3726931	3726931	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3726931delG	uc010ckl.1	-						C17orf85_uc002fwr.2_Intron|C17orf85_uc002fwq.2_Intron	NM_001114118	NP_001107590			ELG protein isoform a								nucleotide binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)														---	---	---	---
MYH3	4621	broad.mit.edu	37	17	10559938	10559938	+	5'Flank	DEL	G	-	-	rs113644288		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10559938delG	uc002gmq.1	-							NM_002470	NP_002461			myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	12322977	12322978	+	IGR	INS	-	A	A	rs141257873		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12322977_12322978insA								MAP2K4 (275927 upstream) : MYOCD (246229 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	15040832	15040833	+	IGR	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15040832_15040833delTG								HS3ST3B1 (791340 upstream) : PMP22 (92264 downstream)																																			---	---	---	---
LRRC48	83450	broad.mit.edu	37	17	17903229	17903230	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17903229_17903230delTG	uc010vxd.1	+						LRRC48_uc002gsa.2_Intron|LRRC48_uc010vxc.1_Intron|LRRC48_uc002gsb.2_Intron|LRRC48_uc010vxe.1_Intron	NM_001130090	NP_001123562			leucine rich repeat containing 48 isoform a							cytoplasm				pancreas(1)	1	all_neural(463;0.228)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	20667543	20667544	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20667543_20667544insT								LGALS9B (296695 upstream) : CCDC144NL (99166 downstream)																																			---	---	---	---
CCDC144NL	339184	broad.mit.edu	37	17	20770501	20770502	+	Intron	INS	-	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20770501_20770502insC	uc002gyf.2	-						uc002gyg.1_5'Flank|uc002gyh.1_5'Flank	NM_001004306	NP_001004306			coiled-coil domain containing 144 family,												0																		---	---	---	---
CCDC144NL	339184	broad.mit.edu	37	17	20771204	20771205	+	Intron	INS	-	A	A	rs112587391		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20771204_20771205insA	uc002gyf.2	-						uc002gyg.1_5'Flank|uc002gyh.1_5'Flank	NM_001004306	NP_001004306			coiled-coil domain containing 144 family,												0																		---	---	---	---
CCDC144NL	339184	broad.mit.edu	37	17	20772524	20772526	+	Intron	DEL	GAG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20772524_20772526delGAG	uc002gyf.2	-						uc002gyg.1_Intron|uc002gyh.1_Intron	NM_001004306	NP_001004306			coiled-coil domain containing 144 family,												0																		---	---	---	---
MAP2K3	5606	broad.mit.edu	37	17	21212384	21212388	+	Intron	DEL	CTGGT	-	-	rs138199864		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21212384_21212388delCTGGT	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731			mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	21516077	21516077	+	IGR	DEL	C	-	-	rs148789712	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21516077delC								C17orf51 (38346 upstream) : FAM27L (309293 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21556285	21556286	+	IGR	INS	-	G	G	rs150331922		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21556285_21556286insG								C17orf51 (78554 upstream) : FAM27L (269084 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25271401	25271402	+	IGR	INS	-	T	T	rs111404685		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25271401_25271402insT								None (None upstream) : WSB1 (349704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25296183	25296183	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25296183delC								None (None upstream) : WSB1 (324923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25318507	25318507	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25318507delC								None (None upstream) : WSB1 (302599 downstream)																																			---	---	---	---
KSR1	8844	broad.mit.edu	37	17	25804743	25804743	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25804743delT	uc010crg.2	+						KSR1_uc002gzj.1_Intron	NM_014238	NP_055053			kinase suppressor of ras						Ras protein signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	26533892	26533892	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26533892delT								NLK (10490 upstream) : PYY2 (19697 downstream)																																			---	---	---	---
C17orf63	55731	broad.mit.edu	37	17	27132067	27132067	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27132067delA	uc002hct.1	-						C17orf63_uc010wax.1_Intron|C17orf63_uc010way.1_Intron|C17orf63_uc002hcw.2_Intron	NM_018182	NP_060652			hypothetical protein LOC55731											ovary(1)	1	all_epithelial(6;5.06e-20)|Lung NSC(42;0.01)		Epithelial(11;3.38e-06)|all cancers(11;2.46e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.104)															---	---	---	---
SEZ6	124925	broad.mit.edu	37	17	27322366	27322366	+	Intron	DEL	G	-	-	rs111548392		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27322366delG	uc002hdp.2	-						SEZ6_uc010cry.1_Intron|SEZ6_uc002hdq.1_Intron|SEZ6_uc010crz.1_Intron	NM_178860	NP_849191			seizure related 6 homolog isoform 1							integral to membrane|plasma membrane				large_intestine(1)|central_nervous_system(1)	2	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)															---	---	---	---
NUFIP2	57532	broad.mit.edu	37	17	27596522	27596523	+	Intron	INS	-	T	T	rs71997273		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27596522_27596523insT	uc002hdy.3	-						NUFIP2_uc002hdx.3_Intron	NM_020772	NP_065823			nuclear fragile X mental retardation protein							nucleus|polysomal ribosome	protein binding|RNA binding			skin(2)|ovary(1)|breast(1)	4			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	27697787	27697787	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27697787delT								NUFIP2 (76621 upstream) : TAOK1 (20156 downstream)																																			---	---	---	---
TAOK1	57551	broad.mit.edu	37	17	27784108	27784121	+	Intron	DEL	TTTTTTTTTTTTTT	-	-	rs71138821		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27784108_27784121delTTTTTTTTTTTTTT	uc002hdz.1	+						TAOK1_uc010wbe.1_Intron|TAOK1_uc010wbf.1_Intron	NM_020791	NP_065842			TAO kinase 1						mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)															---	---	---	---
SSH2	85464	broad.mit.edu	37	17	28071879	28071880	+	Intron	DEL	GT	-	-	rs72074800		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28071879_28071880delGT	uc002heo.1	-						SSH2_uc010wbh.1_Intron|SSH2_uc002hep.1_Intron|SSH2_uc002heq.2_Intron|SSH2_uc002her.2_Intron|SSH2_uc010csc.1_Intron	NM_033389	NP_203747			slingshot 2						actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2																		---	---	---	---
SSH2	85464	broad.mit.edu	37	17	28099127	28099127	+	Intron	DEL	T	-	-	rs10718057		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28099127delT	uc002heo.1	-						SSH2_uc010wbh.1_Intron|SSH2_uc002hep.1_Intron|SSH2_uc002her.2_Intron|SSH2_uc010csc.1_Intron	NM_033389	NP_203747			slingshot 2						actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2																		---	---	---	---
RAB11FIP4	84440	broad.mit.edu	37	17	29847419	29847419	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29847419delT	uc002hgn.1	+						RAB11FIP4_uc002hgo.2_Intron	NM_032932	NP_116321			RAB11 family interacting protein 4 (class II)						cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding			skin(1)	1		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	29957464	29957465	+	IGR	INS	-	G	G	rs150952760	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29957464_29957465insG								MIR365-2 (54924 upstream) : C17orf79 (221420 downstream)																																			---	---	---	---
LRRC37B	114659	broad.mit.edu	37	17	30336133	30336134	+	Intron	INS	-	T	T	rs76151964		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30336133_30336134insT	uc010wbx.1	+							NM_052888	NP_443120			leucine rich repeat containing 37B precursor							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	30434935	30434935	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30434935delA								LRRC37B (54418 upstream) : RHOT1 (34538 downstream)																																			---	---	---	---
RHOT1	55288	broad.mit.edu	37	17	30512422	30512422	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30512422delC	uc002hgz.2	+						RHOT1_uc002hgw.2_Intron|RHOT1_uc002hgy.2_Intron|RHOT1_uc002hha.2_Intron|RHOT1_uc010csv.2_Intron|RHOT1_uc002hgx.2_Intron|RHOT1_uc010wby.1_Intron|RHOT1_uc002hhb.2_Intron|RHOT1_uc002hgv.2_Intron	NM_018307	NP_060777			ras homolog gene family, member T1 isoform 3						apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)																---	---	---	---
MYO1D	4642	broad.mit.edu	37	17	30910764	30910765	+	Intron	INS	-	T	T	rs113513489		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30910764_30910765insT	uc002hho.1	-							NM_015194	NP_056009			myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)															---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31568910	31568910	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31568910delG	uc002hhu.2	-						ACCN1_uc002hht.2_Intron	NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31903805	31903805	+	Intron	DEL	G	-	-	rs67709657		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31903805delG	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
ACCN1	40	broad.mit.edu	37	17	32141827	32141828	+	Intron	DEL	CA	-	-	rs72286309		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32141827_32141828delCA	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	32488350	32488350	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32488350delA								ACCN1 (4525 upstream) : CCL2 (93946 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	32726167	32726168	+	IGR	INS	-	AGA	AGA	rs149553607	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32726167_32726168insAGA								CCL1 (35915 upstream) : C17orf102 (174974 downstream)																																			---	---	---	---
AP2B1	163	broad.mit.edu	37	17	33970046	33970047	+	Intron	INS	-	T	T	rs74384531		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33970046_33970047insT	uc002hjr.2	+						AP2B1_uc002hjq.2_Intron|AP2B1_uc010wci.1_Intron|AP2B1_uc002hjs.2_Intron|AP2B1_uc002hjt.2_Intron|AP2B1_uc010ctv.2_Intron|AP2B1_uc010wcj.1_Intron	NM_001282	NP_001273			adaptor-related protein complex 2, beta 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|coated pit|cytosol|endocytic vesicle membrane|plasma membrane	clathrin binding|protein transporter activity			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)														---	---	---	---
MMP28	79148	broad.mit.edu	37	17	34097734	34097735	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34097734_34097735delTG	uc002hjy.1	-						MMP28_uc002hjw.1_Intron|MMP28_uc002hjz.1_Intron	NM_024302	NP_077278			matrix metalloproteinase 28 isoform 1						proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	34981781	34981798	+	IGR	DEL	TCTTCTTCTTCCTCTTCC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34981781_34981798delTCTTCTTCTTCCTCTTCC								MRM1 (16375 upstream) : LHX1 (312701 downstream)																																			---	---	---	---
ACACA	31	broad.mit.edu	37	17	35750099	35750099	+	Intron	DEL	A	-	-	rs11286732		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35750099delA	uc002hno.2	-						ACACA_uc002hnn.2_Intron|ACACA_uc002hnq.2_Intron	NM_198834	NP_942131			acetyl-Coenzyme A carboxylase alpha isoform 1						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)													---	---	---	---
HNF1B	6928	broad.mit.edu	37	17	36070181	36070183	+	Intron	DEL	GAT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36070181_36070183delGAT	uc002hok.3	-						HNF1B_uc010wdi.1_Intron	NM_000458	NP_000449			hepatocyte nuclear factor 1-beta isoform 1						endocrine pancreas development|genitalia development|kidney development|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric nephron tubule development|regulation of pronephros size	nucleus	DNA binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)											Hereditary_Prostate_Cancer				---	---	---	---
SRCIN1	80725	broad.mit.edu	37	17	36726867	36726868	+	Intron	INS	-	G	G	rs138662730	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36726867_36726868insG	uc002hqd.2	-						SRCIN1_uc002hqe.2_Intron|SRCIN1_uc002hqh.1_Intron	NM_025248	NP_079524			SNAP25-interacting protein						exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0																		---	---	---	---
FBXL20	84961	broad.mit.edu	37	17	37483135	37483136	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37483135_37483136insT	uc010wed.1	-						FBXL20_uc002hrt.2_Intron|FBXL20_uc010cvu.2_Intron	NM_032875	NP_116264			F-box and leucine-rich repeat protein 20							cytoplasm				ovary(1)	1			LUAD - Lung adenocarcinoma(14;0.146)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	37614826	37614827	+	IGR	INS	-	T	T	rs34430019		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37614826_37614827insT								MED1 (7299 upstream) : CDK12 (2912 downstream)																																			---	---	---	---
MED24	9862	broad.mit.edu	37	17	38196005	38196005	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38196005delG	uc002htt.2	-						MED24_uc010wet.1_Intron|MED24_uc002hts.2_Intron|MED24_uc002htu.2_Intron|MED24_uc010cwn.2_Intron|MED24_uc010weu.1_Intron|MED24_uc010wev.1_Intron|MED24_uc010wew.1_Intron|MED24_uc010wex.1_Intron|MED24_uc010wfa.1_Intron|MED24_uc010wfb.1_Intron|MED24_uc010wfc.1_Intron	NM_014815	NP_055630			mediator complex subunit 24 isoform 1						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1	Colorectal(19;0.000442)																	---	---	---	---
THRA	7067	broad.mit.edu	37	17	38225551	38225552	+	Intron	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38225551_38225552delTC	uc002htw.2	+						THRA_uc010cwp.1_Intron|THRA_uc002htv.2_Intron|THRA_uc002htx.2_Intron	NM_003250	NP_003241			thyroid hormone receptor, alpha isoform 2						negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|negative regulation of transcription initiation, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription from RNA polymerase II promoter	cytosol|nucleoplasm	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|TBP-class protein binding|thyroid hormone binding|thyroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding				0	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Levothyroxine(DB00451)|Liothyronine(DB00279)													---	---	---	---
KRT24	192666	broad.mit.edu	37	17	38862758	38862758	+	5'Flank	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38862758delT	uc002hvd.2	-							NM_019016	NP_061889			keratin 24							cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.00526)																---	---	---	---
JUP	3728	broad.mit.edu	37	17	39806163	39806164	+	Intron	INS	-	ACAC	ACAC	rs144330925	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39806163_39806164insACAC	uc010wfs.1	-							NM_021991	NP_068831			junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	41494382	41494382	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41494382delC								ARL4D (15879 upstream) : MIR2117 (27792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	42610163	42610163	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42610163delA								GPATCH8 (29361 upstream) : FZD2 (24762 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	43654859	43654860	+	IGR	INS	-	A	A	rs138744706		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43654859_43654860insA								LRRC37A4 (59343 upstream) : LOC644172 (22631 downstream)																																			---	---	---	---
LOC644172	644172	broad.mit.edu	37	17	43679861	43679864	+	5'Flank	DEL	TTTC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43679861_43679864delTTTC	uc010wjw.1	-							NR_026901				Homo sapiens cDNA clone IMAGE:3941904, partial cds.												0																		---	---	---	---
LOC100128977	100128977	broad.mit.edu	37	17	43932467	43932468	+	Intron	INS	-	A	A	rs74268087		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43932467_43932468insA	uc010wjz.1	-							NR_024559				Homo sapiens cDNA clone IMAGE:4819956.												0																		---	---	---	---
KIAA1267	284058	broad.mit.edu	37	17	44170851	44170852	+	Intron	DEL	AT	-	-	rs66483561		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44170851_44170852delAT	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258			hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)																---	---	---	---
KIAA1267	284058	broad.mit.edu	37	17	44212909	44212909	+	Intron	DEL	T	-	-	rs71886214		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44212909delT	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258			hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	44566824	44566825	+	IGR	INS	-	TTTG	TTTG			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44566824_44566825insTTTG								ARL17A (127661 upstream) : LRRC37A2 (23251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	45539816	45539817	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45539816_45539817insA	uc002ilp.1	-						uc002ilq.2_Intron					Homo sapiens cDNA clone IMAGE:5266250, containing frame-shift errors.																														---	---	---	---
TTLL6	284076	broad.mit.edu	37	17	46861131	46861131	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46861131delT	uc010wlo.1	-						TTLL6_uc002iob.2_Intron|TTLL6_uc010dbi.2_Intron|TTLL6_uc002ioc.2_Intron|TTLL6_uc002iod.2_Intron	NM_001130918	NP_001124390			tubulin tyrosine ligase-like family, member 6							cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity				0																		---	---	---	---
CALCOCO2	10241	broad.mit.edu	37	17	46918190	46918190	+	Intron	DEL	A	-	-	rs77301040		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46918190delA	uc002iof.2	+						CALCOCO2_uc010wlp.1_Intron|CALCOCO2_uc010wlq.1_Intron|CALCOCO2_uc010wlr.1_Intron|CALCOCO2_uc010wls.1_Intron	NM_005831	NP_005822			calcium binding and coiled-coil domain 2						response to interferon-gamma|viral reproduction	cytoskeleton|Golgi apparatus|nucleus|perinuclear region of cytoplasm|soluble fraction	protein homodimerization activity			ovary(1)	1																		---	---	---	---
B4GALNT2	124872	broad.mit.edu	37	17	47218385	47218386	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47218385_47218386insT	uc002ion.2	+						B4GALNT2_uc010wlt.1_Intron|B4GALNT2_uc010wlu.1_Intron	NM_153446	NP_703147			beta-1,4-N-acetyl-galactosaminyl transferase 2						lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity			large_intestine(1)|ovary(1)	2			all cancers(6;0.000316)															---	---	---	---
SPAG9	9043	broad.mit.edu	37	17	49188476	49188477	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49188476_49188477insA	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron	NM_001130528	NP_001124000			sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	51777976	51777976	+	IGR	DEL	T	-	-	rs66604590		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51777976delT								None (None upstream) : KIF2B (122263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	51853783	51853783	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51853783delC								None (None upstream) : KIF2B (46456 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52288544	52288544	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52288544delC								KIF2B (385971 upstream) : TOM1L1 (689508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52477765	52477766	+	IGR	DEL	AG	-	-	rs72504380		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52477765_52477766delAG								KIF2B (575192 upstream) : TOM1L1 (500286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52741856	52741856	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52741856delG								KIF2B (839283 upstream) : TOM1L1 (236196 downstream)																																			---	---	---	---
PCTP	58488	broad.mit.edu	37	17	53852645	53852645	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53852645delT	uc002iul.3	+						PCTP_uc002ium.3_Intron|PCTP_uc010dcg.2_Intron|PCTP_uc010dch.2_Intron	NM_021213	NP_067036			phosphatidylcholine transfer protein isoform 1							cytosol	phosphatidylcholine binding|phosphatidylcholine transmembrane transporter activity			lung(1)	1			BRCA - Breast invasive adenocarcinoma(1;0.00207)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	54718181	54718182	+	IGR	INS	-	GATGGATGGATGGATG	GATGGATGGATGGATG	rs143904690	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54718181_54718182insGATGGATGGATGGATG								NOG (45230 upstream) : C17orf67 (151093 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	55159466	55159466	+	IGR	DEL	T	-	-	rs71363888		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55159466delT								RNF126P1 (35311 upstream) : AKAP1 (3087 downstream)																																			---	---	---	---
MSI2	124540	broad.mit.edu	37	17	55336860	55336860	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55336860delG	uc002iuz.1	+						MSI2_uc010wnm.1_Intron|MSI2_uc002iva.2_Intron|MSI2_uc002ivb.2_5'Flank	NM_138962	NP_620412			musashi 2 isoform a							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)				T	HOXA9	CML								---	---	---	---
MSI2	124540	broad.mit.edu	37	17	55358175	55358176	+	Intron	INS	-	A	A	rs147988117	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55358175_55358176insA	uc002iuz.1	+						MSI2_uc010wnm.1_Intron|MSI2_uc002iva.2_Intron	NM_138962	NP_620412			musashi 2 isoform a							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)				T	HOXA9	CML								---	---	---	---
CUEDC1	404093	broad.mit.edu	37	17	56028826	56028827	+	Intron	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56028826_56028827delTT	uc002ive.1	-							NM_017949	NP_060419			CUE domain-containing 1											skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	56237799	56237800	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56237799_56237800insA								MSX2P1 (1321 upstream) : OR4D2 (9217 downstream)																																			---	---	---	---
RNF43	54894	broad.mit.edu	37	17	56446430	56446431	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56446430_56446431delAC	uc002iwf.2	-						RNF43_uc010wnv.1_Intron|RNF43_uc002iwh.3_Intron|RNF43_uc002iwg.3_Intron|RNF43_uc010dcw.2_Intron	NM_017763	NP_060233			ring finger protein 43 precursor							endoplasmic reticulum membrane|integral to membrane|nuclear envelope	ligase activity|protein binding|zinc ion binding			ovary(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
TMEM49	81671	broad.mit.edu	37	17	57860158	57860158	+	Intron	DEL	G	-	-	rs35519306		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57860158delG	uc002ixu.3	+						TMEM49_uc010wog.1_Intron|TMEM49_uc010woh.1_Intron|TMEM49_uc010woi.1_Intron|TMEM49_uc010woj.1_Intron	NM_030938	NP_112200			transmembrane protein 49						autophagy|cell adhesion	endoplasmic reticulum|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane|vacuolar membrane					0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;1.15e-09)|all cancers(12;1.15e-08)															---	---	---	---
RPS6KB1	6198	broad.mit.edu	37	17	57984901	57984902	+	Intron	INS	-	T	T	rs113454749		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57984901_57984902insT	uc002ixy.2	+						RPS6KB1_uc010ddj.1_Intron|RPS6KB1_uc010wom.1_Intron|RPS6KB1_uc010won.1_Intron	NM_003161	NP_003152			ribosomal protein S6 kinase, 70kDa, polypeptide						apoptosis|G1/S transition of mitotic cell cycle|insulin receptor signaling pathway|negative regulation of apoptosis|phosphatidylinositol-mediated signaling|positive regulation of mitotic cell cycle|positive regulation of translational initiation|TOR signaling cascade	cell junction|cytoplasm|cytosol|mitochondrial outer membrane|nucleus|nucleus|synapse|synaptosome	ATP binding|protein binding|protein kinase activity			large_intestine(1)	1	all_cancers(5;1.63e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.57e-12)|all cancers(12;6.41e-11)															---	---	---	---
MED13	9969	broad.mit.edu	37	17	60066376	60066376	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60066376delT	uc002izo.2	-							NM_005121	NP_005112			mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
MARCH10	162333	broad.mit.edu	37	17	60817445	60817446	+	Intron	DEL	GT	-	-	rs72034322		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60817445_60817446delGT	uc010ddr.2	-						MARCH10_uc002jag.3_Intron|MARCH10_uc010dds.2_Intron|MARCH10_uc002jah.2_Intron	NM_001100875	NP_001094345			ring finger protein 190								ligase activity|zinc ion binding				0																		---	---	---	---
TANC2	26115	broad.mit.edu	37	17	61141036	61141037	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61141036_61141037delTG	uc002jal.3	+							NM_025185	NP_079461			tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2																		---	---	---	---
TANC2	26115	broad.mit.edu	37	17	61409218	61409219	+	Intron	DEL	TG	-	-	rs72013408		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61409218_61409219delTG	uc002jal.3	+						TANC2_uc010wpe.1_Intron	NM_025185	NP_079461			tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2																		---	---	---	---
CCDC47	57003	broad.mit.edu	37	17	61842481	61842482	+	Intron	DEL	CA	-	-	rs56697502		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61842481_61842482delCA	uc002jbs.3	-						CCDC47_uc010ddx.2_Intron|CCDC47_uc002jbt.2_Intron	NM_020198	NP_064583			coiled-coil domain containing 47 precursor							integral to membrane	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	62001221	62001222	+	IGR	DEL	TA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62001221_62001222delTA								GH1 (5023 upstream) : CD79B (4876 downstream)																																			---	---	---	---
TEX2	55852	broad.mit.edu	37	17	62295609	62295609	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62295609delA	uc002jec.2	-						TEX2_uc002jed.2_Intron|TEX2_uc002jee.2_Intron	NM_018469	NP_060939			testis expressed sequence 2						signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)														---	---	---	---
SMURF2	64750	broad.mit.edu	37	17	62561731	62561731	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62561731delA	uc002jep.1	-						SMURF2_uc002jeq.1_Intron|SMURF2_uc002jer.1_Intron	NM_022739	NP_073576			SMAD specific E3 ubiquitin protein ligase 2						BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|membrane raft|nucleus|plasma membrane|ubiquitin ligase complex	identical protein binding|SMAD binding|ubiquitin-protein ligase activity			skin(3)|lung(1)	4	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	62985772	62985772	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62985772delG								AMZ2P1 (14069 upstream) : GNA13 (19637 downstream)																																			---	---	---	---
CCDC46	201134	broad.mit.edu	37	17	63728391	63728391	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63728391delA	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron|CCDC46_uc002jfk.2_Intron	NM_145036	NP_659473			coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)															---	---	---	---
CCDC46	201134	broad.mit.edu	37	17	63949791	63949792	+	Intron	INS	-	G	G	rs141914993	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63949791_63949792insG	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473			coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)															---	---	---	---
PRKCA	5578	broad.mit.edu	37	17	64380764	64380765	+	Intron	INS	-	C	C	rs74838983		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64380764_64380765insC	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728			protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)													---	---	---	---
PRKCA	5578	broad.mit.edu	37	17	64553562	64553563	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64553562_64553563insA	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728			protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	64906420	64906421	+	IGR	INS	-	T	T	rs148528864		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64906420_64906421insT								CACNG5 (25064 upstream) : CACNG4 (54592 downstream)																																			---	---	---	---
HELZ	9931	broad.mit.edu	37	17	65081670	65081671	+	Intron	INS	-	T	T	rs149918669	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65081670_65081671insT	uc010wqk.1	-						HELZ_uc002jfv.3_Intron|HELZ_uc002jfx.3_Intron	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)																	---	---	---	---
PITPNC1	26207	broad.mit.edu	37	17	65477893	65477894	+	Intron	INS	-	A	A	rs5821473		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65477893_65477894insA	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549			phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)															---	---	---	---
PITPNC1	26207	broad.mit.edu	37	17	65485349	65485349	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65485349delT	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549			phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)															---	---	---	---
ARSG	22901	broad.mit.edu	37	17	66314243	66314243	+	Intron	DEL	A	-	-	rs34478147		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66314243delA	uc002jhc.2	+						ARSG_uc002jhb.1_Intron	NM_014960	NP_055775			Arylsulfatase G precursor						sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	67381644	67381645	+	IGR	INS	-	AA	AA	rs55688784		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67381644_67381645insAA								ABCA5 (58321 upstream) : MAP2K6 (29193 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68177825	68177825	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68177825delT								KCNJ2 (1644 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68964782	68964782	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68964782delA								KCNJ2 (788601 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69011995	69011995	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69011995delT								KCNJ2 (835814 upstream) : None (None downstream)																																			---	---	---	---
SOX9	6662	broad.mit.edu	37	17	70122506	70122506	+	3'UTR	DEL	T	-	-	rs67544543		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70122506delT	uc002jiw.2	+	3						NM_000346	NP_000337			transcription factor SOX9						cAMP-mediated signaling|negative regulation of transcription, DNA-dependent|positive regulation of branching involved in ureteric bud morphogenesis|protein complex assembly|renal vesicle induction	nucleus|protein complex	core promoter sequence-specific DNA binding|enhancer binding|protein kinase A catalytic subunit binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription				0		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	70438339	70438339	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70438339delA	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																														---	---	---	---
SLC39A11	201266	broad.mit.edu	37	17	70769784	70769785	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70769784_70769785delAC	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron	NM_001159770	NP_001153242			solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1																		---	---	---	---
SLC39A11	201266	broad.mit.edu	37	17	71033377	71033377	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71033377delA	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242			solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	71182213	71182213	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71182213delA								SSTR2 (14153 upstream) : COG1 (6960 downstream)																																			---	---	---	---
CDC42EP4	23580	broad.mit.edu	37	17	71294150	71294151	+	Intron	INS	-	AC	AC	rs66555137		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71294150_71294151insAC	uc002jjn.2	-						CDC42EP4_uc002jjo.2_Intron|CDC42EP4_uc002jjp.1_Intron	NM_012121	NP_036253			Cdc42 effector protein 4						positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|cytoplasm|endomembrane system|membrane|microtubule cytoskeleton	GTP-Rho binding				0			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	71935448	71935449	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71935448_71935449delAC								C17orf54 (110772 upstream) : RPL38 (264346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	71970003	71970003	+	IGR	DEL	C	-	-	rs35430063		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71970003delC								C17orf54 (145327 upstream) : RPL38 (229792 downstream)																																			---	---	---	---
TTYH2	94015	broad.mit.edu	37	17	72236578	72236578	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72236578delA	uc002jkc.2	+						TTYH2_uc010wqw.1_Intron	NM_032646	NP_116035			tweety 2 isoform 1							chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	73071313	73071314	+	IGR	INS	-	AC	AC			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73071313_73071314insAC								KCTD2 (9334 upstream) : SLC16A5 (12508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	73191218	73191219	+	IGR	DEL	TG	-	-	rs112475854		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73191218_73191219delTG								SUMO2 (12120 upstream) : NUP85 (10378 downstream)																																			---	---	---	---
GRB2	2885	broad.mit.edu	37	17	73326789	73326789	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73326789delA	uc002jnx.3	-						GRB2_uc002jny.3_Intron	NM_002086	NP_002077			growth factor receptor-bound protein 2 isoform						axon guidance|blood coagulation|cell junction assembly|cell-cell signaling|cellular response to ionizing radiation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|receptor internalization|signal transduction in response to DNA damage|T cell costimulation	cytosol|Golgi apparatus	epidermal growth factor receptor binding|insulin receptor substrate binding|SH3/SH2 adaptor activity			ovary(3)	3	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	74247286	74247288	+	IGR	DEL	GTT	-	-	rs35206928		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74247286_74247288delGTT								RNF157 (10896 upstream) : FAM100B (13998 downstream)																																			---	---	---	---
UBE2O	63893	broad.mit.edu	37	17	74402689	74402690	+	Intron	INS	-	A	A	rs35739452		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74402689_74402690insA	uc002jrm.3	-						UBE2O_uc002jrn.3_Intron	NM_022066	NP_071349			ubiquitin-conjugating enzyme E2O								ATP binding|ubiquitin-protein ligase activity			breast(2)|skin(2)|lung(1)	5																		---	---	---	---
CYGB	114757	broad.mit.edu	37	17	74543935	74543936	+	Intron	DEL	AG	-	-	rs59850498		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74543935_74543936delAG	uc002jrv.1	-						PRCD_uc002jrz.1_Intron	NM_134268	NP_599030			cytoglobin						response to oxidative stress	cytoplasm	heme binding|oxygen binding|oxygen transporter activity|peroxidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	74838802	74838803	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74838802_74838803insA								MFSD11 (63466 upstream) : MGAT5B (25995 downstream)																																			---	---	---	---
SEPT9	10801	broad.mit.edu	37	17	75409170	75409171	+	Intron	DEL	GT	-	-	rs3047410		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75409170_75409171delGT	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron|SEPT9_uc002jtv.2_Intron|SEPT9_uc002jtw.2_Intron|SEPT9_uc002jtx.1_Intron|SEPT9_uc010wtl.1_Intron	NM_001113491	NP_001106963			septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	75713189	75713192	+	IGR	DEL	TGTG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75713189_75713192delTGTG								SEPT9 (216513 upstream) : FLJ45079 (161917 downstream)																																			---	---	---	---
SYNGR2	9144	broad.mit.edu	37	17	76165338	76165343	+	Intron	DEL	TGTGTG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76165338_76165343delTGTGTG	uc002juu.1	+						SYNGR2_uc002jut.2_Intron|SYNGR2_uc002juv.1_Intron|SYNGR2_uc010dhi.1_Intron	NM_004710	NP_004701			synaptogyrin 2							integral to plasma membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.0994)															---	---	---	---
TK1	7083	broad.mit.edu	37	17	76177196	76177199	+	Intron	DEL	GCAC	-	-	rs111477915		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76177196_76177199delGCAC	uc002juw.2	-						TK1_uc002jux.2_Intron	NM_003258	NP_003249			thymidine kinase 1						DNA replication|protein homotetramerization|pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|thymidine kinase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.0804)|Lung(188;0.23)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	76311092	76311092	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76311092delC								LOC283999 (74025 upstream) : SOCS3 (41767 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	76330261	76330261	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76330261delT								LOC283999 (93194 upstream) : SOCS3 (22598 downstream)																																			---	---	---	---
HRNBP3	146713	broad.mit.edu	37	17	77371440	77371441	+	Intron	INS	-	AC	AC	rs55904215		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77371440_77371441insAC	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044			hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	77854955	77854956	+	IGR	INS	-	T	T	rs34420382		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77854955_77854956insT								CBX4 (41742 upstream) : TBC1D16 (58865 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	77887447	77887447	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77887447delG								CBX4 (74234 upstream) : TBC1D16 (26374 downstream)																																			---	---	---	---
TBC1D16	125058	broad.mit.edu	37	17	77958359	77958360	+	Intron	INS	-	AGAAAGAG	AGAAAGAG	rs141654166	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77958359_77958360insAGAAAGAG	uc002jxj.2	-							NM_019020	NP_061893			TBC1 domain family, member 16							intracellular	Rab GTPase activator activity				0	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)															---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78684372	78684379	+	Intron	DEL	TGTGTGTG	-	-	rs71951798		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78684372_78684379delTGTGTGTG	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78888490	78888490	+	Intron	DEL	C	-	-	rs35477815		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78888490delC	uc002jyt.1	+						RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78901407	78901410	+	Intron	DEL	TGTC	-	-	rs72031769	byFrequency	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78901407_78901410delTGTC	uc002jyt.1	+						RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	79445272	79445273	+	IGR	INS	-	G	G	rs141462773	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79445272_79445273insG								BAHCC1 (11914 upstream) : ACTG1 (31726 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	79459567	79459568	+	IGR	INS	-	G	G	rs146142763	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79459567_79459568insG								BAHCC1 (26209 upstream) : ACTG1 (17431 downstream)																																			---	---	---	---
NPLOC4	55666	broad.mit.edu	37	17	79601615	79601616	+	Intron	INS	-	T	T	rs149979398		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79601615_79601616insT	uc002kat.3	-						NPLOC4_uc002kau.3_Intron|NPLOC4_uc010wur.1_Intron|uc002kav.1_5'Flank	NM_017921	NP_060391			nuclear protein localization 4						cellular membrane fusion|ER-associated protein catabolic process|Golgi organization	cytosol|endoplasmic reticulum|nuclear outer membrane-endoplasmic reticulum membrane network|nucleus	zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)															---	---	---	---
HGS	9146	broad.mit.edu	37	17	79667664	79667669	+	Intron	DEL	CCAGCC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79667664_79667669delCCAGCC	uc002kbg.2	+						MRPL12_uc002kbh.1_5'Flank|SLC25A10_uc010wut.1_5'Flank	NM_004712	NP_004703			hepatocyte growth factor-regulated tyrosine						cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of JAK-STAT cascade|regulation of protein catabolic process	cytosol|early endosome membrane|multivesicular body membrane	metal ion binding|protein domain specific binding			ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	79777769	79777791	+	IGR	DEL	TCCCCTCCCCCTCCTCACCCCAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79777769_79777791delTCCCCTCCCCCTCCTCACCCCAA								GCGR (5880 upstream) : FAM195B (2502 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	79837880	79837881	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79837880_79837881insA								ARHGDIA (8642 upstream) : THOC4 (7830 downstream)																																			---	---	---	---
ASPSCR1	79058	broad.mit.edu	37	17	79964088	79964089	+	Intron	DEL	GT	-	-	rs149709274		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79964088_79964089delGT	uc002kcx.2	+						ASPSCR1_uc002kcw.1_Intron|ASPSCR1_uc002kcy.2_Intron|ASPSCR1_uc002kcz.2_Intron|ASPSCR1_uc002kda.2_Intron|ASPSCR1_uc002kdb.1_Intron	NM_024083	NP_076988			alveolar soft part sarcoma chromosome region,								protein binding		ASPSCR1/TFE3(161)	soft_tissue(118)|kidney(43)|breast(1)	162	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)					T	TFE3	alveolar soft part sarcoma								---	---	---	---
Unknown	0	broad.mit.edu	37	17	80309098	80309099	+	IGR	INS	-	A	A	rs149311368	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80309098_80309099insA								SECTM1 (17177 upstream) : TEX19 (8025 downstream)																																			---	---	---	---
FOXK2	3607	broad.mit.edu	37	17	80519563	80519563	+	Intron	DEL	C	-	-	rs142663885		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80519563delC	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505			forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)															---	---	---	---
TBCD	6904	broad.mit.edu	37	17	80777653	80777653	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80777653delA	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron	NM_005993	NP_005984			beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)															---	---	---	---
C18orf2	56651	broad.mit.edu	37	18	1358932	1358932	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1358932delA	uc002klb.1	-						C18orf2_uc002klg.2_Intron|C18orf2_uc002klc.1_Intron|C18orf2_uc010dki.1_Intron|C18orf2_uc002kld.1_Intron|C18orf2_uc002kle.1_5'Flank|C18orf2_uc002klf.1_5'Flank					Homo sapiens C18orf2 isoform 1 mRNA, complete sequence, alternatively spliced.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	3395470	3395470	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3395470delA								MYL12B (117190 upstream) : TGIF1 (16602 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	5664270	5664270	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5664270delT								EPB41L3 (33628 upstream) : TMEM200C (225914 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	5930676	5930677	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5930676_5930677delCA								TMEM200C (38573 upstream) : L3MBTL4 (24029 downstream)																																			---	---	---	---
ARHGAP28	79822	broad.mit.edu	37	18	6883091	6883091	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6883091delA	uc010wzi.1	+						ARHGAP28_uc002knc.2_Intron|ARHGAP28_uc002knd.2_Intron|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_Intron					SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)																---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	7772449	7772462	+	Intron	DEL	TTCCTTCCTTCCTT	-	-	rs57297040		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7772449_7772462delTTCCTTCCTTCCTT	uc002knn.3	+						PTPRM_uc010dkv.2_Intron	NM_002845	NP_002836			protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	8469436	8469437	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8469436_8469437insT								PTPRM (62578 upstream) : RAB12 (139998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	9426660	9426661	+	IGR	DEL	AA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9426660_9426661delAA								TWSG1 (24243 upstream) : RALBP1 (48346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	10329521	10329521	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10329521delG								VAPA (369504 upstream) : APCDD1 (125104 downstream)																																			---	---	---	---
FAM38B	63895	broad.mit.edu	37	18	10687489	10687494	+	Intron	DEL	CTTAGT	-	-	rs112523521		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10687489_10687494delCTTAGT	uc002kor.3	-						FAM38B_uc002koq.2_Intron	NM_022068	NP_071351			family with sequence similarity 38, member B							integral to membrane	ion channel activity			ovary(1)	1																		---	---	---	---
GNAL	2774	broad.mit.edu	37	18	11699370	11699370	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11699370delT	uc002kqc.2	+							NM_182978	NP_892023			guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	12289422	12289422	+	IGR	DEL	G	-	-	rs28413807	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12289422delG								CIDEA (11830 upstream) : TUBB6 (18818 downstream)																																			---	---	---	---
AFG3L2	10939	broad.mit.edu	37	18	12340919	12340919	+	Intron	DEL	T	-	-	rs71369925		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12340919delT	uc002kqz.1	-							NM_006796	NP_006787			AFG3 ATPase family gene 3-like 2						cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)													---	---	---	---
SPIRE1	56907	broad.mit.edu	37	18	12600864	12600865	+	Intron	INS	-	G	G	rs146835811	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12600864_12600865insG	uc002kre.2	-						SPIRE1_uc002krc.2_Intron|SPIRE1_uc010wzw.1_Intron|SPIRE1_uc010wzx.1_Intron|SPIRE1_uc010wzy.1_Intron	NM_001128626	NP_001122098			spire homolog 1 isoform a							cytoskeleton|perinuclear region of cytoplasm	actin binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	14213076	14213076	+	IGR	DEL	C	-	-	rs75328904		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14213076delC								ZNF519 (80647 upstream) : LOC284233 (124346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	14397727	14397727	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14397727delT								LOC284233 (55205 upstream) : CXADRP3 (80229 downstream)																																			---	---	---	---
ANKRD30B	374860	broad.mit.edu	37	18	14773661	14773661	+	Intron	DEL	T	-	-	rs144152261		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14773661delT	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501			ankyrin repeat domain 30B											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	15182215	15182215	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15182215delT								ANKRD30B (329478 upstream) : LOC644669 (131340 downstream)																																			---	---	---	---
ESCO1	114799	broad.mit.edu	37	18	19160303	19160305	+	Intron	DEL	ATT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19160303_19160305delATT	uc002kth.1	-						ESCO1_uc002kti.1_Intron	NM_052911	NP_443143			establishment of cohesion 1 homolog 1						cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding				0																		---	---	---	---
ESCO1	114799	broad.mit.edu	37	18	19178304	19178304	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19178304delA	uc002kth.1	-						ESCO1_uc002kti.1_Intron	NM_052911	NP_443143			establishment of cohesion 1 homolog 1						cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	20674632	20674632	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20674632delC								RBBP8 (68187 upstream) : CABLES1 (39896 downstream)																																			---	---	---	---
C18orf45	85019	broad.mit.edu	37	18	20934863	20934864	+	Intron	INS	-	TTCA	TTCA	rs148313637	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20934863_20934864insTTCA	uc002kuf.2	-						C18orf45_uc010xaq.1_Intron|C18orf45_uc010xar.1_Intron|C18orf45_uc002kug.2_Intron|C18orf45_uc002kuh.2_Intron	NM_032933	NP_116322			hypothetical protein LOC85019							integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)																	---	---	---	---
C18orf8	29919	broad.mit.edu	37	18	21108849	21108849	+	Intron	DEL	T	-	-	rs112216095		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21108849delT	uc010xax.1	+						C18orf8_uc002kul.2_Intron|C18orf8_uc010xay.1_Intron|NPC1_uc010dlu.1_RNA	NM_013326	NP_037458			colon cancer-associated protein Mic1											ovary(1)	1	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)																	---	---	---	---
LAMA3	3909	broad.mit.edu	37	18	21382858	21382858	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21382858delA	uc002kuq.2	+						LAMA3_uc002kur.2_Intron	NM_198129	NP_937762			laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	18	22217706	22217707	+	Intron	DEL	AC	-	-	rs150814658		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22217706_22217707delAC	uc002kvj.1	+											Homo sapiens cDNA FLJ42358 fis, clone UTERU2023262.																														---	---	---	---
CHST9	83539	broad.mit.edu	37	18	24490288	24490295	+	3'UTR	DEL	ACCTCACT	-	-	rs11278668		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24490288_24490295delACCTCACT	uc002kwd.2	-	5					C18orf16_uc002kwb.2_Intron|C18orf16_uc010xbm.1_Intron|CHST9_uc002kwc.2_3'UTR|CHST9_uc002kwe.2_3'UTR	NM_031422	NP_113610			GalNAc-4-sulfotransferase 2						carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			ovary(2)|skin(1)	3	all_lung(6;0.0145)|Ovarian(20;0.124)																	---	---	---	---
Unknown	0	broad.mit.edu	37	18	25146292	25146293	+	Intron	INS	-	TT	TT	rs149103159	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25146292_25146293insTT	uc002kwf.1	-											Homo sapiens cDNA FLJ45994 fis, clone SKMUS2009557.																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	25293375	25293375	+	IGR	DEL	C	-	-	rs34760545		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25293375delC								C18orf16 (522725 upstream) : CDH2 (237555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	25324926	25324928	+	IGR	DEL	ATC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25324926_25324928delATC								C18orf16 (554276 upstream) : CDH2 (206002 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	27533079	27533080	+	IGR	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27533079_27533080delTT								None (None upstream) : MIR302F (345796 downstream)																																			---	---	---	---
RNF125	54941	broad.mit.edu	37	18	29618294	29618294	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29618294delG	uc002kxf.1	+							NM_017831	NP_060301			ring finger protein 125						negative regulation of type I interferon production	intracellular	ligase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	32734407	32734407	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32734407delT								MAPRE2 (12030 upstream) : ZNF397 (86591 downstream)																																			---	---	---	---
CELF4	56853	broad.mit.edu	37	18	35095250	35095250	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35095250delT	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565			bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2																		---	---	---	---
CELF4	56853	broad.mit.edu	37	18	35112598	35112598	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35112598delA	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565			bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	38694155	38694156	+	IGR	INS	-	GT	GT	rs140292635	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38694155_38694156insGT								None (None upstream) : KC6 (366082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	39137697	39137697	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39137697delC								KC6 (37136 upstream) : PIK3C3 (397502 downstream)																																			---	---	---	---
MYO5B	4645	broad.mit.edu	37	18	47368466	47368466	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47368466delA	uc002leb.2	-						MYO5B_uc002ldz.2_Intron|MYO5B_uc002lea.2_Intron	NM_001080467	NP_001073936			myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)														---	---	---	---
DCC	1630	broad.mit.edu	37	18	50292184	50292184	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50292184delG	uc002lfe.1	+						DCC_uc010xdr.1_Intron	NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	59272619	59272619	+	IGR	DEL	A	-	-	rs67259135		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59272619delA								CDH20 (50254 upstream) : RNF152 (209685 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	59321145	59321145	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59321145delT								CDH20 (98780 upstream) : RNF152 (161159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	59434108	59434109	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59434108_59434109delAC								CDH20 (211743 upstream) : RNF152 (48195 downstream)																																			---	---	---	---
PIGN	23556	broad.mit.edu	37	18	59845834	59845834	+	Intron	DEL	A	-	-	rs67310031		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59845834delA	uc002lii.3	-						PIGN_uc002lij.3_Intron	NM_176787	NP_789744			phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5		Colorectal(73;0.187)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	62307233	62307236	+	IGR	DEL	TGTA	-	-	rs150694766		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62307233_62307236delTGTA								C18orf20 (490973 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	62523630	62523630	+	IGR	DEL	T	-	-	rs144877949		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62523630delT								C18orf20 (707370 upstream) : CDH7 (893858 downstream)																																			---	---	---	---
CDH7	1005	broad.mit.edu	37	18	63466911	63466912	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63466911_63466912insA	uc002ljz.2	+						CDH7_uc002lka.2_Intron|CDH7_uc002lkb.2_Intron	NM_033646	NP_387450			cadherin 7, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	64025754	64025754	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64025754delC								CDH7 (477580 upstream) : CDH19 (145567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	65042307	65042307	+	IGR	DEL	T	-	-	rs75002100		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65042307delT								CDH19 (771091 upstream) : DSEL (131512 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	66238239	66238239	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66238239delA								None (None upstream) : TMX3 (102688 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	68363839	68363839	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68363839delT								SOCS6 (366405 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	73107755	73107756	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73107755_73107756insA								TSHZ1 (105855 upstream) : C18orf62 (14071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	73323972	73323972	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73323972delG								C18orf62 (184383 upstream) : ZNF516 (747647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	388338	388339	+	IGR	INS	-	CG	CG	rs149583847	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:388338_388339insCG								THEG (12329 upstream) : C2CD4C (17105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	836187	836187	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:836187delA								AZU1 (4170 upstream) : PRTN3 (4798 downstream)																																			---	---	---	---
DAZAP1	26528	broad.mit.edu	37	19	1417730	1417731	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1417730_1417731insT	uc002lsn.2	+						DAZAP1_uc002lsm.2_Intron|DAZAP1_uc002lso.2_Intron|DAZAP1_uc002lsl.1_Intron	NM_018959	NP_061832			DAZ associated protein 1 isoform b						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleotide binding|RNA binding			breast(1)	1		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	1669516	1669517	+	IGR	INS	-	CCTT	CCTT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1669516_1669517insCCTT								TCF3 (17190 upstream) : ONECUT3 (84145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	1717282	1717285	+	IGR	DEL	TGGG	-	-	rs111674956		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1717282_1717285delTGGG								TCF3 (64956 upstream) : ONECUT3 (36377 downstream)																																			---	---	---	---
FAM108A1	81926	broad.mit.edu	37	19	1879647	1879663	+	Intron	DEL	CTCAGCCCCTTCCCATC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1879647_1879663delCTCAGCCCCTTCCCATC	uc002lug.2	-						FAM108A1_uc002lud.2_Intron|FAM108A1_uc002lue.2_Intron|FAM108A1_uc002luf.2_Intron	NM_001130111	NP_001123583			hypothetical protein LOC81926 isoform 2							extracellular region	hydrolase activity				0		Ovarian(11;0.000137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
CSNK1G2	1455	broad.mit.edu	37	19	1951688	1951688	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1951688delT	uc002lul.3	+							NM_001319	NP_001310			casein kinase 1, gamma 2						sphingolipid metabolic process|Wnt receptor signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity			stomach(1)	1		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
GNG7	2788	broad.mit.edu	37	19	2602899	2602900	+	Intron	INS	-	TTTCTTTCTTTCT	TTTCTTTCTTTCT	rs151103355	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2602899_2602900insTTTCTTTCTTTCT	uc002lwd.2	-							NM_052847	NP_443079			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	3332795	3332796	+	IGR	INS	-	T	T	rs147577384		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3332795_3332796insT								CELF5 (35724 upstream) : NFIC (26820 downstream)																																			---	---	---	---
GIPC3	126326	broad.mit.edu	37	19	3592544	3592544	+	3'UTR	DEL	C	-	-	rs35689626		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3592544delC	uc002lyd.3	+	6						NM_133261	NP_573568			GIPC PDZ domain containing family, member 3											breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ATCAY	85300	broad.mit.edu	37	19	3888112	3888112	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3888112delA	uc002lyy.3	+						ATCAY_uc010xhz.1_Intron	NM_033064	NP_149053			caytaxin						transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)														---	---	---	---
SHD	56961	broad.mit.edu	37	19	4276231	4276231	+	5'Flank	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4276231delA	uc002lzw.2	+						SHD_uc010dtu.2_5'Flank	NM_020209	NP_064594			Src homology 2 domain containing transforming												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	4745327	4745327	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4745327delT								DPP9 (21472 upstream) : C19orf30 (23790 downstream)																																			---	---	---	---
PTPRS	5802	broad.mit.edu	37	19	5332141	5332142	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5332141_5332142insT	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	NM_002850	NP_002841			protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	8770087	8770110	+	IGR	DEL	TCCTTCCTCCCCTCCCTCCCTCCC	-	-	rs117660421	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8770087_8770110delTCCTTCCTCCCCTCCCTCCCTCCC								ADAMTS10 (94499 upstream) : ACTL9 (37641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	9281447	9281448	+	IGR	DEL	TT	-	-	rs142265840		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9281447_9281448delTT								ZNF317 (7358 upstream) : OR7D2 (14822 downstream)																																			---	---	---	---
ZNF266	10781	broad.mit.edu	37	19	9527645	9527645	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9527645delC	uc002mll.2	-						ZNF266_uc002mlm.2_Intron|ZNF266_uc002mln.2_Intron|ZNF266_uc002mlo.2_Intron|ZNF266_uc010dwp.2_Intron|ZNF266_uc010dwq.2_Intron	NM_198058	NP_932175			zinc finger protein 266						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	9630084	9630085	+	IGR	DEL	TT	-	-	rs112257231		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9630084_9630085delTT								ZNF560 (20805 upstream) : ZNF426 (8598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	9633695	9633696	+	IGR	DEL	CA	-	-	rs10418477	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9633695_9633696delCA								ZNF560 (24416 upstream) : ZNF426 (4987 downstream)																																			---	---	---	---
ZNF562	54811	broad.mit.edu	37	19	9764668	9764669	+	Intron	INS	-	T	T	rs145922849		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9764668_9764669insT	uc010xks.1	-						ZNF562_uc002mly.2_Intron|ZNF562_uc002mlx.2_Intron|ZNF562_uc010xkt.1_Intron|ZNF562_uc010xku.1_Intron|ZNF562_uc010xkv.1_Intron|ZNF562_uc010xkw.1_Intron	NM_001130032	NP_001123504			zinc finger protein 562 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
NFIX	4784	broad.mit.edu	37	19	13123878	13123879	+	Intron	INS	-	AA	AA	rs141364757	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13123878_13123879insAA	uc002mwd.2	+							NM_002501	NP_002492			nuclear factor I/X (CCAAT-binding transcription						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	14361852	14361853	+	IGR	DEL	TC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14361852_14361853delTC								LPHN1 (44855 upstream) : CD97 (130360 downstream)																																			---	---	---	---
BRD4	23476	broad.mit.edu	37	19	15392831	15392834	+	5'Flank	DEL	AAAC	-	-	rs34560606		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15392831_15392834delAAAC	uc002nar.2	-						BRD4_uc002nas.2_5'Flank|BRD4_uc002nat.3_Intron|BRD4_uc002nau.3_Intron	NM_058243	NP_490597			bromodomain-containing protein 4 isoform long						interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)					T	NUT|C15orf55	lethal midline carcinoma of young people								---	---	---	---
Unknown	0	broad.mit.edu	37	19	15457185	15457186	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15457185_15457186delAC								BRD4 (13843 upstream) : AKAP8 (7155 downstream)																																			---	---	---	---
PGLYRP2	114770	broad.mit.edu	37	19	15590687	15590687	+	5'Flank	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15590687delT	uc002nbf.3	-						PGLYRP2_uc002nbg.3_5'Flank	NM_052890	NP_443122			peptidoglycan recognition protein 2 precursor						defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptide amidation|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
CYP4F22	126410	broad.mit.edu	37	19	15643361	15643361	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15643361delT	uc002nbh.3	+							NM_173483	NP_775754			cytochrome P450, family 4, subfamily F,							endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	15721652	15721653	+	IGR	INS	-	TG	TG	rs146575644	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15721652_15721653insTG								CYP4F22 (58525 upstream) : CYP4F8 (4376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	16406349	16406350	+	IGR	INS	-	T	T	rs113723460		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16406349_16406350insT								AP1M1 (60193 upstream) : KLF2 (29301 downstream)																																			---	---	---	---
MYO9B	4650	broad.mit.edu	37	19	17275195	17275196	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17275195_17275196insT	uc010eak.2	+						MYO9B_uc002nfi.2_Intron|MYO9B_uc002nfj.1_Intron	NM_004145	NP_004136			myosin IXB isoform 1						actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1																		---	---	---	---
ANO8	57719	broad.mit.edu	37	19	17434120	17434121	+	3'UTR	INS	-	TGTGTGTG	TGTGTGTG	rs141546754	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17434120_17434121insTGTGTGTG	uc002ngf.2	-	18					ANO8_uc010eap.2_RNA	NM_020959	NP_066010			anoctamin 8							chloride channel complex	chloride channel activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	17560296	17560296	+	5'Flank	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17560296delG	uc002ngr.2	-											Homo sapiens cDNA clone IMAGE:5300504.																														---	---	---	---
B3GNT3	10331	broad.mit.edu	37	19	17923768	17923769	+	3'UTR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17923768_17923769insA	uc002nhk.1	+	3					B3GNT3_uc002nhl.1_3'UTR|B3GNT3_uc010ebd.1_3'UTR|B3GNT3_uc010ebe.1_3'UTR	NM_014256	NP_055071			UDP-GlcNAc:betaGal						protein glycosylation	Golgi membrane|integral to plasma membrane	galactosyltransferase activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
IL12RB1	3594	broad.mit.edu	37	19	18194821	18194824	+	Intron	DEL	CCAT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18194821_18194824delCCAT	uc002nhw.1	-						IL12RB1_uc010xqb.1_Intron|IL12RB1_uc002nhx.1_Intron|IL12RB1_uc002nhy.2_Intron	NM_005535	NP_005526			interleukin 12 receptor, beta 1 isoform 1						cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	18407868	18407868	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18407868delA								JUND (15436 upstream) : LSM4 (9850 downstream)																																			---	---	---	---
TMEM59L	25789	broad.mit.edu	37	19	18727197	18727198	+	Intron	INS	-	TTGTTGTTG	TTGTTGTTG	rs28620603	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18727197_18727198insTTGTTGTTG	uc002njy.3	+						TMEM59L_uc010ebu.1_Intron	NM_012109	NP_036241			brain-specific membrane-anchored protein							Golgi membrane|integral to membrane|membrane fraction				ovary(2)|skin(2)	4																		---	---	---	---
NCAN	1463	broad.mit.edu	37	19	19327125	19327125	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19327125delT	uc002nlz.2	+							NM_004386	NP_004377			chondroitin sulfate proteoglycan 3 precursor						axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)															---	---	---	---
ZNF101	94039	broad.mit.edu	37	19	19782311	19782312	+	Intron	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19782311_19782312delTT	uc002nni.1	+						ZNF101_uc010ecg.1_Intron|ZNF101_uc002nnj.1_Intron	NM_033204	NP_149981			zinc finger protein 101						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	20883713	20883715	+	IGR	DEL	GTA	-	-	rs146756275		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20883713_20883715delGTA								ZNF626 (39311 upstream) : ZNF85 (222365 downstream)																																			---	---	---	---
ZNF714	148206	broad.mit.edu	37	19	21279104	21279105	+	Intron	INS	-	AGC	AGC	rs138247816	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21279104_21279105insAGC	uc002npo.3	+						ZNF714_uc002npl.2_Intron|ZNF714_uc010ecp.1_Intron|ZNF714_uc002npn.2_Intron	NM_182515	NP_872321			zinc finger protein 714						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	24188024	24188025	+	IGR	INS	-	TT	TT	rs149250953	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24188024_24188025insTT								RPSAP58 (177107 upstream) : ZNF254 (28222 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28989145	28989146	+	Intron	INS	-	AAAT	AAAT	rs150055305	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28989145_28989146insAAAT	uc002nsa.1	-											Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	29548832	29548833	+	IGR	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29548832_29548833delCA								LOC148145 (88777 upstream) : UQCRFS1 (149334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29605564	29605564	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29605564delA								LOC148145 (145509 upstream) : UQCRFS1 (92603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29980004	29980004	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29980004delA	uc002nse.1	-											Homo sapiens cDNA FLJ37474 fis, clone BRAWH2012619.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	30836033	30836033	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30836033delT								C19orf2 (329422 upstream) : ZNF536 (27295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31393683	31393684	+	IGR	DEL	GA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31393683_31393684delGA								ZNF536 (344718 upstream) : DKFZp566F0947 (247099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	32771858	32771858	+	IGR	DEL	A	-	-	rs71335189		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32771858delA								TSHZ3 (931668 upstream) : ZNF507 (64656 downstream)																																			---	---	---	---
CCDC123	84902	broad.mit.edu	37	19	33372497	33372498	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33372497_33372498insA	uc002nty.2	-						CCDC123_uc002ntx.2_Intron|CCDC123_uc010edg.2_Intron	NM_032816	NP_116205			coiled-coil domain containing 123							centrosome|spindle pole					0	Esophageal squamous(110;0.137)																	---	---	---	---
RHPN2	85415	broad.mit.edu	37	19	33546875	33546875	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33546875delA	uc002nuf.2	-						RHPN2_uc010xro.1_Intron	NM_033103	NP_149094			rhophilin, Rho GTPase binding protein 2						signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)																	---	---	---	---
CHST8	64377	broad.mit.edu	37	19	34139093	34139094	+	Intron	DEL	CT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34139093_34139094delCT	uc002nus.3	+						CHST8_uc002nut.3_Intron	NM_001127895	NP_001121367			carbohydrate (N-acetylgalactosamine 4-0)						carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)																	---	---	---	---
KIAA0355	9710	broad.mit.edu	37	19	34747425	34747425	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34747425delA	uc002nvd.3	+							NM_014686	NP_055501			hypothetical protein LOC9710											ovary(1)	1	Esophageal squamous(110;0.162)																	---	---	---	---
KIAA0355	9710	broad.mit.edu	37	19	34773057	34773057	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34773057delT	uc002nvd.3	+						KIAA0355_uc010edk.1_Intron	NM_014686	NP_055501			hypothetical protein LOC9710											ovary(1)	1	Esophageal squamous(110;0.162)																	---	---	---	---
DMKN	93099	broad.mit.edu	37	19	35995482	35995483	+	Intron	INS	-	A	A	rs112661224		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35995482_35995483insA	uc002nzm.3	-						DMKN_uc002nzi.3_5'Flank|DMKN_uc002nzj.2_Intron|DMKN_uc002nzk.3_Intron|DMKN_uc002nzl.3_Intron|DMKN_uc002nzo.3_Intron|DMKN_uc002nzn.3_Intron|DMKN_uc002nzw.2_Intron|DMKN_uc002nzr.2_Intron|DMKN_uc002nzp.2_Intron|DMKN_uc002nzq.2_Intron|DMKN_uc002nzt.2_Intron|DMKN_uc002nzs.2_Intron|DMKN_uc002nzu.2_Intron|DMKN_uc002nzv.2_Intron|DMKN_uc010xsv.1_Intron|DMKN_uc010xsw.1_Intron|DMKN_uc002nzx.3_Intron|DMKN_uc002nzy.3_Intron|DMKN_uc002nzz.2_Intron|DMKN_uc002oac.3_Intron|DMKN_uc010eeb.2_Intron|DMKN_uc002oaa.3_Intron|DMKN_uc002oab.3_Intron	NM_033317	NP_201574			dermokine isoform 2 precursor							extracellular region				large_intestine(1)|ovary(1)|skin(1)	3	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	36619263	36619263	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36619263delA								TBCB (2414 upstream) : CAPNS1 (11655 downstream)																																	OREG0025438	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ZNF566	84924	broad.mit.edu	37	19	36944050	36944051	+	Intron	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36944050_36944051insA	uc002oea.3	-						ZNF566_uc010xte.1_Intron|ZNF566_uc010xtf.1_Intron|ZNF566_uc002oeb.3_Intron|ZNF566_uc002oec.3_Intron|ZNF566_uc010xtg.1_Intron	NM_032838	NP_116227			zinc finger protein 566 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.162)																	---	---	---	---
ZFP30	22835	broad.mit.edu	37	19	38148166	38148167	+	5'Flank	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38148166_38148167insT	uc002ogv.1	-						ZFP30_uc002ogw.1_5'Flank|ZFP30_uc002ogx.1_5'Flank|ZFP30_uc010xtt.1_5'Flank	NM_014898	NP_055713			zinc finger protein 30 homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
SIPA1L3	23094	broad.mit.edu	37	19	38536018	38536018	+	Intron	DEL	A	-	-	rs80200083		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38536018delA	uc002ohk.2	+							NM_015073	NP_055888			signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
SIPA1L3	23094	broad.mit.edu	37	19	38569125	38569126	+	Intron	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38569125_38569126delCA	uc002ohk.2	+							NM_015073	NP_055888			signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
RYR1	6261	broad.mit.edu	37	19	38964914	38964915	+	Intron	INS	-	TT	TT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38964914_38964915insTT	uc002oit.2	+						RYR1_uc002oiu.2_Intron	NM_000540	NP_000531			skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)													---	---	---	---
SAMD4B	55095	broad.mit.edu	37	19	39869871	39869871	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39869871delG	uc002olb.2	+						SAMD4B_uc002ola.2_Intron	NM_018028	NP_060498			sterile alpha motif domain containing 4B								protein binding				0	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)															---	---	---	---
EGLN2	112398	broad.mit.edu	37	19	41302941	41302942	+	Intron	INS	-	T	T	rs143043336	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41302941_41302942insT	uc010ehd.2	+						EGLN2_uc002opg.3_5'Flank|EGLN2_uc002oph.2_5'Flank	NM_080732	NP_542770			EGL nine (C.elegans) homolog 2						cell redox homeostasis|estrogen receptor signaling pathway|positive regulation of protein catabolic process|regulation of cell growth|response to hypoxia	cytoplasm|nucleus	ferrous iron binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|oxygen sensor activity			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)													---	---	---	---
CEACAM21	90273	broad.mit.edu	37	19	42083433	42083434	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42083433_42083434delAC	uc002ore.3	+						CEACAM21_uc002orc.1_Intron|CEACAM21_uc002ord.1_Intron|CEACAM21_uc002orf.2_Intron|CEACAM21_uc002org.3_Intron	NM_001098506	NP_001091976			carcinoembryonic antigen-related cell adhesion							integral to membrane				ovary(1)	1																		---	---	---	---
CEACAM3	1084	broad.mit.edu	37	19	42307390	42307397	+	Intron	DEL	TTTTTTTT	-	-	rs55885625		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42307390_42307397delTTTTTTTT	uc002orn.1	+						CEACAM3_uc010eia.1_Intron|CEACAM3_uc002oro.1_Intron	NM_001815	NP_001806			carcinoembryonic antigen-related cell adhesion							integral to membrane				skin(1)	1																		---	---	---	---
ARHGEF1	9138	broad.mit.edu	37	19	42420995	42420996	+	Intron	INS	-	AC	AC	rs138281678	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42420995_42420996insAC	uc002osc.2	+											SubName: Full=ARHGEF1 protein; SubName: Full=Rho guanine nucleotide exchange factor (GEF) 1, isoform CRA_g;						cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(3)|large_intestine(1)	4		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)														---	---	---	---
POU2F2	5452	broad.mit.edu	37	19	42620416	42620416	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42620416delT	uc002osp.2	-						POU2F2_uc002osn.2_Intron|POU2F2_uc002oso.2_Intron|POU2F2_uc002osq.2_Intron|POU2F2_uc002osr.1_Intron	NM_002698	NP_002689			POU domain, class 2, transcription factor 2						humoral immune response|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2		Prostate(69;0.059)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	43808555	43808556	+	IGR	INS	-	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43808555_43808556insC								PSG9 (34873 upstream) : PRG1 (44652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	44209921	44209922	+	IGR	INS	-	AGCTCAC	AGCTCAC	rs149358724	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44209921_44209922insAGCTCAC								PLAUR (35419 upstream) : IRGC (10292 downstream)																																			---	---	---	---
EXOC3L2	90332	broad.mit.edu	37	19	45717714	45717715	+	Intron	INS	-	TGTT	TGTT	rs140511806	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45717714_45717715insTGTT	uc002pay.1	-							NM_138568	NP_612635			exocyst complex component 3-like 2											ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	45985269	45985270	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45985269_45985270insA								ERCC1 (3183 upstream) : RTN2 (3281 downstream)																																			---	---	---	---
EML2	24139	broad.mit.edu	37	19	46136715	46136716	+	Intron	INS	-	T	T	rs34593917		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46136715_46136716insT	uc002pcn.2	-						EML2_uc002pco.2_Intron|EML2_uc002pcp.2_Intron|EML2_uc010xxl.1_Intron|EML2_uc010xxm.1_Intron|EML2_uc010xxn.1_Intron|EML2_uc010xxo.1_Intron|EML2_uc010ekj.2_Intron|EML2_uc010ekk.1_5'Flank	NM_012155	NP_036287			echinoderm microtubule associated protein like						sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)														---	---	---	---
QPCTL	54814	broad.mit.edu	37	19	46204535	46204536	+	Intron	INS	-	T	T	rs34262469		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46204535_46204536insT	uc010xxr.1	+						QPCTL_uc010ekn.2_Intron	NM_017659	NP_060129			glutaminyl-peptide cyclotransferase-like isoform						peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase|proteolysis	Golgi membrane|integral to membrane	acyltransferase activity|glutaminyl-peptide cyclotransferase activity|peptidase activity|protein binding|zinc ion binding			skin(1)	1		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0059)|GBM - Glioblastoma multiforme(486;0.0882)|Epithelial(262;0.208)														---	---	---	---
PPP5C	5536	broad.mit.edu	37	19	46874297	46874298	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46874297_46874298delTG	uc002pem.2	+						PPP5C_uc010xya.1_Intron|PPP5C_uc002pen.2_Intron	NM_006247	NP_006238			protein phosphatase 5, catalytic subunit						mitosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein dephosphorylation|transcription, DNA-dependent	Golgi apparatus|nucleus	metal ion binding|protein binding|protein serine/threonine phosphatase activity|signal transducer activity			lung(1)|pancreas(1)	2		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)														---	---	---	---
GRLF1	2909	broad.mit.edu	37	19	47470368	47470369	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47470368_47470369insT	uc010ekv.2	+							NM_004491	NP_004482			glucocorticoid receptor DNA binding factor 1						axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)														---	---	---	---
GRLF1	2909	broad.mit.edu	37	19	47505965	47505965	+	3'UTR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47505965delG	uc010ekv.2	+	6						NM_004491	NP_004482			glucocorticoid receptor DNA binding factor 1						axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)														---	---	---	---
EHD2	30846	broad.mit.edu	37	19	48223371	48223372	+	Intron	DEL	TG	-	-	rs72191584		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48223371_48223372delTG	uc002phj.3	+						EHD2_uc010xyu.1_Intron	NM_014601	NP_055416			EH-domain containing 2						blood coagulation|endocytic recycling	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding			ovary(1)|skin(1)	2		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)														---	---	---	---
CRX	1406	broad.mit.edu	37	19	48323381	48323382	+	5'Flank	INS	-	GTGA	GTGA			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48323381_48323382insGTGA	uc002phq.3	+						CRX_uc010elm.1_5'Flank	NM_000554	NP_000545			cone-rod homeobox protein						organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	48370656	48370657	+	IGR	INS	-	AAAC	AAAC	rs139374229	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48370656_48370657insAAAC								CRX (24072 upstream) : SULT2A1 (3066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	49525357	49525357	+	IGR	DEL	A	-	-	rs35791223		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49525357delA								LHB (5010 upstream) : CGB (770 downstream)																																			---	---	---	---
ALDH16A1	126133	broad.mit.edu	37	19	49966602	49966602	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49966602delG	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160			aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)														---	---	---	---
IL4I1	259307	broad.mit.edu	37	19	50409467	50409468	+	Intron	DEL	AT	-	-	rs146701806		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50409467_50409468delAT	uc002pqu.1	-						IL4I1_uc002pqv.1_Intron|IL4I1_uc010eno.1_Intron|IL4I1_uc002pqw.1_Intron	NM_172374	NP_758962			interleukin 4 induced 1 isoform 2							lysosome	L-amino-acid oxidase activity			lung(1)|ovary(1)|prostate(1)	3		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)														---	---	---	---
KLK6	5653	broad.mit.edu	37	19	51472243	51472243	+	5'Flank	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51472243delT	uc002pui.2	-						KLK6_uc010eoj.2_5'Flank|KLK6_uc002puh.2_5'Flank|KLK6_uc002puj.2_5'Flank|KLK6_uc010ycn.1_5'Flank|KLK6_uc002pul.2_Intron|KLK6_uc002pum.2_Intron	NM_001012964	NP_001012982			kallikrein-related peptidase 6 isoform A						amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	51693490	51693490	+	IGR	DEL	G	-	-	rs9973300	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51693490delG								SIGLECP3 (16716 upstream) : CD33 (34845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	52062969	52062976	+	IGR	DEL	CATCCATC	-	-	rs144225113		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52062969_52062976delCATCCATC								SIGLEC6 (27905 upstream) : ZNF175 (11555 downstream)																																			---	---	---	---
ZNF813	126017	broad.mit.edu	37	19	53983619	53983619	+	Intron	DEL	A	-	-	rs35502614		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53983619delA	uc002qbu.2	+							NM_001004301	NP_001004301			zinc finger protein 813						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)														---	---	---	---
ZNF813	126017	broad.mit.edu	37	19	53990240	53990241	+	Intron	INS	-	TA	TA			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53990240_53990241insTA	uc002qbu.2	+						ZNF813_uc010eqq.1_Intron	NM_001004301	NP_001004301			zinc finger protein 813						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	54117212	54117212	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54117212delT								LOC284379 (10461 upstream) : DPRX (18098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	54165811	54165812	+	IGR	INS	-	C	C	rs149559575	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54165811_54165812insC								DPRX (25548 upstream) : MIR512-1 (4121 downstream)																																			---	---	---	---
NLRP12	91662	broad.mit.edu	37	19	54304349	54304349	+	Intron	DEL	A	-	-	rs35326804		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54304349delA	uc002qch.3	-						NLRP12_uc010eqw.2_Intron|NLRP12_uc002qci.3_Intron|NLRP12_uc002qcj.3_Intron|NLRP12_uc002qck.3_Intron|NLRP12_uc010eqx.2_Intron	NM_144687	NP_653288			NLR family, pyrin domain containing 12 isoform						negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)														---	---	---	---
PRPF31	26121	broad.mit.edu	37	19	54624684	54624684	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54624684delA	uc002qdh.2	+						PRPF31_uc010yek.1_Intron	NM_015629	NP_056444			pre-mRNA processing factor 31 homolog						assembly of spliceosomal tri-snRNP	Cajal body|MLL1 complex|nuclear speck|U4 snRNP|U4/U6 x U5 tri-snRNP complex|U4atac snRNP	RNA binding|snRNP binding			ovary(1)	1	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)																	---	---	---	---
KIR3DX1	90011	broad.mit.edu	37	19	55053966	55053966	+	Intron	DEL	T	-	-	rs66488179		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55053966delT	uc010erm.2	+						KIR3DX1_uc010yfa.1_Intron|KIR3DX1_uc010yfb.1_Intron|KIR3DX1_uc010yfc.1_Intron|KIR3DX1_uc010yfd.1_Intron					Homo sapiens killer cell immunoglobulin-like receptor, three domains, X1, mRNA (cDNA clone IMAGE:4849085).											ovary(1)	1				GBM - Glioblastoma multiforme(193;0.099)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	56282343	56282344	+	IGR	INS	-	T	T	rs145866117	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56282343_56282344insT								RFPL4A (7804 upstream) : NLRP11 (14426 downstream)																																			---	---	---	---
NLRP5	126206	broad.mit.edu	37	19	56517794	56517794	+	Intron	DEL	A	-	-	rs647004		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56517794delA	uc002qmj.2	+						NLRP5_uc002qmi.2_Intron	NM_153447	NP_703148			NACHT, LRR and PYD containing protein 5							mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)														---	---	---	---
NLRP5	126206	broad.mit.edu	37	19	56540593	56540594	+	Intron	DEL	TG	-	-	rs34348828		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56540593_56540594delTG	uc002qmj.2	+						NLRP5_uc002qmi.2_Intron	NM_153447	NP_703148			NACHT, LRR and PYD containing protein 5							mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	56581431	56581432	+	IGR	INS	-	TA	TA	rs33927332		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56581431_56581432insTA								NLRP5 (8259 upstream) : ZNF787 (17300 downstream)																																			---	---	---	---
ZNF814	730051	broad.mit.edu	37	19	58377673	58377673	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58377673delC	uc002qqk.2	-						ZNF814_uc010yhl.1_Intron					Homo sapiens full length insert cDNA clone ZE16C11.						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0																		---	---	---	---
UBE2M	9040	broad.mit.edu	37	19	59067291	59067291	+	3'UTR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59067291delA	uc002qtl.3	-	6					CHMP2A_uc002qti.2_5'Flank|CHMP2A_uc002qtj.2_5'Flank|CHMP2A_uc002qtk.2_5'Flank	NM_003969	NP_003960			ubiquitin-conjugating enzyme E2M						protein neddylation		ATP binding|NEDD8 ligase activity|protein binding|ribosomal S6-glutamic acid ligase activity|ubiquitin-protein ligase activity			ovary(1)|pancreas(1)	2		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)														---	---	---	---
Unknown	0	broad.mit.edu	37	20	1737075	1737075	+	IGR	DEL	T	-	-	rs11479792		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1737075delT								SIRPG (98650 upstream) : SIRPA (137738 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	6699928	6699929	+	IGR	INS	-	A	A	rs148741818	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6699928_6699929insA								FERMT1 (595737 upstream) : BMP2 (48816 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7164260	7164261	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7164260_7164261insT								BMP2 (403350 upstream) : HAO1 (699370 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7959720	7959721	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7959720_7959721insT								HAO1 (38627 upstream) : TMX4 (1995 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	9955078	9955078	+	IGR	DEL	C	-	-	rs140821798		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9955078delC								PAK7 (135391 upstream) : ANKRD5 (60619 downstream)																																			---	---	---	---
MKKS	8195	broad.mit.edu	37	20	10407059	10407059	+	Intron	DEL	C	-	-	rs111466973		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10407059delC	uc002wnt.1	-						MKKS_uc002wnu.1_Intron|MKKS_uc010zrd.1_Intron	NM_018848	NP_061336			McKusick-Kaufman syndrome protein						brain morphogenesis|cerebral cortex development|convergent extension involved in gastrulation|detection of mechanical stimulus involved in sensory perception of sound|fat cell differentiation|flagellum assembly|gonad development|heart looping|hippocampus development|intracellular transport|melanosome transport|photoreceptor cell maintenance|pigment granule aggregation in cell center|protein folding|regulation of cilium beat frequency involved in ciliary motility|sensory perception of smell|social behavior|spermatid development|striatum development	cytosol|microtubule organizing center|motile cilium	ATP binding|unfolded protein binding				0														Bardet-Biedl_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	20	12210743	12210743	+	IGR	DEL	T	-	-	rs77754281		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12210743delT								BTBD3 (303501 upstream) : SPTLC3 (778884 downstream)																																			---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	14061479	14061479	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14061479delG	uc002wou.2	+						MACROD2_uc002wot.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	19741653	19741656	+	IGR	DEL	TGAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19741653_19741656delTGAA								SLC24A3 (38113 upstream) : RIN2 (128554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	21065410	21065410	+	IGR	DEL	T	-	-	rs73620308		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21065410delT								RALGAPA2 (372144 upstream) : PLK1S1 (41214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	22082535	22082536	+	IGR	DEL	GA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22082535_22082536delGA								PAX1 (385915 upstream) : LOC284788 (298435 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	22273316	22273329	+	IGR	DEL	CTGAAGTATTGGAT	-	-	rs143126486		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22273316_22273329delCTGAAGTATTGGAT								PAX1 (576696 upstream) : LOC284788 (107642 downstream)																																			---	---	---	---
CSTT	164380	broad.mit.edu	37	20	23516127	23516128	+	Intron	INS	-	CACGCGCG	CACGCGCG	rs11471661		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23516127_23516128insCACGCGCG	uc002wti.2	+						CSTT_uc002wtj.2_Intron	NR_001279				Homo sapiens cystatin pseudogene, mRNA (cDNA clone IMAGE:4837709).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	23929537	23929537	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23929537delT								CST5 (69157 upstream) : GGTLC1 (36154 downstream)																																			---	---	---	---
PYGB	5834	broad.mit.edu	37	20	25266356	25266358	+	Intron	DEL	GTG	-	-	rs150320283		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25266356_25266358delGTG	uc002wup.2	+							NM_002862	NP_002853			brain glycogen phosphorylase						glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	25633783	25633783	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25633783delT	uc002wuz.2	+											Homo sapiens zinc finger protein 337, mRNA (cDNA clone IMAGE:4826085).																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	25859712	25859712	+	IGR	DEL	T	-	-	rs113885992		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25859712delT								FAM182B (10926 upstream) : LOC100134868 (130723 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25918644	25918644	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25918644delT								FAM182B (69858 upstream) : LOC100134868 (71791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25930638	25930638	+	IGR	DEL	A	-	-	rs111792046		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25930638delA								FAM182B (81852 upstream) : LOC100134868 (59797 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26107162	26107163	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26107162_26107163insA								C20orf191 (12485 upstream) : MIR663 (81659 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26117794	26117795	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26117794_26117795insT								C20orf191 (23117 upstream) : MIR663 (71027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26136181	26136182	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26136181_26136182insT								C20orf191 (41504 upstream) : MIR663 (52640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26146969	26146969	+	IGR	DEL	G	-	-	rs77058092		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26146969delG								C20orf191 (52292 upstream) : MIR663 (41853 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26191924	26191925	+	5'Flank	INS	-	GAAA	GAAA	rs149130027	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26191924_26191925insGAAA	uc002wvk.2	-											Homo sapiens hypothetical protein LOC284801, mRNA (cDNA clone IMAGE:4830814).																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	26314472	26314473	+	IGR	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26314472_26314473delAC								MIR663 (125558 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29455644	29455645	+	IGR	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29455644_29455645insT								None (None upstream) : FRG1B (156234 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29464193	29464194	+	IGR	INS	-	T	T	rs150514541	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29464193_29464194insT								None (None upstream) : FRG1B (147685 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29498078	29498078	+	IGR	DEL	T	-	-	rs112193141		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29498078delT								None (None upstream) : FRG1B (113801 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29590361	29590362	+	IGR	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29590361_29590362delTT								None (None upstream) : FRG1B (21517 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29596849	29596849	+	IGR	DEL	C	-	-	rs113777459		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29596849delC								None (None upstream) : FRG1B (15030 downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29647580	29647581	+	Intron	INS	-	AGG	AGG			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29647580_29647581insAGG	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
C20orf112	140688	broad.mit.edu	37	20	31047049	31047050	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31047049_31047050insT	uc002wxu.3	-						C20orf112_uc010gec.2_Intron	NM_080616	NP_542183			hypothetical protein LOC140688												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	31342224	31342225	+	IGR	INS	-	T	T	rs113487486		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31342224_31342225insT								COMMD7 (10410 upstream) : DNMT3B (7966 downstream)																																			---	---	---	---
C20orf71	128861	broad.mit.edu	37	20	31802902	31802902	+	5'Flank	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31802902delT	uc002wyr.2	+						C20orf71_uc002wys.2_5'Flank	NM_178466	NP_848561			short long palate, lung and nasal epithelium							extracellular region	lipid binding			ovary(1)|skin(1)	2																		---	---	---	---
CHMP4B	128866	broad.mit.edu	37	20	32433128	32433128	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32433128delT	uc002xaa.2	+							NM_176812	NP_789782			chromatin modifying protein 4B						cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ITCH	83737	broad.mit.edu	37	20	32972996	32972997	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32972996_32972997delTG	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671			itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
TRPC4AP	26133	broad.mit.edu	37	20	33647588	33647590	+	Intron	DEL	GAA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33647588_33647590delGAA	uc002xbk.2	-						TRPC4AP_uc002xbl.2_Intron|TRPC4AP_uc010zur.1_Intron|TRPC4AP_uc002xbm.1_Intron	NM_015638	NP_056453			TRPC4-associated protein isoform a						protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)															---	---	---	---
EDEM2	55741	broad.mit.edu	37	20	33748856	33748857	+	Intron	DEL	TT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33748856_33748857delTT	uc010zuv.1	-							NM_018217	NP_060687			ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00936)															---	---	---	---
PHF20	51230	broad.mit.edu	37	20	34484004	34484005	+	Intron	DEL	TG	-	-	rs35800229		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34484004_34484005delTG	uc002xek.1	+						PHF20_uc002xei.1_Intron|PHF20_uc010gfo.1_Intron|PHF20_uc002xej.1_Intron	NM_016436	NP_057520			PHD finger protein 20						regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)																	---	---	---	---
EPB41L1	2036	broad.mit.edu	37	20	34724999	34724999	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34724999delT	uc002xev.2	+						EPB41L1_uc002xeu.2_Intron|EPB41L1_uc010zvo.1_Intron|EPB41L1_uc002xew.2_Intron|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Intron|EPB41L1_uc002xez.2_Intron	NM_012156	NP_036288			erythrocyte membrane protein band 4.1-like 1						cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity			ovary(2)|pancreas(1)	3	Breast(12;0.0239)																	---	---	---	---
EPB41L1	2036	broad.mit.edu	37	20	34745529	34745530	+	Intron	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34745529_34745530delGT	uc002xfb.2	+						EPB41L1_uc002xeu.2_Intron|EPB41L1_uc010zvo.1_Intron|EPB41L1_uc002xev.2_Intron|EPB41L1_uc002xew.2_Intron|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Intron|EPB41L1_uc002xez.2_Intron|uc002xfa.1_5'Flank	NM_012156	NP_036288			erythrocyte membrane protein band 4.1-like 1						cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity			ovary(2)|pancreas(1)	3	Breast(12;0.0239)																	---	---	---	---
CTNNBL1	56259	broad.mit.edu	37	20	36487004	36487004	+	Intron	DEL	G	-	-	rs11475640		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36487004delG	uc010zvw.1	+						CTNNBL1_uc002xhh.2_Intron|CTNNBL1_uc002xhi.2_Intron|CTNNBL1_uc002xhj.2_Intron	NM_030877	NP_110517			beta catenin-like 1						apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding			ovary(2)	2		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36505408	36505408	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36505408delC								CTNNBL1 (4889 upstream) : VSTM2L (26091 downstream)																																			---	---	---	---
KIAA0406	9675	broad.mit.edu	37	20	36620685	36620686	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36620685_36620686insT	uc002xhl.2	-						KIAA0406_uc002xhm.2_Intron	NM_014657	NP_055472			hypothetical protein LOC9675								binding				0		Myeloproliferative disorder(115;0.00874)																---	---	---	---
KIAA0406	9675	broad.mit.edu	37	20	36630126	36630127	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36630126_36630127insT	uc002xhl.2	-						KIAA0406_uc002xhm.2_Intron	NM_014657	NP_055472			hypothetical protein LOC9675								binding				0		Myeloproliferative disorder(115;0.00874)																---	---	---	---
KIAA0406	9675	broad.mit.edu	37	20	36645807	36645808	+	Intron	DEL	TG	-	-	rs112205846		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36645807_36645808delTG	uc002xhl.2	-						KIAA0406_uc002xhm.2_Intron	NM_014657	NP_055472			hypothetical protein LOC9675								binding				0		Myeloproliferative disorder(115;0.00874)																---	---	---	---
RPRD1B	58490	broad.mit.edu	37	20	36664171	36664171	+	Intron	DEL	T	-	-	rs112303905		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36664171delT	uc002xho.3	+						KIAA0406_uc002xhl.2_5'Flank|KIAA0406_uc002xhm.2_5'Flank	NM_021215	NP_067038			Regulation of nuclear pre-mRNA domain containing											pancreas(1)	1																		---	---	---	---
PPP1R16B	26051	broad.mit.edu	37	20	37495842	37495842	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37495842delA	uc002xje.2	+						PPP1R16B_uc010ggc.2_Intron	NM_015568	NP_056383			protein phosphatase 1 regulatory inhibitor						regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)																---	---	---	---
PPP1R16B	26051	broad.mit.edu	37	20	37517214	37517214	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37517214delT	uc002xje.2	+						PPP1R16B_uc010ggc.2_Intron	NM_015568	NP_056383			protein phosphatase 1 regulatory inhibitor						regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	38933581	38933581	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38933581delC								None (None upstream) : MAFB (380938 downstream)																																			---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41274405	41274406	+	Intron	DEL	TG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41274405_41274406delTG	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41465755	41465755	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41465755delC	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41730925	41730926	+	Intron	DEL	CA	-	-	rs36105148		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41730925_41730926delCA	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
TOX2	84969	broad.mit.edu	37	20	42662322	42662322	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42662322delA	uc002xlf.3	+						TOX2_uc010ggo.2_Intron|TOX2_uc002xle.3_Intron|TOX2_uc010ggp.2_Intron|TOX2_uc002xlg.2_Intron	NM_001098798	NP_001092268			TOX high mobility group box family member 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	42848165	42848170	+	Intron	DEL	TGTCTC	-	-	rs60651167		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42848165_42848170delTGTCTC	uc002xll.2	+						uc002xlm.2_Intron|uc002xln.2_Intron|uc002xlo.2_Intron					Homo sapiens, clone IMAGE:4941532, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	43766864	43766864	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43766864delA								WFDC12 (13758 upstream) : PI3 (36676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	43787979	43787979	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43787979delA								WFDC12 (34873 upstream) : PI3 (15561 downstream)																																			---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45806983	45806984	+	Intron	INS	-	A	A	rs74178708		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45806983_45806984insA	uc002xsm.2	+						EYA2_uc010ghp.2_Intron|EYA2_uc002xsn.2_Intron|EYA2_uc002xso.2_Intron|EYA2_uc002xsp.2_Intron|EYA2_uc002xsq.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	47168373	47168374	+	IGR	INS	-	AAAC	AAAC	rs145687226	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47168373_47168374insAAAC								LOC284749 (168992 upstream) : PREX1 (72419 downstream)																																			---	---	---	---
PREX1	57580	broad.mit.edu	37	20	47409339	47409340	+	Intron	INS	-	A	A	rs75214410		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47409339_47409340insA	uc002xtw.1	-							NM_020820	NP_065871			phosphatidylinositol-3,4,						actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	47460677	47460677	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47460677delA								PREX1 (16257 upstream) : ARFGEF2 (77598 downstream)																																			---	---	---	---
ARFGEF2	10564	broad.mit.edu	37	20	47537357	47537358	+	5'Flank	INS	-	CTCA	CTCA	rs139629508	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47537357_47537358insCTCA	uc002xtx.3	+							NM_006420	NP_006411			ADP-ribosylation factor guanine						exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	48351597	48351597	+	IGR	DEL	T	-	-	rs139962090		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48351597delT								B4GALT5 (21176 upstream) : SLC9A8 (77653 downstream)																																			---	---	---	---
TMEM189-UBE2V1	387522	broad.mit.edu	37	20	48709298	48709298	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48709298delA	uc002xvf.2	-						UBE2V1_uc002xvb.2_Intron|UBE2V1_uc002xva.2_Intron|UBE2V1_uc002xvc.2_Intron|UBE2V1_uc002xvd.2_Intron|UBE2V1_uc002xve.2_Intron	NM_199203	NP_954673			TMEM189-UBE2V1 readthrough transcript						cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein K63-linked ubiquitination|regulation of DNA repair|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus|UBC13-UEV1A complex|ubiquitin ligase complex	acid-amino acid ligase activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)															---	---	---	---
TMEM189-UBE2V1	387522	broad.mit.edu	37	20	48720247	48720248	+	Intron	DEL	TA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48720247_48720248delTA	uc002xvf.2	-						UBE2V1_uc002xvb.2_Intron|UBE2V1_uc002xva.2_Intron|UBE2V1_uc002xvc.2_Intron|UBE2V1_uc002xvd.2_Intron|UBE2V1_uc002xve.2_Intron	NM_199203	NP_954673			TMEM189-UBE2V1 readthrough transcript						cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein K63-linked ubiquitination|regulation of DNA repair|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus|UBC13-UEV1A complex|ubiquitin ligase complex	acid-amino acid ligase activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	48923449	48923450	+	Intron	INS	-	C	C	rs149343812	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48923449_48923450insC	uc002xvk.2	+											Homo sapiens cDNA FLJ33286 fis, clone ASTRO2014174.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	50006632	50006633	+	IGR	INS	-	TG	TG	rs141653085	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50006632_50006633insTG								KCNG1 (366957 upstream) : NFATC2 (1133 downstream)																																			---	---	---	---
NFATC2	4773	broad.mit.edu	37	20	50144956	50144959	+	Intron	DEL	ACAG	-	-	rs138422522		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50144956_50144959delACAG	uc002xwd.2	-						NFATC2_uc002xwc.2_Intron|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Intron|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Intron	NM_173091	NP_775114			nuclear factor of activated T-cells,						B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	50636553	50636553	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50636553delA								SALL4 (217505 upstream) : ZFP64 (63998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	51316624	51316629	+	IGR	DEL	ACACAC	-	-	rs149329558	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51316624_51316629delACACAC								ZFP64 (508100 upstream) : TSHZ2 (272248 downstream)																																			---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51978463	51978464	+	Intron	INS	-	G	G	rs72548454		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51978463_51978464insG	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	53275224	53275224	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53275224delT								DOK5 (7515 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	53574828	53574828	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53574828delT								DOK5 (307119 upstream) : CBLN4 (997669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55514759	55514760	+	IGR	INS	-	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55514759_55514760insA								TFAP2C (300423 upstream) : BMP7 (229049 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55606868	55606869	+	IGR	INS	-	TG	TG	rs151170504	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55606868_55606869insTG								TFAP2C (392532 upstream) : BMP7 (136940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56020147	56020149	+	IGR	DEL	TCC	-	-	rs111771843		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56020147_56020149delTCC								RBM38 (35763 upstream) : CTCFL (43731 downstream)																																			---	---	---	---
PCK1	5105	broad.mit.edu	37	20	56136889	56136901	+	Intron	DEL	TGCACAAAAGCTC	-	-	rs66514941		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56136889_56136901delTGCACAAAAGCTC	uc002xyn.3	+						PCK1_uc010zzm.1_Intron	NM_002591	NP_002582			cytosolic phosphoenolpyruvate carboxykinase 1						gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	59309997	59309997	+	IGR	DEL	A	-	-	rs141439925	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59309997delA								MIR646 (426372 upstream) : CDH4 (517562 downstream)																																			---	---	---	---
CDH4	1002	broad.mit.edu	37	20	59962333	59962334	+	Intron	INS	-	AG	AG			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59962333_59962334insAG	uc002ybn.1	+							NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	60688203	60688204	+	IGR	INS	-	C	C	rs148991073	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60688203_60688204insC								TAF4 (47337 upstream) : LSM14B (9313 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	60693394	60693394	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60693394delC								TAF4 (52528 upstream) : LSM14B (4123 downstream)																																			---	---	---	---
CABLES2	81928	broad.mit.edu	37	20	60973037	60973045	+	Intron	DEL	TGGCGGTGG	-	-	rs58871404	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60973037_60973045delTGGCGGTGG	uc002ycv.2	-							NM_031215	NP_112492			Cdk5 and Abl enzyme substrate 2						cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	61079450	61079452	+	IGR	DEL	TTT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61079450_61079452delTTT								GATA5 (28424 upstream) : C20orf200 (62103 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	61661181	61661182	+	Intron	INS	-	C	C	rs138995308	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61661181_61661182insC	uc002yec.1	+											Homo sapiens cDNA FLJ46471 fis, clone THYMU3023394.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	62140896	62140896	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62140896delT								EEF1A2 (10391 upstream) : PPDPF (11237 downstream)																																			---	---	---	---
GMEB2	26205	broad.mit.edu	37	20	62240392	62240392	+	Intron	DEL	A	-	-	rs55700463		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62240392delA	uc002yfp.1	-						GMEB2_uc002yfq.1_Intron	NM_012384	NP_036516			glucocorticoid modulatory element binding						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding				0	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)															---	---	---	---
GMEB2	26205	broad.mit.edu	37	20	62240629	62240629	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62240629delC	uc002yfp.1	-						GMEB2_uc002yfq.1_Intron	NM_012384	NP_036516			glucocorticoid modulatory element binding						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding				0	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	62259531	62259531	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62259531delT								GMEB2 (1150 upstream) : STMN3 (11530 downstream)																																			---	---	---	---
ZBTB46	140685	broad.mit.edu	37	20	62395789	62395789	+	Intron	DEL	A	-	-	rs111949874		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62395789delA	uc002ygv.1	-						ZBTB46_uc002ygu.2_Intron	NM_025224	NP_079500			zinc finger and BTB domain containing 46						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)|ovary(1)	2	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)																	---	---	---	---
TPD52L2	7165	broad.mit.edu	37	20	62502706	62502707	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62502706_62502707insT	uc002yhc.2	+						TPD52L2_uc002ygy.2_Intron|TPD52L2_uc002ygz.2_Intron|TPD52L2_uc002yha.2_Intron|TPD52L2_uc002yhb.2_Intron|TPD52L2_uc002yhd.2_Intron|TPD52L2_uc011abk.1_Intron|TPD52L2_uc011abl.1_Intron|TPD52L2_uc002yhe.2_5'Flank	NM_003288	NP_003279			tumor protein D52-like 2 isoform e						regulation of cell proliferation	perinuclear region of cytoplasm	protein binding|protein homodimerization activity			ovary(1)|skin(1)	2	all_cancers(38;1.3e-12)|all_epithelial(29;2.23e-14)|Lung NSC(23;5.92e-10)|all_lung(23;2.08e-09)																	---	---	---	---
Unknown	0	broad.mit.edu	37	21	9672275	9672275	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9672275delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9832163	9832165	+	IGR	DEL	TTG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9832163_9832165delTTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10459303	10459306	+	Intron	DEL	TCTC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10459303_10459306delTCTC	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10462609	10462609	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10462609delT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10857185	10857189	+	IGR	DEL	GAATG	-	-	rs150941992		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10857185_10857189delGAATG								None (None upstream) : TPTE (49554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	11132711	11132711	+	IGR	DEL	A	-	-	rs111717206		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11132711delA								BAGE (33774 upstream) : None (None downstream)																																			---	---	---	---
RBM11	54033	broad.mit.edu	37	21	15592948	15592948	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15592948delT	uc002yjo.3	+						RBM11_uc002yjn.3_Intron|RBM11_uc002yjp.3_Intron	NM_144770	NP_658983			RNA binding motif protein 11								nucleotide binding|RNA binding				0				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)														---	---	---	---
HSPA13	6782	broad.mit.edu	37	21	15747813	15747814	+	Intron	DEL	TT	-	-	rs71966027		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15747813_15747814delTT	uc002yjt.2	-						HSPA13_uc011abx.1_Intron	NM_006948	NP_008879			heat shock protein 70kDa family member 13							endoplasmic reticulum|microsome	ATP binding			kidney(1)	1																		---	---	---	---
USP25	29761	broad.mit.edu	37	21	17220944	17220945	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17220944_17220945insT	uc002yjy.1	+						USP25_uc011aby.1_Intron|USP25_uc002yjz.1_Intron|USP25_uc010gla.1_Intron	NM_013396	NP_037528			ubiquitin specific peptidase 25						protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)|liver(2)	5				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)														---	---	---	---
C21orf34	388815	broad.mit.edu	37	21	17593399	17593399	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17593399delT	uc002ykb.2	+						C21orf34_uc010glc.2_Intron|C21orf34_uc002ykc.2_Intron	NR_027790				Homo sapiens C21ORF34 (C21orf34) mRNA, partial cds, alternatively spliced.												0		Breast(209;0.152)		Epithelial(23;8.3e-05)|all cancers(11;0.000383)|Colorectal(24;0.00387)|COAD - Colon adenocarcinoma(22;0.0113)|OV - Ovarian serous cystadenocarcinoma(11;0.0127)|LUSC - Lung squamous cell carcinoma(23;0.153)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	18000065	18000065	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18000065delC								C21orf34 (17971 upstream) : CXADR (885265 downstream)																																			---	---	---	---
CXADR	1525	broad.mit.edu	37	21	18882690	18882691	+	5'Flank	INS	-	C	C	rs150119201	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18882690_18882691insC	uc002yki.2	+						CXADR_uc002ykh.1_5'Flank|CXADR_uc010gld.1_5'Flank|CXADR_uc010gle.1_5'Flank	NM_001338	NP_001329			coxsackie virus and adenovirus receptor						blood coagulation|cell adhesion|interspecies interaction between organisms|leukocyte migration|regulation of immune response	adherens junction|basolateral plasma membrane|extracellular region|integral to plasma membrane|nucleus|tight junction	receptor activity			ovary(1)	1				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)														---	---	---	---
CXADR	1525	broad.mit.edu	37	21	18894473	18894473	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18894473delT	uc002yki.2	+						CXADR_uc002ykh.1_Intron|CXADR_uc010gld.1_Intron|CXADR_uc010gle.1_Intron	NM_001338	NP_001329			coxsackie virus and adenovirus receptor						blood coagulation|cell adhesion|interspecies interaction between organisms|leukocyte migration|regulation of immune response	adherens junction|basolateral plasma membrane|extracellular region|integral to plasma membrane|nucleus|tight junction	receptor activity			ovary(1)	1				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)														---	---	---	---
NCRNA00157	54075	broad.mit.edu	37	21	19254502	19254502	+	Intron	DEL	T	-	-	rs72282156		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19254502delT	uc011aca.1	-							NR_024354				Homo sapiens non-protein coding RNA 157 (NCRNA00157), non-coding RNA.												0																		---	---	---	---
NCAM2	4685	broad.mit.edu	37	21	22809795	22809796	+	Intron	DEL	TG	-	-	rs3990174		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22809795_22809796delTG	uc002yld.1	+						NCAM2_uc011acb.1_Intron	NM_004540	NP_004531			neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	24394953	24394953	+	IGR	DEL	T	-	-	rs67004990		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24394953delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	25295926	25295927	+	IGR	DEL	GT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25295926_25295927delGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	26144946	26144946	+	IGR	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26144946delA								None (None upstream) : NCRNA00158 (613188 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	26410943	26410943	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26410943delT								None (None upstream) : NCRNA00158 (347191 downstream)																																			---	---	---	---
APP	351	broad.mit.edu	37	21	27421517	27421517	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27421517delA	uc002ylz.2	-						APP_uc010glk.2_Intron|APP_uc002yma.2_Intron|APP_uc011ach.1_Intron|APP_uc002ymb.2_Intron|APP_uc010glj.2_Intron|APP_uc011aci.1_Intron|APP_uc011acj.1_Intron	NM_000484	NP_000475			amyloid beta A4 protein isoform a precursor						adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		Breast(209;0.00295)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	27635596	27635596	+	IGR	DEL	T	-	-	rs34123021		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27635596delT								APP (92150 upstream) : CYYR1 (202933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	28425010	28425010	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28425010delC								ADAMTS5 (85571 upstream) : NCRNA00113 (669688 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	28528706	28528707	+	IGR	INS	-	C	C	rs150219738	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28528706_28528707insC								ADAMTS5 (189267 upstream) : NCRNA00113 (565991 downstream)																																			---	---	---	---
C21orf7	56911	broad.mit.edu	37	21	30474382	30474382	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30474382delA	uc002yne.2	+						C21orf7_uc011acr.1_Intron|C21orf7_uc002ynd.2_Intron|C21orf7_uc010gln.2_Intron|C21orf7_uc002ynf.2_Intron	NM_020152	NP_064537			chromosome 21 open reading frame 7							cytosol|nucleus	protein binding			ovary(2)	2				Colorectal(56;0.248)														---	---	---	---
GRIK1	2897	broad.mit.edu	37	21	31030442	31030442	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31030442delT	uc002yno.1	-						GRIK1_uc002ynn.2_Intron|GRIK1_uc011acs.1_Intron|GRIK1_uc011act.1_Intron|GRIK1_uc010glq.1_Intron|GRIK1_uc002ynr.2_Intron	NM_000830	NP_000821			glutamate receptor, ionotropic, kainate 1						central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)													---	---	---	---
Unknown	0	broad.mit.edu	37	21	33241238	33241239	+	IGR	INS	-	T	T	rs150495849	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33241238_33241239insT								SFRS15 (136807 upstream) : HUNK (4389 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	33558357	33558358	+	IGR	INS	-	T	T	rs138195398	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33558357_33558358insT								NCRNA00159 (29541 upstream) : C21orf45 (82174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	34290207	34290207	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34290207delC								C21orf62 (104154 upstream) : OLIG2 (108032 downstream)																																			---	---	---	---
ITSN1	6453	broad.mit.edu	37	21	35248571	35248572	+	Intron	DEL	TC	-	-	rs72068493		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35248571_35248572delTC	uc002yta.1	+						DONSON_uc002ysn.1_Intron|ITSN1_uc002ytb.1_Intron|ITSN1_uc002ytj.2_Intron|ITSN1_uc010gmm.1_Intron|ITSN1_uc010gmn.1_Intron|ITSN1_uc002ytk.1_Intron	NM_003024	NP_003015			intersectin 1 isoform ITSN-l						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4																		---	---	---	---
CLIC6	54102	broad.mit.edu	37	21	36061896	36061896	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36061896delT	uc010gmt.1	+						CLIC6_uc002yuf.1_Intron	NM_053277	NP_444507			chloride intracellular channel 6							chloride channel complex|cytoplasm|plasma membrane	voltage-gated chloride channel activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
RUNX1	861	broad.mit.edu	37	21	36626847	36626850	+	Intron	DEL	GTGC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36626847_36626850delGTGC	uc002yut.1	-											Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
CBR3	874	broad.mit.edu	37	21	37512728	37512728	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37512728delG	uc002yve.2	+						uc002yvc.1_Intron|uc002yvd.1_Intron	NM_001236	NP_001227			carbonyl reductase 3							cytosol|nucleus	carbonyl reductase (NADPH) activity|NADPH binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	37995554	37995554	+	IGR	DEL	T	-	-	rs111532513		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37995554delT								CLDN14 (46687 upstream) : SIM2 (76437 downstream)																																			---	---	---	---
TTC3	7267	broad.mit.edu	37	21	38496045	38496045	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38496045delT	uc002yvz.2	+						TTC3_uc011aee.1_Intron|TTC3_uc002ywa.2_Intron|TTC3_uc002ywb.2_Intron|TTC3_uc010gnf.2_Intron|TTC3_uc002ywc.2_Intron|TTC3_uc011aed.1_Intron|TTC3_uc010gne.1_Intron	NM_001001894	NP_001001894			tetratricopeptide repeat domain 3						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)																---	---	---	---
KCNJ6	3763	broad.mit.edu	37	21	39216366	39216367	+	Intron	INS	-	TTT	TTT	rs10650462		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39216366_39216367insTTT	uc011aej.1	-						KCNJ6_uc002ywo.2_Intron	NM_002240	NP_002231			potassium inwardly-rectifying channel J6						synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1					Halothane(DB01159)													---	---	---	---
DSCR4	10281	broad.mit.edu	37	21	39493079	39493080	+	Intron	DEL	AC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39493079_39493080delAC	uc002ywp.2	-						DSCR8_uc002ywt.3_5'Flank|DSCR8_uc010gnp.2_5'Flank|DSCR8_uc010gnq.2_5'Flank|DSCR8_uc010gnr.2_5'Flank|DSCR8_uc010gns.2_5'Flank	NM_005867	NP_005858			Down syndrome critical region protein 4											ovary(1)	1																		---	---	---	---
PCP4	5121	broad.mit.edu	37	21	41249928	41249929	+	Intron	INS	-	GA	GA			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41249928_41249929insGA	uc002yyp.2	+							NM_006198	NP_006189			Purkinje cell protein 4						central nervous system development	cytosol|nucleus				large_intestine(1)	1		Prostate(19;2.65e-06)|all_epithelial(19;0.138)																---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	42138063	42138063	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42138063delA	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
SLC37A1	54020	broad.mit.edu	37	21	43940073	43940074	+	Intron	DEL	TT	-	-	rs59285718		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43940073_43940074delTT	uc002zbi.2	+						SLC37A1_uc002zbj.2_Intron	NM_018964	NP_061837			solute carrier family 37 member 1						carbohydrate transport|transmembrane transport	integral to membrane					0																		---	---	---	---
PDE9A	5152	broad.mit.edu	37	21	44098661	44098662	+	Intron	INS	-	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44098661_44098662insG	uc002zbm.2	+						PDE9A_uc002zbn.2_Intron|PDE9A_uc002zbo.2_Intron|PDE9A_uc002zbp.2_Intron|PDE9A_uc002zbq.2_Intron|PDE9A_uc002zbs.2_Intron|PDE9A_uc002zbr.2_Intron|PDE9A_uc002zbt.2_Intron|PDE9A_uc002zbu.2_Intron|PDE9A_uc002zbv.2_Intron|PDE9A_uc002zbw.2_Intron|PDE9A_uc002zbx.2_Intron|PDE9A_uc002zby.2_Intron|PDE9A_uc002zbz.2_Intron|PDE9A_uc002zca.2_Intron|PDE9A_uc002zcb.2_Intron|PDE9A_uc002zcc.2_Intron|PDE9A_uc002zcd.2_Intron|PDE9A_uc002zce.2_Intron|PDE9A_uc002zcf.2_Intron|PDE9A_uc002zcg.2_Intron	NM_002606	NP_002597			phosphodiesterase 9A isoform a						platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
WDR4	10785	broad.mit.edu	37	21	44268454	44268455	+	Intron	DEL	CA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44268454_44268455delCA	uc002zci.2	-						uc002zcj.1_5'Flank	NM_033661	NP_387510			WD repeat domain 4 protein						tRNA modification	cytoplasm|nucleoplasm	protein binding			ovary(1)	1				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	44457397	44457398	+	IGR	INS	-	A	A	rs141511289	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44457397_44457398insA								PKNOX1 (3709 upstream) : CBS (15903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	44832936	44832936	+	IGR	DEL	A	-	-	rs11346836		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44832936delA								CRYAA (240023 upstream) : SIK1 (1462 downstream)																																			---	---	---	---
TRAPPC10	7109	broad.mit.edu	37	21	45461263	45461264	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45461263_45461264insT	uc002zea.2	+						TRAPPC10_uc010gpo.2_Intron|TRAPPC10_uc002zdz.2_Intron	NM_003274	NP_003265			trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	45632082	45632083	+	IGR	INS	-	TGAA	TGAA	rs150240279	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45632082_45632083insTGAA								C21orf33 (66478 upstream) : ICOSLG (14641 downstream)																																			---	---	---	---
COL18A1	80781	broad.mit.edu	37	21	46926685	46926706	+	Intron	DEL	CCCTCCCACCTTCCCTCTGGAG	-	-	rs141187903	by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46926685_46926706delCCCTCCCACCTTCCCTCTGGAG	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron|SLC19A1_uc010gpy.1_Intron|COL18A1_uc002zhj.2_Intron|COL18A1_uc002zhk.2_5'Flank	NM_130444	NP_569711			alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)														---	---	---	---
PCBP3	54039	broad.mit.edu	37	21	47263044	47263044	+	Intron	DEL	T	-	-	rs141356928		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47263044delT	uc010gqb.2	+							NM_020528	NP_065389			poly(rC) binding protein 3 isoform 1						mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)														---	---	---	---
DIP2A	23181	broad.mit.edu	37	21	47903253	47903253	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47903253delA	uc002zjo.2	+						DIP2A_uc011afy.1_Intron|DIP2A_uc011afz.1_Intron|DIP2A_uc002zjl.2_Intron|DIP2A_uc002zjm.2_Intron|DIP2A_uc010gql.2_Intron|DIP2A_uc002zjn.2_Intron	NM_015151	NP_055966			disco-interacting protein 2A isoform a						multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	16601841	16601844	+	IGR	DEL	GTGA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16601841_16601844delGTGA								OR11H1 (152037 upstream) : CCT8L2 (469804 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	17238598	17238599	+	IGR	INS	-	A	A	rs142952466	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17238598_17238599insA								psiTPTE22 (59077 upstream) : XKR3 (25714 downstream)																																			---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	23028411	23028418	+	Intron	DEL	GACCCTGG	-	-	rs144113904		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23028411_23028418delGACCCTGG	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	23848665	23848666	+	IGR	INS	-	A	A	rs144878934		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23848665_23848666insA								ZDHHC8P1 (103866 upstream) : IGLL1 (66649 downstream)																																			---	---	---	---
SLC2A11	66035	broad.mit.edu	37	22	24204625	24204626	+	Intron	INS	-	G	G	rs140916169	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24204625_24204626insG	uc002zyn.3	+						SLC2A11_uc002zyl.1_Intron|SLC2A11_uc002zym.3_Intron|SLC2A11_uc002zyo.3_Intron|SLC2A11_uc011ajc.1_Intron|SLC2A11_uc011ajd.1_Intron|SLC2A11_uc002zyp.3_Intron	NM_001024938	NP_001020109			glucose transporter protein 10 isoform c							integral to membrane|plasma membrane	sugar transmembrane transporter activity			ovary(1)	1																		---	---	---	---
ADRBK2	157	broad.mit.edu	37	22	26040103	26040103	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26040103delT	uc003abx.3	+						ADRBK2_uc010gux.2_Intron|ADRBK2_uc003abw.2_Intron|ADRBK2_uc003aby.3_Intron	NM_005160	NP_005151			beta-adrenergic receptor kinase 2								ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			lung(3)|ovary(2)|stomach(1)|central_nervous_system(1)	7					Adenosine triphosphate(DB00171)													---	---	---	---
TPST2	8459	broad.mit.edu	37	22	26960708	26960708	+	Intron	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26960708delC	uc003acw.2	-						TPST2_uc003acx.2_Intron|TPST2_uc011akf.1_Intron	NM_001008566	NP_001008566			tyrosylprotein sulfotransferase 2						peptidyl-tyrosine sulfation	endoplasmic reticulum|Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity			central_nervous_system(1)	1																		---	---	---	---
PISD	23761	broad.mit.edu	37	22	32025367	32025368	+	Intron	INS	-	GA	GA	rs144624624	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32025367_32025368insGA	uc003alm.3	-						PISD_uc003alk.2_Intron|PISD_uc003all.2_Intron|PISD_uc011alr.1_Intron|PISD_uc003aln.3_Intron	NM_014338	NP_055153			phosphatidylserine decarboxylase						phospholipid biosynthetic process	mitochondrion	phosphatidylserine decarboxylase activity			central_nervous_system(2)|ovary(1)	3					Phosphatidylserine(DB00144)													---	---	---	---
SYN3	8224	broad.mit.edu	37	22	33156790	33156790	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33156790delA	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481			synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1																		---	---	---	---
FOXRED2	80020	broad.mit.edu	37	22	36893227	36893227	+	Intron	DEL	A	-	-	rs74938657		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36893227delA	uc003apn.3	-						FOXRED2_uc003apm.3_Intron|FOXRED2_uc003apo.3_Intron|FOXRED2_uc003app.3_Intron	NM_024955	NP_079231			FAD-dependent oxidoreductase domain containing 2						ER-associated protein catabolic process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			lung(1)|kidney(1)	2																		---	---	---	---
LGALS1	3956	broad.mit.edu	37	22	38075480	38075481	+	Intron	INS	-	A	A	rs145418865	by1000genomes;by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38075480_38075481insA	uc003atn.2	+							NM_002305	NP_002296			galectin-1						apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of apoptosis	cytoplasm|extracellular space|proteinaceous extracellular matrix	galactoside binding|signal transducer activity				0	Melanoma(58;0.0574)																	---	---	---	---
TRIOBP	11078	broad.mit.edu	37	22	38161835	38161836	+	Intron	INS	-	G	G	rs138412450	by1000genomes	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38161835_38161836insG	uc003atr.2	+						TRIOBP_uc003atu.2_Intron|TRIOBP_uc003atw.2_Intron|TRIOBP_uc003atx.1_Intron|TRIOBP_uc010gxh.2_Intron	NM_001039141	NP_001034230			TRIO and F-actin binding protein isoform 6						actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)																	---	---	---	---
Unknown	0	broad.mit.edu	37	22	39333583	39333584	+	IGR	INS	-	GTGTGTGTGG	GTGTGTGTGG	rs58276656		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39333583_39333584insGTGTGTGTGG								CBX6 (65325 upstream) : APOBEC3A (19943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	40094945	40094945	+	IGR	DEL	C	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40094945delC								CACNA1I (9207 upstream) : ENTHD1 (44105 downstream)																																			---	---	---	---
MEI1	150365	broad.mit.edu	37	22	42128781	42128781	+	Intron	DEL	T	-	-	rs34396284		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42128781delT	uc003baz.1	+						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc003bay.3_Intron|MEI1_uc011apd.1_Intron	NM_152513	NP_689726			meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	42831822	42831822	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42831822delT								NFAM1 (3421 upstream) : SERHL (64763 downstream)																																			---	---	---	---
PACSIN2	11252	broad.mit.edu	37	22	43290256	43290257	+	Intron	INS	-	T	T	rs78108805		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43290256_43290257insT	uc010gzg.2	-						PACSIN2_uc003bdg.3_Intron|PACSIN2_uc003bde.3_Intron|PACSIN2_uc003bdf.3_Intron	NM_007229	NP_009160			protein kinase C and casein kinase substrate in						actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)																---	---	---	---
PARVB	29780	broad.mit.edu	37	22	44403370	44403370	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44403370delG	uc003bem.2	+							NM_001003828	NP_001003828			parvin, beta isoform a						cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding				0		Ovarian(80;0.0246)|all_neural(38;0.0423)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	44606896	44606896	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44606896delT								PARVG (3862 upstream) : KIAA1644 (32661 downstream)																																			---	---	---	---
RIBC2	26150	broad.mit.edu	37	22	45813915	45813916	+	Intron	INS	-	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45813915_45813916insT	uc011aqs.1	+							NM_015653	NP_056468			RIB43A domain with coiled-coils 2												0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)														---	---	---	---
CERK	64781	broad.mit.edu	37	22	47125937	47125940	+	Intron	DEL	AAAC	-	-	rs67843141		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47125937_47125940delAAAC	uc003bia.2	-							NM_022766	NP_073603			ceramide kinase						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|ceramide metabolic process	integral to membrane of membrane fraction|membrane|nucleus	ATP binding|ceramide kinase activity|diacylglycerol kinase activity|magnesium ion binding			skin(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)														---	---	---	---
TBC1D22A	25771	broad.mit.edu	37	22	47338157	47338157	+	Intron	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47338157delG	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161			TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)														---	---	---	---
ALG12	79087	broad.mit.edu	37	22	50297035	50297036	+	3'UTR	DEL	CT	-	-	rs16445	byFrequency	TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50297035_50297036delCT	uc003biy.2	-	10						NM_024105	NP_077010			alpha-1,6-mannosyltransferase ALG12						dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane					0		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	642264	642271	+	IGR	DEL	AGAGACAG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:642264_642271delAGAGACAG								SHOX (22119 upstream) : CRLF2 (672616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	858824	858825	+	IGR	INS	-	CTT	CTT			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:858824_858825insCTT								SHOX (238679 upstream) : CRLF2 (456062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	1263811	1263814	+	IGR	DEL	AGGG	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1263811_1263814delAGGG								SHOX (643666 upstream) : CRLF2 (51073 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	1346429	1346432	+	IGR	DEL	GGAT	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1346429_1346432delGGAT								CRLF2 (14899 upstream) : CSF2RA (41261 downstream)																																			---	---	---	---
CD99	4267	broad.mit.edu	37	X	2654243	2654243	+	Intron	DEL	A	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2654243delA	uc004cqm.2	+						CD99_uc010nda.2_Intron|CD99_uc004cqn.2_Intron|CD99_uc004cqo.2_Intron	NM_002414	NP_002405			CD99 antigen isoform a precursor						cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	26468333	26468334	+	IGR	INS	-	TC	TC			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26468333_26468334insTC								MAGEB6 (254571 upstream) : VENTXP1 (108120 downstream)																																			---	---	---	---
KIF4A	24137	broad.mit.edu	37	X	69561845	69561859	+	Intron	DEL	TTAACATGTATCTCA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69561845_69561859delTTAACATGTATCTCA	uc004dyg.2	+						KIF4A_uc010nkw.2_Intron|KIF4A_uc004dyf.1_Intron	NM_012310	NP_036442			kinesin family member 4						anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	78019925	78019926	+	IGR	INS	-	TC	TC	rs72101114		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78019925_78019926insTC								LPAR4 (7349 upstream) : P2RY10 (180903 downstream)																																			---	---	---	---
DIAPH2	1730	broad.mit.edu	37	X	96116503	96116503	+	Intron	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96116503delT	uc004efu.3	+						DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efs.2_Intron	NM_006729	NP_006720			diaphanous 2 isoform 156						cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	135698762	135698763	+	IGR	INS	-	TGA	TGA	rs113524784		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135698762_135698763insTGA								VGLL1 (59797 upstream) : CD40LG (31573 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	139638494	139638497	+	IGR	DEL	ACAC	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139638494_139638497delACAC								SOX3 (51269 upstream) : RP1-177G6.2 (153435 downstream)																																			---	---	---	---
SPANXC	64663	broad.mit.edu	37	X	140577261	140577262	+	Intron	DEL	TA	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140577261_140577262delTA	uc004fbl.2	-											Homo sapiens nuclear-associated protein SPAN-Xa (SPANX) mRNA, complete cds.							cytoplasm|nucleus					0	Acute lymphoblastic leukemia(192;7.65e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10054250	10054250	+	IGR	DEL	G	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10054250delG								TTTY22 (403396 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13402692	13402692	+	IGR	DEL	T	-	-	rs139669284		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13402692delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13714134	13714135	+	IGR	INS	-	TGTAG	TGTAG			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13714134_13714135insTGTAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	28582961	28582962	+	IGR	INS	-	AT	AT	rs4008413		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28582961_28582962insAT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	58992819	58992819	+	IGR	DEL	A	-	-	rs71244044		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58992819delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	59007433	59007433	+	IGR	DEL	T	-	-			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59007433delT								None (None upstream) : None (None downstream)																																			---	---	---	---
MTOR	2475	broad.mit.edu	37	1	11204807	11204807	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11204807C>G	uc001asd.2	-	34	4891	c.4770G>C	c.(4768-4770)ATG>ATC	p.M1590I		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1590	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29																		---	---	---	---
CLIC4	25932	broad.mit.edu	37	1	25153587	25153587	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25153587C>G	uc001bjo.2	+	4	680	c.395C>G	c.(394-396)TCA>TGA	p.S132*	CLIC4_uc001bjn.2_RNA|CLIC4_uc001bjp.1_Nonsense_Mutation_p.S112*	NM_013943	NP_039234	Q9Y696	CLIC4_HUMAN	chloride intracellular channel 4	132	GST C-terminal.				cellular response to calcium ion|establishment or maintenance of apical/basal cell polarity|keratinocyte differentiation|negative regulation of cell migration|regulation of cytoskeleton organization	actin cytoskeleton|apical part of cell|cell surface|cell-cell junction|centrosome|chloride channel complex|cytoplasmic vesicle membrane|cytosol|microvillus|midbody|mitochondrion|nuclear matrix|perinuclear region of cytoplasm|soluble fraction	voltage-gated chloride channel activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000778)|all_lung(284;0.00106)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0479)|OV - Ovarian serous cystadenocarcinoma(117;1.06e-24)|Colorectal(126;1.03e-07)|COAD - Colon adenocarcinoma(152;4.93e-06)|STAD - Stomach adenocarcinoma(196;0.000418)|GBM - Glioblastoma multiforme(114;0.000451)|BRCA - Breast invasive adenocarcinoma(304;0.00215)|KIRC - Kidney renal clear cell carcinoma(1967;0.00216)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.18)														---	---	---	---
ZMYM6	9204	broad.mit.edu	37	1	35452793	35452793	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35452793T>C	uc001byh.2	-	16	4118	c.3890A>G	c.(3889-3891)AAA>AGA	p.K1297R	uc001byd.3_5'Flank|uc001bye.2_5'Flank|ZMYM6_uc001byf.1_Intron|ZMYM6_uc010oht.1_Missense_Mutation_p.K1200R	NM_007167	NP_009098	O95789	ZMYM6_HUMAN	zinc finger protein 258	1297					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)																---	---	---	---
GJA9	81025	broad.mit.edu	37	1	39341225	39341225	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39341225G>C	uc001cct.1	-	2	827	c.546C>G	c.(544-546)CAC>CAG	p.H182Q	RRAGC_uc001ccr.2_5'Flank|MYCBP_uc001ccs.2_5'Flank	NM_030772	NP_110399	P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	182	Helical; (Potential).				cell communication	connexon complex|integral to membrane					0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)															---	---	---	---
TNNI3K	51086	broad.mit.edu	37	1	74664041	74664041	+	Silent	SNP	A	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74664041A>C	uc001dge.1	+	1	95	c.79A>C	c.(79-81)AGA>CGA	p.R27R	LRRIQ3_uc001dfy.3_5'Flank|LRRIQ3_uc001dfz.3_5'Flank|TNNI3K_uc001dgc.1_Silent_p.R27R|TNNI3K_uc001dgd.2_Silent_p.R27R|FPGT_uc010oqt.1_5'UTR|FPGT_uc010oqu.1_Silent_p.R27R|FPGT_uc001dgb.1_Silent_p.R27R|FPGT_uc010oqv.1_Silent_p.R27R	NM_001112808	NP_001106279	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform a	Error:Variant_position_missing_in_Q59H18_after_alignment						cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10																		---	---	---	---
ZNHIT6	54680	broad.mit.edu	37	1	86123656	86123656	+	Splice_Site	SNP	T	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86123656T>G	uc001dlh.2	-	9	1382	c.1248_splice	c.e9-1	p.R416_splice	ZNHIT6_uc010osc.1_Splice_Site_p.R377_splice	NM_017953	NP_060423			zinc finger, HIT type 6						box C/D snoRNP assembly|ribosome biogenesis	pre-snoRNP complex	identical protein binding|metal ion binding			large_intestine(1)	1																		---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103470221	103470221	+	Intron	SNP	T	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103470221T>C	uc001dul.2	-						COL11A1_uc001duk.2_Intron|COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845			alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)														---	---	---	---
CA14	23632	broad.mit.edu	37	1	150234696	150234696	+	Silent	SNP	A	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150234696A>C	uc001etx.2	+	4	705	c.396A>C	c.(394-396)GCA>GCC	p.A132A		NM_012113	NP_036245	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV precursor	132	Extracellular (Potential).					integral to membrane	carbonate dehydratase activity|metal ion binding			ovary(1)	1	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
CLK2	1196	broad.mit.edu	37	1	155235680	155235680	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155235680C>G	uc001fjy.2	-	8	1194	c.904G>C	c.(904-906)GAC>CAC	p.D302H	RAG1AP1_uc010pey.1_Intron|CLK2_uc001fjw.2_Missense_Mutation_p.D301H|CLK2_uc001fjx.2_Missense_Mutation_p.D74H|CLK2_uc009wqm.2_Missense_Mutation_p.D302H	NM_003993	NP_003984	P49760	CLK2_HUMAN	CDC-like kinase 2	302	Protein kinase.					nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)										Other_conserved_DNA_damage_response_genes					---	---	---	---
KIRREL	55243	broad.mit.edu	37	1	158064804	158064804	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158064804C>T	uc001frn.3	+	15	2572	c.2168C>T	c.(2167-2169)GCG>GTG	p.A723V	KIRREL_uc010pib.1_Missense_Mutation_p.A623V|KIRREL_uc009wsq.2_Missense_Mutation_p.A559V|KIRREL_uc001fro.3_Missense_Mutation_p.A537V|uc001frp.2_5'Flank	NM_018240	NP_060710	Q96J84	KIRR1_HUMAN	kin of IRRE like precursor	723	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)																	---	---	---	---
CD1C	911	broad.mit.edu	37	1	158261887	158261887	+	Silent	SNP	A	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158261887A>G	uc001fru.2	+	3	634	c.342A>G	c.(340-342)GTA>GTG	p.V114V	CD1C_uc001frv.2_5'UTR	NM_001765	NP_001756	P29017	CD1C_HUMAN	CD1C antigen precursor	114	Extracellular (Potential).				antigen processing and presentation|T cell activation involved in immune response	endosome membrane|integral to plasma membrane	endogenous lipid antigen binding|exogenous lipid antigen binding|glycolipid binding|lipopeptide binding			ovary(2)|skin(1)|pancreas(1)	4	all_hematologic(112;0.0378)																	---	---	---	---
DARC	2532	broad.mit.edu	37	1	159176045	159176045	+	Silent	SNP	G	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159176045G>T	uc001fto.2	+	2	1056	c.816G>T	c.(814-816)CTG>CTT	p.L272L	DARC_uc001ftp.3_Silent_p.L274L	NM_002036	NP_002027	Q16570	DUFFY_HUMAN	Duffy blood group antigen isoform b	272	Extracellular (Potential).				defense response	integral to membrane|plasma membrane	C-C chemokine binding|chemokine receptor activity			ovary(1)|lung(1)	2	all_hematologic(112;0.0429)																	---	---	---	---
RNPEP	6051	broad.mit.edu	37	1	201965357	201965357	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201965357G>A	uc001gxd.2	+	4	849	c.820G>A	c.(820-822)GGA>AGA	p.G274R	RNPEP_uc001gxe.2_5'UTR|RNPEP_uc001gxf.2_Missense_Mutation_p.G143R	NM_020216	NP_064601	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase	274					leukotriene biosynthetic process		epoxide hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)														---	---	---	---
PGBD5	79605	broad.mit.edu	37	1	230498095	230498095	+	Intron	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230498095C>T	uc010pwb.1	-						PGBD5_uc001htv.2_Silent_p.E115E	NM_024554	NP_078830			piggyBac transposable element derived 5							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)														---	---	---	---
NLRP3	114548	broad.mit.edu	37	1	247587525	247587525	+	Silent	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247587525C>T	uc001icr.2	+	5	918	c.780C>T	c.(778-780)CAC>CAT	p.H260H	NLRP3_uc001ics.2_Silent_p.H260H|NLRP3_uc001icu.2_Silent_p.H260H|NLRP3_uc001icw.2_Silent_p.H260H|NLRP3_uc001icv.2_Silent_p.H260H|NLRP3_uc010pyw.1_Silent_p.H258H|NLRP3_uc001ict.1_Silent_p.H258H	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	260	NACHT.				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)															---	---	---	---
RRM2	6241	broad.mit.edu	37	2	10263605	10263605	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10263605A>G	uc002rah.2	+	3	457	c.266A>G	c.(265-267)GAT>GGT	p.D89G		NM_001034	NP_001025	P31350	RIR2_HUMAN	ribonucleotide reductase M2 polypeptide isoform	89					deoxyribonucleoside diphosphate metabolic process|deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol	ribonucleoside-diphosphate reductase activity|transition metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)														---	---	---	---
KCNG3	170850	broad.mit.edu	37	2	42671708	42671708	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42671708G>C	uc002rsn.2	-	2	1273	c.677C>G	c.(676-678)GCT>GGT	p.A226G	KCNG3_uc002rsm.2_Missense_Mutation_p.A215G	NM_133329	NP_579875	Q8TAE7	KCNG3_HUMAN	potassium voltage-gated channel, subfamily G,	226	Helical; Name=Segment S2; (Potential).					endoplasmic reticulum|voltage-gated potassium channel complex	protein binding			central_nervous_system(1)	1																		---	---	---	---
NEB	4703	broad.mit.edu	37	2	152581987	152581987	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152581987C>G	uc010fnx.2	-	6	573	c.382G>C	c.(382-384)GTA>CTA	p.V128L		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	128	Nebulin 2.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)														---	---	---	---
ZDBF2	57683	broad.mit.edu	37	2	207175935	207175935	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207175935C>T	uc002vbp.2	+	5	6933	c.6683C>T	c.(6682-6684)TCG>TTG	p.S2228L		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2228							nucleic acid binding|zinc ion binding			ovary(3)	3																		---	---	---	---
CPS1	1373	broad.mit.edu	37	2	211507237	211507237	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211507237G>T	uc002vee.3	+	25	3121	c.2989G>T	c.(2989-2991)GTC>TTC	p.V997F	CPS1_uc010fur.2_Missense_Mutation_p.V1003F|CPS1_uc010fus.2_Missense_Mutation_p.V546F	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	997					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)														---	---	---	---
GOLGA4	2803	broad.mit.edu	37	3	37368748	37368748	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37368748C>G	uc003cgv.2	+	14	5675	c.5371C>G	c.(5371-5373)CAA>GAA	p.Q1791E	GOLGA4_uc010hgr.1_Missense_Mutation_p.Q1352E|GOLGA4_uc003cgw.2_Missense_Mutation_p.Q1813E|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Missense_Mutation_p.Q1672E	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4	1791	Potential.|Glu-rich.				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4																		---	---	---	---
VPRBP	9730	broad.mit.edu	37	3	51458366	51458366	+	Silent	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51458366G>A	uc003dbe.1	-	14	2226	c.2058C>T	c.(2056-2058)ATC>ATT	p.I686I	VPRBP_uc003dbf.1_5'UTR	NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein	686					interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)														---	---	---	---
DNAH1	25981	broad.mit.edu	37	3	52356529	52356529	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52356529C>A	uc011bef.1	+	2	332	c.71C>A	c.(70-72)CCT>CAT	p.P24H	DNAH1_uc003ddt.1_Missense_Mutation_p.P24H	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	24	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)														---	---	---	---
ARAP2	116984	broad.mit.edu	37	4	36189098	36189098	+	Silent	SNP	A	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36189098A>C	uc003gsq.1	-	8	1991	c.1653T>G	c.(1651-1653)ACT>ACG	p.T551T	ARAP2_uc003gsr.1_Silent_p.T551T	NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	551	PH 1.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
SLC6A18	348932	broad.mit.edu	37	5	1243688	1243688	+	Missense_Mutation	SNP	C	G	G	rs150034651		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1243688C>G	uc003jby.1	+	9	1273	c.1150C>G	c.(1150-1152)CTG>GTG	p.L384V		NM_182632	NP_872438	Q96N87	S6A18_HUMAN	solute carrier family 6, member 18	384	Extracellular (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)															---	---	---	---
MARCH6	10299	broad.mit.edu	37	5	10411480	10411480	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10411480A>T	uc003jet.1	+	19	1910	c.1727A>T	c.(1726-1728)GAA>GTA	p.E576V	MARCH6_uc011cmu.1_Missense_Mutation_p.E528V|MARCH6_uc003jeu.1_Missense_Mutation_p.E274V|MARCH6_uc011cmv.1_Missense_Mutation_p.E471V	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	576	Cytoplasmic (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2																		---	---	---	---
NUP155	9631	broad.mit.edu	37	5	37342678	37342678	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37342678A>T	uc003jku.1	-	10	1184	c.1066T>A	c.(1066-1068)TGT>AGT	p.C356S	NUP155_uc003jkt.1_Missense_Mutation_p.C297S|NUP155_uc010iuz.1_Missense_Mutation_p.C356S	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1	356					carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
RAB3C	115827	broad.mit.edu	37	5	58021913	58021913	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58021913A>T	uc003jrp.2	+	3	434	c.337A>T	c.(337-339)ACA>TCA	p.T113S		NM_138453	NP_612462	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family	113					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			ovary(1)|central_nervous_system(1)	2		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)														---	---	---	---
CMYA5	202333	broad.mit.edu	37	5	79034978	79034978	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79034978A>C	uc003kgc.2	+	2	10462	c.10390A>C	c.(10390-10392)AAT>CAT	p.N3464H		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3464						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)														---	---	---	---
VCAN	1462	broad.mit.edu	37	5	82876239	82876239	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82876239G>C	uc003kii.3	+	15	10533	c.10177G>C	c.(10177-10179)GAG>CAG	p.E3393Q	VCAN_uc003kij.3_Missense_Mutation_p.E2406Q|VCAN_uc010jau.2_Missense_Mutation_p.E1639Q|VCAN_uc003kik.3_Missense_Mutation_p.E652Q|VCAN_uc003kil.3_Missense_Mutation_p.E2057Q	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	3393					cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)														---	---	---	---
ELL2	22936	broad.mit.edu	37	5	95278749	95278749	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95278749A>T	uc003klr.3	-	2	502	c.152T>A	c.(151-153)TTA>TAA	p.L51*		NM_012081	NP_036213	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	51					regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)														---	---	---	---
APC	324	broad.mit.edu	37	5	112174631	112174631	+	Nonsense_Mutation	SNP	C	T	T	rs121913331		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112174631C>T	uc010jby.2	+	16	3720	c.3340C>T	c.(3340-3342)CGA>TGA	p.R1114*	APC_uc011cvt.1_Nonsense_Mutation_p.R1096*|APC_uc003kpz.3_Nonsense_Mutation_p.R1114*|APC_uc003kpy.3_Nonsense_Mutation_p.R1114*|APC_uc010jbz.2_Nonsense_Mutation_p.R831*|APC_uc010jca.2_Nonsense_Mutation_p.R414*	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	1114	Ser-rich.|Responsible for down-regulation through a process mediated by direct ubiquitination.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.R1114*(22)|p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		R1114*(SW948_LARGE_INTESTINE)|R1114*(LOVO_LARGE_INTESTINE)	12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			---	---	---	---
PCDHB8	56128	broad.mit.edu	37	5	140558485	140558485	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140558485C>G	uc011dai.1	+	1	1056	c.870C>G	c.(868-870)AGC>AGG	p.S290R	PCDHB16_uc003liv.2_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	290	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
HRH2	3274	broad.mit.edu	37	5	175110463	175110463	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175110463C>A	uc003mdd.2	+	1	2000	c.227C>A	c.(226-228)GCC>GAC	p.A76D	HRH2_uc003mdc.3_Missense_Mutation_p.A76D	NM_022304	NP_071640	P25021	HRH2_HUMAN	histamine receptor H2 isoform 2	76	Helical; Name=2; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|immune response	integral to plasma membrane	histamine receptor activity			ovary(1)	1	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Nizatidine(DB00585)|Ranitidine(DB00863)													---	---	---	---
CDYL	9425	broad.mit.edu	37	6	4935819	4935819	+	Silent	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4935819G>C	uc003mwi.2	+	5	1055	c.924G>C	c.(922-924)GTG>GTC	p.V308V	CDYL_uc003mwj.2_Silent_p.V254V|CDYL_uc003mwk.2_Silent_p.V19V|CDYL_uc011dhx.1_Silent_p.V122V|CDYL_uc011dhy.1_Silent_p.V122V	NM_001143971	NP_001137443	Q9Y232	CDYL1_HUMAN	chromodomain protein, Y chromosome-like isoform	308					regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)														---	---	---	---
CDKAL1	54901	broad.mit.edu	37	6	20846367	20846367	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20846367C>G	uc003ndc.1	+	9	874	c.700C>G	c.(700-702)CCA>GCA	p.P234A	CDKAL1_uc003ndd.1_Missense_Mutation_p.P234A|CDKAL1_uc003nde.1_Missense_Mutation_p.P164A	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein	234					RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)															---	---	---	---
OR2J2	26707	broad.mit.edu	37	6	29141694	29141694	+	Silent	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29141694G>A	uc011dlm.1	+	1	384	c.282G>A	c.(280-282)TCG>TCA	p.S94S		NM_030905	NP_112167	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J,	94	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---
GSTA5	221357	broad.mit.edu	37	6	52701078	52701078	+	Silent	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52701078G>C	uc003pba.1	-	4	298	c.228C>G	c.(226-228)GCC>GCG	p.A76A		NM_153699	NP_714543	Q7RTV2	GSTA5_HUMAN	glutathione S-transferase alpha 5	76	GST N-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.0912)				Glutathione(DB00143)													---	---	---	---
LAMA2	3908	broad.mit.edu	37	6	129591764	129591764	+	Intron	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129591764C>G	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417			laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)														---	---	---	---
MED23	9439	broad.mit.edu	37	6	131914216	131914216	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131914216C>T	uc003qcs.1	-	24	3502	c.3328G>A	c.(3328-3330)GTG>ATG	p.V1110M	MED23_uc003qcq.2_Missense_Mutation_p.V1116M|MED23_uc003qcr.1_Translation_Start_Site	NM_004830	NP_004821	Q9ULK4	MED23_HUMAN	mediator complex subunit 23 isoform a	1110					regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)														---	---	---	---
FBXO24	26261	broad.mit.edu	37	7	100192033	100192033	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100192033T>C	uc003uvm.1	+	6	1114	c.821T>C	c.(820-822)GTG>GCG	p.V274A	FBXO24_uc003uvl.1_Missense_Mutation_p.V260A|FBXO24_uc003uvn.1_5'UTR|uc011kjy.1_Intron|FBXO24_uc011kjz.1_Missense_Mutation_p.V312A|FBXO24_uc011kka.1_Missense_Mutation_p.V262A	NM_033506	NP_277041	O75426	FBX24_HUMAN	F-box only protein 24 isoform 1	274						ubiquitin ligase complex	ubiquitin-protein ligase activity			ovary(3)|skin(1)	4	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)																	---	---	---	---
MUC17	140453	broad.mit.edu	37	7	100686417	100686417	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100686417C>T	uc003uxp.1	+	3	11773	c.11720C>T	c.(11719-11721)ACC>ATC	p.T3907I	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3907	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)																	---	---	---	---
GPR37	2861	broad.mit.edu	37	7	124386683	124386683	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124386683T>G	uc003vli.2	-	2	2389	c.1738A>C	c.(1738-1740)AGT>CGT	p.S580R		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	580	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3																		---	---	---	---
TEX15	56154	broad.mit.edu	37	8	30699691	30699691	+	Silent	SNP	A	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30699691A>T	uc003xil.2	-	1	6843	c.6843T>A	c.(6841-6843)CCT>CCA	p.P2281P		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	2281										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)														---	---	---	---
OSR2	116039	broad.mit.edu	37	8	99961741	99961741	+	Silent	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99961741G>A	uc003yir.2	+	2	1096	c.561G>A	c.(559-561)TTG>TTA	p.L187L	OSR2_uc010mbn.2_Silent_p.L187L|OSR2_uc003yiq.2_Silent_p.L187L|OSR2_uc011lgx.1_Silent_p.L308L	NM_001142462	NP_001135934	Q8N2R0	OSR2_HUMAN	odd-skipped related 2 isoform a	187	C2H2-type 1.				bone morphogenesis|chondrocyte differentiation|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic hindlimb morphogenesis|embryonic leg joint morphogenesis|embryonic skeletal joint morphogenesis|eyelid development in camera-type eye|head development|mesonephros development|metanephros development|middle ear morphogenesis|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|osteoblast proliferation|palate development|positive regulation of bone mineralization|positive regulation of epithelial cell proliferation|positive regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|zinc ion binding			central_nervous_system(1)	1	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)															---	---	---	---
DSCC1	79075	broad.mit.edu	37	8	120847250	120847250	+	Intron	SNP	A	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120847250A>G	uc003yov.2	-						TAF2_uc003you.2_5'Flank	NM_024094	NP_076999			defective in sister chromatid cohesion 1						DNA replication|maintenance of mitotic sister chromatid cohesion|post-translational protein acetylation|regulation of DNA replication	chromatin|chromosome, centromeric region|nucleoplasm	DNA binding|protein binding			pancreas(1)	1	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)															---	---	---	---
ADCY8	114	broad.mit.edu	37	8	132052171	132052171	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132052171T>G	uc003ytd.3	-	1	665	c.409A>C	c.(409-411)AGC>CGC	p.S137R	ADCY8_uc010mds.2_Missense_Mutation_p.S137R	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	137	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)												HNSCC(32;0.087)			---	---	---	---
FOXD4	2298	broad.mit.edu	37	9	117757	117757	+	Silent	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117757C>T	uc003zfz.2	-	1	661	c.363G>A	c.(361-363)CCG>CCA	p.P121P		NM_207305	NP_997188	Q12950	FOXD4_HUMAN	forkhead box D4	121	Fork-head.				axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)														---	---	---	---
KLHL9	55958	broad.mit.edu	37	9	21334270	21334270	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21334270G>A	uc003zoy.2	-	1	1160	c.589C>T	c.(589-591)CGA>TGA	p.R197*	KLHL9_uc003zow.2_Intron|KLHL9_uc003zox.2_RNA	NM_018847	NP_061335	Q9P2J3	KLHL9_HUMAN	kelch-like 9	197	BACK.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex|midbody				ovary(3)|skin(1)	4				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)														---	---	---	---
POLR1E	64425	broad.mit.edu	37	9	37493611	37493611	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37493611C>A	uc003zzz.1	+	5	932	c.644C>A	c.(643-645)ACC>AAC	p.T215N	POLR1E_uc011lqj.1_Intron|POLR1E_uc003zzy.1_Missense_Mutation_p.T153N|POLR1E_uc011lqk.1_Missense_Mutation_p.T82N	NM_022490	NP_071935	Q9GZS1	RPA49_HUMAN	RNA polymerase I associated factor 53	215					rRNA transcription	cell junction|cytoplasm|nucleolus	DNA binding|DNA-directed RNA polymerase activity|protein binding				0				GBM - Glioblastoma multiforme(29;0.00851)|Lung(182;0.229)														---	---	---	---
GABBR2	9568	broad.mit.edu	37	9	101156449	101156449	+	Intron	SNP	T	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101156449T>A	uc004ays.2	-							NM_005458	NP_005449			G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)													---	---	---	---
ALAD	210	broad.mit.edu	37	9	116151266	116151266	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116151266G>T	uc011lxf.1	-	11	1124	c.922C>A	c.(922-924)CGC>AGC	p.R308S	ALAD_uc011lxe.1_Missense_Mutation_p.R291S|ALAD_uc004bhl.3_Missense_Mutation_p.R337S	NM_000031	NP_000022	P13716	HEM2_HUMAN	delta-aminolevulinic acid dehydratase	308					heme biosynthetic process|protein homooligomerization	cytosol	identical protein binding|lead ion binding|porphobilinogen synthase activity|zinc ion binding				0					Aminolevulinic acid(DB00855)													---	---	---	---
TNFSF15	9966	broad.mit.edu	37	9	117568086	117568086	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117568086G>C	uc004bjh.2	-	1	323	c.207C>G	c.(205-207)TTC>TTG	p.F69L		NM_005118	NP_005109	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily,	69	Extracellular (Potential).				activation of caspase activity|activation of NF-kappaB-inducing kinase activity|cytokine metabolic process|immune response	extracellular space|integral to plasma membrane	cytokine activity|tumor necrosis factor receptor binding				0																		---	---	---	---
ZNF33A	7581	broad.mit.edu	37	10	38305806	38305806	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38305806A>G	uc001izh.2	+	3	195	c.17A>G	c.(16-18)CAG>CGG	p.Q6R	ZNF33A_uc001izg.2_Missense_Mutation_p.Q6R|ZNF33A_uc010qev.1_Missense_Mutation_p.Q13R|ZNF33A_uc001izi.1_Missense_Mutation_p.Q6R|ZNF33A_uc001izj.2_RNA	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b	6						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
IFIT1B	439996	broad.mit.edu	37	10	91143104	91143104	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91143104G>C	uc001kgh.2	+	2	114	c.34G>C	c.(34-36)GAC>CAC	p.D12H	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron	NM_001010987	NP_001010987	Q5T764	IFT1B_HUMAN	interferon-induced protein with	12							binding				0																		---	---	---	---
B4GALNT4	338707	broad.mit.edu	37	11	379952	379952	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:379952G>A	uc001lpb.2	+	16	2584	c.2575G>A	c.(2575-2577)GTC>ATC	p.V859I		NM_178537	NP_848632	Q76KP1	B4GN4_HUMAN	beta	859	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			pancreas(1)	1		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---
CDHR5	53841	broad.mit.edu	37	11	618098	618098	+	Silent	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:618098C>T	uc001lqj.2	-	14	2079	c.1974G>A	c.(1972-1974)TCG>TCA	p.S658S	IRF7_uc009ycb.2_5'Flank|IRF7_uc010qwf.1_5'Flank|IRF7_uc001lqf.2_5'Flank|IRF7_uc010qwg.1_5'Flank|IRF7_uc001lqg.2_5'Flank|IRF7_uc001lqh.2_5'Flank|IRF7_uc001lqi.2_5'Flank|IRF7_uc010qwh.1_5'Flank|CDHR5_uc001lqk.2_Silent_p.S464S|CDHR5_uc009ycc.2_Silent_p.S492S|CDHR5_uc009ycd.2_Silent_p.S652S|CDHR5_uc001lql.2_Silent_p.S658S	NM_021924	NP_068743	Q9HBB8	CDHR5_HUMAN	mucin and cadherin-like isoform 1	658	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0																		---	---	---	---
TRIM22	10346	broad.mit.edu	37	11	5730579	5730579	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5730579A>T	uc001mbr.2	+	8	1475	c.1198A>T	c.(1198-1200)AGA>TGA	p.R400*	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron|TRIM22_uc009yes.2_Nonsense_Mutation_p.R396*|TRIM22_uc010qzm.1_Nonsense_Mutation_p.R228*|TRIM22_uc009yeu.2_Nonsense_Mutation_p.R211*|OR56B1_uc001mbs.1_Intron|OR56B1_uc009yev.1_Intron	NM_006074	NP_006065	Q8IYM9	TRI22_HUMAN	tripartite motif-containing 22	400	B30.2/SPRY.				immune response|interspecies interaction between organisms|protein trimerization|response to virus	Cajal body|Golgi apparatus|nuclear speck	ligase activity|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding				0		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)														---	---	---	---
ZNF408	79797	broad.mit.edu	37	11	46726634	46726634	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46726634C>T	uc001nde.1	+	5	1614	c.1384C>T	c.(1384-1386)CCA>TCA	p.P462S	ZNF408_uc010rgw.1_Missense_Mutation_p.P454S	NM_024741	NP_079017	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	462					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding				0																		---	---	---	---
NR1H3	10062	broad.mit.edu	37	11	47282926	47282926	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47282926G>T	uc009ylm.2	+	5	855	c.634G>T	c.(634-636)GGC>TGC	p.G212C	NR1H3_uc009yll.1_Missense_Mutation_p.G218C|NR1H3_uc010rhk.1_Missense_Mutation_p.G218C|NR1H3_uc001nek.2_Missense_Mutation_p.G167C|NR1H3_uc001nej.2_Missense_Mutation_p.G212C|NR1H3_uc001nel.2_Missense_Mutation_p.G167C|NR1H3_uc001nen.3_Missense_Mutation_p.G212C|NR1H3_uc001nem.2_Missense_Mutation_p.G212C|NR1H3_uc001nep.2_Missense_Mutation_p.G121C	NM_005693	NP_005684	Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	212					apoptotic cell clearance|cellular response to lipopolysaccharide|cholesterol homeostasis|negative regulation of cholesterol storage|negative regulation of inflammatory response|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of lipid transport|negative regulation of macrophage activation|negative regulation of pancreatic juice secretion|negative regulation of pinocytosis|negative regulation of secretion of lysosomal enzymes|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of cholesterol homeostasis|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of receptor biosynthetic process|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of triglyceride biosynthetic process|regulation of circadian rhythm|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to progesterone stimulus|triglyceride homeostasis	nuclear chromatin|nucleoplasm	cholesterol binding|steroid hormone receptor activity|sterol response element binding|transcription coactivator activity|zinc ion binding			ovary(2)|lung(1)	3																		---	---	---	---
OR5F1	338674	broad.mit.edu	37	11	55761793	55761793	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55761793G>T	uc010riv.1	-	1	309	c.309C>A	c.(307-309)TTC>TTA	p.F103L		NM_003697	NP_003688	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)																	---	---	---	---
SYT7	9066	broad.mit.edu	37	11	61300595	61300595	+	Silent	SNP	A	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61300595A>G	uc001nrv.2	-	4	223	c.217T>C	c.(217-219)TTG>CTG	p.L73L	SYT7_uc009ynr.2_Silent_p.L148L	NM_004200	NP_004191	O43581	SYT7_HUMAN	synaptotagmin VII	73	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			ovary(3)|pancreas(1)	4																		---	---	---	---
ODZ4	26011	broad.mit.edu	37	11	78443625	78443625	+	Intron	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78443625G>C	uc001ozl.3	-							NM_001098816	NP_001092286			odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4																		---	---	---	---
KRAS	3845	broad.mit.edu	37	12	25398281	25398281	+	Missense_Mutation	SNP	C	T	T	rs112445441		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25398281C>T	uc001rgp.1	-	2	219	c.38G>A	c.(37-39)GGC>GAC	p.G13D	KRAS_uc001rgq.1_Missense_Mutation_p.G13D|KRAS_uc001rgr.2_RNA	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	13	GTP.		G -> R (in pylocytic astrocytoma; somatic mutation; increase activation of the Ras pathway).|G -> D (in a breast carcinoma cell line and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.G13D(2647)|p.G13C(182)|p.G13S(58)|p.G13R(41)|p.G13V(27)|p.G13A(24)|p.G13G(11)|p.G13E(4)|p.G12_G13insG(4)|p.G13N(3)|p.G13I(1)|p.G13_V14>DI(1)		large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			G13D(NCIH647_LUNG)|G13D(MDAMB231_BREAST)|G13D(NCIH747_LARGE_INTESTINE)|G13D(T84_LARGE_INTESTINE)|G13D(LOVO_LARGE_INTESTINE)|G13D(DLD1_LARGE_INTESTINE)|G13D(DV90_LUNG)|G13D(HCT15_LARGE_INTESTINE)|G13D(HCT116_LARGE_INTESTINE)|G13D(TOLEDO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G13D(NOMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			---	---	---	---
MLL2	8085	broad.mit.edu	37	12	49424548	49424548	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49424548G>C	uc001rta.3	-	41	13675	c.13675C>G	c.(13675-13677)CTG>GTG	p.L4559V		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	4559					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41								N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			---	---	---	---
KIAA0748	9840	broad.mit.edu	37	12	55356379	55356379	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55356379T>A	uc001sgn.3	-	9	1413	c.1303A>T	c.(1303-1305)AAG>TAG	p.K435*	KIAA0748_uc001sgl.3_Nonsense_Mutation_p.K297*|KIAA0748_uc001sgm.3_Nonsense_Mutation_p.K182*|KIAA0748_uc010spb.1_Nonsense_Mutation_p.K182*|KIAA0748_uc010spc.1_Nonsense_Mutation_p.K297*|KIAA0748_uc010spd.1_Nonsense_Mutation_p.K435*|KIAA0748_uc001sgo.3_RNA	NM_001098815	NP_001092285	A2RU30	K0748_HUMAN	hypothetical protein LOC9840	435										ovary(1)|central_nervous_system(1)	2																		---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	108045467	108045467	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108045467A>C	uc001tmk.1	+	16	3529	c.3008A>C	c.(3007-3009)AAG>ACG	p.K1003T	BTBD11_uc001tml.1_Missense_Mutation_p.K540T|BTBD11_uc001tmm.1_Missense_Mutation_p.K82T	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a	1003						integral to membrane	DNA binding			skin(2)|ovary(1)	3																		---	---	---	---
NOS1	4842	broad.mit.edu	37	12	117657958	117657958	+	Silent	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117657958G>C	uc001twm.1	-	27	4778	c.4092C>G	c.(4090-4092)CTC>CTG	p.L1364L		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	1364					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)													---	---	---	---
RNF10	9921	broad.mit.edu	37	12	121013630	121013630	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121013630A>G	uc001typ.3	+	16	2719	c.2236A>G	c.(2236-2238)AGC>GGC	p.S746G	RNF10_uc010szk.1_RNA|RNF10_uc001tyq.3_Missense_Mutation_p.S657G	NM_014868	NP_055683	Q8N5U6	RNF10_HUMAN	ring finger protein 10	746					negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
OGFOD2	79676	broad.mit.edu	37	12	123463763	123463763	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123463763G>A	uc001uea.1	+	7	944	c.923G>A	c.(922-924)CGA>CAA	p.R308Q	OGFOD2_uc001uds.1_Missense_Mutation_p.R144Q|OGFOD2_uc001udt.1_Missense_Mutation_p.R144Q|OGFOD2_uc001udu.1_Missense_Mutation_p.R144Q|OGFOD2_uc001udv.1_Missense_Mutation_p.R144Q|OGFOD2_uc009zxs.1_Missense_Mutation_p.R144Q|OGFOD2_uc001udw.1_Missense_Mutation_p.R144Q|OGFOD2_uc001udx.1_Missense_Mutation_p.R144Q|OGFOD2_uc001udy.1_Missense_Mutation_p.R144Q|OGFOD2_uc001udz.1_Missense_Mutation_p.R248Q|OGFOD2_uc001ueb.1_Missense_Mutation_p.R144Q|ARL6IP4_uc001uec.2_5'Flank|ARL6IP4_uc001ued.2_5'Flank|ARL6IP4_uc001uee.2_5'Flank|ARL6IP4_uc001uef.2_5'Flank|ARL6IP4_uc001ueg.2_5'Flank|ARL6IP4_uc009zxt.2_5'Flank|ARL6IP4_uc001ueh.2_5'Flank|ARL6IP4_uc001uei.2_5'Flank	NM_024623	NP_078899	Q6N063	OGFD2_HUMAN	2-oxoglutarate and iron-dependent oxygenase	308	Fe2OG dioxygenase.						iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			pancreas(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.11e-05)|Epithelial(86;0.000127)|BRCA - Breast invasive adenocarcinoma(302;0.107)	Vitamin C(DB00126)													---	---	---	---
WASF3	10810	broad.mit.edu	37	13	27246003	27246003	+	Intron	SNP	T	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27246003T>C	uc001uqv.2	+						WASF3_uc001uqw.2_Intron	NM_006646	NP_006637			WAS protein family, member 3						actin filament polymerization	cytoplasm|cytoskeleton	actin binding			pancreas(1)	1	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)														---	---	---	---
KPNA3	3839	broad.mit.edu	37	13	50283717	50283717	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50283717C>G	uc001vdj.2	-	12	1438	c.1023G>C	c.(1021-1023)AAG>AAC	p.K341N		NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3	341	NLS binding site (minor) (By similarity).|ARM 7.				interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)														---	---	---	---
DCT	1638	broad.mit.edu	37	13	95118904	95118904	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95118904G>A	uc001vlv.3	-	3	1031	c.604C>T	c.(604-606)CGC>TGC	p.R202C	DCT_uc010afh.2_Missense_Mutation_p.R202C	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1	202	Lumenal, melanosome (Potential).				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)														---	---	---	---
HS6ST3	266722	broad.mit.edu	37	13	96743492	96743492	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96743492C>T	uc001vmw.2	+	1	400	c.376C>T	c.(376-378)CGC>TGC	p.R126C		NM_153456	NP_703157	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	126	Lumenal (Potential).					integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)																	---	---	---	---
TRIM9	114088	broad.mit.edu	37	14	51448802	51448802	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51448802G>C	uc001wyx.3	-	8	2388	c.1623C>G	c.(1621-1623)GAC>GAG	p.D541E	TRIM9_uc001wyy.2_Missense_Mutation_p.D622E	NM_015163	NP_055978	Q9C026	TRIM9_HUMAN	tripartite motif protein 9 isoform 1	541	B30.2/SPRY.				proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			skin(2)|lung(1)	3	all_epithelial(31;0.00418)|Breast(41;0.148)																	---	---	---	---
C14orf73	91828	broad.mit.edu	37	14	103566569	103566569	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103566569C>G	uc001ymk.2	+	1	89	c.13C>G	c.(13-15)CAG>GAG	p.Q5E		NM_001077594	NP_001071062	Q17RC7	EX3L4_HUMAN	hypothetical protein LOC91828	5											0		Melanoma(154;0.155)	Epithelial(46;0.221)															---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33878223	33878223	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33878223T>A	uc001zhi.2	+	16	1764	c.1694T>A	c.(1693-1695)ATC>AAC	p.I565N	RYR3_uc010bar.2_Missense_Mutation_p.I565N	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	565	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
IDH3A	3419	broad.mit.edu	37	15	78454614	78454614	+	Silent	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78454614C>T	uc002bdd.2	+	6	543	c.516C>T	c.(514-516)ACC>ACT	p.T172T	IDH3A_uc010umt.1_Silent_p.T137T|IDH3A_uc010umu.1_Silent_p.T63T|IDH3A_uc002bde.2_Silent_p.T122T|IDH3A_uc010umv.1_Silent_p.T122T|IDH3A_uc002bdf.2_Silent_p.T23T|IDH3A_uc002bdg.2_Silent_p.T85T	NM_005530	NP_005521	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha	172					carbohydrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0					NADH(DB00157)													---	---	---	---
MSLN	10232	broad.mit.edu	37	16	818658	818658	+	Silent	SNP	G	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:818658G>T	uc002cjw.1	+	17	1869	c.1818G>T	c.(1816-1818)TCG>TCT	p.S606S	MSLN_uc002cjt.1_Silent_p.S598S|MSLN_uc002cju.1_Silent_p.S598S|MSLN_uc010brd.1_Silent_p.S597S|MSLN_uc002cjv.1_Intron|MSLN_uc002cjx.1_Silent_p.S598S|MSLN_uc002cjy.1_Missense_Mutation_p.G291W|MIR662_hsa-mir-662|MI0003670_5'Flank	NM_013404	NP_037536	Q13421	MSLN_HUMAN	mesothelin isoform 2 preproprotein	606					cell adhesion	anchored to membrane|extracellular region|Golgi apparatus|plasma membrane				pancreas(1)	1		Hepatocellular(780;0.00335)																---	---	---	---
ADCY9	115	broad.mit.edu	37	16	4164838	4164838	+	Silent	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4164838G>A	uc002cvx.2	-	2	1145	c.606C>T	c.(604-606)GGC>GGT	p.G202G		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	202	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6																		---	---	---	---
RRN3	54700	broad.mit.edu	37	16	15155664	15155664	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15155664G>T	uc002dde.2	-	18	1961	c.1893C>A	c.(1891-1893)TTC>TTA	p.F631L	PDXDC1_uc002ddc.2_Intron|RRN3_uc010uzp.1_Missense_Mutation_p.F499L|RRN3_uc010uzq.1_Missense_Mutation_p.F601L	NM_018427	NP_060897	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor	631	Interaction with EIF3L.|Interaction with TWISTNB.				regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm				ovary(1)	1																		---	---	---	---
ACSM3	6296	broad.mit.edu	37	16	20796353	20796353	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20796353T>C	uc002dhr.2	+	8	1254	c.1067T>C	c.(1066-1068)ATT>ACT	p.I356T	ACSM3_uc002dhq.2_Missense_Mutation_p.I356T|ACSM3_uc010vba.1_Missense_Mutation_p.I385T|ERI2_uc002dhs.2_Intron	NM_005622	NP_005613	Q53FZ2	ACSM3_HUMAN	SA hypertension-associated homolog isoform 1	356					regulation of blood pressure	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			ovary(1)	1																		---	---	---	---
DNAH3	55567	broad.mit.edu	37	16	20975848	20975848	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20975848G>A	uc010vbe.1	-	53	9358	c.9358C>T	c.(9358-9360)CAG>TAG	p.Q3120*	DNAH3_uc010vbd.1_Nonsense_Mutation_p.Q555*	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3120	AAA 5 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)														---	---	---	---
BRD7	29117	broad.mit.edu	37	16	50354623	50354623	+	Silent	SNP	C	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50354623C>A	uc002egf.1	-	15	1630	c.1563G>T	c.(1561-1563)CTG>CTT	p.L521L	BRD7_uc002ege.1_Silent_p.L522L	NM_013263	NP_037395	Q9NPI1	BRD7_HUMAN	bromodomain containing 7	521					cell cycle|negative regulation of cell proliferation|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of histone acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|nucleus	histone acetyl-lysine binding|p53 binding|transcription coactivator activity|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding				0		all_cancers(37;0.0127)																---	---	---	---
CES7	221223	broad.mit.edu	37	16	55899941	55899941	+	Silent	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55899941G>A	uc002eip.2	-	5	788	c.639C>T	c.(637-639)TTC>TTT	p.F213F	CES7_uc002eio.2_Silent_p.F213F|CES7_uc002eiq.2_5'UTR|CES7_uc002eir.2_Silent_p.F107F	NM_001143685	NP_001137157	Q6NT32	EST5A_HUMAN	carboxylesterase 7 isoform 1	213						extracellular region	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.229)|Epithelial(162;0.231)														---	---	---	---
HYDIN	54768	broad.mit.edu	37	16	70916555	70916555	+	Intron	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70916555C>T	uc002ezr.2	-							NM_032821	NP_116210			hydrocephalus inducing isoform a											ovary(1)|skin(1)	2		Ovarian(137;0.0654)																---	---	---	---
HYDIN	54768	broad.mit.edu	37	16	70934955	70934955	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70934955G>T	uc002ezr.2	-	53	9125	c.8997C>A	c.(8995-8997)TAC>TAA	p.Y2999*		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3000										ovary(1)|skin(1)	2		Ovarian(137;0.0654)																---	---	---	---
ZNF19	7567	broad.mit.edu	37	16	71512174	71512174	+	Silent	SNP	T	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71512174T>A	uc010cgc.1	-	5	737	c.231A>T	c.(229-231)GCA>GCT	p.A77A	ZNF23_uc002fai.2_5'UTR|ZNF19_uc002fak.1_Silent_p.A65A|ZNF19_uc002fal.1_Silent_p.A65A|ZNF19_uc002fam.1_Silent_p.A77A	NM_006961	NP_008892	P17023	ZNF19_HUMAN	zinc finger protein 19	77	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(137;0.00965)		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)														---	---	---	---
KCNG4	93107	broad.mit.edu	37	16	84270603	84270603	+	Silent	SNP	C	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84270603C>A	uc010voc.1	-	2	610	c.489G>T	c.(487-489)CGG>CGT	p.R163R	KCNG4_uc002fhu.1_Silent_p.R163R	NM_172347	NP_758857	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G,	163						voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(3)	3																		---	---	---	---
UBB	7314	broad.mit.edu	37	17	16285491	16285491	+	Silent	SNP	C	T	T	rs16962973		TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16285491C>T	uc002gpx.2	+	2	408	c.270C>T	c.(268-270)ACC>ACT	p.T90T	UBB_uc010vwe.1_Intron	NM_018955	NP_061828	P0CG47	UBB_HUMAN	ubiquitin B precursor	90	Ubiquitin-like 2.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)														---	---	---	---
UBB	7314	broad.mit.edu	37	17	16285497	16285497	+	Silent	SNP	A	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16285497A>G	uc002gpx.2	+	2	414	c.276A>G	c.(274-276)GAA>GAG	p.E92E	UBB_uc010vwe.1_Intron	NM_018955	NP_061828	P0CG47	UBB_HUMAN	ubiquitin B precursor	92	Ubiquitin-like 2.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)														---	---	---	---
ITGB3	3690	broad.mit.edu	37	17	45362061	45362061	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45362061A>C	uc002ilj.2	+	4	634	c.614A>C	c.(613-615)GAT>GCT	p.D205A	ITGB3_uc002ili.1_Missense_Mutation_p.D205A|ITGB3_uc010wkr.1_RNA	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor	205	VWFA.|Extracellular (Potential).			D -> EY (in Ref. 11; AAA67537).	activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)													---	---	---	---
MIB1	57534	broad.mit.edu	37	18	19418419	19418419	+	Silent	SNP	T	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19418419T>G	uc002ktq.2	+	13	1923	c.1923T>G	c.(1921-1923)CTT>CTG	p.L641L	MIB1_uc002ktp.2_Silent_p.L280L	NM_020774	NP_065825	Q86YT6	MIB1_HUMAN	mindbomb homolog 1	641	ANK 7.				Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(4)	4			STAD - Stomach adenocarcinoma(5;0.212)															---	---	---	---
SMAD4	4089	broad.mit.edu	37	18	48591919	48591919	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48591919G>C	uc010xdp.1	+	9	1620	c.1082G>C	c.(1081-1083)CGC>CCC	p.R361P	SMAD4_uc002lfb.3_Missense_Mutation_p.R206P	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	361	MH2.		R -> H (in a colorectal cancer sample; somatic mutation).|R -> C (in JPS).		BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.R361C(6)|p.R361H(3)|p.?(2)|p.R361S(1)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)										Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				---	---	---	---
RTTN	25914	broad.mit.edu	37	18	67741130	67741130	+	Intron	SNP	C	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67741130C>A	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron	NM_173630	NP_775901			rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)																---	---	---	---
PCSK4	54760	broad.mit.edu	37	19	1481839	1481839	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1481839C>T	uc002ltb.1	-	15	2249	c.2187G>A	c.(2185-2187)ATG>ATA	p.M729I	C19orf25_uc010xgn.1_5'Flank|C19orf25_uc002lsy.3_5'Flank|C19orf25_uc010dsk.2_5'Flank|C19orf25_uc010xgo.1_5'Flank|C19orf25_uc002lsx.1_5'Flank|PCSK4_uc002lsz.2_Missense_Mutation_p.M216I|PCSK4_uc002lta.2_3'UTR	NM_017573	NP_060043	Q6UW60	PCSK4_HUMAN	proprotein convertase subtilisin/kexin type 4	729	Helical; (Potential).				proteolysis	integral to membrane	serine-type endopeptidase activity				0		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
CREB3L3	84699	broad.mit.edu	37	19	4159760	4159760	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4159760C>T	uc002lzl.2	+	4	673	c.557C>T	c.(556-558)TCG>TTG	p.S186L	CREB3L3_uc002lzm.2_Missense_Mutation_p.S176L|CREB3L3_uc010xib.1_Missense_Mutation_p.S177L|CREB3L3_uc010xic.1_Missense_Mutation_p.S177L	NM_032607	NP_115996	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like	186	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
MAN2B1	4125	broad.mit.edu	37	19	12763200	12763200	+	Silent	SNP	C	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12763200C>A	uc002mub.2	-	15	1981	c.1905G>T	c.(1903-1905)CTG>CTT	p.L635L	MAN2B1_uc010dyv.1_Silent_p.L634L	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	635					protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6																		---	---	---	---
UNC13A	23025	broad.mit.edu	37	19	17738735	17738735	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17738735C>T	uc002nhd.2	-	32	4032	c.4032G>A	c.(4030-4032)ATG>ATA	p.M1344I		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	1256					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3																		---	---	---	---
ZNF607	84775	broad.mit.edu	37	19	38190035	38190035	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38190035C>G	uc002ohc.1	-	5	1593	c.997G>C	c.(997-999)GGG>CGG	p.G333R	ZNF607_uc002ohb.1_Missense_Mutation_p.G332R	NM_032689	NP_116078	Q96SK3	ZN607_HUMAN	zinc finger protein 607	333					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)															---	---	---	---
RYR1	6261	broad.mit.edu	37	19	38968395	38968395	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38968395G>A	uc002oit.2	+	30	4469	c.4339G>A	c.(4339-4341)GTG>ATG	p.V1447M	RYR1_uc002oiu.2_Missense_Mutation_p.V1447M	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	1447	Cytoplasmic.|B30.2/SPRY 3.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)													---	---	---	---
SPTBN4	57731	broad.mit.edu	37	19	41003482	41003482	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41003482T>A	uc002ony.2	+	7	841	c.755T>A	c.(754-756)CTG>CAG	p.L252Q	SPTBN4_uc002onx.2_Missense_Mutation_p.L252Q|SPTBN4_uc002onz.2_Missense_Mutation_p.L252Q	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	252	Actin-binding.|CH 2.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)															---	---	---	---
ATP5SL	55101	broad.mit.edu	37	19	41938220	41938220	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41938220C>G	uc002oqw.1	-	6	696	c.690G>C	c.(688-690)GAG>GAC	p.E230D	CYP2F1_uc010xvw.1_Intron|ATP5SL_uc002oqu.1_RNA|ATP5SL_uc002oqv.2_Missense_Mutation_p.E236D|ATP5SL_uc010xwa.1_Missense_Mutation_p.R182T|ATP5SL_uc002oqx.1_Missense_Mutation_p.E203D|ATP5SL_uc002oqy.1_Missense_Mutation_p.R176T|ATP5SL_uc002oqz.1_Missense_Mutation_p.R149T	NM_018035	NP_060505	Q9NW81	AT5SL_HUMAN	ATP5S-like	230										large_intestine(1)|breast(1)	2																		---	---	---	---
SLC8A2	6543	broad.mit.edu	37	19	47969322	47969322	+	Silent	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47969322G>A	uc002pgx.2	-	2	617	c.339C>T	c.(337-339)AAC>AAT	p.N113N	SLC8A2_uc010xyq.1_Intron|SLC8A2_uc010xyr.1_Intron|SLC8A2_uc010ele.2_Silent_p.N113N	NM_015063	NP_055878	Q9UPR5	NAC2_HUMAN	solute carrier family 8 member 2 precursor	113	Cytoplasmic (Potential).				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(1)	4		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)														---	---	---	---
FCGRT	2217	broad.mit.edu	37	19	50017644	50017644	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50017644G>A	uc002poe.2	+	4	988	c.502G>A	c.(502-504)GAC>AAC	p.D168N	FCGRT_uc002pod.2_RNA|FCGRT_uc002pog.2_Missense_Mutation_p.D168N|FCGRT_uc002pof.1_Missense_Mutation_p.D73N|FCGRT_uc010yax.1_Missense_Mutation_p.D168N|FCGRT_uc002poh.1_Missense_Mutation_p.D28N	NM_001136019	NP_001129491	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha	168	Extracellular (Potential).|Alpha-2.				antigen processing and presentation|female pregnancy|immune response	integral to membrane|MHC class I protein complex	IgG binding|receptor activity			ovary(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)														---	---	---	---
RRAS	6237	broad.mit.edu	37	19	50138991	50138991	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50138991C>G	uc002pop.1	-	5	617	c.572G>C	c.(571-573)CGG>CCG	p.R191P		NM_006270	NP_006261	P10301	RRAS_HUMAN	related RAS viral (r-ras) oncogene homolog	191					axon guidance|Ras protein signal transduction|synaptic transmission	intracellular|plasma membrane	GDP binding|GTP binding|GTPase activity|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00114)|GBM - Glioblastoma multiforme(134;0.0206)														---	---	---	---
CLEC11A	6320	broad.mit.edu	37	19	51228703	51228703	+	Silent	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51228703C>T	uc002psy.2	+	4	1129	c.951C>T	c.(949-951)TAC>TAT	p.Y317Y		NM_002975	NP_002966	Q9Y240	CLC11_HUMAN	stem cell growth factor precursor	317	C-type lectin.				positive regulation of cell proliferation	cytoplasm|extracellular region	growth factor activity|sugar binding			ovary(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)														---	---	---	---
EPB41L1	2036	broad.mit.edu	37	20	34797562	34797562	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34797562C>A	uc002xfb.2	+	15	1992	c.1821C>A	c.(1819-1821)AGC>AGA	p.S607R	EPB41L1_uc002xeu.2_Missense_Mutation_p.S533R|EPB41L1_uc010zvo.1_Missense_Mutation_p.S607R|EPB41L1_uc002xev.2_Missense_Mutation_p.S607R|EPB41L1_uc002xew.2_Missense_Mutation_p.S498R|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Intron|EPB41L1_uc002xez.2_Missense_Mutation_p.S533R|EPB41L1_uc010gfq.2_Missense_Mutation_p.S706R	NM_012156	NP_036288	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	607					cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity			ovary(2)|pancreas(1)	3	Breast(12;0.0239)																	---	---	---	---
C20orf43	51507	broad.mit.edu	37	20	55048432	55048432	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55048432G>C	uc002xxt.2	+	2	252	c.145G>C	c.(145-147)GTT>CTT	p.V49L	C20orf43_uc010zzf.1_Missense_Mutation_p.V79L|C20orf43_uc002xxu.2_Missense_Mutation_p.V49L|C20orf43_uc002xxv.2_Missense_Mutation_p.V49L	NM_016407	NP_057491	Q9BY42	CT043_HUMAN	hypothetical protein LOC51507	49										ovary(1)	1			Colorectal(105;0.202)															---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60503257	60503257	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60503257C>T	uc002ybn.1	+	12	1795	c.1781C>T	c.(1780-1782)CCG>CTG	p.P594L	CDH4_uc002ybp.1_Missense_Mutation_p.P520L	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	594	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
FAM3B	54097	broad.mit.edu	37	21	42710319	42710319	+	Silent	SNP	A	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42710319A>C	uc002yzb.1	+	3	324	c.178A>C	c.(178-180)AGG>CGG	p.R60R	FAM3B_uc002yza.2_RNA|FAM3B_uc002yzc.1_Silent_p.R12R|FAM3B_uc002yzd.1_Silent_p.R83R|FAM3B_uc011aeq.1_Silent_p.R74R	NM_058186	NP_478066	P58499	FAM3B_HUMAN	family with sequence similarity 3, member B	60					apoptosis|insulin secretion	extracellular space	cytokine activity				0		Prostate(19;1.57e-07)|all_epithelial(19;0.0404)																---	---	---	---
SLC7A4	6545	broad.mit.edu	37	22	21385414	21385414	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21385414C>T	uc002zud.2	-	2	756	c.688G>A	c.(688-690)GCA>ACA	p.A230T	SLC7A4_uc002zue.2_Missense_Mutation_p.A230T	NM_004173	NP_004164	O43246	CTR4_HUMAN	solute carrier family 7 (cationic amino acid	230	Helical; (Potential).				cellular amino acid metabolic process	integral to membrane	basic amino acid transmembrane transporter activity			ovary(1)|lung(1)	2	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)													---	---	---	---
TLR7	51284	broad.mit.edu	37	X	12906522	12906522	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12906522A>C	uc004cvc.2	+	3	3034	c.2895A>C	c.(2893-2895)GAA>GAC	p.E965D		NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7 precursor	965	TIR.|Cytoplasmic (Potential).				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(2)|lung(2)|breast(1)	5					Imiquimod(DB00724)													---	---	---	---
GRIPAP1	56850	broad.mit.edu	37	X	48837686	48837686	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48837686C>T	uc004dly.1	-	21	1906	c.1871G>A	c.(1870-1872)CGG>CAG	p.R624Q	GRIPAP1_uc004dlz.2_Missense_Mutation_p.R514Q|GRIPAP1_uc004dma.2_Missense_Mutation_p.R545Q	NM_020137	NP_064522	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1 isoform 1	624	Potential.					early endosome				breast(2)|kidney(1)	3																		---	---	---	---
WDR45	11152	broad.mit.edu	37	X	48934155	48934155	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48934155A>G	uc004dmk.1	-	6	542	c.370T>C	c.(370-372)TAT>CAT	p.Y124H	PRAF2_uc004dmi.2_5'Flank|PRAF2_uc011mmt.1_Intron|WDR45_uc004dmj.1_Missense_Mutation_p.Y74H|WDR45_uc004dml.1_Missense_Mutation_p.Y125H|WDR45_uc004dmm.1_Missense_Mutation_p.Y89H|WDR45_uc010nim.1_Missense_Mutation_p.Y124H|WDR45_uc004dmn.1_Missense_Mutation_p.Y15H|WDR45_uc004dmo.1_Missense_Mutation_p.Y147H|WDR45_uc004dmp.1_Missense_Mutation_p.Y125H	NM_001029896	NP_001025067	Q9Y484	WIPI4_HUMAN	WD repeat domain 45 isoform 2	124					autophagy|response to starvation	organelle membrane	phosphatidylinositol-3,5-bisphosphate binding			ovary(1)	1																		---	---	---	---
AKAP4	8852	broad.mit.edu	37	X	49957932	49957932	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49957932C>T	uc004dow.1	-	5	1556	c.1432G>A	c.(1432-1434)GAC>AAC	p.D478N	AKAP4_uc004dov.1_Intron|AKAP4_uc010njp.1_Missense_Mutation_p.D300N|AKAP4_uc004dou.1_Missense_Mutation_p.D469N	NM_003886	NP_003877	Q5JQC9	AKAP4_HUMAN	A-kinase anchor protein 4 isoform 1	478					cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding			kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8	Ovarian(276;0.236)																	---	---	---	---
ELF4	2000	broad.mit.edu	37	X	129208703	129208703	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129208703C>G	uc004evd.3	-	3	485	c.100G>C	c.(100-102)GCT>CCT	p.A34P	ELF4_uc004eve.3_Missense_Mutation_p.A34P	NM_001421	NP_001412	Q99607	ELF4_HUMAN	E74-like factor 4	34					natural killer cell proliferation|NK T cell proliferation|positive regulation of transcription from RNA polymerase II promoter	PML body	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1								T	ERG	AML								---	---	---	---
GABRE	2564	broad.mit.edu	37	X	151123349	151123349	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4267-01A-01D-1126-08	TCGA-BR-4267-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151123349A>G	uc004ffi.2	-	9	1399	c.1345T>C	c.(1345-1347)TGG>CGG	p.W449R	GABRE_uc011myd.1_RNA	NM_004961	NP_004952	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,	449	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
