Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
Unknown	0	broad.mit.edu	37	1	255909	255910	+	IGR	INS	-	TG	TG			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:255909_255910insTG								OR4F5 (185901 upstream) : LOC100132287 (66127 downstream)																																			---	---	---	---
CHD5	26038	broad.mit.edu	37	1	6234574	6234577	+	Intron	DEL	TGGA	-	-	rs113035924		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6234574_6234577delTGGA	uc001amb.1	-							NM_015557	NP_056372			chromodomain helicase DNA binding protein 5						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)														---	---	---	---
PER3	8863	broad.mit.edu	37	1	7851259	7851259	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7851259delT	uc001aoo.2	+						PER3_uc009vmg.1_Intron|PER3_uc009vmh.1_Intron|PER3_uc001aop.2_Intron|PER3_uc010nzw.1_Intron|PER3_uc001aon.2_Intron	NM_016831	NP_058515			period 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PIK3CD	5293	broad.mit.edu	37	1	9722054	9722054	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9722054delA	uc001aqb.3	+						PIK3CD_uc001aqa.2_Intron	NM_005026	NP_005017			catalytic phosphatidylinositol 3-kinase delta						phosphatidylinositol-mediated signaling|protein phosphorylation	phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(4)|skin(2)|central_nervous_system(1)	7	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	11607674	11607675	+	IGR	DEL	AG	-	-	rs34399641		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11607674_11607675delAG								PTCHD2 (10035 upstream) : FBXO2 (100775 downstream)																																			---	---	---	---
NBPF1	55672	broad.mit.edu	37	1	16924252	16924253	+	Intron	DEL	AC	-	-	rs67132303		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16924252_16924253delAC	uc009vos.1	-							NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17195763	17195763	+	Intron	DEL	A	-	-	rs68102505		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17195763delA	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
PADI4	23569	broad.mit.edu	37	1	17646024	17646025	+	Intron	DEL	AG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17646024_17646025delAG	uc001baj.2	+						PADI4_uc009vpc.2_Intron	NM_012387	NP_036519			peptidyl arginine deiminase, type IV						chromatin modification|peptidyl-citrulline biosynthetic process from peptidyl-arginine|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)													---	---	---	---
KIAA0090	23065	broad.mit.edu	37	1	19561349	19561349	+	Intron	DEL	A	-	-	rs113797552		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19561349delA	uc001bbo.2	-						KIAA0090_uc001bbp.2_Intron|KIAA0090_uc001bbq.2_Intron|KIAA0090_uc001bbr.2_Intron	NM_015047	NP_055862			hypothetical protein LOC23065 precursor							integral to membrane	protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	20839679	20839680	+	IGR	DEL	AG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20839679_20839680delAG								MUL1 (5005 upstream) : FAM43B (39252 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	22696760	22696760	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22696760delG								WNT4 (226375 upstream) : ZBTB40 (81584 downstream)																																			---	---	---	---
GRHL3	57822	broad.mit.edu	37	1	24671748	24671748	+	Intron	DEL	C	-	-	rs68002622		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24671748delC	uc001biy.2	+						GRHL3_uc001bix.2_Intron|GRHL3_uc001biz.2_Intron	NM_021180	NP_067003			sister-of-mammalian grainyhead protein isoform						regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	24957556	24957557	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24957556_24957557insT								C1orf130 (21740 upstream) : SRRM1 (12037 downstream)																																			---	---	---	---
FCN3	8547	broad.mit.edu	37	1	27702952	27702952	+	5'Flank	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27702952delG	uc001boa.2	-						FCN3_uc001bob.2_5'Flank	NM_003665	NP_003656			ficolin 3 isoform 1 precursor						complement activation, lectin pathway|signal transduction	collagen|extracellular space	receptor binding|sugar binding				0		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;1.42e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	31242992	31242992	+	IGR	DEL	G	-	-	rs59615264		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31242992delG								LAPTM5 (12309 upstream) : SDC3 (99321 downstream)																																			---	---	---	---
TINAGL1	64129	broad.mit.edu	37	1	32045665	32045666	+	Intron	DEL	TG	-	-	rs67110682		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32045665_32045666delTG	uc001bta.2	+						TINAGL1_uc001bsz.2_Intron|TINAGL1_uc010ogi.1_Intron|TINAGL1_uc010ogj.1_Intron|TINAGL1_uc010ogk.1_Intron	NM_022164	NP_071447			tubulointerstitial nephritis antigen-like 1						endosome transport|immune response|proteolysis	extracellular region	cysteine-type endopeptidase activity|extracellular matrix structural constituent|polysaccharide binding|scavenger receptor activity				0		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)														---	---	---	---
ZBTB8A	653121	broad.mit.edu	37	1	33023928	33023928	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33023928delC	uc001bvn.2	+						ZBTB8A_uc001bvk.2_Intron|ZBTB8A_uc001bvm.2_Intron	NM_001040441	NP_001035531			zinc finger and BTB domain containing 8A						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ZBTB8OS	339487	broad.mit.edu	37	1	33105707	33105708	+	Intron	INS	-	T	T	rs141906366	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33105707_33105708insT	uc001bvp.2	-						ZBTB8OS_uc001bvo.1_Intron|ZBTB8OS_uc001bvq.2_Intron	NM_178547	NP_848642			zinc finger and BTB domain containing 8 opposite												0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)																---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34290754	34290755	+	Intron	INS	-	C	C	rs141851024	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34290754_34290755insC	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128			CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34611332	34611332	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34611332delT	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128			CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
INPP5B	3633	broad.mit.edu	37	1	38392967	38392967	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38392967delA	uc001ccg.1	-						INPP5B_uc009vvk.1_Intron|INPP5B_uc001ccf.1_Intron	NM_005540	NP_005531			inositol polyphosphate-5-phosphatase, 75kDa						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	46929906	46929906	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46929906delC								FAAH (50386 upstream) : DMBX1 (42762 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	48363381	48363382	+	IGR	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48363381_48363382delAC								FOXD2 (457019 upstream) : SKINTL (204005 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	48957148	48957149	+	IGR	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48957148_48957149delGT								SPATA6 (19303 upstream) : AGBL4 (41378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	50882714	50882714	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50882714delC								ELAVL4 (215174 upstream) : DMRTA2 (515 downstream)																																			---	---	---	---
EPS15	2060	broad.mit.edu	37	1	51825580	51825581	+	Intron	INS	-	T	T	rs112942070		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51825580_51825581insT	uc001csq.1	-						EPS15_uc009vyz.1_Intron|EPS15_uc001csp.3_Intron	NM_001981	NP_001972			epidermal growth factor receptor pathway						cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2								T	MLL	ALL								---	---	---	---
SLC1A7	6512	broad.mit.edu	37	1	53604872	53604872	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53604872delT	uc001cuy.2	-						SLC1A7_uc001cuz.3_Intron	NM_006671	NP_006662			solute carrier family 1 (glutamate transporter),							integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)													---	---	---	---
SSBP3	23648	broad.mit.edu	37	1	54743550	54743550	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54743550delC	uc001cxe.2	-						SSBP3_uc001cxf.2_Intron|SSBP3_uc001cxg.2_Intron	NM_145716	NP_663768			single stranded DNA binding protein 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	single-stranded DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	59115490	59115491	+	IGR	INS	-	CTGG	CTGG	rs141603535	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59115490_59115491insCTGG								TACSTD2 (72324 upstream) : MYSM1 (10099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	59543117	59543118	+	IGR	INS	-	A	A	rs146016717	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59543117_59543118insA								JUN (293332 upstream) : LOC729467 (54492 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	71253040	71253040	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71253040delT								CTH (347788 upstream) : PTGER3 (64996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	71831881	71831882	+	IGR	DEL	TA	-	-	rs2421909		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71831881_71831882delTA								ZRANB2 (285136 upstream) : NEGR1 (36744 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	74332458	74332458	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74332458delT								None (None upstream) : LRRIQ3 (159246 downstream)																																			---	---	---	---
ZZZ3	26009	broad.mit.edu	37	1	78085891	78085891	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78085891delC	uc001dhq.2	-						ZZZ3_uc001dhr.2_Intron|ZZZ3_uc009wbz.1_Intron|ZZZ3_uc001dhp.2_Intron	NM_015534	NP_056349			zinc finger, ZZ-type containing 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|large_intestine(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	83964039	83964039	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:83964039delA								None (None upstream) : TTLL7 (371020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	85168358	85168358	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85168358delC								SSX2IP (11918 upstream) : LPAR3 (110728 downstream)																																			---	---	---	---
COL24A1	255631	broad.mit.edu	37	1	86385140	86385140	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86385140delT	uc001dlj.2	-						COL24A1_uc001dli.2_Intron|COL24A1_uc010osd.1_Intron|COL24A1_uc001dlk.2_Intron|COL24A1_uc010ose.1_Intron|COL24A1_uc010osf.1_Intron	NM_152890	NP_690850			collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	88424840	88424840	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88424840delT								LMO4 (610237 upstream) : PKN2 (725082 downstream)																																			---	---	---	---
GBP7	388646	broad.mit.edu	37	1	89602117	89602117	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89602117delA	uc001dna.2	-						GBP2_uc001dmy.1_Intron	NM_207398	NP_997281			guanylate binding protein 4-like							integral to membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	95891689	95891689	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95891689delA								RWDD3 (178916 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	97387072	97387072	+	IGR	DEL	C	-	-	rs75564190		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97387072delC								PTBP2 (106473 upstream) : DPYD (156230 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	102835124	102835124	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102835124delA								OLFM3 (372334 upstream) : COL11A1 (506900 downstream)																																			---	---	---	---
CAPZA1	829	broad.mit.edu	37	1	113212984	113212985	+	3'UTR	INS	-	T	T	rs72984526		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113212984_113212985insT	uc001ecj.1	+	10						NM_006135	NP_006126			F-actin capping protein alpha-1 subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement|innate immune response|protein complex assembly	cytosol|extracellular region|F-actin capping protein complex|WASH complex	actin binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	116499826	116499826	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116499826delG								NHLH2 (116079 upstream) : SLC22A15 (19293 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	117598907	117598907	+	IGR	DEL	C	-	-	rs5777296		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117598907delC								CD101 (19734 upstream) : TTF2 (4042 downstream)																																			---	---	---	---
PHGDH	26227	broad.mit.edu	37	1	120276142	120276142	+	Intron	DEL	G	-	-	rs34338933		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120276142delG	uc001ehz.2	+						PHGDH_uc009whl.2_Intron|PHGDH_uc009whm.2_Intron|PHGDH_uc001eia.2_Intron|PHGDH_uc009whn.2_Intron|PHGDH_uc001eib.2_Intron	NM_006623	NP_006614			phosphoglycerate dehydrogenase						brain development|L-serine biosynthetic process		electron carrier activity|NAD binding|phosphoglycerate dehydrogenase activity			ovary(1)	1	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)	NADH(DB00157)													---	---	---	---
HMGCS2	3158	broad.mit.edu	37	1	120292569	120292570	+	Intron	INS	-	TCATATA	TCATATA	rs146969894	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120292569_120292570insTCATATA	uc001eid.2	-						HMGCS2_uc010oxj.1_Intron|HMGCS2_uc001eie.2_Intron	NM_005518	NP_005509			hydroxymethylglutaryl-CoA synthase 2 isoform 1						acetoacetic acid biosynthetic process|cholesterol biosynthetic process|isoprenoid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA synthase activity			ovary(2)	2	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	120323047	120323048	+	IGR	INS	-	A	A	rs140429060	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120323047_120323048insA								HMGCS2 (11529 upstream) : REG4 (13594 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	120442257	120442258	+	IGR	DEL	AC	-	-	rs2487569	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120442257_120442258delAC								ADAM30 (3144 upstream) : NOTCH2 (11920 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	120624248	120624248	+	IGR	DEL	G	-	-	rs74418771		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120624248delG								NOTCH2 (11972 upstream) : FAM72B (214757 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	144014490	144014497	+	Intron	DEL	TCTCTCTC	-	-	rs72117340		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144014490_144014497delTCTCTCTC	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																														---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144853333	144853334	+	Intron	INS	-	AA	AA	rs149112816		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144853333_144853334insAA	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144940321	144940321	+	Intron	DEL	T	-	-	rs66484014		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144940321delT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	145005447	145005447	+	Intron	DEL	C	-	-	rs71810601		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145005447delC	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145054268	145054269	+	Intron	INS	-	G	G	rs149978567		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145054268_145054269insG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145058201	145058201	+	Intron	DEL	A	-	-	rs11347217		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145058201delA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145085808	145085809	+	Intron	INS	-	T	T	rs146743627		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145085808_145085809insT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145207564	145207564	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145207564delT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'Flank|NOTCH2NL_uc001emn.3_5'Flank|NOTCH2NL_uc001emm.3_5'Flank|NOTCH2NL_uc001emo.2_5'Flank|NOTCH2NL_uc010oyh.1_5'Flank					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NOTCH2NL	388677	broad.mit.edu	37	1	145291063	145291063	+	3'UTR	DEL	A	-	-	rs11322524		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145291063delA	uc001emo.2	+	6					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NOTCH2NL_uc010oyh.1_Intron|NBPF10_uc001end.3_5'Flank|NBPF10_uc001emq.1_5'Flank	NM_203458	NP_982283			Notch homolog 2 N-terminal like protein						cell differentiation|multicellular organismal development|Notch signaling pathway	cytoplasm|extracellular region	calcium ion binding			ovary(1)	1																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145369705	145369705	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145369705delC	uc001emp.3	+							NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	146708691	146708691	+	IGR	DEL	C	-	-	rs149189514		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146708691delC								FMO5 (11461 upstream) : CHD1L (5600 downstream)																																			---	---	---	---
CHD1L	9557	broad.mit.edu	37	1	146750155	146750155	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146750155delA	uc001epm.3	+						uc001epp.2_Intron|CHD1L_uc001epn.3_Intron|CHD1L_uc010ozo.1_Intron|CHD1L_uc009wjg.2_Intron|CHD1L_uc009wjh.2_Intron|CHD1L_uc010ozp.1_Intron|CHD1L_uc001epo.3_Intron|CHD1L_uc010ozq.1_Intron|CHD1L_uc009wji.2_Intron	NM_004284	NP_004275			chromodomain helicase DNA binding protein						chromatin remodeling|DNA repair	cytoplasm|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(3)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.0487)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	147262187	147262187	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147262187delA								GJA5 (16703 upstream) : GJA8 (112749 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	147390832	147390833	+	IGR	INS	-	AC	AC	rs141918645	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147390832_147390833insAC								GJA8 (9439 upstream) : GPR89B (9673 downstream)																																			---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	148001178	148001180	+	Intron	DEL	AGG	-	-	rs35235086		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148001178_148001180delAGG	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	148864080	148864081	+	IGR	DEL	TT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148864080_148864081delTT								NBPF16 (105769 upstream) : LOC645166 (64205 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149226394	149226394	+	IGR	DEL	G	-	-	rs113966689		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149226394delG								LOC645166 (273340 upstream) : LOC388692 (53082 downstream)																																			---	---	---	---
VPS45	11311	broad.mit.edu	37	1	150054596	150054597	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150054596_150054597insA	uc001etp.2	+						VPS45_uc010pbp.1_Intron|VPS45_uc010pbq.1_Intron|VPS45_uc010pbs.1_Intron|VPS45_uc001etq.2_Intron|VPS45_uc009wlm.1_Intron	NM_007259	NP_009190			vacuolar protein sorting 45A						blood coagulation|intracellular protein transport|vesicle docking involved in exocytosis	endosome membrane|Golgi membrane|integral to membrane of membrane fraction				central_nervous_system(1)|skin(1)	2	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	150606676	150606677	+	IGR	INS	-	A	A	rs150779531		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150606676_150606677insA								ENSA (4578 upstream) : GOLPH3L (12024 downstream)																																			---	---	---	---
ARNT	405	broad.mit.edu	37	1	150831913	150831913	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150831913delC	uc001evr.1	-						ARNT_uc001evs.1_Intron|ARNT_uc009wmb.1_Intron|ARNT_uc009wmc.1_Intron|ARNT_uc009wmd.1_Intron|ARNT_uc009wme.1_Intron|ARNT_uc010pcl.1_Intron	NM_001668	NP_001659			aryl hydrocarbon receptor nuclear translocator						positive regulation of hormone biosynthetic process|positive regulation vascular endothelial growth factor production|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hypoxia		aryl hydrocarbon receptor binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity			skin(4)|lung(3)|central_nervous_system(1)|kidney(1)	9	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)					T	ETV6	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	1	150883918	150883918	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150883918delT								ARNT (34732 upstream) : SETDB1 (14897 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	150891336	150891336	+	IGR	DEL	A	-	-	rs149958045		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150891336delA								ARNT (42150 upstream) : SETDB1 (7479 downstream)																																			---	---	---	---
INTS3	65123	broad.mit.edu	37	1	153708927	153708928	+	Intron	INS	-	T	T	rs71947114		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153708927_153708928insT	uc009wom.2	+						INTS3_uc001fct.2_Intron|INTS3_uc001fcu.2_Intron|INTS3_uc001fcv.2_Intron	NM_023015	NP_075391			integrator complex subunit 3						DNA repair|G2/M transition checkpoint|response to ionizing radiation|snRNA processing	integrator complex|SOSS complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	155084169	155084170	+	IGR	INS	-	TCT	TCT	rs145480789	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155084169_155084170insTCT								EFNA3 (24163 upstream) : EFNA1 (16179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	155084174	155084175	+	IGR	INS	-	TTCT	TTCT			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155084174_155084175insTTCT								EFNA3 (24168 upstream) : EFNA1 (16174 downstream)																																			---	---	---	---
COPA	1314	broad.mit.edu	37	1	160301664	160301664	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160301664delG	uc009wti.2	-						COPA_uc001fvv.3_Intron|COPA_uc009wtj.1_Intron	NM_004371	NP_004362			coatomer protein complex, subunit alpha isoform						COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)															---	---	---	---
SLAMF7	57823	broad.mit.edu	37	1	160722743	160722743	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160722743delG	uc001fwq.2	+						SLAMF7_uc010pjn.1_Intron|SLAMF7_uc001fws.2_Intron|SLAMF7_uc001fwr.2_Intron|SLAMF7_uc010pjo.1_Intron|SLAMF7_uc010pjp.1_Intron|SLAMF7_uc010pjq.1_Intron|SLAMF7_uc010pjr.1_Intron	NM_021181	NP_067004			SLAM family member 7						cell adhesion|natural killer cell activation|natural killer cell mediated cytotoxicity	integral to membrane	receptor activity			skin(2)|ovary(1)	3	all_cancers(52;2.63e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	160741626	160741627	+	IGR	INS	-	AC	AC	rs141520069	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160741626_160741627insAC								SLAMF7 (17026 upstream) : LY9 (24301 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	160895310	160895311	+	IGR	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160895310_160895311delAC								ITLN1 (40350 upstream) : ITLN2 (19506 downstream)																																			---	---	---	---
OLFML2B	25903	broad.mit.edu	37	1	161958534	161958534	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161958534delG	uc001gbu.2	-						OLFML2B_uc010pkq.1_Intron	NM_015441	NP_056256			olfactomedin-like 2B precursor											skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	164240257	164240258	+	IGR	INS	-	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164240257_164240258insG								NUF2 (914704 upstream) : PBX1 (288544 downstream)																																			---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164816107	164816108	+	3'UTR	INS	-	T	T	rs14832		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164816107_164816108insT	uc001gct.2	+	9					PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_3'UTR|PBX1_uc001gcs.2_3'UTR|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164850800	164850801	+	Intron	DEL	GA	-	-	rs140679561	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164850800_164850801delGA	uc010pkw.1	+							NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
RXRG	6258	broad.mit.edu	37	1	165371784	165371785	+	Intron	DEL	CT	-	-	rs35680898		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165371784_165371785delCT	uc001gda.2	-							NM_006917	NP_008848			retinoid X receptor, gamma isoform a						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)													---	---	---	---
FAM78B	149297	broad.mit.edu	37	1	166044962	166044962	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166044962delC	uc001gdr.2	-						FAM78B_uc010plc.1_Intron	NM_001017961	NP_001017961			hypothetical protein LOC149297											central_nervous_system(1)|skin(1)	2	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)																	---	---	---	---
FAM78B	149297	broad.mit.edu	37	1	166132212	166132212	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166132212delC	uc001gdr.2	-						FAM78B_uc010plc.1_Intron	NM_001017961	NP_001017961			hypothetical protein LOC149297											central_nervous_system(1)|skin(1)	2	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)																	---	---	---	---
GPR161	23432	broad.mit.edu	37	1	168107997	168107998	+	5'Flank	INS	-	T	T	rs141108939	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168107997_168107998insT	uc001gfc.2	-						GPR161_uc001gfb.2_5'Flank|GPR161_uc010pll.1_5'Flank|GPR161_uc010plm.1_5'Flank|GPR161_uc009wvo.2_5'Flank|GPR161_uc001gfd.2_5'Flank|GPR161_uc010pln.1_5'Flank	NM_153832	NP_722561			G protein-coupled receptor 161 isoform 2						multicellular organismal development	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_hematologic(923;0.215)																	---	---	---	---
F5	2153	broad.mit.edu	37	1	169515418	169515419	+	Intron	INS	-	AC	AC			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169515418_169515419insAC	uc001ggg.1	-							NM_000130	NP_000121			coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)													---	---	---	---
DNM3	26052	broad.mit.edu	37	1	172125392	172125392	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172125392delC	uc001gie.2	+						DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384			dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	173376309	173376310	+	Intron	INS	-	G	G	rs143436194	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173376309_173376310insG	uc001gix.1	-											Homo sapiens cDNA FLJ45305 fis, clone BRHIP3004193.																														---	---	---	---
FAM5B	57795	broad.mit.edu	37	1	177186486	177186486	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177186486delA	uc001glf.2	+							NM_021165	NP_066988			family with sequence similarity 5, member B							extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
C1orf49	84066	broad.mit.edu	37	1	178502677	178502678	+	Intron	INS	-	TTT	TTT	rs10631642		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178502677_178502678insTTT	uc001glv.1	+											Homo sapiens cDNA FLJ35950 fis, clone TESTI2012090.							microtubule cytoskeleton					0																		---	---	---	---
C1orf14	81626	broad.mit.edu	37	1	182894099	182894100	+	Intron	INS	-	AG	AG			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182894099_182894100insAG	uc001gpu.2	-						C1orf14_uc001gpv.2_Intron|C1orf14_uc010pnz.1_Intron|C1orf14_uc001gpw.2_Intron	NM_030933	NP_112195			chromosome 1 open reading frame 14												0				Colorectal(1306;1.64e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00267)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	188829205	188829206	+	IGR	INS	-	T	T	rs112573167		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188829205_188829206insT								None (None upstream) : None (None downstream)																																			---	---	---	---
NEK7	140609	broad.mit.edu	37	1	198272125	198272126	+	Intron	DEL	AA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198272125_198272126delAA	uc001gun.3	+							NM_133494	NP_598001			NIMA-related kinase 7							cytoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|lung(1)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	207273399	207273414	+	IGR	DEL	ATGTGTGTGTGTGTGT	-	-	rs57088528		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207273399_207273414delATGTGTGTGTGTGTGT								C4BPB (64 upstream) : C4BPA (4097 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	209257737	209257738	+	IGR	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209257737_209257738delAC								PLXNA2 (840072 upstream) : LOC642587 (344430 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	209410297	209410297	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209410297delA								PLXNA2 (992632 upstream) : LOC642587 (191871 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	209639686	209639687	+	IGR	INS	-	G	G	rs142125516	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209639686_209639687insG								LOC642587 (33796 upstream) : CAMK1G (117358 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	210370953	210370953	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210370953delG								SYT14 (33322 upstream) : C1orf133 (33851 downstream)																																			---	---	---	---
TGFB2	7042	broad.mit.edu	37	1	218552472	218552473	+	Intron	INS	-	T	T	rs59028457		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218552472_218552473insT	uc001hlm.2	+						TGFB2_uc001hll.2_Intron|TGFB2_uc001hln.2_Intron|TGFB2_uc010pue.1_Intron|TGFB2_uc001hlo.2_Intron	NM_003238	NP_003229			transforming growth factor, beta 2 isoform 2						activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding				0				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	230646238	230646240	+	IGR	DEL	TGT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230646238_230646240delTGT								PGBD5 (132871 upstream) : COG2 (131962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	232346679	232346679	+	IGR	DEL	A	-	-	rs71646058		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232346679delA								DISC1 (169663 upstream) : SIPA1L2 (187035 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234659815	234659816	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234659815_234659816insA								TARBP1 (44966 upstream) : IRF2BP2 (80201 downstream)																																			---	---	---	---
ERO1LB	56605	broad.mit.edu	37	1	236434407	236434407	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236434407delT	uc001hxt.2	-						ERO1LB_uc010pxt.1_Intron	NM_019891	NP_063944			endoplasmic reticulum oxidoreductin 1-Lbeta						electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)															---	---	---	---
GREM2	64388	broad.mit.edu	37	1	240774765	240774765	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240774765delG	uc001hys.2	-							NM_022469	NP_071914			gremlin 2 precursor						BMP signaling pathway	extracellular space	cytokine activity				0		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	242950776	242950776	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242950776delT								PLD5 (262778 upstream) : CEP170 (336955 downstream)																																			---	---	---	---
SDCCAG8	10806	broad.mit.edu	37	1	243643926	243643926	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243643926delT	uc001hzw.2	+						SDCCAG8_uc010pyk.1_Intron|SDCCAG8_uc010pyl.1_Intron|SDCCAG8_uc001hzx.2_Intron	NM_006642	NP_006633			serologically defined colon cancer antigen 8						establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)														---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245654879	245654879	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245654879delA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	248597909	248597910	+	IGR	INS	-	TG	TG	rs141268428	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248597909_248597910insTG								OR2T1 (27505 upstream) : OR2T2 (18189 downstream)																																			---	---	---	---
TTC15	51112	broad.mit.edu	37	2	3437655	3437656	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3437655_3437656insT	uc002qxm.1	+						TTC15_uc002qxn.1_Intron|TTC15_uc010ewm.1_Intron	NM_016030	NP_057114			tetratricopeptide repeat domain 15								binding			ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.214)		OV - Ovarian serous cystadenocarcinoma(76;0.0402)|Epithelial(75;0.0986)|all cancers(51;0.149)														---	---	---	---
ALLC	55821	broad.mit.edu	37	2	3711711	3711711	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3711711delT	uc010ewt.2	+							NM_018436	NP_060906			allantoicase isoform a								allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)											HNSCC(21;0.051)			---	---	---	---
Unknown	0	broad.mit.edu	37	2	9174914	9174914	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9174914delA								MBOAT2 (31038 upstream) : ASAP2 (171980 downstream)																																			---	---	---	---
ITGB1BP1	9270	broad.mit.edu	37	2	9552171	9552172	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9552171_9552172insA	uc002qzj.2	-						ITGB1BP1_uc002qzk.2_Intron|ITGB1BP1_uc002qzl.2_Intron|ITGB1BP1_uc002qzm.2_Intron|ITGB1BP1_uc010yiy.1_Intron|ITGB1BP1_uc002qzn.1_Intron	NM_004763	NP_004754			integrin cytoplasmic domain-associated protein 1						cell migration|cell-matrix adhesion|intracellular protein kinase cascade	cytosol|lamellipodium|membrane|ruffle	protein binding|protein binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.23)														---	---	---	---
HPCAL1	3241	broad.mit.edu	37	2	10500543	10500544	+	Intron	INS	-	T	T	rs112033400		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10500543_10500544insT	uc002raj.2	+						HPCAL1_uc002rak.2_Intron|HPCAL1_uc002ral.2_Intron|HPCAL1_uc010exe.2_Intron	NM_002149	NP_002140			hippocalcin-like 1								calcium ion binding			pancreas(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	10997512	10997512	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10997512delA								PDIA6 (19409 upstream) : KCNF1 (54551 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	20586857	20586857	+	IGR	DEL	T	-	-	rs79491431		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20586857delT								PUM2 (36394 upstream) : RHOB (59978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23171793	23171794	+	IGR	INS	-	A	A	rs144020506	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23171793_23171794insA								None (None upstream) : KLHL29 (583661 downstream)																																			---	---	---	---
KLHL29	114818	broad.mit.edu	37	2	23757404	23757405	+	Intron	DEL	TT	-	-	rs146487324		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23757404_23757405delTT	uc002ref.2	+											SubName: Full=KLHL29 protein; Flags: Fragment;											ovary(1)|lung(1)	2																		---	---	---	---
ATAD2B	54454	broad.mit.edu	37	2	24057022	24057023	+	Intron	INS	-	T	T	rs13012295		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24057022_24057023insT	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc002rej.3_5'Flank	NM_017552	NP_060022			ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
PPM1G	5496	broad.mit.edu	37	2	27614053	27614053	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27614053delT	uc002rkl.2	-						PPM1G_uc002rkm.2_Intron	NM_002707	NP_002698			protein phosphatase 1G						cell cycle arrest|protein dephosphorylation	cytoplasm|nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33578035	33578037	+	Intron	DEL	TTC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33578035_33578037delTTC	uc002ros.2	+						LTBP1_uc002rot.2_Intron|LTBP1_uc002rou.2_Intron|LTBP1_uc002rov.2_Intron|LTBP1_uc010ymz.1_Intron|LTBP1_uc010yna.1_Intron|LTBP1_uc010ynb.1_Intron	NM_206943	NP_996826			latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	42620927	42620927	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42620927delT								COX7A2L (24777 upstream) : KCNG3 (48232 downstream)																																			---	---	---	---
SRBD1	55133	broad.mit.edu	37	2	45688797	45688798	+	Intron	INS	-	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45688797_45688798insC	uc002rus.2	-						SRBD1_uc010yoc.1_Intron	NM_018079	NP_060549			S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)															---	---	---	---
SRBD1	55133	broad.mit.edu	37	2	45759199	45759200	+	Intron	DEL	AC	-	-	rs10581832		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45759199_45759200delAC	uc002rus.2	-						SRBD1_uc010yoc.1_Intron	NM_018079	NP_060549			S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)															---	---	---	---
EPAS1	2034	broad.mit.edu	37	2	46603311	46603311	+	Intron	DEL	A	-	-	rs3214773		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46603311delA	uc002ruv.2	+							NM_001430	NP_001421			endothelial PAS domain protein 1						angiogenesis|myoblast cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|response to hypoxia	transcription factor complex	histone acetyltransferase binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription coactivator activity|transcription factor binding			ovary(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)															---	---	---	---
TTC7A	57217	broad.mit.edu	37	2	47255006	47255007	+	Intron	INS	-	C	C	rs148192713	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47255006_47255007insC	uc002rvo.2	+						TTC7A_uc002rvm.2_Intron|TTC7A_uc002rvn.1_Intron|TTC7A_uc010fbb.2_Intron|TTC7A_uc010fbc.2_Intron|TTC7A_uc002rvp.2_Intron|TTC7A_uc002rvq.2_Intron|TTC7A_uc002rvr.2_Intron	NM_020458	NP_065191			tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)															---	---	---	---
MSH2	4436	broad.mit.edu	37	2	47731616	47731617	+	Intron	INS	-	CAGC	CAGC	rs79374278		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47731616_47731617insCAGC	uc002rvz.2	+							NM_000251	NP_000242			mutS homolog 2						B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding			large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)					D|Mis|N|F|S		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	2	49078447	49078447	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49078447delA								LHCGR (95567 upstream) : FSHR (111206 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	52411922	52411925	+	IGR	DEL	CTAA	-	-	rs140010673		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52411922_52411925delCTAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	55292891	55292891	+	IGR	DEL	A	-	-	rs11351020		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55292891delA								RTN4 (15157 upstream) : C2orf63 (106796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	60919937	60919937	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60919937delG								BCL11A (139304 upstream) : PAPOLG (63446 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	61074126	61074126	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61074126delA								PAPOLG (48030 upstream) : REL (34626 downstream)																																			---	---	---	---
C2orf86	51057	broad.mit.edu	37	2	63753190	63753191	+	Intron	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63753190_63753191delTG	uc002sch.2	-						C2orf86_uc002sci.1_Intron	NM_015910	NP_056994			hypothetical protein LOC51057 isoform 2						cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0																		---	---	---	---
AAK1	22848	broad.mit.edu	37	2	69740458	69740458	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69740458delT	uc002sfp.2	-						AAK1_uc010fdk.2_Intron|AAK1_uc010yqm.1_Intron	NM_014911	NP_055726			AP2 associated kinase 1							coated pit|mitochondrion|plasma membrane	ATP binding|protein serine/threonine kinase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	71983249	71983249	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71983249delA								DYSF (69357 upstream) : CYP26B1 (373118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	75643198	75643199	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75643198_75643199insA								TACR1 (216553 upstream) : FAM176A (76245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	81992437	81992437	+	IGR	DEL	C	-	-	rs35979192		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:81992437delC								None (None upstream) : None (None downstream)																																			---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87617752	87617753	+	Intron	INS	-	TG	TG	rs4070848		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87617752_87617753insTG	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
RPIA	22934	broad.mit.edu	37	2	89013685	89013686	+	Intron	INS	-	T	T	rs7587788		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89013685_89013686insT	uc002ste.2	+							NM_144563	NP_653164			ribose 5-phosphate isomerase A						pentose-phosphate shunt, non-oxidative branch	cytosol	ribose-5-phosphate isomerase activity			ovary(1)	1		Acute lymphoblastic leukemia(2;0.000456)|all_hematologic(2;0.00287)																---	---	---	---
FLJ40330	645784	broad.mit.edu	37	2	89091578	89091578	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89091578delT	uc010fhg.2	+						FLJ40330_uc010fhh.2_Intron	NR_015424				Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	89208567	89208568	+	Intron	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89208567_89208568delTG	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	90424303	90424306	+	Intron	DEL	AGAG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90424303_90424306delAGAG	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	90461803	90461804	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90461803_90461804insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	90472399	90472400	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90472399_90472400insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92177504	92177506	+	IGR	DEL	ATG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92177504_92177506delATG								FKSG73 (47010 upstream) : None (None downstream)																																			---	---	---	---
ARID5A	10865	broad.mit.edu	37	2	97208588	97208588	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97208588delT	uc002swe.2	+						ARID5A_uc010yuq.1_Intron|ARID5A_uc002swf.2_Intron|ARID5A_uc002swg.2_Intron	NM_212481	NP_997646			AT rich interactive domain 5A						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	100820420	100820421	+	IGR	INS	-	A	A	rs11689199	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100820420_100820421insA								AFF3 (61383 upstream) : LONRF2 (69333 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	100885132	100885132	+	IGR	DEL	C	-	-	rs75522322		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100885132delC								AFF3 (126095 upstream) : LONRF2 (4622 downstream)																																			---	---	---	---
RFX8	731220	broad.mit.edu	37	2	102080079	102080079	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102080079delA	uc010yvx.1	-						RFX8_uc002tbb.1_Intron	NM_001145664	NP_001139136			regulatory factor X, 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
IL1RL2	8808	broad.mit.edu	37	2	102804538	102804539	+	Intron	INS	-	ACC	ACC	rs144678772	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102804538_102804539insACC	uc002tbs.2	+						IL1RL2_uc002tbt.2_Intron	NM_003854	NP_003845			interleukin 1 receptor-like 2 precursor						cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2																		---	---	---	---
NCK2	8440	broad.mit.edu	37	2	106509301	106509302	+	Intron	INS	-	AA	AA	rs111320888		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106509301_106509302insAA	uc002tdg.2	+						NCK2_uc002tdh.2_Intron|NCK2_uc002tdi.2_Intron	NM_003581	NP_003572			NCK adaptor protein 2 isoform A						axon guidance|epidermal growth factor receptor signaling pathway|negative regulation of cell proliferation|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of epidermal growth factor receptor activity|regulation of translation|signal complex assembly|T cell activation	cytosol|endoplasmic reticulum	cytoskeletal adaptor activity|receptor signaling complex scaffold activity			ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	107821176	107821176	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107821176delA								ST6GAL2 (317613 upstream) : LOC729121 (618344 downstream)																																			---	---	---	---
SH3RF3	344558	broad.mit.edu	37	2	110056619	110056619	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110056619delG	uc010ywt.1	+							NM_001099289	NP_001092759			SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	116131462	116131463	+	Intron	DEL	AG	-	-	rs112666069		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116131462_116131463delAG	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
GLI2	2736	broad.mit.edu	37	2	121603903	121603903	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121603903delA	uc010flp.2	+						GLI2_uc010yyu.1_Intron|GLI2_uc002tmp.1_Intron|GLI2_uc010fln.1_Intron|GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Intron|GLI2_uc010flo.1_Intron|GLI2_uc002tmw.1_Intron	NM_005270	NP_005261			GLI-Kruppel family member GLI2						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)																---	---	---	---
MAP3K2	10746	broad.mit.edu	37	2	128087455	128087456	+	Intron	INS	-	GA	GA			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128087455_128087456insGA	uc002toj.1	-						MAP3K2_uc010flz.1_Intron	NM_006609	NP_006600			mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|cellular response to mechanical stimulus	nucleus	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein kinase binding			lung(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)														---	---	---	---
HS6ST1	9394	broad.mit.edu	37	2	129068169	129068170	+	Intron	INS	-	CA	CA	rs146916773	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129068169_129068170insCA	uc002tpt.3	-							NM_004807	NP_004798			heparan sulfate 6-O-sulfotransferase 1						heparan sulfate proteoglycan biosynthetic process, enzymatic modification	integral to plasma membrane	sulfotransferase activity			pancreas(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	129258308	129258308	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129258308delT								HS6ST1 (182137 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	131394053	131394054	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131394053_131394054insA								LOC150527 (86582 upstream) : C2orf14 (43569 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	132405729	132405730	+	IGR	INS	-	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132405729_132405730insG								CCDC74A (114492 upstream) : C2orf27A (74334 downstream)																																			---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	134073205	134073205	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134073205delA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	138215621	138215622	+	Intron	INS	-	A	A	rs145342642	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138215621_138215622insA	uc002tva.1	+						THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	138283819	138283819	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138283819delA	uc002tva.1	+						THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	142081490	142081491	+	Intron	INS	-	CACA	CACA	rs142943049	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142081490_142081491insCACA	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	142290909	142290910	+	Intron	INS	-	AAGC	AAGC	rs145668080	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142290909_142290910insAAGC	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	2	143836901	143836902	+	IGR	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143836901_143836902delGT								KYNU (37017 upstream) : ARHGAP15 (49997 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	149624337	149624338	+	IGR	DEL	AC	-	-	rs35641817		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149624337_149624338delAC								EPC2 (79202 upstream) : KIF5C (8481 downstream)																																			---	---	---	---
NEB	4703	broad.mit.edu	37	2	152350402	152350402	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152350402delC	uc010fnx.2	-						NEB_uc002txr.2_Intron|RIF1_uc002txp.2_Intron|NEB_uc010zbz.1_Intron|NEB_uc002txq.2_Intron|NEB_uc010zca.1_Intron|NEB_uc010zcb.1_Intron	NM_004543	NP_004534			nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	156516464	156516464	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156516464delT								KCNJ3 (803450 upstream) : NR4A2 (664482 downstream)																																			---	---	---	---
UBR3	130507	broad.mit.edu	37	2	170759051	170759051	+	Intron	DEL	T	-	-	rs66964268		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170759051delT	uc010zdi.1	+							NM_172070	NP_742067			E3 ubiquitin-protein ligase UBR3						sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
DCAF17	80067	broad.mit.edu	37	2	172309993	172309994	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172309993_172309994insT	uc002ugx.2	+						DCAF17_uc010zdq.1_Intron|DCAF17_uc010fqf.1_Intron|DCAF17_uc010zdr.1_Intron|DCAF17_uc010fqg.2_Intron	NM_025000	NP_079276			DDB1 and CUL4 associated factor 17 isoform 1							CUL4 RING ubiquitin ligase complex|integral to membrane|nucleolus					0																		---	---	---	---
GPR155	151556	broad.mit.edu	37	2	175319512	175319515	+	Intron	DEL	GGAA	-	-	rs112767995		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175319512_175319515delGGAA	uc002uit.2	-						GPR155_uc002uiu.2_Intron|GPR155_uc002uiv.2_Intron|GPR155_uc010fqs.2_Intron	NM_001033045	NP_001028217			G protein-coupled receptor 155 isoform 9						intracellular signal transduction|transmembrane transport	integral to membrane				ovary(1)	1																		---	---	---	---
OSBPL6	114880	broad.mit.edu	37	2	179200810	179200810	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179200810delT	uc002ulx.2	+						OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Intron|OSBPL6_uc010zfe.1_Intron|OSBPL6_uc002ulz.2_Intron|OSBPL6_uc002uma.2_Intron	NM_032523	NP_115912			oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)															---	---	---	---
ZNF385B	151126	broad.mit.edu	37	2	180503976	180503977	+	Intron	INS	-	AAGG	AAGG	rs71029824		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180503976_180503977insAAGG	uc002unn.3	-						ZNF385B_uc002unm.2_Intron	NM_152520	NP_689733			zinc finger protein 385B isoform 1							nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	182271186	182271187	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182271186_182271187insA								UBE2E3 (343036 upstream) : ITGA4 (50432 downstream)																																			---	---	---	---
CERKL	375298	broad.mit.edu	37	2	182494361	182494361	+	Intron	DEL	A	-	-	rs111821745		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182494361delA	uc002unx.2	-						CERKL_uc002uny.2_Intron|CERKL_uc010zfm.1_Intron|CERKL_uc002unz.2_Intron|CERKL_uc002uoa.2_Intron|CERKL_uc002uob.2_Intron|CERKL_uc002uoc.2_Intron|CERKL_uc010frk.2_Intron|CERKL_uc002uod.1_Intron|CERKL_uc002uoe.2_Intron	NM_001030311	NP_001025482			ceramide kinase-like isoform b						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	187640260	187640260	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187640260delA								FAM171B (9576 upstream) : ZSWIM2 (51947 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	196418918	196418918	+	IGR	DEL	A	-	-	rs71700530		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196418918delA								None (None upstream) : SLC39A10 (102614 downstream)																																			---	---	---	---
ANKRD44	91526	broad.mit.edu	37	2	198155758	198155758	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198155758delC	uc002uuc.2	-						ANKRD44_uc002uub.2_Intron|ANKRD44_uc010zgw.1_Intron|ANKRD44_uc002uud.1_Intron	NM_153697	NP_710181			ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)															---	---	---	---
SPATS2L	26010	broad.mit.edu	37	2	201194075	201194075	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201194075delT	uc002uvn.3	+						SPATS2L_uc010fst.2_Intron|SPATS2L_uc002uvo.3_Intron|SPATS2L_uc002uvp.3_Intron|SPATS2L_uc002uvq.3_Intron|SPATS2L_uc002uvr.3_Intron|SPATS2L_uc010zhc.1_Intron	NM_015535	NP_056350			SPATS2-like protein isoform a							cytoplasm|nucleolus				ovary(2)|pancreas(1)	3																		---	---	---	---
SPATS2L	26010	broad.mit.edu	37	2	201237094	201237095	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201237094_201237095insA	uc002uvn.3	+						SPATS2L_uc010fst.2_Intron|SPATS2L_uc002uvo.3_Intron|SPATS2L_uc002uvp.3_Intron|SPATS2L_uc002uvq.3_Intron|SPATS2L_uc002uvr.3_Intron|SPATS2L_uc010zhc.1_Intron	NM_015535	NP_056350			SPATS2-like protein isoform a							cytoplasm|nucleolus				ovary(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	201578210	201578210	+	RNA	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201578210delT	uc002uvy.1	-	3		c.868delA								Homo sapiens cDNA clone IMAGE:5294477.																												OREG0015138	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	2	204672084	204672085	+	IGR	DEL	AG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204672084_204672085delAG								CD28 (69528 upstream) : CTLA4 (60424 downstream)																																			---	---	---	---
NDUFS1	4719	broad.mit.edu	37	2	206994674	206994674	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206994674delA	uc002vbe.2	-						NDUFS1_uc010ziq.1_Intron|NDUFS1_uc010zir.1_Intron|NDUFS1_uc010zis.1_Intron|NDUFS1_uc010zit.1_Intron|NDUFS1_uc010ziu.1_Intron	NM_005006	NP_004997			NADH dehydrogenase (ubiquinone) Fe-S protein 1,						apoptosis|ATP metabolic process|mitochondrial electron transport, NADH to ubiquinone|reactive oxygen species metabolic process|regulation of mitochondrial membrane potential|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)													---	---	---	---
MAP2	4133	broad.mit.edu	37	2	210507153	210507153	+	Intron	DEL	A	-	-	rs78107136		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210507153delA	uc002vde.1	+						MAP2_uc002vdc.1_Intron|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron	NM_002374	NP_002365			microtubule-associated protein 2 isoform 1						central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	216217597	216217598	+	IGR	INS	-	T	T	rs142180977	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216217597_216217598insT								ATIC (3120 upstream) : FN1 (7583 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	217121430	217121430	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217121430delG								XRCC5 (50416 upstream) : MARCH4 (1156 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	222026186	222026186	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222026186delA								None (None upstream) : EPHA4 (256563 downstream)																																			---	---	---	---
SERPINE2	5270	broad.mit.edu	37	2	224866695	224866695	+	Intron	DEL	T	-	-	rs10706128		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224866695delT	uc002vnu.2	-						SERPINE2_uc002vnt.2_Intron|SERPINE2_uc010zlr.1_Intron|SERPINE2_uc002vnv.2_Intron	NM_006216	NP_006207			plasminogen activator inhibitor type 1, member 2						negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	225090934	225090934	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225090934delC								SERPINE2 (186898 upstream) : FAM124B (152482 downstream)																																			---	---	---	---
CAB39	51719	broad.mit.edu	37	2	231576184	231576184	+	5'Flank	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231576184delT	uc002vqx.2	+						CAB39_uc010fxr.2_5'Flank|CAB39_uc010fxq.2_5'Flank	NM_016289	NP_057373			calcium binding protein 39						cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	kinase binding			central_nervous_system(1)	1		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)														---	---	---	---
INPP5D	3635	broad.mit.edu	37	2	233991378	233991378	+	Intron	DEL	T	-	-	rs7587242	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233991378delT	uc010zmo.1	+						INPP5D_uc010zmp.1_Intron	NM_001017915	NP_001017915			SH2 containing inositol phosphatase isoform a						apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	235280533	235280533	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235280533delA								SPP2 (294757 upstream) : ARL4C (121155 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	235646611	235646611	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235646611delT								ARL4C (240918 upstream) : SH3BP4 (214017 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237897507	237897507	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237897507delT								CXCR7 (406515 upstream) : COPS8 (96577 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237933949	237933949	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237933949delG								CXCR7 (442957 upstream) : COPS8 (60135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	238015369	238015370	+	IGR	INS	-	AC	AC	rs150651770	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238015369_238015370insAC								COPS8 (7882 upstream) : COL6A3 (217285 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	239939539	239939540	+	IGR	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239939539_239939540delTG								TWIST2 (107302 upstream) : HDAC4 (30325 downstream)																																			---	---	---	---
ANKMY1	51281	broad.mit.edu	37	2	241438608	241438609	+	Intron	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241438608_241438609delGT	uc002vyz.1	-						ANKMY1_uc002vza.1_Intron|ANKMY1_uc010fzd.1_Intron|ANKMY1_uc002vzb.1_Intron|ANKMY1_uc002vzc.1_Intron|ANKMY1_uc002vzd.1_Intron	NM_016552	NP_057636			ankyrin repeat and MYND domain containing 1								zinc ion binding			central_nervous_system(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)														---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	2909287	2909288	+	Intron	DEL	TT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2909287_2909288delTT	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron|CNTN4_uc003bpd.1_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	6409345	6409345	+	IGR	DEL	T	-	-	rs35510031		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6409345delT								None (None upstream) : GRM7 (493457 downstream)																																			---	---	---	---
ATP2B2	491	broad.mit.edu	37	3	10405745	10405745	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10405745delA	uc003bvt.2	-						ATP2B2_uc003bvv.2_Intron|ATP2B2_uc003bvw.2_Intron|ATP2B2_uc010hdo.2_Intron	NM_001001331	NP_001001331			plasma membrane calcium ATPase 2 isoform 1						ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
HRH1	3269	broad.mit.edu	37	3	11278113	11278114	+	Intron	INS	-	CAAAA	CAAAA	rs141979292	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11278113_11278114insCAAAA	uc010hdr.2	+						HRH1_uc010hds.2_Intron|HRH1_uc010hdt.2_Intron	NM_001098213	NP_001091683			histamine receptor H1						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|inflammatory response	cytoplasm|integral to plasma membrane|nucleus	histamine receptor activity			large_intestine(1)|ovary(1)	2					Aceprometazine(DB01615)|Astemizole(DB00637)|Azatadine(DB00719)|Azelastine(DB00972)|Benzquinamide(DB00767)|Bepotastine(DB04890)|Bromodiphenhydramine(DB01237)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbinoxamine(DB00748)|Cetirizine(DB00341)|Chlophedianol(DB04837)|Chlorpheniramine(DB01114)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clemastine(DB00283)|Clozapine(DB00363)|Cyclizine(DB01176)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexbrompheniramine(DB00405)|Dimenhydrinate(DB00985)|Diphenhydramine(DB01075)|Diphenylpyraline(DB01146)|Doxepin(DB01142)|Doxylamine(DB00366)|Emedastine(DB01084)|Epinastine(DB00751)|Fexofenadine(DB00950)|Flunarizine(DB04841)|Histamine Phosphate(DB00667)|Hydroxyzine(DB00557)|Ketotifen(DB00920)|Levocabastine(DB01106)|Loratadine(DB00455)|Maprotiline(DB00934)|Meclizine(DB00737)|Mequitazine(DB01071)|Methdilazine(DB00902)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Nedocromil(DB00716)|Olanzapine(DB00334)|Olopatadine(DB00768)|Orphenadrine(DB01173)|Pemirolast(DB00885)|Phenindamine(DB01619)|Pheniramine(DB01620)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Terfenadine(DB00342)|Thiethylperazine(DB00372)|Trazodone(DB00656)|Trimeprazine(DB01246)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Ziprasidone(DB00246)													---	---	---	---
ATG7	10533	broad.mit.edu	37	3	11376105	11376106	+	Intron	DEL	TG	-	-	rs10558538		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11376105_11376106delTG	uc003bwc.2	+						ATG7_uc003bwd.2_Intron|ATG7_uc011aum.1_Intron	NM_006395	NP_006386			APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1																		---	---	---	---
WNT7A	7476	broad.mit.edu	37	3	13879035	13879036	+	Intron	INS	-	TGAA	TGAA	rs147109535	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13879035_13879036insTGAA	uc003bye.1	-							NM_004625	NP_004616			wingless-type MMTV integration site family,						activation of JUN kinase activity|anterior/posterior pattern formation|canonical Wnt receptor signaling pathway|cell proliferation in forebrain|cellular response to transforming growth factor beta stimulus|central nervous system vasculogenesis|cerebellar granule cell differentiation|dorsal/ventral pattern formation|embryonic axis specification|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic leg morphogenesis|lens fiber cell development|negative regulation of neurogenesis|palate development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of JNK cascade|positive regulation of synaptogenesis|positive regulation of transcription from RNA polymerase II promoter|regulation of axon diameter|satellite cell activation|satellite cell maintenance involved in skeletal muscle regeneration|sex differentiation|uterus development|Wnt receptor signaling pathway involved in wound healing, spreading of epidermal cells|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled binding|receptor agonist activity|signal transducer activity			ovary(2)|breast(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	28735822	28735822	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28735822delG								ZCWPW2 (169192 upstream) : RBMS3 (587121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	31445660	31445660	+	IGR	DEL	A	-	-	rs13320149		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31445660delA								GADL1 (509507 upstream) : STT3B (128831 downstream)																																			---	---	---	---
ITGA9	3680	broad.mit.edu	37	3	37505608	37505611	+	Intron	DEL	GTGT	-	-	rs113159930		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37505608_37505611delGTGT	uc003chd.2	+						ITGA9_uc003chc.2_Intron	NM_002207	NP_002198			integrin, alpha 9 precursor						axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)														---	---	---	---
ZNF445	353274	broad.mit.edu	37	3	44500508	44500508	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44500508delC	uc003cnf.2	-						ZNF445_uc011azw.1_Intron	NM_181489	NP_852466			zinc finger protein 445						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	45382901	45382901	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45382901delC								TMEM158 (115087 upstream) : LARS2 (47174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	46853515	46853516	+	Intron	INS	-	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46853515_46853516insC	uc011ban.1	-						uc011bao.1_Intron					Homo sapiens cDNA FLJ35279 fis, clone PROST2006766, highly similar to Testis-specific protease-like protein 50 precursor.																														---	---	---	---
CCDC12	151903	broad.mit.edu	37	3	46987610	46987610	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46987610delA	uc011baq.1	-						CCDC12_uc003cqo.2_Intron|CCDC12_uc011bar.1_Intron	NM_144716	NP_653317			coiled-coil domain containing 12												0		Prostate(884;0.0143)|Ovarian(412;0.0448)|Acute lymphoblastic leukemia(5;0.143)		OV - Ovarian serous cystadenocarcinoma(275;2.2e-56)|BRCA - Breast invasive adenocarcinoma(193;0.00136)|KIRC - Kidney renal clear cell carcinoma(197;0.00703)|Kidney(197;0.00809)														---	---	---	---
RBM5	10181	broad.mit.edu	37	3	50155888	50155889	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50155888_50155889delGA	uc003cyg.2	+	25	2595_2596	c.2447_2448delGA	c.(2446-2448)TGAfs	p.*816fs	RBM5_uc011bdk.1_Frame_Shift_Del_p.*644fs|RBM5_uc003cyh.2_Frame_Shift_Del_p.*273fs|uc003cyi.1_Intron	NM_005778	NP_005769	P52756	RBM5_HUMAN	RNA binding motif protein 5	816					apoptosis|negative regulation of cell proliferation|positive regulation of apoptosis|regulation of alternative nuclear mRNA splicing, via spliceosome|spliceosome assembly	nucleoplasm|spliceosomal complex	DNA binding|mRNA binding|nucleotide binding|protein binding|zinc ion binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
DOCK3	1795	broad.mit.edu	37	3	51337555	51337555	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51337555delT	uc011bds.1	+							NM_004947	NP_004938			dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)														---	---	---	---
GRM2	2912	broad.mit.edu	37	3	51738902	51738903	+	5'Flank	INS	-	GT	GT	rs138178730	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51738902_51738903insGT	uc010hlv.2	+						GRM2_uc003dbo.3_5'Flank|GRM2_uc010hlu.2_5'Flank	NM_000839	NP_000830			glutamate receptor, metabotropic 2 isoform a						synaptic transmission	integral to plasma membrane				lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acamprosate(DB00659)|Nicotine(DB00184)													---	---	---	---
DNAH1	25981	broad.mit.edu	37	3	52373820	52373821	+	Intron	INS	-	TG	TG	rs151185110	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52373820_52373821insTG	uc011bef.1	+						DNAH1_uc003ddt.1_Intron	NM_015512	NP_056327			dynein, axonemal, heavy chain 1						ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)														---	---	---	---
LOC440957	440957	broad.mit.edu	37	3	52573620	52573620	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52573620delG	uc003dep.2	+							NM_001124767	NP_001118239			hypothetical protein LOC440957							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	54007391	54007392	+	IGR	INS	-	ATGG	ATGG	rs113875165		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54007391_54007392insATGG								SELK (81402 upstream) : CACNA2D3 (149301 downstream)																																			---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56461192	56461192	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56461192delA	uc003dhr.1	-							NM_015576	NP_056391			cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	64262694	64262695	+	IGR	DEL	TT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64262694_64262695delTT								PRICKLE2 (51563 upstream) : ADAMTS9 (238638 downstream)																																			---	---	---	---
GXYLT2	727936	broad.mit.edu	37	3	73024107	73024107	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73024107delT	uc003dpg.2	+							NM_001080393	NP_001073862			glycosyltransferase 8 domain containing 4						O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	84239911	84239911	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84239911delA								None (None upstream) : CADM2 (768222 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	87620060	87620060	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87620060delT								POU1F1 (294323 upstream) : HTR1F (411666 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	95900685	95900686	+	IGR	DEL	TG	-	-	rs113328942		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95900685_95900686delTG								None (None upstream) : EPHA6 (632739 downstream)																																			---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	97245335	97245335	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97245335delT	uc010how.1	+						EPHA6_uc011bgo.1_Intron|EPHA6_uc011bgp.1_Intron|EPHA6_uc003drs.3_Intron|EPHA6_uc003drr.3_Intron|EPHA6_uc003drt.2_Intron|EPHA6_uc010hox.1_Intron	NM_001080448	NP_001073917			EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	98730377	98730379	+	IGR	DEL	AGG	-	-	rs150557859		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98730377_98730379delAGG								DCBLD2 (109844 upstream) : COL8A1 (627075 downstream)																																			---	---	---	---
COL8A1	1295	broad.mit.edu	37	3	99367167	99367167	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99367167delA	uc003dtg.1	+						COL8A1_uc003dth.1_Intron|COL8A1_uc010hpe.1_Intron	NM_001850	NP_001841			alpha 1 type VIII collagen precursor						angiogenesis|cell adhesion	basement membrane|collagen type VIII					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	101318024	101318024	+	IGR	DEL	T	-	-	rs148687228	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101318024delT								PCNP (4745 upstream) : ZBTB11 (50261 downstream)																																			---	---	---	---
CD96	10225	broad.mit.edu	37	3	111265767	111265768	+	Intron	DEL	AC	-	-	rs71988528		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111265767_111265768delAC	uc003dxw.2	+						CD96_uc003dxv.2_Intron|CD96_uc003dxx.2_Intron|CD96_uc010hpy.1_Intron	NM_198196	NP_937839			CD96 antigen isoform 1 precursor						cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3														Opitz_Trigonocephaly_syndrome				---	---	---	---
LSAMP	4045	broad.mit.edu	37	3	115672252	115672253	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115672252_115672253delAC	uc003ebt.2	-						LSAMP_uc011bis.1_Intron	NM_002338	NP_002329			limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)														---	---	---	---
LSAMP	4045	broad.mit.edu	37	3	115822405	115822405	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115822405delT	uc003ebt.2	-						LSAMP_uc011bis.1_Intron	NM_002338	NP_002329			limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	118538429	118538432	+	IGR	DEL	CACA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118538429_118538432delCACA								None (None upstream) : IGSF11 (81049 downstream)																																			---	---	---	---
C3orf1	51300	broad.mit.edu	37	3	119217940	119217940	+	Intron	DEL	T	-	-	rs34000460		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119217940delT	uc003ecn.2	+						C3orf1_uc003eco.2_Intron|C3orf1_uc003ecp.2_Intron	NM_016589	NP_057673			hypothetical protein LOC51300							integral to membrane|mitochondrial inner membrane	protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.186)														---	---	---	---
KALRN	8997	broad.mit.edu	37	3	123871441	123871443	+	Intron	DEL	TTT	-	-	rs149304634		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123871441_123871443delTTT	uc003ehg.2	+						KALRN_uc003ehd.2_Intron|KALRN_uc003ehe.2_Intron|KALRN_uc010hru.1_Intron|KALRN_uc010hrv.1_Intron|KALRN_uc010hrw.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron	NM_001024660	NP_001019831			kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
KALRN	8997	broad.mit.edu	37	3	124025292	124025295	+	Intron	DEL	AGAG	-	-	rs144382682		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124025292_124025295delAGAG	uc003ehg.2	+						KALRN_uc010hrv.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron	NM_001024660	NP_001019831			kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	125684511	125684513	+	IGR	DEL	ATA	-	-	rs142347245		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125684511_125684513delATA								ALG1L (28629 upstream) : ROPN1B (3515 downstream)																																			---	---	---	---
ABTB1	80325	broad.mit.edu	37	3	127393862	127393872	+	Intron	DEL	CTGCTTGCTTG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127393862_127393872delCTGCTTGCTTG	uc003ejt.2	+						ABTB1_uc003ejr.2_Intron|ABTB1_uc003ejs.2_Intron|ABTB1_uc003eju.2_Intron|ABTB1_uc010hsm.2_5'Flank	NM_172027	NP_742024			ankyrin repeat and BTB (POZ) domain containing 1							cytoplasm|nucleolus|plasma membrane	translation elongation factor activity				0																		---	---	---	---
ACAD9	28976	broad.mit.edu	37	3	128617413	128617413	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128617413delT	uc003ela.3	+						ACAD9_uc010hsw.1_Intron|ACAD9_uc011bks.1_Intron|ACAD9_uc003elb.2_Intron|ACAD9_uc003elc.1_Intron|ACAD9_uc003eld.1_5'Flank	NM_014049	NP_054768			acyl-Coenzyme A dehydrogenase family, member 9							mitochondrion	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
COPG	22820	broad.mit.edu	37	3	128993030	128993030	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128993030delA	uc003els.2	+						COPG_uc010htb.2_Intron	NM_016128	NP_057212			coatomer protein complex, subunit gamma 1						COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(3)|breast(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	129797100	129797100	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129797100delT								TRH (100324 upstream) : ALG1L2 (3574 downstream)																																			---	---	---	---
ALG1L2	644974	broad.mit.edu	37	3	129800641	129800651	+	5'Flank	DEL	CTGACCCACCC	-	-	rs140390186		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129800641_129800651delCTGACCCACCC	uc011bld.1	+						ALG1L2_uc010hth.2_5'Flank	NM_001136152	NP_001129624			asparagine-linked glycosylation 1-like 2						biosynthetic process		transferase activity, transferring glycosyl groups				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	132020951	132020952	+	IGR	DEL	TC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132020951_132020952delTC								CPNE4 (16697 upstream) : ACPP (15259 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	136924112	136924112	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136924112delT								IL20RB (194192 upstream) : SOX14 (559467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	139492530	139492531	+	IGR	DEL	AC	-	-	rs141168590		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139492530_139492531delAC								NMNAT3 (95690 upstream) : CLSTN2 (161496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	150238121	150238121	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150238121delG								TSC22D2 (60508 upstream) : SERP1 (21660 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	153344865	153344866	+	IGR	INS	-	TG	TG	rs138470624	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153344865_153344866insTG								C3orf79 (124382 upstream) : SGEF (494283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	161411798	161411798	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161411798delT								OTOL1 (190070 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	161659032	161659033	+	IGR	INS	-	C	C	rs141438366	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161659032_161659033insC								OTOL1 (437304 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	162068607	162068608	+	IGR	INS	-	A	A	rs151054106	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162068607_162068608insA								OTOL1 (846879 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166658972	166658972	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166658972delA								None (None upstream) : ZBBX (299109 downstream)																																			---	---	---	---
TNIK	23043	broad.mit.edu	37	3	170875829	170875829	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170875829delA	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron	NM_015028	NP_055843			TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)															---	---	---	---
KLHL6	89857	broad.mit.edu	37	3	183245512	183245513	+	Intron	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183245512_183245513delGT	uc003flr.2	-						KLHL6_uc003fls.1_Intron|KLHL6_uc003flt.1_Intron	NM_130446	NP_569713			kelch-like 6											haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)															---	---	---	---
EHHADH	1962	broad.mit.edu	37	3	184928605	184928605	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184928605delA	uc003fpf.2	-						EHHADH_uc011brs.1_Intron	NM_001966	NP_001957			enoyl-Coenzyme A, hydratase/3-hydroxyacyl							peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity			ovary(3)	3	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		NADH(DB00157)													---	---	---	---
ETV5	2119	broad.mit.edu	37	3	185788988	185788988	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185788988delA	uc003fpz.2	-						ETV5_uc003fpy.2_Intron	NM_004454	NP_004445			ets variant gene 5 (ets-related molecule)						cellular response to oxidative stress	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)|skin(2)|breast(1)	5	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)					T	TMPRSS2|SCL45A3	Prostate 								---	---	---	---
Unknown	0	broad.mit.edu	37	3	187475682	187475682	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187475682delA								BCL6 (12207 upstream) : LPP (396037 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	190450143	190450144	+	IGR	INS	-	TATC	TATC	rs144511685	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190450143_190450144insTATC								IL1RAP (74300 upstream) : LOC647309 (120382 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	191142942	191142942	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191142942delA								CCDC50 (26484 upstream) : PYDC2 (36010 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	194251148	194251148	+	IGR	DEL	T	-	-	rs62655660		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194251148delT								ATP13A3 (62180 upstream) : TMEM44 (57255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	195375265	195375265	+	5'Flank	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195375265delC	uc011bsy.1	-						uc011bsz.1_5'Flank					Homo sapiens cDNA FLJ36096 fis, clone TESTI2020906.																														---	---	---	---
PAK2	5062	broad.mit.edu	37	3	196538143	196538144	+	Intron	INS	-	CCCTA	CCCTA	rs147942931	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196538143_196538144insCCCTA	uc003fwy.3	+							NM_002577	NP_002568			p21-activated kinase 2						axon guidance|cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of apoptosis|regulation of defense response to virus by virus|regulation of growth|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|nucleus|perinuclear region of cytoplasm|plasma membrane	ATP binding|identical protein binding|protein kinase binding|protein serine/threonine kinase activity|protein tyrosine kinase activator activity			ovary(1)|lung(1)	2	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)														---	---	---	---
LMLN	89782	broad.mit.edu	37	3	197733589	197733589	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197733589delT	uc011buo.1	+						LMLN_uc003fyt.2_Intron|LMLN_uc010iar.2_Intron|LMLN_uc010ias.2_Intron|LMLN_uc003fyu.2_Intron	NM_033029	NP_149018			leishmanolysin-like isoform 2						cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)														---	---	---	---
LMLN	89782	broad.mit.edu	37	3	197752837	197752837	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197752837delT	uc011buo.1	+						LMLN_uc003fyt.2_Intron|LMLN_uc010iar.2_Intron|LMLN_uc010ias.2_Intron|LMLN_uc003fyu.2_Intron	NM_033029	NP_149018			leishmanolysin-like isoform 2						cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)														---	---	---	---
RNF4	6047	broad.mit.edu	37	4	2516306	2516307	+	3'UTR	INS	-	CCA	CCA	rs111983570		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2516306_2516307insCCA	uc003gfb.2	+	8					RNF4_uc010icj.2_3'UTR|RNF4_uc003gfc.2_3'UTR	NM_002938	NP_002929			ring finger protein 4						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|protein K63-linked ubiquitination|regulation of kinetochore assembly|regulation of spindle assembly|response to arsenic-containing substance	cytoplasm|PML body	androgen receptor binding|DNA binding|nucleosome binding|sequence-specific DNA binding transcription factor activity|SUMO polymer binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(65;0.241)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	3610214	3610215	+	IGR	INS	-	C	C	rs145974626	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3610214_3610215insC								LRPAP1 (75990 upstream) : ADRA2C (157860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3779609	3779612	+	IGR	DEL	TTCA	-	-	rs112488147		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3779609_3779612delTTCA								ADRA2C (9358 upstream) : LOC348926 (164058 downstream)																																			---	---	---	---
JAKMIP1	152789	broad.mit.edu	37	4	6148684	6148685	+	Intron	INS	-	T	T	rs113435961		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6148684_6148685insT	uc003giu.3	-						JAKMIP1_uc010idb.1_Intron|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Intron|JAKMIP1_uc010ide.2_Intron	NM_144720	NP_653321			janus kinase and microtubule interacting protein						protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	10410400	10410400	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10410400delT								WDR1 (291827 upstream) : ZNF518B (31105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13900821	13900821	+	Intron	DEL	A	-	-	rs74452798		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13900821delA	uc003gna.1	+											Homo sapiens cDNA FLJ34570 fis, clone KIDNE2008072.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	24040324	24040324	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24040324delT								PPARGC1A (148624 upstream) : MIR573 (481491 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	24240219	24240220	+	IGR	DEL	CT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24240219_24240220delCT								PPARGC1A (348519 upstream) : MIR573 (281595 downstream)																																			---	---	---	---
TBC1D1	23216	broad.mit.edu	37	4	37936160	37936160	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37936160delG	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron	NM_015173	NP_055988			TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
CWH43	80157	broad.mit.edu	37	4	48995940	48995940	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48995940delT	uc003gyv.2	+						CWH43_uc011bzl.1_Intron	NM_025087	NP_079363			cell wall biogenesis 43 C-terminal homolog						GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	49095572	49095573	+	IGR	INS	-	GGATG	GGATG			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49095572_49095573insGGATG								CWH43 (31479 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49136257	49136261	+	IGR	DEL	TTCAT	-	-	rs144634219	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49136257_49136261delTTCAT								CWH43 (72164 upstream) : None (None downstream)																																			---	---	---	---
SCFD2	152579	broad.mit.edu	37	4	53827729	53827729	+	Intron	DEL	C	-	-	rs35069480		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53827729delC	uc003gzu.2	-						SCFD2_uc010igm.2_Intron	NM_152540	NP_689753			sec1 family domain containing 2						protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	59460132	59460132	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59460132delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	67596098	67596098	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67596098delT								MIR1269 (453452 upstream) : CENPC1 (741891 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	72742235	72742238	+	IGR	DEL	TCCT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72742235_72742238delTCCT								GC (72477 upstream) : NPFFR2 (155283 downstream)																																			---	---	---	---
ANXA3	306	broad.mit.edu	37	4	79483923	79483923	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79483923delA	uc003hld.2	+						ANXA3_uc003hle.2_Intron|ANXA3_uc010ijk.2_Intron	NM_005139	NP_005130			annexin A3						defense response to bacterium|neutrophil degranulation|phagocytosis|positive regulation of angiogenesis|positive regulation of endothelial cell migration|positive regulation of sequence-specific DNA binding transcription factor activity	phagocytic vesicle membrane|plasma membrane|specific granule	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	83494031	83494032	+	IGR	INS	-	T	T	rs141426726	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83494031_83494032insT								TMEM150C (10521 upstream) : C4orf11 (40235 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	83947111	83947111	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83947111delT								LIN54 (13071 upstream) : COPS4 (9128 downstream)																																			---	---	---	---
IBSP	3381	broad.mit.edu	37	4	88722634	88722635	+	Intron	DEL	AC	-	-	rs149235444		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88722634_88722635delAC	uc003hqx.3	+							NM_004967	NP_004958			integrin-binding sialoprotein precursor						biomineral tissue development|cell adhesion|ossification						0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	89293771	89293771	+	IGR	DEL	A	-	-	rs78454724		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89293771delA								PPM1K (87883 upstream) : HERC6 (6120 downstream)																																			---	---	---	---
GRID2	2895	broad.mit.edu	37	4	93679328	93679328	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93679328delT	uc011cdt.1	+						GRID2_uc010ikx.2_Intron|GRID2_uc011cdu.1_Intron	NM_001510	NP_001501			glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
UNC5C	8633	broad.mit.edu	37	4	96326291	96326291	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96326291delA	uc003htp.1	-						UNC5C_uc010ilc.1_Intron|UNC5C_uc003htq.2_Intron	NM_003728	NP_003719			unc5C precursor						apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	98132876	98132876	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98132876delT								None (None upstream) : C4orf37 (347158 downstream)																																			---	---	---	---
ADH5	128	broad.mit.edu	37	4	100009952	100009953	+	5'Flank	INS	-	G	G	rs145470085	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100009952_100009953insG	uc003hui.2	-						ADH5_uc003huk.1_5'Flank|uc003hum.1_5'Flank|uc003hul.1_5'Flank	NM_000671	NP_000662			class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)													---	---	---	---
NHEDC2	133308	broad.mit.edu	37	4	103952169	103952169	+	Intron	DEL	T	-	-	rs36106582		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103952169delT	uc003hwx.3	-						NHEDC2_uc010iln.1_Intron|NHEDC2_uc003hwy.2_Intron|NHEDC2_uc011cew.1_Intron|NHEDC2_uc011cex.1_Intron	NM_178833	NP_849155			Na+/H+ exchanger domain containing 2						sodium ion transport	integral to membrane|mitochondrial membrane	solute:hydrogen antiporter activity				0				OV - Ovarian serous cystadenocarcinoma(123;2.3e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	104477437	104477437	+	IGR	DEL	G	-	-	rs141538429		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104477437delG								CENPE (357871 upstream) : TACR3 (33188 downstream)																																			---	---	---	---
TBCK	93627	broad.mit.edu	37	4	107025701	107025701	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107025701delC	uc010ilv.2	-						TBCK_uc003hyb.2_Intron|TBCK_uc003hye.2_Intron|TBCK_uc003hyc.2_Intron|TBCK_uc003hyd.2_Intron|TBCK_uc003hyf.2_Intron	NM_001163435	NP_001156907			TBC domain-containing protein kinase-like							intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	126574498	126574499	+	IGR	INS	-	A	A	rs148972375	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126574498_126574499insA								MIR2054 (146036 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	144243136	144243136	+	IGR	DEL	T	-	-	rs141110335		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144243136delT								USP38 (99996 upstream) : GAB1 (14847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	146511592	146511593	+	IGR	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146511592_146511593delTG								SMAD1 (31269 upstream) : MMAA (28947 downstream)																																			---	---	---	---
ARHGAP10	79658	broad.mit.edu	37	4	148893910	148893911	+	Intron	INS	-	T	T	rs150559095		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148893910_148893911insT	uc003ilf.2	+						ARHGAP10_uc003ilg.2_Intron|ARHGAP10_uc003ilh.2_Intron	NM_024605	NP_078881			Rho GTPase activating protein 10						apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)														---	---	---	---
KIAA0922	23240	broad.mit.edu	37	4	154539628	154539629	+	Intron	INS	-	A	A	rs149769213		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154539628_154539629insA	uc003inm.3	+						KIAA0922_uc010ipp.2_Intron|KIAA0922_uc010ipq.2_Intron	NM_015196	NP_056011			hypothetical protein LOC23240 isoform 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	164355994	164355995	+	IGR	INS	-	TG	TG	rs141764979	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164355994_164355995insTG								NPY5R (82910 upstream) : TKTL2 (36253 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	165346458	165346459	+	IGR	DEL	TG	-	-	rs10552711		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165346458_165346459delTG								MARCH1 (41256 upstream) : TRIM61 (529141 downstream)																																			---	---	---	---
GALNTL6	442117	broad.mit.edu	37	4	173592995	173592995	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173592995delT	uc003isv.2	+							NM_001034845	NP_001030017			N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	179874926	179874928	+	IGR	DEL	CTG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179874926_179874928delCTG								LOC285501 (963023 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	182899050	182899050	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:182899050delT	uc003iva.1	-											Homo sapiens cDNA FLJ31634 fis, clone NT2RI2003419.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	183753505	183753520	+	IGR	DEL	CTCCCTTCCTTCTCCC	-	-	rs140079431	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183753505_183753520delCTCCCTTCCTTCTCCC								ODZ3 (29328 upstream) : DCTD (57725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	189137257	189137258	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189137257_189137258insT								TRIML1 (68608 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190574002	190574002	+	IGR	DEL	G	-	-	rs68116009		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190574002delG								None (None upstream) : FRG1 (287972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190767268	190767268	+	IGR	DEL	C	-	-	rs79051841		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190767268delC								None (None upstream) : FRG1 (94706 downstream)																																			---	---	---	---
CLPTM1L	81037	broad.mit.edu	37	5	1333412	1333412	+	Intron	DEL	A	-	-	rs68084960		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1333412delA	uc003jch.2	-						CLPTM1L_uc003jcg.2_Intron	NM_030782	NP_110409			CLPTM1-like						apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	1539790	1539791	+	IGR	DEL	TG	-	-	rs34564989		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1539790_1539791delTG								LPCAT1 (15714 upstream) : SDHAP3 (28846 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2164121	2164122	+	IGR	INS	-	C	C	rs145327812	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2164121_2164122insC								IRX4 (281241 upstream) : IRX2 (582159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2420303	2420303	+	IGR	DEL	A	-	-	rs76499894		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2420303delA								IRX4 (537423 upstream) : IRX2 (325978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3904800	3904800	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3904800delC								IRX1 (303284 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5714097	5714098	+	IGR	INS	-	AC	AC	rs142646543	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5714097_5714098insAC								KIAA0947 (223760 upstream) : FLJ33360 (596456 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	6357965	6357965	+	IGR	DEL	T	-	-	rs79395631		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6357965delT								FLJ33360 (20560 upstream) : MED10 (14075 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	10063871	10063872	+	IGR	INS	-	CAGG	CAGG	rs141613600	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10063871_10063872insCAGG								LOC285692 (159935 upstream) : FAM173B (162566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	10844739	10844739	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10844739delC								DAP (83352 upstream) : CTNND2 (127213 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	10962798	10962799	+	IGR	INS	-	AG	AG	rs144196101	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10962798_10962799insAG								DAP (201411 upstream) : CTNND2 (9153 downstream)																																			---	---	---	---
CDH18	1016	broad.mit.edu	37	5	19750801	19750801	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19750801delT	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925			cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	20557071	20557071	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20557071delG								CDH18 (568764 upstream) : GUSBP1 (784871 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	28377274	28377275	+	IGR	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28377274_28377275delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	30083570	30083571	+	IGR	DEL	GG	-	-	rs62351666	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30083570_30083571delGG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	31033009	31033010	+	IGR	DEL	TC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31033009_31033010delTC								None (None upstream) : CDH6 (160786 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	38716365	38716365	+	IGR	DEL	T	-	-	rs35332099		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38716365delT								LIFR (120858 upstream) : OSMR (129763 downstream)																																			---	---	---	---
HCN1	348980	broad.mit.edu	37	5	45531160	45531161	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45531160_45531161delAC	uc003jok.2	-							NM_021072	NP_066550			hyperpolarization activated cyclic							integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	46380936	46380937	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46380936_46380937insA								HCN1 (684716 upstream) : None (None downstream)																																			---	---	---	---
ARL15	54622	broad.mit.edu	37	5	53546968	53546968	+	Intron	DEL	T	-	-	rs59492418		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53546968delT	uc003jpg.1	-						ARL15_uc010ivs.1_Intron	NM_019087	NP_061960			ADP-ribosylation factor-like 15								GTP binding			ovary(1)	1		Lung NSC(810;0.000779)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	53970946	53970947	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53970946_53970947insA								SNX18 (128531 upstream) : ESM1 (302749 downstream)																																			---	---	---	---
RAB3C	115827	broad.mit.edu	37	5	58134475	58134475	+	Intron	DEL	A	-	-	rs35643010		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58134475delA	uc003jrp.2	+							NM_138453	NP_612462			RAB3C, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			ovary(1)|central_nervous_system(1)	2		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	58245332	58245333	+	IGR	INS	-	G	G	rs147273092	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58245332_58245333insG								RAB3C (97927 upstream) : PDE4D (19533 downstream)																																			---	---	---	---
CWC27	10283	broad.mit.edu	37	5	64145531	64145531	+	Intron	DEL	G	-	-	rs76406137		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64145531delG	uc003jtn.1	+						CWC27_uc010iwt.1_Intron	NM_005869	NP_005860			serologically defined colon cancer antigen 10						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	74901131	74901131	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74901131delT								POLK (5487 upstream) : POC5 (68902 downstream)																																			---	---	---	---
CMYA5	202333	broad.mit.edu	37	5	79072843	79072844	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79072843_79072844insT	uc003kgc.2	+							NM_153610	NP_705838			cardiomyopathy associated 5							perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)														---	---	---	---
RASGRF2	5924	broad.mit.edu	37	5	80465808	80465816	+	Intron	DEL	CACCTGCAT	-	-	rs68106690		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80465808_80465816delCACCTGCAT	uc003kha.1	+						RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840			Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	86475192	86475193	+	Intron	DEL	GA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86475192_86475193delGA	uc003kit.2	+											Homo sapiens cDNA clone IMAGE:5444809, **** WARNING: chimeric clone ****.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	90537734	90537734	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90537734delT								GPR98 (77702 upstream) : ARRDC3 (126807 downstream)																																			---	---	---	---
LNPEP	4012	broad.mit.edu	37	5	96345386	96345387	+	Intron	INS	-	TGCTGC	TGCTGC	rs139412921	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96345386_96345387insTGCTGC	uc003kmv.1	+						LNPEP_uc003kmw.1_Intron	NM_005575	NP_005566			leucyl/cystinyl aminopeptidase isoform 1						cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	103721604	103721604	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103721604delT								NUDT12 (823114 upstream) : RAB9BP1 (713571 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	105936147	105936147	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105936147delA								None (None upstream) : EFNA5 (776444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	117359019	117359019	+	IGR	DEL	A	-	-	rs78741874		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117359019delA								None (None upstream) : DTWD2 (813552 downstream)																																			---	---	---	---
DMXL1	1657	broad.mit.edu	37	5	118513953	118513954	+	Intron	INS	-	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118513953_118513954insG	uc003ksd.2	+						DMXL1_uc010jcl.1_Intron	NM_005509	NP_005500			Dmx-like 1											ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	122406302	122406303	+	IGR	DEL	GC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122406302_122406303delGC								PPIC (33877 upstream) : PRDM6 (18538 downstream)																																			---	---	---	---
PRDM6	93166	broad.mit.edu	37	5	122430128	122430135	+	Intron	DEL	TCTCTCTC	-	-	rs72416461		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122430128_122430135delTCTCTCTC	uc003kti.2	+						PRDM6_uc003ktj.2_Intron	NM_001136239	NP_001129711			PR domain containing 6						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	123645135	123645135	+	IGR	DEL	C	-	-	rs35522843		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123645135delC								CSNK1G3 (692673 upstream) : ZNF608 (327475 downstream)																																			---	---	---	---
FSTL4	23105	broad.mit.edu	37	5	132629812	132629812	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132629812delT	uc003kyn.1	-							NM_015082	NP_055897			follistatin-like 4 precursor							extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	138924217	138924218	+	IGR	DEL	CC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138924217_138924218delCC								TMEM173 (61925 upstream) : UBE2D2 (16533 downstream)																																			---	---	---	---
NR3C1	2908	broad.mit.edu	37	5	142772915	142772916	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142772915_142772916delAC	uc003lmz.2	-						NR3C1_uc003lmy.2_Intron|NR3C1_uc003lna.2_Intron|NR3C1_uc003lnb.2_Intron|NR3C1_uc011dbk.1_Intron|NR3C1_uc003lnc.2_Intron|NR3C1_uc003lnd.2_Intron|NR3C1_uc003lne.2_Intron|NR3C1_uc003lnf.2_Intron	NM_000176	NP_000167			glucocorticoid receptor isoform alpha						chromatin modification|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus|transcription from RNA polymerase II promoter	mitochondrial matrix|nucleoplasm	glucocorticoid receptor activity|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Amcinonide(DB00288)|Betamethasone(DB00443)|Budesonide(DB01222)|Dexamethasone(DB01234)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluticasone Propionate(DB00588)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol Etabonate(DB00873)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Prednisone(DB00635)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	144495851	144495852	+	IGR	DEL	TG	-	-	rs143825728	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:144495851_144495852delTG								KCTD16 (638907 upstream) : PRELID2 (642730 downstream)																																			---	---	---	---
SH3TC2	79628	broad.mit.edu	37	5	148312736	148312736	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148312736delG	uc003lpp.1	-							NM_024577				SH3 domain and tetratricopeptide repeats 2								binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	149820635	149820636	+	IGR	INS	-	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149820635_149820636insG								CD74 (28303 upstream) : RPS14 (3158 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	157375101	157375101	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157375101delA								CLINT1 (88933 upstream) : EBF1 (747823 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	159307762	159307762	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159307762delT								LOC285627 (414478 upstream) : ADRA1B (35978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	160543296	160543297	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160543296_160543297insA								LOC285629 (177663 upstream) : GABRB2 (172139 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	165480745	165480745	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165480745delA								None (None upstream) : None (None downstream)																																			---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169206737	169206737	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169206737delA	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron	NM_004946	NP_004937			dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169361352	169361352	+	Intron	DEL	G	-	-	rs117432039	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169361352delG	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron|FAM196B_uc003mag.2_Intron	NM_004946	NP_004937			dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	171909052	171909054	+	IGR	DEL	ATC	-	-	rs143367541		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171909052_171909054delATC								SH3PXD2B (27525 upstream) : NEURL1B (159222 downstream)																																			---	---	---	---
ERGIC1	57222	broad.mit.edu	37	5	172312709	172312710	+	Intron	INS	-	CCTGCTGCCTCGCTA	CCTGCTGCCTCGCTA	rs149462374	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172312709_172312710insCCTGCTGCCTCGCTA	uc003mbw.3	+							NM_001031711	NP_001026881			endoplasmic reticulum-golgi intermediate						ER to Golgi vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	172765464	172765465	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172765464_172765465insA								STC2 (8958 upstream) : LOC285593 (241181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	177386067	177386082	+	IGR	DEL	AACGGGCTTTCCCTGG	-	-	rs67404368		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177386067_177386082delAACGGGCTTTCCCTGG								LOC728554 (74800 upstream) : PROP1 (33154 downstream)																																			---	---	---	---
AACSL	729522	broad.mit.edu	37	5	178217993	178217994	+	Intron	DEL	CA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178217993_178217994delCA	uc011dgl.1	-						AACSL_uc003mjk.2_Intron					Homo sapiens acetoacetyl-CoA synthetase-like, mRNA (cDNA clone IMAGE:3945810), partial cds.												0																		---	---	---	---
BTNL8	79908	broad.mit.edu	37	5	180368087	180368090	+	Intron	DEL	AGGG	-	-	rs144370596		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180368087_180368090delAGGG	uc003mmp.2	+						BTNL8_uc003mmq.2_Intron|BTNL8_uc011dhg.1_Intron|BTNL8_uc010jll.2_Intron|BTNL8_uc010jlm.2_Intron|BTNL8_uc011dhh.1_Intron	NM_001040462	NP_001035552			butyrophilin-like 8 isoform 2 precursor							integral to membrane				upper_aerodigestive_tract(1)|skin(1)	2	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	266020	266021	+	IGR	INS	-	TT	TT	rs71536967		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:266020_266021insTT								None (None upstream) : DUSP22 (26080 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	384955	384956	+	IGR	INS	-	CC	CC	rs149712824	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:384955_384956insCC								DUSP22 (33602 upstream) : IRF4 (6796 downstream)																																			---	---	---	---
EXOC2	55770	broad.mit.edu	37	6	597182	597182	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:597182delT	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773			Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	2366914	2366915	+	IGR	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2366914_2366915delAC								GMDS (121068 upstream) : C6orf195 (256057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	2584952	2584952	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2584952delT								GMDS (339106 upstream) : C6orf195 (38020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	4006469	4006470	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4006469_4006470insA								FAM50B (154919 upstream) : PRPF4B (15099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	7429393	7429393	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7429393delA								RIOK1 (11125 upstream) : DSP (112477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	8467697	8467698	+	Intron	INS	-	GTGGG	GTGGG	rs142595285	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8467697_8467698insGTGGG	uc003mye.2	+											Homo sapiens, clone IMAGE:5539086, mRNA.																														---	---	---	---
C6orf52	347744	broad.mit.edu	37	6	10680487	10680487	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10680487delA	uc011dij.1	-						C6orf52_uc011dik.1_Intron|C6orf52_uc003mzf.3_Intron|C6orf52_uc011dil.1_Intron	NM_001145020	NP_001138492			hypothetical protein LOC347744												0																		---	---	---	---
NEDD9	4739	broad.mit.edu	37	6	11244494	11244495	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11244494_11244495delAC	uc010joz.2	-						NEDD9_uc003mzw.3_Intron	NM_001142393	NP_001135865			neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)															---	---	---	---
DTNBP1	84062	broad.mit.edu	37	6	15545722	15545723	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15545722_15545723delAC	uc003nbm.2	-						DTNBP1_uc003nbl.2_Intron|DTNBP1_uc003nbn.2_Intron|DTNBP1_uc003nbo.2_Intron|DTNBP1_uc003nbp.2_Intron|DTNBP1_uc010jph.2_Intron	NM_032122	NP_115498			dystrobrevin binding protein 1 isoform a						actin cytoskeleton reorganization|cellular membrane organization|neuron projection morphogenesis|post-Golgi vesicle-mediated transport|regulation of dopamine receptor signaling pathway	axon part|BLOC-1 complex|cell junction|dendritic spine|endoplasmic reticulum membrane|endosome membrane|growth cone|melanosome membrane|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|synaptic vesicle membrane|synaptosome	identical protein binding				0	Breast(50;0.0289)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.211)											Hermansky-Pudlak_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	6	16970030	16970033	+	IGR	DEL	AGAA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16970030_16970033delAGAA								ATXN1 (208309 upstream) : RBM24 (311776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	19476295	19476295	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19476295delC								MIR548A1 (904184 upstream) : ID4 (361322 downstream)																																			---	---	---	---
FLJ22536	401237	broad.mit.edu	37	6	22031511	22031512	+	Intron	DEL	CA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22031511_22031512delCA	uc003ndj.2	+						FLJ22536_uc011djk.1_Intron|FLJ22536_uc003ndl.2_Intron	NR_015410				Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	23237694	23237695	+	IGR	INS	-	T	T	rs35702830		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23237694_23237695insT								HDGFL1 (666945 upstream) : NRSN1 (888719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	28860078	28860079	+	IGR	INS	-	AAGG	AAGG	rs147730516	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28860078_28860079insAAGG								SCAND3 (304966 upstream) : TRIM27 (10701 downstream)																																			---	---	---	---
HLA-B	3106	broad.mit.edu	37	6	31324247	31324248	+	Intron	INS	-	C	C	rs5875314		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31324247_31324248insC	uc003nth.2	-						HLA-C_uc003ntb.2_5'Flank|HLA-C_uc003ntc.1_5'Flank|HLA-B_uc010jsm.1_5'Flank|HLA-B_uc011dnk.1_5'Flank|HLA-B_uc003ntf.2_Intron|HLA-B_uc003ntg.1_5'UTR|HLA-B_uc003nti.1_5'Flank|HLA-B_uc010jsn.1_5'Flank|HLA-B_uc010jso.2_Intron	NM_005514	NP_005505			major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0														Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				---	---	---	---
LSM2	57819	broad.mit.edu	37	6	31767142	31767143	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31767142_31767143insT	uc003nxg.2	-							NM_021177	NP_067000			LSM2 homolog, U6 small nuclear RNA associated						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|cytosol|nucleoplasm	U6 snRNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	33918368	33918371	+	IGR	DEL	GTGT	-	-	rs147700351		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33918368_33918371delGTGT								MLN (146575 upstream) : MIR1275 (49378 downstream)																																			---	---	---	---
GRM4	2914	broad.mit.edu	37	6	34048843	34048843	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34048843delG	uc003oir.3	-						GRM4_uc011dsn.1_Intron|GRM4_uc010jvh.2_Intron|GRM4_uc010jvi.2_Intron|GRM4_uc011dsl.1_Intron|GRM4_uc003oiq.2_Intron|GRM4_uc011dsm.1_Intron	NM_000841	NP_000832			glutamate receptor, metabotropic 4 precursor						activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)													---	---	---	---
STK38	11329	broad.mit.edu	37	6	36505678	36505679	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36505678_36505679insA	uc003omg.2	-						STK38_uc003omh.2_Intron|STK38_uc003omi.2_Intron	NM_007271	NP_009202			serine/threonine kinase 38						intracellular protein kinase cascade|negative regulation of MAP kinase activity	cytoplasm|MLL5-L complex	ATP binding|magnesium ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	37073219	37073219	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37073219delT								FGD2 (76374 upstream) : PIM1 (64703 downstream)																																			---	---	---	---
MDGA1	266727	broad.mit.edu	37	6	37632759	37632760	+	Intron	INS	-	G	G	rs147774836	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37632759_37632760insG	uc003onu.1	-							NM_153487	NP_705691			MAM domain containing						brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane				central_nervous_system(2)	2																		---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38912745	38912750	+	Intron	DEL	TAACCC	-	-	rs113455471		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38912745_38912750delTAACCC	uc003ooe.1	+						DNAH8_uc003oog.1_Intron|uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	39011547	39011548	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39011547_39011548insA								DNAH8 (12980 upstream) : GLP1R (5009 downstream)																																			---	---	---	---
C6orf64	55776	broad.mit.edu	37	6	39085711	39085712	+	5'Flank	DEL	CT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39085711_39085712delCT	uc003ook.1	-						C6orf64_uc011dty.1_5'Flank|C6orf64_uc003oom.1_5'Flank	NM_018322	NP_060792			hypothetical protein LOC55776							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	39222255	39222255	+	IGR	DEL	A	-	-	rs35667128		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39222255delA								KCNK5 (25004 upstream) : KCNK17 (44523 downstream)																																			---	---	---	---
KIF6	221458	broad.mit.edu	37	6	39617498	39617501	+	Intron	DEL	AAAG	-	-	rs71543967		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39617498_39617501delAAAG	uc003oot.2	-						KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464			kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	39731187	39731187	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39731187delA								KIF6 (38006 upstream) : DAAM2 (28955 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	40076992	40076996	+	IGR	DEL	GGGCA	-	-	rs113147253		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40076992_40076996delGGGCA								MOCS1 (174738 upstream) : TDRG1 (269167 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	40125812	40125813	+	IGR	INS	-	C	C	rs138647279	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40125812_40125813insC								MOCS1 (223558 upstream) : TDRG1 (220350 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	40157737	40157738	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40157737_40157738insT								MOCS1 (255483 upstream) : TDRG1 (188425 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	40181375	40181375	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40181375delT								MOCS1 (279121 upstream) : TDRG1 (164788 downstream)																																			---	---	---	---
LRFN2	57497	broad.mit.edu	37	6	40429327	40429328	+	Intron	INS	-	A	A	rs34520776		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40429327_40429328insA	uc003oph.1	-							NM_020737	NP_065788			leucine rich repeat and fibronectin type III							cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)																	---	---	---	---
LRFN2	57497	broad.mit.edu	37	6	40550454	40550454	+	Intron	DEL	A	-	-	rs67578715		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40550454delA	uc003oph.1	-							NM_020737	NP_065788			leucine rich repeat and fibronectin type III							cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	40719294	40719294	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40719294delA								LRFN2 (164168 upstream) : UNC5CL (275478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	41445650	41445651	+	IGR	INS	-	G	G	rs140209060	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41445650_41445651insG								NCR2 (127025 upstream) : FOXP4 (68513 downstream)																																			---	---	---	---
USP49	25862	broad.mit.edu	37	6	41798578	41798578	+	Intron	DEL	T	-	-	rs11756454	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41798578delT	uc003ori.2	-							NM_018561	NP_061031			ubiquitin thioesterase 49						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
KIAA0240	23506	broad.mit.edu	37	6	42776718	42776718	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42776718delG	uc003osn.1	+						KIAA0240_uc003osm.1_Intron|KIAA0240_uc011duw.1_Intron	NM_015349	NP_056164			hypothetical protein LOC23506											ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)															---	---	---	---
CLIC5	53405	broad.mit.edu	37	6	46025812	46025813	+	Intron	INS	-	TG	TG	rs138296904	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46025812_46025813insTG	uc003oxv.3	-							NM_001114086	NP_001107558			chloride intracellular channel 5 isoform a						female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2																		---	---	---	---
CYP39A1	51302	broad.mit.edu	37	6	46618120	46618121	+	Intron	INS	-	T	T	rs137921148	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46618120_46618121insT	uc003oyf.1	-						CYP39A1_uc011dwa.1_Intron|CYP39A1_uc010jzd.1_Intron|SLC25A27_uc011dwb.1_5'Flank|SLC25A27_uc003oyg.2_5'Flank|SLC25A27_uc003oyh.2_5'Flank|SLC25A27_uc011dwc.1_5'Flank	NM_016593	NP_057677			cytochrome P450, family 39, subfamily A,						bile acid biosynthetic process|bile acid catabolic process|digestion|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1																		---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51854699	51854700	+	Intron	INS	-	AAAGA	AAAGA	rs144773405	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51854699_51854700insAAAGA	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639			fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
MCM3	4172	broad.mit.edu	37	6	52134301	52134305	+	Intron	DEL	AAGAG	-	-	rs17240161		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52134301_52134305delAAGAG	uc003pan.1	-						MCM3_uc011dwu.1_Intron	NM_002388	NP_002379			minichromosome maintenance complex component 3						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	alpha DNA polymerase:primase complex|centrosome|MCM complex|perinuclear region of cytoplasm	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)|lung(1)|skin(1)	3	Lung NSC(77;0.0931)																	---	---	---	---
LRRC1	55227	broad.mit.edu	37	6	53766346	53766346	+	Intron	DEL	A	-	-	rs34098229		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53766346delA	uc003pcd.1	+							NM_018214	NP_060684			leucine rich repeat containing 1							cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)														---	---	---	---
TINAG	27283	broad.mit.edu	37	6	54228991	54228991	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54228991delA	uc003pcj.2	+						TINAG_uc010jzt.2_Intron	NM_014464	NP_055279			tubulointerstitial nephritis antigen						cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	54390408	54390408	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54390408delA								TINAG (135458 upstream) : FAM83B (321161 downstream)																																			---	---	---	---
COL21A1	81578	broad.mit.edu	37	6	56137397	56137397	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56137397delT	uc003pcu.1	-							NM_030820	NP_110447			collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)															---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57284242	57284242	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57284242delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57301956	57301963	+	Intron	DEL	ACACTTAA	-	-	rs146504937		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57301956_57301963delACACTTAA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57361709	57361710	+	Intron	INS	-	G	G	rs149019154	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57361709_57361710insG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57391354	57391355	+	Intron	INS	-	T	T	rs5876592		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57391354_57391355insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57438823	57438823	+	Intron	DEL	G	-	-	rs145954948		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57438823delG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57511818	57511818	+	Intron	DEL	G	-	-	rs11310474		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57511818delG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57558300	57558301	+	IGR	DEL	AC	-	-	rs145307612		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57558300_57558301delAC								PRIM2 (44925 upstream) : GUSBL2 (687858 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	58632557	58632557	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58632557delG								GUSBL2 (344833 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	63800412	63800413	+	IGR	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63800412_63800413delAC								KHDRBS2 (804312 upstream) : LGSN (185444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	63976562	63976562	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63976562delT								KHDRBS2 (980462 upstream) : LGSN (9295 downstream)																																			---	---	---	---
EYS	346007	broad.mit.edu	37	6	65519998	65520000	+	Intron	DEL	ATC	-	-	rs141627161		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65519998_65520000delATC	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
KCNQ5	56479	broad.mit.edu	37	6	73806060	73806061	+	Intron	DEL	AA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73806060_73806061delAA	uc003pgk.2	+						KCNQ5_uc003pgj.3_Intron|KCNQ5_uc011dyh.1_Intron|KCNQ5_uc011dyi.1_Intron|KCNQ5_uc010kat.2_Intron|KCNQ5_uc011dyj.1_Intron|KCNQ5_uc011dyk.1_Intron	NM_019842	NP_062816			potassium voltage-gated channel, KQT-like						protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	77015527	77015527	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77015527delA								IMPG1 (233192 upstream) : None (None downstream)																																			---	---	---	---
SH3BGRL2	83699	broad.mit.edu	37	6	80391669	80391669	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80391669delA	uc003piz.1	+							NM_031469	NP_113657			SH3 domain binding glutamic acid-rich protein							nucleus	SH3 domain binding				0		all_cancers(76;0.00188)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.174)		BRCA - Breast invasive adenocarcinoma(397;0.0278)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	87776409	87776409	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87776409delT								HTR1E (50019 upstream) : CGA (18813 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	89938564	89938565	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89938564_89938565insA								GABRR1 (11068 upstream) : GABRR2 (28674 downstream)																																			---	---	---	---
MDN1	23195	broad.mit.edu	37	6	90453841	90453842	+	Intron	INS	-	AC	AC	rs2017994		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90453841_90453842insAC	uc003pnn.1	-							NM_014611	NP_055426			MDN1, midasin homolog						protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	92938004	92938005	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92938004_92938005insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	93109346	93109347	+	IGR	INS	-	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93109346_93109347insC								None (None upstream) : EPHA7 (840395 downstream)																																			---	---	---	---
MICAL1	64780	broad.mit.edu	37	6	109769300	109769301	+	Intron	INS	-	AC	AC			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109769300_109769301insAC	uc003ptj.2	-						MICAL1_uc003ptk.2_Intron|MICAL1_uc010kdr.2_Intron|MICAL1_uc011eaq.1_Intron	NM_022765	NP_073602			microtubule associated monoxygenase, calponin						cytoskeleton organization|signal transduction	cytoplasm|intermediate filament	SH3 domain binding|zinc ion binding			breast(2)|ovary(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	112275456	112275456	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112275456delA								FYN (80829 upstream) : WISP3 (99822 downstream)																																			---	---	---	---
HS3ST5	222537	broad.mit.edu	37	6	114413648	114413649	+	Intron	DEL	TA	-	-	rs138229614		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114413648_114413649delTA	uc003pwh.3	-						uc003pwf.2_Intron	NM_153612	NP_705840			heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)														---	---	---	---
C6orf204	387119	broad.mit.edu	37	6	118947088	118947089	+	Intron	INS	-	C	C	rs141855905	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118947088_118947089insC	uc003pxz.1	-						C6orf204_uc003pya.1_Intron|C6orf204_uc003pyb.2_Intron|C6orf204_uc011ebj.1_Intron|C6orf204_uc003pyc.2_Intron|C6orf204_uc011ebl.1_Intron	NM_001042475	NP_001035940			chromosome 6 open reading frame 204 isoform a							centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)														---	---	---	---
MAN1A1	4121	broad.mit.edu	37	6	119641145	119641145	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119641145delT	uc003pym.1	-						MAN1A1_uc010kei.1_Intron	NM_005907	NP_005898			mannosidase, alpha, class 1A, member 1						post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum|ER-Golgi intermediate compartment|Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	121914388	121914388	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121914388delA								GJA1 (143516 upstream) : HSF2 (806308 downstream)																																			---	---	---	---
PKIB	5570	broad.mit.edu	37	6	122794123	122794123	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122794123delG	uc003pyz.2	+						SERINC1_uc003pyy.1_5'Flank	NM_181794	NP_861459			cAMP-dependent protein kinase inhibitor beta								cAMP-dependent protein kinase inhibitor activity				0				GBM - Glioblastoma multiforme(226;0.164)														---	---	---	---
THEMIS	387357	broad.mit.edu	37	6	128043722	128043722	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128043722delC	uc003qbi.2	-						THEMIS_uc010kfa.2_Intron|THEMIS_uc011ebt.1_Intron|THEMIS_uc010kfb.2_Intron	NM_001010923	NP_001010923			thymocyte selection pathway associated isoform						negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4																		---	---	---	---
PTPRK	5796	broad.mit.edu	37	6	128586032	128586032	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128586032delG	uc003qbk.2	-						PTPRK_uc003qbj.2_Intron|PTPRK_uc010kfc.2_Intron|PTPRK_uc011ebu.1_Intron|PTPRK_uc003qbl.1_Intron|PTPRK_uc011ebv.1_Intron	NM_002844	NP_002835			protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	131777468	131777468	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131777468delT								AKAP7 (172795 upstream) : ARG1 (116897 downstream)																																			---	---	---	---
EYA4	2070	broad.mit.edu	37	6	133836761	133836762	+	Intron	DEL	GT	-	-	rs145450874		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133836761_133836762delGT	uc003qec.3	+						EYA4_uc011ecq.1_Intron|EYA4_uc011ecr.1_Intron|EYA4_uc003qed.3_Intron|EYA4_uc003qee.3_Intron|EYA4_uc011ecs.1_Intron|uc003qeg.1_Intron	NM_004100	NP_004091			eyes absent 4 isoform a						anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)														---	---	---	---
SGK1	6446	broad.mit.edu	37	6	134507948	134507948	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134507948delG	uc003qeo.3	-							NM_001143676	NP_001137148			serum/glucocorticoid regulated kinase 1 isoform						apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)														---	---	---	---
SGK1	6446	broad.mit.edu	37	6	134509878	134509879	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134509878_134509879insT	uc003qeo.3	-							NM_001143676	NP_001137148			serum/glucocorticoid regulated kinase 1 isoform						apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)														---	---	---	---
PEX7	5191	broad.mit.edu	37	6	137227637	137227638	+	Intron	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137227637_137227638delTG	uc003qhd.2	+						PEX7_uc010kgx.2_Intron	NM_000288	NP_000279			peroxisomal biogenesis factor 7						ether lipid biosynthetic process|protein import into peroxisome matrix	peroxisome	peroxisome matrix targeting signal-2 binding				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	140921663	140921664	+	IGR	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140921663_140921664delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	140955635	140955635	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140955635delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	145636093	145636094	+	IGR	INS	-	AA	AA	rs141575430	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145636093_145636094insAA								UTRN (461925 upstream) : EPM2A (310352 downstream)																																			---	---	---	---
AKAP12	9590	broad.mit.edu	37	6	151569403	151569403	+	Intron	DEL	T	-	-	rs72259973		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151569403delT	uc011eep.1	+						AKAP12_uc003qoe.2_Intron	NM_005100	NP_005091			A kinase (PRKA) anchor protein 12 isoform 1						G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding			large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)														---	---	---	---
ARID1B	57492	broad.mit.edu	37	6	157180664	157180665	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157180664_157180665insA	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron	NM_017519	NP_059989			AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	158142688	158142689	+	IGR	INS	-	T	T	rs150433453	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158142688_158142689insT								ZDHHC14 (47712 upstream) : SNX9 (101605 downstream)																																			---	---	---	---
TMEM181	57583	broad.mit.edu	37	6	158987577	158987577	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158987577delG	uc003qrm.3	+						TMEM181_uc010kjr.1_Intron	NM_020823	NP_065874			G protein-coupled receptor 178						pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)														---	---	---	---
QKI	9444	broad.mit.edu	37	6	163901292	163901293	+	Intron	DEL	TC	-	-	rs138903989		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163901292_163901293delTC	uc003qui.2	+						QKI_uc003que.2_Intron|QKI_uc003quf.2_Intron|QKI_uc003qug.2_Intron|QKI_uc003quh.2_Intron|QKI_uc003quj.2_Intron	NM_006775	NP_006766			quaking homolog, KH domain RNA binding isoform						mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)														---	---	---	---
TTLL2	83887	broad.mit.edu	37	6	167744888	167744888	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167744888delT	uc003qvs.1	+						TTLL2_uc011egr.1_Intron	NM_031949	NP_114155			tubulin tyrosine ligase-like family, member 2						protein modification process		ATP binding|tubulin-tyrosine ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	168148788	168148788	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168148788delT								TCP10 (350790 upstream) : C6orf123 (36433 downstream)																																			---	---	---	---
MLLT4	4301	broad.mit.edu	37	6	168319289	168319290	+	Intron	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168319289_168319290delTG	uc003qwd.2	+						MLLT4_uc003qwb.1_Intron|MLLT4_uc003qwc.1_Intron|MLLT4_uc003qwg.1_Intron	NM_001040001	NP_001035090			myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)				T	MLL	AL								---	---	---	---
Unknown	0	broad.mit.edu	37	7	390184	390186	+	IGR	DEL	ACA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:390184_390186delACA								FAM20C (89473 upstream) : PDGFA (146713 downstream)																																			---	---	---	---
MAD1L1	8379	broad.mit.edu	37	7	1870712	1870713	+	Intron	DEL	CT	-	-	rs76390129		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1870712_1870713delCT	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc003sld.1_Intron	NM_001013836	NP_001013858			MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	2667209	2667210	+	IGR	INS	-	A	A	rs148018760	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2667209_2667210insA								IQCE (12842 upstream) : TTYH3 (4393 downstream)																																			---	---	---	---
CARD11	84433	broad.mit.edu	37	7	2952354	2952357	+	Intron	DEL	ATCC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2952354_2952357delATCC	uc003smv.2	-							NM_032415	NP_115791			caspase recruitment domain family, member 11						positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)				Mis		DLBCL								---	---	---	---
Unknown	0	broad.mit.edu	37	7	4530595	4530595	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4530595delG								SDK1 (221966 upstream) : FOXK1 (152793 downstream)																																			---	---	---	---
RNF216	54476	broad.mit.edu	37	7	5735762	5735762	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5735762delG	uc003soy.1	-						RNF216_uc010ksz.1_Intron|RNF216_uc010kta.1_Intron|RNF216_uc011jwj.1_Intron|RNF216_uc003sox.1_Intron	NM_207116	NP_996999			ring finger protein 216 isoform b						apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)														---	---	---	---
C1GALT1	56913	broad.mit.edu	37	7	7227640	7227641	+	Intron	INS	-	AG	AG	rs144104396	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7227640_7227641insAG	uc010ktn.2	+						C1GALT1_uc010ktm.1_Intron	NM_020156	NP_064541			core 1 synthase,						angiogenesis|cell differentiation|kidney development	integral to membrane	glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase activity|metal ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)														---	---	---	---
NXPH1	30010	broad.mit.edu	37	7	8639559	8639559	+	Intron	DEL	A	-	-	rs112912217		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8639559delA	uc003srv.2	+						NXPH1_uc011jxh.1_Intron	NM_152745	NP_689958			neurexophilin 1 precursor							extracellular region				ovary(1)|central_nervous_system(1)	2		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	13156658	13156658	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13156658delG								ARL4A (426102 upstream) : ETV1 (774200 downstream)																																			---	---	---	---
DGKB	1607	broad.mit.edu	37	7	14533550	14533551	+	Intron	INS	-	AC	AC			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14533550_14533551insAC	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071			diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	20995436	20995439	+	IGR	DEL	ATCC	-	-	rs141173118		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20995436_20995439delATCC								RPL23P8 (127997 upstream) : SP4 (472250 downstream)																																			---	---	---	---
CDCA7L	55536	broad.mit.edu	37	7	21949708	21949709	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21949708_21949709insA	uc010kuk.2	-						CDCA7L_uc003sve.3_Intron|CDCA7L_uc010kul.2_Intron|CDCA7L_uc003svf.3_Intron|CDCA7L_uc011jyk.1_Intron	NM_018719	NP_061189			cell division cycle associated 7-like isoform 1						positive regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	22445556	22445562	+	IGR	DEL	TTGTTGT	-	-	rs77683676		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22445556_22445562delTTGTTGT								RAPGEF5 (49023 upstream) : MGC87042 (13504 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	23531320	23531321	+	IGR	INS	-	TCC	TCC	rs139298885	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23531320_23531321insTCC								RPS2P32 (291 upstream) : TRA2A (13081 downstream)																																			---	---	---	---
CREB5	9586	broad.mit.edu	37	7	28855673	28855674	+	Intron	DEL	CA	-	-	rs66949642		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28855673_28855674delCA	uc003szq.2	+						CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Intron|CREB5_uc003szs.2_Intron	NM_182898	NP_878901			cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	29763483	29763484	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29763483_29763484delAC	uc003tai.2	+											Homo sapiens DPY-19-like 2 pseudogene 3 (DPY19L2P3) pseudogene mRNA, complete sequence.																														---	---	---	---
SCRN1	9805	broad.mit.edu	37	7	29976507	29976507	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29976507delA	uc010kvp.2	-						SCRN1_uc011jzy.1_Intron|SCRN1_uc003tak.2_Intron|SCRN1_uc011jzz.1_Intron|SCRN1_uc011kaa.1_Intron|SCRN1_uc011jzw.1_Intron|SCRN1_uc011jzx.1_Intron	NM_001145515	NP_001138987			secernin 1 isoform c						exocytosis|proteolysis	cytoplasm|nuclear membrane	dipeptidase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	30426940	30426941	+	IGR	INS	-	ACTT	ACTT	rs139343122	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30426940_30426941insACTT								DKFZP586I1420 (14532 upstream) : NOD1 (37203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	33716875	33716877	+	IGR	DEL	GTT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33716875_33716877delGTT								BBS9 (71195 upstream) : BMPER (228235 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	34218827	34218827	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34218827delT								BMPER (24716 upstream) : AAA1 (171208 downstream)																																			---	---	---	---
TARP	445347	broad.mit.edu	37	7	38316140	38316140	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38316140delA	uc003tge.1	-						uc003tfz.1_Intron|TARP_uc003tgb.2_5'Flank|TARP_uc003tgc.1_5'Flank|TARP_uc003tgd.1_5'Flank|TARP_uc010kxi.1_Intron|TARP_uc003tgf.1_Intron|TARP_uc003tgj.1_Intron|TARP_uc003tgh.1_Intron|TARP_uc003tgi.1_Intron|TARP_uc003tgg.1_Intron					Homo sapiens TCRgamma alternate reading frame protein (TCRg) mRNA, complete cds.												0																		---	---	---	---
AMPH	273	broad.mit.edu	37	7	38545298	38545298	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38545298delA	uc003tgu.2	-						AMPH_uc003tgv.2_Intron	NM_001635	NP_001626			amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5																		---	---	---	---
CDK13	8621	broad.mit.edu	37	7	39993523	39993523	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39993523delA	uc003thh.3	+						CDK13_uc003thi.3_Intron	NM_003718	NP_003709			cell division cycle 2-like 5 isoform 1						alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5																		---	---	---	---
C7orf10	79783	broad.mit.edu	37	7	40417817	40417819	+	Intron	DEL	CTC	-	-	rs75017441		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40417817_40417819delCTC	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004			dermal papilla derived protein 13								transferase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	42818751	42818752	+	IGR	INS	-	T	T	rs149043695	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42818751_42818752insT								GLI3 (542133 upstream) : C7orf25 (130122 downstream)																																			---	---	---	---
C7orf44	55744	broad.mit.edu	37	7	43749034	43749035	+	Intron	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43749034_43749035delTG	uc003tin.1	-						C7orf44_uc003til.2_Intron|C7orf44_uc003tii.2_Intron|C7orf44_uc003tij.2_Intron|C7orf44_uc010kxu.1_Intron|C7orf44_uc003tik.2_Intron|C7orf44_uc003tim.1_Intron|C7orf44_uc003tio.1_Intron|C7orf44_uc003tiq.1_Intron|C7orf44_uc003tip.1_Intron	NM_018224	NP_060694			hypothetical protein LOC55744							integral to membrane				ovary(1)	1																		---	---	---	---
BLVRA	644	broad.mit.edu	37	7	43827988	43827988	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43827988delT	uc003tir.2	+						BLVRA_uc010kxv.2_Intron	NM_000712	NP_000703			biliverdin reductase A precursor						heme catabolic process	cytosol	biliverdin reductase activity|zinc ion binding			ovary(1)	1					NADH(DB00157)													---	---	---	---
BLVRA	644	broad.mit.edu	37	7	43833398	43833398	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43833398delT	uc003tir.2	+						BLVRA_uc010kxv.2_Intron	NM_000712	NP_000703			biliverdin reductase A precursor						heme catabolic process	cytosol	biliverdin reductase activity|zinc ion binding			ovary(1)	1					NADH(DB00157)													---	---	---	---
GCK	2645	broad.mit.edu	37	7	44202951	44202952	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44202951_44202952insT	uc003tkl.2	-							NM_000162	NP_000153			glucokinase isoform 1						cellular response to insulin stimulus|cellular response to leptin stimulus|detection of glucose|endocrine pancreas development|glucose homeostasis|glucose transport|glycolysis|negative regulation of gluconeogenesis|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|regulation of glucose transport|regulation of glycolysis|transmembrane transport	cytosol|nucleoplasm	ATP binding|glucokinase activity|glucose binding|protein binding			skin(3)|lung(1)	4																		---	---	---	---
ABCA13	154664	broad.mit.edu	37	7	48623670	48623670	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48623670delA	uc003toq.2	+						ABCA13_uc010kys.1_Intron|ABCA13_uc010kyt.1_Intron|ABCA13_uc010kyu.1_Intron	NM_152701	NP_689914			ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	51985827	51985828	+	IGR	DEL	AA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51985827_51985828delAA								COBL (601312 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52670606	52670606	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52670606delT								None (None upstream) : POM121L12 (432743 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53685761	53685762	+	IGR	DEL	AA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53685761_53685762delAA								POM121L12 (581144 upstream) : HPVC1 (583155 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56905859	56905862	+	IGR	DEL	TTCT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56905859_56905862delTTCT								DKFZp434L192 (340882 upstream) : ZNF479 (281466 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57701099	57701099	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57701099delT								ZNF716 (167834 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57988127	57988127	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57988127delA								ZNF716 (454862 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57988163	57988163	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57988163delT								ZNF716 (454898 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57990616	57990617	+	IGR	DEL	CT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57990616_57990617delCT								ZNF716 (457351 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61077837	61077838	+	IGR	INS	-	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61077837_61077838insC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63033167	63033168	+	IGR	INS	-	GAG	GAG	rs141286287	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63033167_63033168insGAG								LOC100287704 (221016 upstream) : ZNF727 (472653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63299100	63299105	+	IGR	DEL	AAAAAC	-	-	rs78342807		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63299100_63299105delAAAAAC								LOC100287704 (486949 upstream) : ZNF727 (206716 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63550212	63550212	+	IGR	DEL	A	-	-	rs112069555		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63550212delA								ZNF727 (11287 upstream) : ZNF735 (117369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63797572	63797573	+	Intron	INS	-	TGTGTGTGT	TGTGTGTGT	rs143451018	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63797572_63797573insTGTGTGTGT	uc011kdo.1	+											SubName: Full=cDNA FLJ57041, moderately similar to Zinc finger protein 92;																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	64944365	64944365	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64944365delC								ZNF92 (78368 upstream) : INTS4L2 (168412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65319148	65319149	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65319148_65319149insT								CCT6P1 (90487 upstream) : VKORC1L1 (19108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65975662	65975662	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65975662delT								NCRNA00174 (110267 upstream) : LOC493754 (17784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	66075787	66075788	+	IGR	INS	-	AA	AA	rs142652855	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66075787_66075788insAA								LOC493754 (18424 upstream) : RABGEF1 (18102 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67726275	67726276	+	IGR	DEL	AG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67726275_67726276delAG								STAG3L4 (939763 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68958966	68958966	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68958966delA								None (None upstream) : AUTS2 (104939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	70578861	70578862	+	IGR	INS	-	A	A	rs144460785		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70578861_70578862insA								AUTS2 (320977 upstream) : WBSCR17 (18927 downstream)																																			---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73553800	73553800	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73553800delA	uc011kfa.1	-							NM_181471				replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
SPDYE8P	389517	broad.mit.edu	37	7	74970249	74970249	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74970249delA	uc010lcv.2	+						PMS2L2_uc011kfp.1_Intron|PMS2L2_uc011kfq.1_Intron|PMS2L2_uc003uch.1_Intron|SPDYE8P_uc011kfs.1_Intron|PMS2L2_uc003uco.1_Intron|PMS2L2_uc003ucq.2_Intron					RecName: Full=Putative WBSCR19-like protein 4;												0																		---	---	---	---
HIP1	3092	broad.mit.edu	37	7	75243711	75243712	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75243711_75243712delAC	uc003uds.1	-							NM_005338	NP_005329			huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8								T	PDGFRB	CMML								---	---	---	---
Unknown	0	broad.mit.edu	37	7	77641071	77641071	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77641071delG								PHTF2 (54253 upstream) : MAGI2 (5304 downstream)																																			---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	77712322	77712323	+	Intron	INS	-	A	A	rs147300404	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77712322_77712323insA	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc010ldx.1_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	84178245	84178245	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84178245delA	uc003uia.1	+											Homo sapiens mRNA; cDNA DKFZp686F03118 (from clone DKFZp686F03118).																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	88250507	88250508	+	IGR	DEL	CA	-	-	rs72017250		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88250507_88250508delCA								STEAP4 (314298 upstream) : ZNF804B (138245 downstream)																																			---	---	---	---
CCDC132	55610	broad.mit.edu	37	7	92911222	92911222	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92911222delA	uc003umo.2	+						CCDC132_uc003umq.2_Intron|CCDC132_uc003ump.2_Intron|CCDC132_uc003umr.2_Intron|CCDC132_uc011khz.1_Intron	NM_017667	NP_060137			coiled-coil domain containing 132 isoform a												0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	93976016	93976018	+	IGR	DEL	GGA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93976016_93976018delGGA								BET1 (342326 upstream) : COL1A2 (47855 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	97638429	97638430	+	IGR	INS	-	TT	TT	rs77065946		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97638429_97638430insTT								OCM2 (19013 upstream) : LMTK2 (97767 downstream)																																			---	---	---	---
TRRAP	8295	broad.mit.edu	37	7	98618827	98618827	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98618827delA	uc003ups.2	+											Homo sapiens TRRAP protein (TRRAP) mRNA, complete cds.						histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	100111302	100111302	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100111302delA								C7orf51 (18880 upstream) : AGFG2 (25532 downstream)																																			---	---	---	---
AP1S1	1174	broad.mit.edu	37	7	100803265	100803266	+	Intron	INS	-	CA	CA	rs78558757	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100803265_100803266insCA	uc003uxv.3	+							NM_001283	NP_001274			adaptor-related protein complex 1, sigma 1						intracellular protein transport|post-Golgi vesicle-mediated transport|receptor-mediated endocytosis|regulation of defense response to virus by virus|response to virus|viral reproduction	AP-1 adaptor complex|coated pit|cytosol|lysosomal membrane	protein binding|protein transporter activity				0	Lung NSC(181;0.168)|all_lung(186;0.215)																	---	---	---	---
SH2B2	10603	broad.mit.edu	37	7	101927787	101927787	+	5'Flank	DEL	A	-	-	rs141645721		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101927787delA	uc011kko.1	+							NM_020979	NP_066189			SH2B adaptor protein 2						blood coagulation|insulin receptor signaling pathway|intracellular signal transduction	cytosol|plasma membrane	JAK pathway signal transduction adaptor activity|SH3/SH2 adaptor activity|signal transducer activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	103680800	103680800	+	IGR	DEL	G	-	-	rs76891098		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103680800delG								RELN (50837 upstream) : ORC5L (85990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	103962766	103962766	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103962766delA								ORC5L (114303 upstream) : LHFPL3 (6338 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	106552479	106552480	+	IGR	INS	-	A	A	rs75868597		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106552479_106552480insA								PIK3CG (4894 upstream) : PRKAR2B (132698 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	108518909	108518909	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108518909delA								DNAJB9 (303617 upstream) : C7orf66 (5131 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	128069928	128069928	+	IGR	DEL	G	-	-	rs144909351		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128069928delG								IMPDH1 (19892 upstream) : C7orf68 (25956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	131644384	131644387	+	IGR	DEL	AAGG	-	-	rs72124207		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131644384_131644387delAAGG								PODXL (403008 upstream) : PLXNA4 (163705 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	132370321	132370322	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132370321_132370322insA	uc003vrd.1	+											Homo sapiens cDNA FLJ40288 fis, clone TESTI2028098.																														---	---	---	---
CHCHD3	54927	broad.mit.edu	37	7	132645003	132645003	+	Intron	DEL	A	-	-	rs75450739		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132645003delA	uc003vre.2	-						CHCHD3_uc010lmi.2_Intron|CHCHD3_uc003vrf.2_Intron|CHCHD3_uc010lmj.2_Intron	NM_017812	NP_060282			coiled-coil-helix-coiled-coil-helix domain						inner mitochondrial membrane organization|mitochondrial fusion	mitochondrial inner membrane	protein complex scaffold				0																		---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133088665	133088666	+	Intron	DEL	CT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133088665_133088666delCT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vri.2_Intron|EXOC4_uc003vrj.2_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133135976	133135976	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133135976delT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vri.2_Intron|EXOC4_uc003vrj.2_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	136060342	136060343	+	IGR	INS	-	A	A	rs146898619	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136060342_136060343insA								LUZP6 (398138 upstream) : CHRM2 (493056 downstream)																																			---	---	---	---
DGKI	9162	broad.mit.edu	37	7	137407875	137407877	+	Intron	DEL	ATG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137407875_137407877delATG	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708			diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	139997651	139997654	+	IGR	DEL	TTTA	-	-	rs111962542		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139997651_139997654delTTTA								LOC100134229 (118212 upstream) : SLC37A3 (35900 downstream)																																			---	---	---	---
TPK1	27010	broad.mit.edu	37	7	144219346	144219347	+	Intron	DEL	TT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144219346_144219347delTT	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890			thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	144808135	144808135	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144808135delT								TPK1 (274989 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	152386426	152386427	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152386426_152386427insA								XRCC2 (13176 upstream) : ACTR3B (70424 downstream)																																			---	---	---	---
ACTR3B	57180	broad.mit.edu	37	7	152506635	152506636	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152506635_152506636insT	uc003wle.1	+						ACTR3B_uc003wlf.1_Intron|ACTR3B_uc003wlg.1_Intron|ACTR3B_uc011kvp.1_Intron	NM_020445	NP_065178			actin-related protein 3-beta isoform 1						regulation of actin filament polymerization	cell projection|cytoplasm|cytoskeleton	actin binding|ATP binding				0		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	155127463	155127478	+	IGR	DEL	CTCAGTCCTCATTGAT	-	-	rs112043650		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155127463_155127478delCTCAGTCCTCATTGAT								INSIG1 (25521 upstream) : EN2 (123346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155584765	155584765	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155584765delC								RBM33 (10586 upstream) : SHH (7971 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155727737	155727738	+	IGR	INS	-	TCA	TCA	rs147255185		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155727737_155727738insTCA								SHH (122770 upstream) : C7orf4 (605447 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	156097459	156097460	+	IGR	DEL	CA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156097459_156097460delCA								SHH (492492 upstream) : C7orf4 (235725 downstream)																																			---	---	---	---
UBE3C	9690	broad.mit.edu	37	7	156959631	156959632	+	Intron	INS	-	GGG	GGG			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156959631_156959632insGGG	uc010lqs.2	+						UBE3C_uc003wnf.2_Intron|UBE3C_uc003wng.2_Intron	NM_014671	NP_055486			ubiquitin protein ligase E3C						protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	157232379	157232380	+	IGR	INS	-	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157232379_157232380insG								DNAJB6 (22247 upstream) : PTPRN2 (99371 downstream)																																			---	---	---	---
NCAPG2	54892	broad.mit.edu	37	7	158460127	158460128	+	Intron	INS	-	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158460127_158460128insC	uc003wnv.1	-						NCAPG2_uc010lqu.1_Intron|NCAPG2_uc003wnw.1_Intron|NCAPG2_uc003wnx.1_Intron|NCAPG2_uc011kwe.1_Intron|NCAPG2_uc011kwc.1_5'Flank|NCAPG2_uc011kwd.1_5'Flank	NM_017760	NP_060230			leucine zipper protein 5						cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)														---	---	---	---
DLGAP2	9228	broad.mit.edu	37	8	1537166	1537166	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1537166delA	uc003wpl.2	+						DLGAP2_uc003wpm.2_Intron	NM_004745	NP_004736			discs large-associated protein 2						neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	2171125	2171125	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2171125delG								MYOM2 (77746 upstream) : CSMD1 (621751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2306335	2306336	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2306335_2306336insT								MYOM2 (212956 upstream) : CSMD1 (486540 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9043355	9043355	+	IGR	DEL	T	-	-	rs10088196	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9043355delT								PPP1R3B (34271 upstream) : TNKS (370090 downstream)																																			---	---	---	---
SOX7	83595	broad.mit.edu	37	8	10624919	10624919	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10624919delA	uc011kwz.1	-						PINX1_uc003wth.2_Intron|PINX1_uc003wti.2_Intron	NM_031439	NP_113627			SRY-box 7						endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding			breast(1)	1				COAD - Colon adenocarcinoma(149;0.0732)														---	---	---	---
PSD3	23362	broad.mit.edu	37	8	18698977	18698978	+	Intron	INS	-	AC	AC	rs139457887	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18698977_18698978insAC	uc003wza.2	-							NM_015310	NP_056125			ADP-ribosylation factor guanine nucleotide						regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)														---	---	---	---
LOXL2	4017	broad.mit.edu	37	8	23256803	23256804	+	Intron	INS	-	C	C	rs144204307	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23256803_23256804insC	uc003xdh.1	-						ENTPD4_uc011kzu.1_Intron	NM_002318	NP_002309			lysyl oxidase-like 2 precursor						aging|cell adhesion|protein modification process	extracellular space|membrane	copper ion binding|electron carrier activity|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor|scavenger receptor activity			breast(2)|ovary(1)	3		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)														---	---	---	---
STC1	6781	broad.mit.edu	37	8	23707993	23707994	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23707993_23707994insT	uc003xdw.1	-							NM_003155	NP_003146			stanniocalcin 1 precursor						cell surface receptor linked signaling pathway|cell-cell signaling|cellular calcium ion homeostasis		hormone activity			skin(3)|upper_aerodigestive_tract(1)	4		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)														---	---	---	---
PTK2B	2185	broad.mit.edu	37	8	27301282	27301282	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27301282delA	uc003xfn.1	+						PTK2B_uc003xfo.1_Intron|PTK2B_uc003xfp.1_Intron|PTK2B_uc003xfq.1_Intron|PTK2B_uc003xfr.1_Intron	NM_173174	NP_775266			PTK2B protein tyrosine kinase 2 beta isoform a						apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)														---	---	---	---
ADAM9	8754	broad.mit.edu	37	8	38902965	38902966	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38902965_38902966delAC	uc003xmr.2	+						ADAM9_uc011lcf.1_Intron|ADAM9_uc011lcg.1_Intron|ADAM9_uc010lwr.2_Intron	NM_003816	NP_003807			ADAM metallopeptidase domain 9 isoform 1						activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)															---	---	---	---
ANK1	286	broad.mit.edu	37	8	41703232	41703232	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41703232delC	uc003xom.2	-							NM_001142446	NP_001135918			ankyrin 1 isoform 9						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	43061389	43061390	+	IGR	DEL	CA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43061389_43061390delCA								HGSNAT (3420 upstream) : POTEA (86195 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	47037395	47037396	+	IGR	INS	-	A	A	rs112829307		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47037395_47037396insA								None (None upstream) : BEYLA (715112 downstream)																																			---	---	---	---
PRKDC	5591	broad.mit.edu	37	8	48758993	48758993	+	Intron	DEL	G	-	-	rs10046747		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48758993delG	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835			protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)											NHEJ					---	---	---	---
Unknown	0	broad.mit.edu	37	8	54075351	54075352	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54075351_54075352insA								NPBWR1 (221898 upstream) : OPRK1 (62924 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	54086517	54086517	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54086517delA								NPBWR1 (233064 upstream) : OPRK1 (51759 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	58660908	58660909	+	RNA	DEL	AC	-	-	rs112241056		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58660908_58660909delAC	uc003xti.1	+	2		c.611_612delAC								Homo sapiens cDNA FLJ33422 fis, clone BRACE2020097.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	64256168	64256168	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64256168delA								YTHDF3 (130823 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	64617767	64617768	+	IGR	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64617767_64617768delGT								YTHDF3 (492422 upstream) : MIR124-2 (673938 downstream)																																			---	---	---	---
CYP7B1	9420	broad.mit.edu	37	8	65546975	65546975	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65546975delA	uc003xvj.2	-							NM_004820	NP_004811			cytochrome P450, family 7, subfamily B,						bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	65723939	65723939	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65723939delT								CYP7B1 (12591 upstream) : ARMC1 (791133 downstream)																																			---	---	---	---
MYBL1	4603	broad.mit.edu	37	8	67519366	67519367	+	Intron	INS	-	C	C	rs7013391		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67519366_67519367insC	uc003xwj.2	-						MYBL1_uc003xwl.2_Intron|MYBL1_uc003xwk.2_Intron	NM_001080416	NP_001073885			v-myb myeloblastosis viral oncogene homolog						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)	3			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)															---	---	---	---
COPS5	10987	broad.mit.edu	37	8	67962849	67962850	+	Intron	INS	-	GT	GT	rs149857869	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67962849_67962850insGT	uc003xxe.2	-						COPS5_uc003xxd.2_Intron|COPS5_uc003xxf.2_Intron|COPS5_uc010lyu.1_Intron	NM_006837	NP_006828			COP9 signalosome subunit 5						cullin deneddylation|transcription from RNA polymerase II promoter	eukaryotic translation initiation factor 3 complex|signalosome	metal ion binding|metallopeptidase activity|protein binding|transcription coactivator activity|translation initiation factor activity			ovary(1)|skin(1)	2	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	70184588	70184588	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70184588delT								C8orf34 (453332 upstream) : SULF1 (194271 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	70300460	70300463	+	IGR	DEL	GAGT	-	-	rs72406215		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70300460_70300463delGAGT								C8orf34 (569204 upstream) : SULF1 (78396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	70804367	70804367	+	IGR	DEL	A	-	-	rs142250291		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70804367delA								SLCO5A1 (57068 upstream) : PRDM14 (159658 downstream)																																			---	---	---	---
STAU2	27067	broad.mit.edu	37	8	74344280	74344280	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74344280delC	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron|uc003xzl.2_Intron	NM_014393	NP_055208			staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	75113480	75113481	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75113480_75113481insT								LY96 (172175 upstream) : JPH1 (33460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78924702	78924705	+	IGR	DEL	CTTC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78924702_78924705delCTTC								None (None upstream) : PKIA (503631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81266490	81266491	+	IGR	INS	-	AAAC	AAAC	rs140547416	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81266490_81266491insAAAC								TPD52 (182654 upstream) : ZBTB10 (131363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84170278	84170279	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84170278_84170279insT								None (None upstream) : RALYL (925174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84547374	84547374	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84547374delA								None (None upstream) : RALYL (548079 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	90337653	90337653	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90337653delA								MMP16 (997936 upstream) : RIPK2 (432322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	94904048	94904048	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94904048delT								TMEM67 (73702 upstream) : PDP1 (25035 downstream)																																			---	---	---	---
RAD54B	25788	broad.mit.edu	37	8	95398813	95398824	+	Intron	DEL	TGTGTGTGTGCA	-	-	rs36233795	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95398813_95398824delTGTGTGTGTGCA	uc003ygk.2	-						RAD54B_uc010may.1_Intron	NM_012415	NP_036547			RAD54 homolog B						double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)										Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
C8orf38	137682	broad.mit.edu	37	8	96076927	96076932	+	Intron	DEL	CACCTG	-	-	rs71569106		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96076927_96076932delCACCTG	uc011lgs.1	+											Homo sapiens cDNA FLJ57417 complete cds.						biosynthetic process	mitochondrion	transferase activity				0	Breast(36;3.32e-06)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	96320229	96320230	+	IGR	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96320229_96320230delTG								C8orf37 (38792 upstream) : GDF6 (834330 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	96466412	96466412	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96466412delT								C8orf37 (184975 upstream) : GDF6 (688148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	100928102	100928102	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100928102delT								COX6C (22207 upstream) : RGS22 (45174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	101696175	101696176	+	IGR	DEL	TC	-	-	rs144586062		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101696175_101696176delTC								SNX31 (34282 upstream) : PABPC1 (18968 downstream)																																			---	---	---	---
NCALD	83988	broad.mit.edu	37	8	102781852	102781852	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102781852delT	uc003yke.2	-						NCALD_uc003ykf.2_Intron|NCALD_uc003ykg.2_Intron|NCALD_uc003ykh.2_Intron|NCALD_uc003yki.2_Intron|NCALD_uc003ykj.2_Intron|NCALD_uc003ykk.2_Intron|NCALD_uc003ykl.2_Intron	NM_032041	NP_114430			neurocalcin delta						synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	103540867	103540880	+	IGR	DEL	CTGTGCTGTGTGCG	-	-	rs143104633		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103540867_103540880delCTGTGCTGTGTGCG								UBR5 (116372 upstream) : ODF1 (22968 downstream)																																			---	---	---	---
ODF1	4956	broad.mit.edu	37	8	103566261	103566261	+	Intron	DEL	T	-	-	rs66721337		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103566261delT	uc003ykt.2	+							NM_024410	NP_077721			outer dense fiber of sperm tails 1						cell differentiation|multicellular organismal development|spermatogenesis	outer dense fiber	structural molecule activity			ovary(2)	2	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	103821468	103821472	+	RNA	DEL	GAGCA	-	-	rs145625424		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103821468_103821472delGAGCA	uc003ykw.1	+	2		c.2039_2043delGAGCA								Homo sapiens cDNA FLJ45248 fis, clone BRHIP2006819.																														---	---	---	---
DPYS	1807	broad.mit.edu	37	8	105456793	105456794	+	Intron	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105456793_105456794delTG	uc003yly.3	-							NM_001385	NP_001376			dihydropyrimidinase						protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	105779233	105779238	+	IGR	DEL	GTGTGT	-	-	rs34403551		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105779233_105779238delGTGTGT								LRP12 (178013 upstream) : ZFPM2 (551909 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	105798207	105798208	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105798207_105798208insA								LRP12 (196987 upstream) : ZFPM2 (532939 downstream)																																			---	---	---	---
OXR1	55074	broad.mit.edu	37	8	107427722	107427723	+	Intron	DEL	TG	-	-	rs33980421	byFrequency	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107427722_107427723delTG	uc003ymf.2	+							NM_018002	NP_060472			oxidation resistance 1 isoform 1						cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	107836800	107836801	+	IGR	INS	-	A	A	rs137866358	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107836800_107836801insA								ABRA (54328 upstream) : ANGPT1 (424910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	108096969	108096969	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108096969delT								ABRA (314497 upstream) : ANGPT1 (164742 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	110802925	110802925	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110802925delT								SYBU (98905 upstream) : KCNV1 (176310 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	114713494	114713494	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114713494delT								CSMD3 (264252 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116250230	116250230	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116250230delC								None (None upstream) : TRPS1 (170495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	117004710	117004710	+	IGR	DEL	A	-	-	rs111862307		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117004710delA								TRPS1 (323482 upstream) : EIF3H (652346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	117942681	117942684	+	IGR	DEL	AACT	-	-	rs34144497		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117942681_117942684delAACT								RAD21 (55576 upstream) : C8orf85 (7780 downstream)																																			---	---	---	---
SAMD12	401474	broad.mit.edu	37	8	119320044	119320045	+	Intron	INS	-	ATGCCTCAC	ATGCCTCAC	rs140917085	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119320044_119320045insATGCCTCAC	uc010mda.1	-						SAMD12_uc010mdb.1_Intron	NM_001101676	NP_001095146			sterile alpha motif domain containing 12 isoform											ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	120507766	120507766	+	IGR	DEL	C	-	-	rs35657087		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120507766delC								NOV (71088 upstream) : ENPP2 (61553 downstream)																																			---	---	---	---
SNTB1	6641	broad.mit.edu	37	8	121671214	121671214	+	Intron	DEL	C	-	-	rs115333607	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121671214delC	uc010mdg.2	-						SNTB1_uc003ype.2_Intron	NM_021021	NP_066301			basic beta 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	124671988	124671991	+	IGR	DEL	CATC	-	-	rs139449286		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124671988_124671991delCATC								KLHL38 (6798 upstream) : ANXA13 (21044 downstream)																																			---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125654203	125654204	+	Intron	INS	-	T	T	rs149294447	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125654203_125654204insT	uc003yrk.2	-						MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566			metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	128268084	128268084	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128268084delT								FAM84B (697618 upstream) : LOC727677 (33978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128315507	128315507	+	Intron	DEL	G	-	-	rs114376487	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128315507delG	uc003ysc.1	-						uc003ysd.1_Intron|LOC727677_uc003yse.1_Intron					Homo sapiens isolate DGPc1_8_exons1-2-3-4-6-8 unknown mRNA, alternatively spliced.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	130445178	130445179	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130445178_130445179insA								None (None upstream) : GSDMC (315264 downstream)																																			---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133295339	133295340	+	Intron	DEL	CG	-	-	rs62520368		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133295339_133295340delCG	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	134397427	134397427	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134397427delA								NDRG1 (87880 upstream) : ST3GAL1 (69664 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134444489	134444502	+	IGR	DEL	ACACACACACACAC	-	-	rs72142490		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134444489_134444502delACACACACACACAC								NDRG1 (134942 upstream) : ST3GAL1 (22589 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134596897	134596898	+	IGR	INS	-	TG	TG	rs147132701	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134596897_134596898insTG								ST3GAL1 (12714 upstream) : ZFAT (893135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134607564	134607570	+	IGR	DEL	TGTACTA	-	-	rs34427443		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134607564_134607570delTGTACTA								ST3GAL1 (23381 upstream) : ZFAT (882463 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135097137	135097137	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135097137delT								ST3GAL1 (512954 upstream) : ZFAT (392896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	139021345	139021346	+	IGR	DEL	TT	-	-	rs34726046		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139021345_139021346delTT								None (None upstream) : FAM135B (120922 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	142048112	142048112	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142048112delC								PTK2 (36780 upstream) : DENND3 (90608 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	142953910	142953911	+	IGR	INS	-	GGT	GGT			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142953910_142953911insGGT								MIR1302-7 (86236 upstream) : NCRNA00051 (325806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144501013	144501014	+	IGR	INS	-	CT	CT	rs139522138	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144501013_144501014insCT								RHPN1 (34624 upstream) : MAFA (10501 downstream)																																			---	---	---	---
ZC3H3	23144	broad.mit.edu	37	8	144601288	144601289	+	Intron	INS	-	G	G	rs140206195	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144601288_144601289insG	uc003yyd.2	-							NM_015117	NP_055932			zinc finger CCCH-type containing 3						mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding			skin(1)	1	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)															---	---	---	---
EEF1D	1936	broad.mit.edu	37	8	144665865	144665866	+	Intron	INS	-	GTGGCT	GTGGCT	rs151259570	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144665865_144665866insGTGGCT	uc011lki.1	-						EEF1D_uc003yyp.1_Intron|EEF1D_uc003yyq.1_Intron|EEF1D_uc011lkj.1_Intron|EEF1D_uc003yyr.2_Intron|EEF1D_uc003yyt.2_Intron|EEF1D_uc011lkk.1_Intron|EEF1D_uc003yys.2_Intron|EEF1D_uc003yyv.2_Intron|EEF1D_uc003yyu.2_Intron|EEF1D_uc011lkl.1_Intron	NM_001130057	NP_001123529			eukaryotic translation elongation factor 1 delta						positive regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|eukaryotic translation elongation factor 1 complex	protein binding|signal transducer activity|translation elongation factor activity			ovary(1)|kidney(1)|skin(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	1552824	1552825	+	IGR	DEL	GA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1552824_1552825delGA								DMRT2 (495271 upstream) : SMARCA2 (462517 downstream)																																			---	---	---	---
KIAA2026	158358	broad.mit.edu	37	9	5987509	5987510	+	Intron	INS	-	A	A	rs76506916		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5987509_5987510insA	uc003zjq.3	-							NM_001017969	NP_001017969			hypothetical protein LOC158358											ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	11763746	11763747	+	IGR	DEL	TG	-	-	rs140297985		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11763746_11763747delTG								None (None upstream) : TYRP1 (929639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13436909	13436909	+	IGR	DEL	A	-	-	rs112255863		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13436909delA								MPDZ (157346 upstream) : NFIB (644939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	19203296	19203297	+	IGR	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19203296_19203297delGT								PLIN2 (75723 upstream) : DENND4C (87405 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32657128	32657135	+	IGR	DEL	GAAGGAAG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32657128_32657135delGAAGGAAG								TAF1L (21461 upstream) : TMEM215 (126362 downstream)																																			---	---	---	---
PRSS3	5646	broad.mit.edu	37	9	33768480	33768480	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33768480delA	uc003ztj.3	+						PRSS3_uc003zti.3_Intron	NM_007343	NP_031369			mesotrypsin isoform 1 preproprotein						digestion|endothelial cell migration|zymogen activation	extracellular space	calcium ion binding|protein binding|serine-type endopeptidase activity|serine-type peptidase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)															---	---	---	---
DNAJB5	25822	broad.mit.edu	37	9	34992128	34992128	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34992128delA	uc003zvt.2	+						DNAJB5_uc003zvs.2_Intron|DNAJB5_uc011los.1_Intron	NM_012266	NP_036398			DnaJ (Hsp40) homolog, subfamily B, member 5						protein folding|response to unfolded protein		heat shock protein binding|unfolded protein binding				0			LUSC - Lung squamous cell carcinoma(32;0.00575)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	36765279	36765280	+	IGR	INS	-	CA	CA	rs145354629	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36765279_36765280insCA								MELK (87601 upstream) : PAX5 (73251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	38469016	38469016	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38469016delT								IGFBPL1 (44572 upstream) : C9orf122 (152069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	38751011	38751012	+	IGR	INS	-	A	A	rs113025010		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38751011_38751012insA								C9orf122 (127736 upstream) : CNTNAP3 (321754 downstream)																																			---	---	---	---
CNTNAP3	79937	broad.mit.edu	37	9	39118399	39118399	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39118399delT	uc004abi.2	-						CNTNAP3_uc004abj.2_Intron|CNTNAP3_uc011lqr.1_Intron|CNTNAP3_uc004abk.1_Intron|CNTNAP3_uc011lqs.1_Intron	NM_033655	NP_387504			cell recognition molecule CASPR3 precursor						cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	66736654	66736655	+	IGR	INS	-	T	T	rs150571010	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66736654_66736655insT								LOC442421 (233627 upstream) : AQP7P1 (517612 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66797636	66797636	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66797636delT								LOC442421 (294609 upstream) : AQP7P1 (456631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69810302	69810302	+	IGR	DEL	C	-	-	rs111286695		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69810302delC								LOC100133920 (145353 upstream) : FOXD4L5 (365407 downstream)																																			---	---	---	---
KLF9	687	broad.mit.edu	37	9	73020185	73020186	+	Intron	INS	-	GGA	GGA			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73020185_73020186insGGA	uc004aht.2	-							NM_001206	NP_001197			Kruppel-like factor 9						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
TMC1	117531	broad.mit.edu	37	9	75146328	75146328	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75146328delA	uc004aiz.1	+							NM_138691	NP_619636			transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	79171183	79171184	+	IGR	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79171183_79171184delGT								GCNT1 (48853 upstream) : PRUNE2 (55109 downstream)																																			---	---	---	---
GNAQ	2776	broad.mit.edu	37	9	80357498	80357499	+	Intron	INS	-	A	A	rs5898556		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80357498_80357499insA	uc004akw.2	-						GNAQ_uc011lso.1_Intron	NM_002072	NP_002063			guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity			eye(136)|skin(44)|meninges(11)|ovary(1)|kidney(1)	193								Mis		uveal melanoma								---	---	---	---
Unknown	0	broad.mit.edu	37	9	81656899	81656900	+	IGR	INS	-	GT	GT	rs144219096	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81656899_81656900insGT								PSAT1 (711892 upstream) : TLE4 (529978 downstream)																																			---	---	---	---
SLC28A3	64078	broad.mit.edu	37	9	86902301	86902302	+	Intron	INS	-	T	T	rs141517251	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86902301_86902302insT	uc010mpz.2	-						SLC28A3_uc011lsy.1_Intron|SLC28A3_uc004anu.1_Intron	NM_022127	NP_071410			concentrative Na+-nucleoside cotransporter						nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	88415216	88415216	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88415216delT								AGTPBP1 (58272 upstream) : NAA35 (140841 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	89495002	89495002	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89495002delT								ZCCHC6 (525624 upstream) : GAS1 (64277 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91103028	91103029	+	IGR	DEL	CT	-	-	rs10617226		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91103028_91103029delCT								SPIN1 (9408 upstream) : NXNL2 (46987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91834292	91834292	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91834292delC								SHC3 (40610 upstream) : CKS2 (91821 downstream)																																			---	---	---	---
NANS	54187	broad.mit.edu	37	9	100828935	100828936	+	Intron	INS	-	T	T	rs35815359		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100828935_100828936insT	uc004ayb.2	+						NANS_uc004ayc.2_Intron	NM_018946	NP_061819			N-acetylneuraminic acid phosphate synthase						lipopolysaccharide biosynthetic process	cytoplasm	N-acetylneuraminate synthase activity|N-acylneuraminate cytidylyltransferase activity|N-acylneuraminate-9-phosphate synthase activity			skin(1)	1		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
Unknown	0	broad.mit.edu	37	9	117323898	117323898	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117323898delA								DFNB31 (56168 upstream) : ATP6V1G1 (26096 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	120613729	120613731	+	IGR	DEL	TTT	-	-	rs34170148		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120613729_120613731delTTT								TLR4 (133965 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	121279327	121279327	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121279327delA								TLR4 (799563 upstream) : DBC1 (649581 downstream)																																			---	---	---	---
SH2D3C	10044	broad.mit.edu	37	9	130501788	130501789	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130501788_130501789insA	uc004bsc.2	-						SH2D3C_uc010mxo.2_Intron|SH2D3C_uc004bry.2_Intron|SH2D3C_uc004brz.3_Intron|SH2D3C_uc011mak.1_Intron|SH2D3C_uc004bsa.2_Intron|SH2D3C_uc004bsb.2_Intron	NM_170600	NP_733745			SH2 domain containing 3C isoform a						JNK cascade|small GTPase mediated signal transduction	cytoplasm|membrane	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			ovary(1)	1																		---	---	---	---
CIZ1	25792	broad.mit.edu	37	9	130963550	130963553	+	Intron	DEL	AAAC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130963550_130963553delAAAC	uc004btv.2	-						CIZ1_uc004btw.2_Intron|DNM1_uc010mxr.2_5'Flank|DNM1_uc011mat.1_5'Flank|DNM1_uc011mau.1_5'Flank	NM_012127	NP_036259			CDKN1A interacting zinc finger protein 1 isoform							nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
BAT2L1	84726	broad.mit.edu	37	9	134305428	134305429	+	5'Flank	INS	-	T	T	rs72770799		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134305428_134305429insT	uc004can.3	+						BAT2L1_uc004cam.1_Intron	NM_013318	NP_037450			HLA-B associated transcript 2-like								protein binding				0																		---	---	---	---
SURF6	6838	broad.mit.edu	37	9	136202547	136202547	+	Intron	DEL	A	-	-	rs112046522		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136202547delA	uc004cdb.3	-							NM_006753	NP_006744			surfeit 6							granular component	DNA binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;1.16e-06)|Epithelial(140;8.34e-06)|all cancers(34;7.08e-05)														---	---	---	---
NOTCH1	4851	broad.mit.edu	37	9	139430311	139430311	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139430311delA	uc004chz.2	-							NM_017617	NP_060087			notch1 preproprotein						aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)				T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			---	---	---	---
ENTPD2	954	broad.mit.edu	37	9	139946905	139946906	+	Intron	INS	-	A	A	rs149050700	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139946905_139946906insA	uc004ckw.1	-						ENTPD2_uc004ckv.1_5'Flank|ENTPD2_uc004ckx.1_Intron	NM_203468	NP_982293			ectonucleoside triphosphate diphosphohydrolase 2							integral to membrane	ATP binding				0	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)														---	---	---	---
DIP2C	22982	broad.mit.edu	37	10	503926	503926	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:503926delC	uc001ifp.2	-						DIP2C_uc009xhk.1_Intron	NM_014974	NP_055789			DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	1818854	1818855	+	IGR	INS	-	T	T	rs143713989		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1818854_1818855insT								ADARB2 (39136 upstream) : None (None downstream)																																			---	---	---	---
PITRM1	10531	broad.mit.edu	37	10	3206216	3206216	+	Intron	DEL	A	-	-	rs68085518		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3206216delA	uc010qah.1	-						PITRM1_uc001igr.1_Intron|PITRM1_uc001igt.1_Intron|PITRM1_uc001igu.1_Intron|PITRM1_uc010qai.1_Intron|PITRM1_uc001igw.1_Intron|uc001igx.1_5'Flank					SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;						proteolysis		metalloendopeptidase activity|zinc ion binding			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	4358652	4358652	+	IGR	DEL	A	-	-	rs78104011		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4358652delA								KLF6 (531179 upstream) : LOC100216001 (262792 downstream)																																			---	---	---	---
IL15RA	3601	broad.mit.edu	37	10	6017555	6017556	+	Intron	INS	-	A	A	rs149795970	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6017555_6017556insA	uc001iiv.2	-						IL15RA_uc010qau.1_Intron|IL15RA_uc001iiw.2_Intron|IL15RA_uc001iix.2_Intron|IL15RA_uc001iiy.2_Intron	NM_002189	NP_002180			interleukin 15 receptor, alpha isoform 1						cell proliferation	cytoplasmic vesicle membrane|endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane|nuclear membrane	cytokine receptor activity				0																		---	---	---	---
PRKCQ	5588	broad.mit.edu	37	10	6526384	6526384	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6526384delA	uc001ijj.1	-						PRKCQ_uc009xim.1_Intron|PRKCQ_uc001iji.1_Intron|PRKCQ_uc009xin.1_Intron|PRKCQ_uc010qax.1_Intron	NM_006257	NP_006248			protein kinase C, theta						axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	6764797	6764798	+	IGR	INS	-	GT	GT	rs145134675	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6764797_6764798insGT								PRKCQ (142559 upstream) : SFMBT2 (439451 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	7113952	7113953	+	IGR	INS	-	GCGC	GCGC	rs141805649	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7113952_7113953insGCGC								PRKCQ (491714 upstream) : SFMBT2 (90296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	9249516	9249518	+	IGR	DEL	TTG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9249516_9249518delTTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	10037334	10037334	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10037334delT								None (None upstream) : SFTA1P (789068 downstream)																																			---	---	---	---
CELF2	10659	broad.mit.edu	37	10	11331423	11331423	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11331423delT	uc001iki.3	+						CELF2_uc010qbi.1_Intron|CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron|CELF2_uc010qbl.1_Intron|CELF2_uc010qbm.1_Intron|CELF2_uc001iko.3_Intron|CELF2_uc001ikp.3_Intron|CELF2_uc010qbn.1_Intron|CELF2_uc010qbo.1_Intron|CELF2_uc010qbp.1_Intron	NM_001025077	NP_001020248			CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
CCDC3	83643	broad.mit.edu	37	10	12996720	12996720	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12996720delC	uc001ilq.1	-						CCDC3_uc009xjb.1_Intron|CCDC3_uc001ilr.2_Intron|CCDC3_uc009xjc.1_Intron	NM_031455	NP_113643			coiled-coil domain containing 3 precursor							endoplasmic reticulum|extracellular region				ovary(1)	1		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	14540324	14540325	+	IGR	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14540324_14540325delTG								FRMD4A (36181 upstream) : FAM107B (20234 downstream)																																			---	---	---	---
FAM107B	83641	broad.mit.edu	37	10	14577597	14577600	+	Intron	DEL	GTCT	-	-	rs141458163		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14577597_14577600delGTCT	uc001imx.1	-						FAM107B_uc001ina.1_Intron|FAM107B_uc010qbu.1_Intron|FAM107B_uc009xjg.1_Intron|FAM107B_uc001imy.1_Intron|FAM107B_uc001imz.1_Intron	NM_031453	NP_113641			hypothetical protein LOC83641											breast(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	16209802	16209802	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16209802delA								FAM188A (307283 upstream) : PTER (269165 downstream)																																			---	---	---	---
PTPLA	9200	broad.mit.edu	37	10	17660378	17660379	+	5'Flank	DEL	TC	-	-	rs35364203		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17660378_17660379delTC	uc001ipg.2	-						PTPLA_uc001iph.1_5'Flank|PTPLA_uc001ipi.2_5'Flank	NM_014241	NP_055056			protein tyrosine phosphatase-like, member A						fatty acid biosynthetic process|multicellular organismal development|signal transduction	endoplasmic reticulum membrane|integral to membrane	lyase activity|protein tyrosine phosphatase activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	23768286	23768286	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23768286delC								OTUD1 (36978 upstream) : KIAA1217 (215389 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	23777065	23777065	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23777065delC								OTUD1 (45757 upstream) : KIAA1217 (206610 downstream)																																			---	---	---	---
ENKUR	219670	broad.mit.edu	37	10	25275227	25275227	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25275227delG	uc001isg.1	-						ENKUR_uc001ish.1_Intron	NM_145010	NP_659447			enkurin							cilium|flagellum	calmodulin binding|SH3 domain binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	25976927	25976927	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25976927delT	uc001isl.1	+											Homo sapiens cDNA FLJ41446 fis, clone BRSTN2003590.																														---	---	---	---
MYO3A	53904	broad.mit.edu	37	10	26438959	26438960	+	Intron	DEL	GT	-	-	rs113632652		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26438959_26438960delGT	uc001isn.2	+						MYO3A_uc009xko.1_Intron|MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129			myosin IIIA						protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	26594076	26594076	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26594076delT								GAD2 (585 upstream) : APBB1IP (133190 downstream)																																			---	---	---	---
APBB1IP	54518	broad.mit.edu	37	10	26760621	26760622	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26760621_26760622insT	uc001iss.2	+						APBB1IP_uc001isr.2_Intron|APBB1IP_uc009xks.1_Intron	NM_019043	NP_061916			amyloid beta (A4) precursor protein-binding,						blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	27877777	27877777	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27877777delA								RAB18 (48680 upstream) : MKX (84027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	29165850	29165850	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29165850delT								BAMBI (193982 upstream) : LYZL1 (412140 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	29323431	29323432	+	IGR	INS	-	AA	AA	rs149319402		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29323431_29323432insAA								BAMBI (351563 upstream) : LYZL1 (254558 downstream)																																			---	---	---	---
LYZL1	84569	broad.mit.edu	37	10	29580475	29580476	+	Intron	INS	-	AA	AA	rs145176171	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29580475_29580476insAA	uc001iul.2	+							NM_032517	NP_115906			lysozyme-like 1						cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Breast(68;0.203)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	30137788	30137789	+	IGR	INS	-	AA	AA			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30137788_30137789insAA								SVIL (111924 upstream) : KIAA1462 (163940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	31420861	31420861	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31420861delT								ZNF438 (99995 upstream) : LOC220930 (184597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	32050699	32050702	+	IGR	DEL	AGGA	-	-	rs112430684		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32050699_32050702delAGGA								ZEB1 (232572 upstream) : ARHGAP12 (44523 downstream)																																			---	---	---	---
NRP1	8829	broad.mit.edu	37	10	33478067	33478068	+	Intron	INS	-	AC	AC	rs140696916	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33478067_33478068insAC	uc001iwx.3	-						NRP1_uc001iwv.3_Intron|NRP1_uc009xlz.2_Intron|NRP1_uc001iww.3_Intron|NRP1_uc001iwy.3_Intron	NM_003873	NP_003864			neuropilin 1 isoform a						axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)													---	---	---	---
CCNY	219771	broad.mit.edu	37	10	35726589	35726590	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35726589_35726590insA	uc001iyw.3	+						CCNY_uc001iyu.3_Intron|CCNY_uc001iyv.3_Intron|CCNY_uc001iyx.3_Intron|CCNY_uc009xmb.2_Intron|CCNY_uc010qet.1_Intron	NM_145012	NP_659449			cyclin Y isoform 1						cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	35900786	35900796	+	IGR	DEL	CTCAGGGACCC	-	-	rs146481995		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35900786_35900796delCTCAGGGACCC								GJD4 (2923 upstream) : FZD8 (26381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42602125	42602125	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42602125delA								None (None upstream) : LOC441666 (225190 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42631697	42631697	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42631697delA								None (None upstream) : LOC441666 (195618 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42653302	42653303	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42653302_42653303insA								None (None upstream) : LOC441666 (174012 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	44136381	44136381	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44136381delT	uc001jba.2	+											Homo sapiens chromosome 10 open reading frame 44, mRNA (cDNA clone IMAGE:4837462).																														---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47036053	47036054	+	Intron	INS	-	CA	CA	rs138001329		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47036053_47036054insCA	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	54173278	54173278	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54173278delT								DKK1 (95862 upstream) : MBL2 (351863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	54351318	54351319	+	IGR	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54351318_54351319delTG								DKK1 (273902 upstream) : MBL2 (173822 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	59009397	59009398	+	IGR	INS	-	AC	AC	rs35679814		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59009397_59009398insAC								ZWINT (888363 upstream) : IPMK (946220 downstream)																																			---	---	---	---
CCAR1	55749	broad.mit.edu	37	10	70530835	70530835	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70530835delA	uc001joo.2	+						CCAR1_uc001jol.1_Intron|CCAR1_uc001jom.1_Intron|CCAR1_uc009xpx.1_Intron|CCAR1_uc001jon.1_Intron|CCAR1_uc010qiz.1_Intron|CCAR1_uc010qja.1_Intron|CCAR1_uc010qjb.1_Intron	NM_018237	NP_060707			cell-cycle and apoptosis regulatory protein 1						apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	70876150	70876151	+	IGR	DEL	TG	-	-	rs71474473		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70876150_70876151delTG								SRGN (11585 upstream) : VPS26A (7757 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	71204776	71204777	+	IGR	DEL	AA	-	-	rs34843822		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71204776_71204777delAA								TACR2 (28102 upstream) : TSPAN15 (6449 downstream)																																			---	---	---	---
KIAA1274	27143	broad.mit.edu	37	10	72320696	72320697	+	Intron	DEL	GG	-	-	rs71472980		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72320696_72320697delGG	uc001jrd.3	+						KIAA1274_uc001jre.3_Intron	NM_014431	NP_055246			KIAA1274											ovary(2)|central_nervous_system(1)	3																		---	---	---	---
ADAMTS14	140766	broad.mit.edu	37	10	72433021	72433022	+	Intron	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72433021_72433022delGT	uc001jrh.2	+						ADAMTS14_uc001jrg.2_Intron	NM_080722	NP_542453			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6																		---	---	---	---
CBARA1	10367	broad.mit.edu	37	10	74237247	74237248	+	Intron	INS	-	T	T	rs150029432	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74237247_74237248insT	uc001jtb.1	-						CBARA1_uc010qjw.1_Intron|CBARA1_uc010qjx.1_Intron|CBARA1_uc009xqo.1_Intron	NM_006077	NP_006068			calcium binding atopy-related autoantigen 1						calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1																		---	---	---	---
USP54	159195	broad.mit.edu	37	10	75268731	75268731	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75268731delT	uc001juo.2	-						USP54_uc010qkk.1_Intron|USP54_uc001juk.2_Intron|USP54_uc001jul.2_Intron|USP54_uc001jum.2_Intron|USP54_uc001jun.2_Intron	NM_152586	NP_689799			ubiquitin specific peptidase 54						ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)																	---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	79286580	79286581	+	Intron	DEL	CT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79286580_79286581delCT	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	80620074	80620074	+	IGR	DEL	T	-	-	rs35456775		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80620074delT								RPS24 (803504 upstream) : LOC283050 (83010 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	89387794	89387794	+	IGR	DEL	A	-	-	rs147643738		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89387794delA								MINPP1 (74626 upstream) : PAPSS2 (31682 downstream)																																			---	---	---	---
KIF11	3832	broad.mit.edu	37	10	94393720	94393721	+	Intron	DEL	AT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94393720_94393721delAT	uc001kic.2	+						KIF11_uc010qnq.1_Intron	NM_004523	NP_004514			kinesin family member 11						blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	94867941	94867942	+	IGR	DEL	CC	-	-	rs114902927	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94867941_94867942delCC								CYP26A1 (30300 upstream) : MYOF (198245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	97364464	97364465	+	IGR	INS	-	G	G	rs150032253	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97364464_97364465insG								SORBS1 (43293 upstream) : ALDH18A1 (1222 downstream)																																			---	---	---	---
PI4K2A	55361	broad.mit.edu	37	10	99394415	99394416	+	Intron	INS	-	CA	CA			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99394415_99394416insCA	uc010qoy.1	+						MORN4_uc001kob.3_5'Flank|MORN4_uc001koc.3_5'Flank|MORN4_uc001kod.3_5'Flank|MORN4_uc001koe.2_5'Flank|MORN4_uc009xvv.1_5'Flank	NM_018425	NP_060895			phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)														---	---	---	---
C10orf28	27291	broad.mit.edu	37	10	99956965	99956965	+	Intron	DEL	C	-	-	rs77063066		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99956965delC	uc001kow.3	+						C10orf28_uc001kox.3_Intron|C10orf28_uc001koy.3_Intron|C10orf28_uc009xvx.2_Intron|C10orf28_uc009xvy.2_Intron|C10orf28_uc001koz.3_Intron	NM_014472	NP_055287			growth inhibition and differentiation related								nucleotide binding			large_intestine(1)|skin(1)	2		Colorectal(252;0.234)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)														---	---	---	---
SLC25A28	81894	broad.mit.edu	37	10	101412192	101412193	+	Intron	INS	-	T	T	rs150175129	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101412192_101412193insT	uc001kpy.2	-											RecName: Full=Mitoferrin-2; AltName: Full=Mitochondrial iron transporter 2; AltName: Full=Solute carrier family 25 member 28; AltName: Full=Mitochondrial RNA-splicing protein 3/4 homolog;          Short=hMRS3/4;          Short=MRS3/4;						ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Colorectal(252;0.234)		Epithelial(162;2.57e-10)|all cancers(201;2.01e-08)														---	---	---	---
ACTR1A	10121	broad.mit.edu	37	10	104255325	104255325	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104255325delA	uc001kvv.2	-						ACTR1A_uc010qqn.1_Intron|ACTR1A_uc010qqo.1_Intron	NM_005736	NP_005727			ARP1 actin-related protein 1 homolog A,						G2/M transition of mitotic cell cycle|vesicle-mediated transport	centrosome|cytosol|dynactin complex	ATP binding			central_nervous_system(1)	1		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)														---	---	---	---
SH3PXD2A	9644	broad.mit.edu	37	10	105356401	105356402	+	3'UTR	INS	-	AG	AG	rs67331275		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105356401_105356402insAG	uc001kxj.1	-	14					SH3PXD2A_uc010qqr.1_Intron|SH3PXD2A_uc010qqs.1_3'UTR|SH3PXD2A_uc010qqt.1_3'UTR|SH3PXD2A_uc009xxn.1_3'UTR|SH3PXD2A_uc010qqu.1_3'UTR	NM_014631	NP_055446			SH3 multiple domains 1						cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)														---	---	---	---
SORCS3	22986	broad.mit.edu	37	10	106850878	106850885	+	Intron	DEL	TCCCTCCT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106850878_106850885delTCCCTCCT	uc001kyi.1	+							NM_014978	NP_055793			VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	107974901	107974902	+	IGR	INS	-	A	A	rs146972227	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107974901_107974902insA								SORCS3 (949908 upstream) : SORCS1 (358520 downstream)																																			---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108390606	108390607	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108390606_108390607insA	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
XPNPEP1	7511	broad.mit.edu	37	10	111669628	111669629	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111669628_111669629delAC	uc001kyp.1	-						XPNPEP1_uc009xxt.1_Intron|XPNPEP1_uc001kyq.1_Intron|XPNPEP1_uc010qrb.1_Intron	NM_020383	NP_065116			X-prolyl aminopeptidase (aminopeptidase P) 1,						bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity			ovary(3)|pancreas(1)	4		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)														---	---	---	---
ABLIM1	3983	broad.mit.edu	37	10	116529876	116529876	+	5'Flank	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116529876delT	uc001lbz.1	-						uc001lca.1_Intron					Homo sapiens cDNA FLJ25105 fis, clone CBR01442.						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117454452	117454453	+	Intron	DEL	CA	-	-	rs68049907		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117454452_117454453delCA	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186			attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117576127	117576130	+	Intron	DEL	ACAC	-	-	rs72098255		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117576127_117576130delACAC	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186			attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	120058828	120058829	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120058828_120058829insT								CASC2 (89169 upstream) : C10orf84 (9743 downstream)																																			---	---	---	---
GRK5	2869	broad.mit.edu	37	10	121012109	121012109	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121012109delT	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299			G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	121749505	121749505	+	IGR	DEL	G	-	-	rs76411657		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121749505delG								SEC23IP (48260 upstream) : PPAPDC1A (466961 downstream)																																			---	---	---	---
TACC2	10579	broad.mit.edu	37	10	123900685	123900687	+	Intron	DEL	GGA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123900685_123900687delGGA	uc001lfv.2	+						TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Intron|TACC2_uc010qtv.1_Intron|TACC2_uc001lfx.2_Intron|TACC2_uc001lfy.2_Intron	NM_206862	NP_996744			transforming, acidic coiled-coil containing							microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	125014445	125014446	+	IGR	INS	-	TCA	TCA	rs146799469		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125014445_125014446insTCA								BUB3 (89559 upstream) : GPR26 (411425 downstream)																																			---	---	---	---
GPR26	2849	broad.mit.edu	37	10	125422954	125422955	+	5'Flank	DEL	GA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125422954_125422955delGA	uc001lhh.2	+							NM_153442	NP_703143			G protein-coupled receptor 26						activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)																---	---	---	---
LHPP	64077	broad.mit.edu	37	10	126294402	126294403	+	Intron	INS	-	G	G	rs141845838	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126294402_126294403insG	uc001lhs.1	+						LHPP_uc001lht.1_Intron|LHPP_uc009yai.1_Intron|LHPP_uc009yaj.1_Intron	NM_022126	NP_071409			phospholysine phosphohistidine inorganic						protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)														---	---	---	---
DHX32	55760	broad.mit.edu	37	10	127578794	127578795	+	Intron	DEL	AT	-	-	rs5788723		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127578794_127578795delAT	uc001ljg.1	-							NM_018180	NP_060650			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)																---	---	---	---
ADAM12	8038	broad.mit.edu	37	10	127879380	127879380	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127879380delA	uc001ljk.2	-						ADAM12_uc010qul.1_Intron|ADAM12_uc001ljm.2_Intron|ADAM12_uc001ljn.2_Intron|ADAM12_uc001ljl.3_Intron	NM_003474	NP_003465			ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	132549545	132549545	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132549545delG								GLRX3 (566761 upstream) : TCERG1L (341111 downstream)																																			---	---	---	---
JAKMIP3	282973	broad.mit.edu	37	10	133978412	133978426	+	Intron	DEL	GGAGCTGAGCTGGGT	-	-	rs148045230	by1000genomes;by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133978412_133978426delGGAGCTGAGCTGGGT	uc001lkx.3	+						JAKMIP3_uc009yba.1_Intron	NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)														---	---	---	---
MUC2	4583	broad.mit.edu	37	11	1100311	1100318	+	Intron	DEL	CCATCCAT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1100311_1100318delCCATCCAT	uc001lsx.1	+							NM_002457	NP_002448			mucin 2 precursor							inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)													---	---	---	---
BRSK2	9024	broad.mit.edu	37	11	1432330	1432330	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1432330delC	uc001lti.2	+						BRSK2_uc009ycv.1_Intron|BRSK2_uc001lth.1_Intron|BRSK2_uc001ltj.2_Intron|BRSK2_uc001ltk.2_Intron|BRSK2_uc001ltl.2_Intron|BRSK2_uc001ltm.2_5'Flank	NM_003957	NP_003948			BR serine/threonine kinase 2						establishment of cell polarity|neuron differentiation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)														---	---	---	---
FAM99B	100132464	broad.mit.edu	37	11	1707866	1707881	+	5'Flank	DEL	CTTCTTCCCTCCCTCA	-	-	rs113231874		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1707866_1707881delCTTCTTCCCTCCCTCA	uc010qxa.1	-						uc001ltz.1_5'Flank	NR_026642				Homo sapiens family with sequence similarity 99, member B (FAM99B), non-coding RNA.												0																		---	---	---	---
NAP1L4	4676	broad.mit.edu	37	11	2974188	2974189	+	Intron	INS	-	TT	TT	rs146857720	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2974188_2974189insTT	uc001lxc.2	-						NAP1L4_uc001lxb.2_5'Flank|NAP1L4_uc009ydt.2_Intron|NAP1L4_uc010qxm.1_Intron|NAP1L4_uc010qxn.1_Intron	NM_005969	NP_005960			nucleosome assembly protein 1-like 4						nucleosome assembly	chromatin assembly complex|cytoplasm	unfolded protein binding			ovary(1)	1		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)														---	---	---	---
DNHD1	144132	broad.mit.edu	37	11	6552753	6552754	+	Intron	INS	-	AAAC	AAAC	rs146527313	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6552753_6552754insAAAC	uc001mdw.3	+							NM_144666	NP_653267			dynein heavy chain domain 1 isoform 1						microtubule-based movement	dynein complex	microtubule motor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	7502807	7502807	+	Intron	DEL	T	-	-	rs67728287		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7502807delT	uc001mff.1	-											Homo sapiens cDNA FLJ46728 fis, clone TRACH3019142.																														---	---	---	---
STK33	65975	broad.mit.edu	37	11	8578833	8578834	+	Intron	INS	-	A	A	rs150095375	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8578833_8578834insA	uc001mgj.1	-						STK33_uc001mgk.1_Intron|STK33_uc010rbn.1_Intron|STK33_uc001mgl.3_Intron|STK33_uc009yfp.2_Intron	NM_030906	NP_112168			serine/threonine kinase 33							Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|pancreas(1)|central_nervous_system(1)|skin(1)	7				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)														---	---	---	---
ST5	6764	broad.mit.edu	37	11	8754183	8754183	+	Intron	DEL	A	-	-	rs34774168		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8754183delA	uc001mgt.2	-						ST5_uc009yfr.2_Intron|ST5_uc001mgu.2_Intron|ST5_uc001mgv.2_Intron|ST5_uc010rbq.1_Intron|ST5_uc001mgw.1_Intron	NM_213618	NP_998783			suppression of tumorigenicity 5 isoform 1						positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)														---	---	---	---
AMPD3	272	broad.mit.edu	37	11	10479486	10479495	+	Intron	DEL	ATCTGGCATA	-	-	rs138243305		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10479486_10479495delATCTGGCATA	uc001mio.1	+						AMPD3_uc010rbz.1_Intron|AMPD3_uc001min.1_Intron|AMPD3_uc009yfw.1_Intron|AMPD3_uc009yfx.1_Intron|AMPD3_uc009yfz.2_Intron|AMPD3_uc001mip.1_Intron	NM_001025389	NP_001020560			adenosine monophosphate deaminase 3 isoform 1B						AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)														---	---	---	---
MRVI1	10335	broad.mit.edu	37	11	10644424	10644425	+	Intron	DEL	AC	-	-	rs34502097		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10644424_10644425delAC	uc010rcc.1	-						MRVI1_uc001miw.2_Intron|MRVI1_uc010rcb.1_Intron|MRVI1_uc009ygb.1_Intron|MRVI1_uc001mix.2_Intron|MRVI1_uc001miz.2_Intron|MRVI1_uc009ygc.1_Intron|MRVI1_uc010rcd.1_Intron|MRVI1_uc009ygd.1_Intron|MRVI1_uc010rce.1_Intron	NM_001100167	NP_001093637			JAW1-related protein isoform c						platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)														---	---	---	---
DKK3	27122	broad.mit.edu	37	11	12022225	12022225	+	Intron	DEL	T	-	-	rs34623420		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12022225delT	uc001mju.2	-						DKK3_uc010rcf.1_Intron|DKK3_uc001mjv.2_Intron|DKK3_uc001mjw.2_Intron|DKK3_uc010rcg.1_Intron	NM_001018057	NP_001018067			dickkopf homolog 3 precursor						adrenal gland development|anatomical structure morphogenesis|negative regulation of aldosterone biosynthetic process|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cortisol biosynthetic process|negative regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	extracellular space				breast(1)	1				Epithelial(150;0.000502)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	12100294	12100295	+	IGR	INS	-	T	T	rs35564264		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12100294_12100295insT								DKK3 (68978 upstream) : MICAL2 (15248 downstream)																																			---	---	---	---
SOX6	55553	broad.mit.edu	37	11	16460278	16460278	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16460278delC	uc001mmg.2	-						SOX6_uc001mmh.1_Intron|SOX6_uc001mmi.3_Intron|SOX6_uc001mmj.2_Intron	NM_033326	NP_201583			SRY (sex determining region Y)-box 6 isoform 2						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	17705629	17705630	+	IGR	INS	-	TGAG	TGAG	rs151312586	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17705629_17705630insTGAG								USH1C (139666 upstream) : MYOD1 (35480 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	17718239	17718239	+	IGR	DEL	T	-	-	rs112742043		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17718239delT								USH1C (152276 upstream) : MYOD1 (22871 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	17745044	17745044	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17745044delA								MYOD1 (1367 upstream) : KCNC1 (12451 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	19274193	19274193	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19274193delG								E2F8 (11026 upstream) : NAV2 (98078 downstream)																																			---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19491195	19491195	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19491195delA	uc001mpp.2	+							NM_001111018	NP_001104488			neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	20554731	20554732	+	IGR	INS	-	TTAAAC	TTAAAC	rs112875874		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20554731_20554732insTTAAAC								PRMT3 (23854 upstream) : SLC6A5 (66214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	21740237	21740238	+	IGR	INS	-	CT	CT	rs148417024	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21740237_21740238insCT								NELL1 (143010 upstream) : ANO5 (474484 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	28706712	28706713	+	IGR	INS	-	TC	TC	rs149296207	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28706712_28706713insTC								METT5D1 (351658 upstream) : None (None downstream)																																			---	---	---	---
ELP4	26610	broad.mit.edu	37	11	31649983	31649984	+	Intron	INS	-	AC	AC	rs145938182	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31649983_31649984insAC	uc001mtb.2	+						ELP4_uc001mta.1_Intron|ELP4_uc001mtc.2_Intron|ELP4_uc010rdz.1_Intron	NM_019040	NP_061913			elongation protein 4 homolog						histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	32245033	32245033	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32245033delG								RCN1 (117762 upstream) : WT1 (164292 downstream)																																			---	---	---	---
EHF	26298	broad.mit.edu	37	11	34667575	34667576	+	Intron	DEL	GT	-	-	rs111921486		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34667575_34667576delGT	uc001mvr.1	+						EHF_uc009yke.1_Intron|EHF_uc009ykf.1_Intron	NM_012153	NP_036285			ets homologous factor						cell proliferation|epithelial cell differentiation|multicellular organismal development|positive regulation of transcription, DNA-dependent		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(20;0.117)	Epithelial(1;0.055)|all cancers(1;0.137)|STAD - Stomach adenocarcinoma(6;0.235)															---	---	---	---
APIP	51074	broad.mit.edu	37	11	34928075	34928075	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34928075delT	uc001mvs.2	-						APIP_uc010reo.1_Intron	NM_015957	NP_057041			APAF1 interacting protein						apoptosis|L-methionine salvage	cytoplasm	identical protein binding|metal ion binding|methylthioribulose 1-phosphate dehydratase activity				0	all_epithelial(35;0.161)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.000425)															---	---	---	---
PAMR1	25891	broad.mit.edu	37	11	35455394	35455397	+	Intron	DEL	GAGG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35455394_35455397delGAGG	uc001mwg.2	-						PAMR1_uc001mwf.2_Intron|PAMR1_uc010rew.1_Intron|PAMR1_uc010rex.1_Intron	NM_001001991	NP_001001991			regeneration associated muscle protease isoform						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2																		---	---	---	---
PRR5L	79899	broad.mit.edu	37	11	36379258	36379259	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36379258_36379259insA	uc001mwo.3	+							NM_001160167	NP_001153639			protor-2 isoform a											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	43198739	43198740	+	IGR	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43198739_43198740delTG								None (None upstream) : API5 (134765 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	45055369	45055369	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45055369delG								LOC221122 (55793 upstream) : PRDM11 (60195 downstream)																																			---	---	---	---
PRDM11	56981	broad.mit.edu	37	11	45206909	45206909	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45206909delT	uc001myo.2	+							NM_020229	NP_064614			PR domain containing 11											upper_aerodigestive_tract(1)	1																		---	---	---	---
MADD	8567	broad.mit.edu	37	11	47314855	47314856	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47314855_47314856insT	uc001ner.1	+						MADD_uc001neq.2_Intron|MADD_uc001nev.1_Intron|MADD_uc001nes.1_Intron|MADD_uc001net.1_Intron|MADD_uc009yln.1_Intron|MADD_uc001neu.1_Intron|MADD_uc001nex.2_Intron|MADD_uc001nez.2_Intron|MADD_uc001new.2_Intron|MADD_uc009ylo.2_Intron	NM_003682	NP_003673			MAP-kinase activating death domain-containing						activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	48363139	48363140	+	IGR	INS	-	G	G	rs143199863	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48363139_48363140insG								OR4C3 (15659 upstream) : OR4C45 (3762 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48387684	48387684	+	IGR	DEL	T	-	-	rs67755516		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48387684delT								OR4C45 (13685 upstream) : OR4A47 (122661 downstream)																																			---	---	---	---
ASRGL1	80150	broad.mit.edu	37	11	62154365	62154366	+	Intron	INS	-	T	T	rs34472338		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62154365_62154366insT	uc001nte.3	+						ASRGL1_uc001ntf.3_Intron|ASRGL1_uc001ntg.3_Intron	NM_025080	NP_079356			asparaginase-like 1						asparagine catabolic process via L-aspartate|protein maturation	cytoplasm|microtubule cytoskeleton|nucleus	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity				0					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)													---	---	---	---
FERMT3	83706	broad.mit.edu	37	11	63980530	63980530	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63980530delT	uc001nyl.2	+						FERMT3_uc001nym.2_Intron	NM_178443	NP_848537			fermitin family homolog 3 long form						integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding			ovary(1)	1																		---	---	---	---
PACS1	55690	broad.mit.edu	37	11	65913283	65913283	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65913283delA	uc001oha.1	+						PACS1_uc001ogz.1_Intron	NM_018026	NP_060496			phosphofurin acidic cluster sorting protein 1						interspecies interaction between organisms|regulation of defense response to virus by virus|viral reproduction	cytosol	protein binding			ovary(6)	6																		---	---	---	---
PC	5091	broad.mit.edu	37	11	66651983	66651984	+	Intron	DEL	CA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66651983_66651984delCA	uc001ojn.1	-						PC_uc001ojo.1_Intron|PC_uc001ojp.1_Intron	NM_022172	NP_071504			pyruvate carboxylase precursor						gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity			ovary(2)|lung(1)|kidney(1)	4		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)													---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70671881	70671882	+	Intron	INS	-	TT	TT	rs139086605	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70671881_70671882insTT	uc001oqc.2	-							NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	72246883	72246883	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72246883delA								CLPB (101199 upstream) : PDE2A (40303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	76437289	76437290	+	IGR	INS	-	CTT	CTT	rs142653999	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76437289_76437290insCTT								GUCY2E (4456 upstream) : TSKU (56995 downstream)																																			---	---	---	---
ODZ4	26011	broad.mit.edu	37	11	78614787	78614787	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78614787delC	uc001ozl.3	-							NM_001098816	NP_001092286			odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	87934991	87934991	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87934991delT								RAB38 (26392 upstream) : CTSC (91770 downstream)																																			---	---	---	---
TRIM77	390231	broad.mit.edu	37	11	89444610	89444611	+	Frame_Shift_Ins	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89444610_89444611insA	uc010rtw.1	+	2	444_445	c.444_445insA	c.(442-447)TGGAAAfs	p.W148fs		NM_001146162	NP_001139634			tripartite motif-containing 77												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	90665978	90665978	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90665978delT								MIR1261 (63608 upstream) : None (None downstream)																																			---	---	---	---
SLC36A4	120103	broad.mit.edu	37	11	92896144	92896144	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92896144delT	uc001pdn.2	-						SLC36A4_uc001pdm.2_Intron	NM_152313	NP_689526			solute carrier family 36 (proton/amino acid						L-alanine transport|proline transport|tryptophan transport	integral to membrane	symporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	94736218	94736218	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94736218delT								KDM4D (3544 upstream) : KDM4DL (22204 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	95705597	95705597	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95705597delA								MTMR2 (48226 upstream) : MAML2 (5843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	97881664	97881665	+	IGR	INS	-	TTG	TTG	rs142173494	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97881664_97881665insTTG								None (None upstream) : None (None downstream)																																			---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	99422642	99422642	+	Intron	DEL	T	-	-	rs79777820		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99422642delT	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176			contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	99834447	99834448	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99834447_99834448insT	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176			contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	102793712	102793712	+	IGR	DEL	T	-	-	rs35762944		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102793712delT								MMP12 (48000 upstream) : MMP13 (20013 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	103438280	103438281	+	IGR	DEL	TA	-	-	rs144851316		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103438280_103438281delTA								DYNC2H1 (87689 upstream) : PDGFD (339634 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	104177664	104177664	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104177664delT								PDGFD (142637 upstream) : CASP12 (578778 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	107095110	107095110	+	IGR	DEL	G	-	-	rs34497239		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107095110delG								GUCY1A2 (205939 upstream) : CWF19L2 (101964 downstream)																																			---	---	---	---
ELMOD1	55531	broad.mit.edu	37	11	107465002	107465002	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107465002delA	uc010rvs.1	+						ELMOD1_uc001pjm.2_Intron|ELMOD1_uc010rvt.1_Intron	NM_018712	NP_061182			ELMO/CED-12 domain containing 1 isoform 1						phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	111978166	111978166	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111978166delA								SDHD (11649 upstream) : IL18 (35810 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	119855162	119855163	+	IGR	DEL	GC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119855162_119855163delGC								PVRL1 (255727 upstream) : TRIM29 (126832 downstream)																																			---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120662945	120662946	+	Intron	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120662945_120662946delGT	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434			glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120799732	120799733	+	Intron	DEL	AT	-	-	rs72400411		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120799732_120799733delAT	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434			glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	121585277	121585278	+	IGR	INS	-	AG	AG	rs146117987	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121585277_121585278insAG								SORL1 (80806 upstream) : LOC399959 (374533 downstream)																																			---	---	---	---
ROBO4	54538	broad.mit.edu	37	11	124755476	124755477	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124755476_124755477insT	uc001qbg.2	-						ROBO4_uc010sas.1_Intron	NM_019055	NP_061928			roundabout homolog 4, magic roundabout						angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)														---	---	---	---
CCDC15	80071	broad.mit.edu	37	11	124882217	124882217	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124882217delC	uc001qbm.3	+							NM_025004	NP_079280			coiled-coil domain containing 15							centrosome				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)														---	---	---	---
KIRREL3	84623	broad.mit.edu	37	11	126360776	126360776	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126360776delG	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920			kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	127088422	127088422	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127088422delG								KIRREL3 (215067 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	127149666	127149666	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127149666delT	uc001qeh.2	+											Homo sapiens cDNA clone IMAGE:4794631.																														---	---	---	---
ARHGAP32	9743	broad.mit.edu	37	11	129023040	129023041	+	Intron	INS	-	A	A	rs35216784		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129023040_129023041insA	uc009zcp.2	-						ARHGAP32_uc009zcq.1_Intron	NM_001142685	NP_001136157			Rho GTPase-activating protein isoform 1						cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5																		---	---	---	---
NTM	50863	broad.mit.edu	37	11	131337400	131337400	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131337400delG	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530			neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
NTM	50863	broad.mit.edu	37	11	131885996	131885996	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131885996delT	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606			neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
OPCML	4978	broad.mit.edu	37	11	133281567	133281567	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133281567delG	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
TSPAN9	10867	broad.mit.edu	37	12	3378919	3378920	+	Intron	DEL	GA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3378919_3378920delGA	uc001qlp.2	+							NM_006675	NP_006666			tetraspanin 9							integral to plasma membrane|membrane fraction				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)															---	---	---	---
DYRK4	8798	broad.mit.edu	37	12	4695895	4695896	+	Intron	INS	-	AG	AG	rs28366517		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4695895_4695896insAG	uc009zeh.1	+							NM_003845	NP_003836			dual-specificity tyrosine-(Y)-phosphorylation							Golgi apparatus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|skin(1)	3			Colorectal(7;0.103)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	6292425	6292426	+	IGR	DEL	CT	-	-	rs10568270		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6292425_6292426delCT								VWF (58589 upstream) : CD9 (16447 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	18306091	18306091	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18306091delA								RERGL (62977 upstream) : PIK3C2G (108383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	19573666	19573666	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19573666delT								PLEKHA5 (44335 upstream) : AEBP2 (18942 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	23417121	23417121	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23417121delA								ETNK1 (573514 upstream) : SOX5 (268111 downstream)																																			---	---	---	---
DENND5B	160518	broad.mit.edu	37	12	31540134	31540134	+	3'UTR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31540134delA	uc001rki.1	-	21					DENND5B_uc001rkh.1_3'UTR|DENND5B_uc009zjq.1_Intron	NM_144973	NP_659410			DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
FGD4	121512	broad.mit.edu	37	12	32786157	32786157	+	Intron	DEL	G	-	-	rs150951121		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32786157delG	uc001rkz.2	+						FGD4_uc001rlc.2_Intron|FGD4_uc001rky.2_Intron|FGD4_uc001rla.2_Intron|FGD4_uc010ske.1_Intron|FGD4_uc001rlb.1_Intron	NM_139241	NP_640334			FYVE, RhoGEF and PH domain containing 4						actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)																	---	---	---	---
PPHLN1	51535	broad.mit.edu	37	12	42830740	42830740	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42830740delG	uc001rng.1	+						PPHLN1_uc001rmy.2_Intron|PPHLN1_uc001rne.2_Intron|PPHLN1_uc001rnb.2_Intron|PPHLN1_uc001rnd.2_Intron|PPHLN1_uc001rnc.2_Intron|PPHLN1_uc001rnf.2_Intron|PPHLN1_uc010skq.1_Intron|PPHLN1_uc010skr.1_Intron|PPHLN1_uc010sks.1_Intron|PPHLN1_uc010skt.1_Intron|PPHLN1_uc001rni.1_Intron|PPHLN1_uc001rnh.1_Intron|PPHLN1_uc010sku.1_Intron	NM_016488	NP_057572			periphilin 1 isoform 1						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	46731864	46731864	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46731864delA								SLC38A1 (68656 upstream) : SLC38A2 (20108 downstream)																																			---	---	---	---
FAM113B	91523	broad.mit.edu	37	12	47621822	47621822	+	Intron	DEL	T	-	-	rs72274544		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47621822delT	uc001rpn.2	+						FAM113B_uc010slj.1_Intron|FAM113B_uc001rpq.2_Intron	NM_138371	NP_612380			hypothetical protein LOC91523								hydrolase activity			skin(3)|ovary(2)	5	Renal(347;0.138)|Lung SC(27;0.192)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	48226932	48226943	+	IGR	DEL	GCGCGCGCGCGT	-	-	rs62948262	by1000genomes;by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48226932_48226943delGCGCGCGCGCGT								HDAC7 (13169 upstream) : VDR (8379 downstream)																																			---	---	---	---
TUBA1C	84790	broad.mit.edu	37	12	49650046	49650047	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49650046_49650047insT	uc010smh.1	+						TUBA1C_uc001rts.2_Intron	NM_032704	NP_116093			tubulin alpha 6						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0																		---	---	---	---
SPATS2	65244	broad.mit.edu	37	12	49852267	49852267	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49852267delA	uc001rud.2	+						SPATS2_uc001ruc.2_Intron|SPATS2_uc001rue.2_Intron|SPATS2_uc009zli.1_Intron|SPATS2_uc001ruf.2_Intron|SPATS2_uc001rug.2_5'Flank	NM_023071	NP_075559			spermatogenesis associated, serine-rich 2							cytoplasm				breast(1)	1																		---	---	---	---
TFCP2	7024	broad.mit.edu	37	12	51563290	51563290	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51563290delA	uc001rxw.2	-						TFCP2_uc001rxv.1_Intron|TFCP2_uc009zlx.1_Intron|TFCP2_uc001rxx.2_Intron|TFCP2_uc009zly.1_Intron	NM_005653	NP_005644			transcription factor CP2						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
PDE1B	5153	broad.mit.edu	37	12	54955546	54955547	+	Intron	DEL	GT	-	-	rs112226491		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54955546_54955547delGT	uc001sgd.1	+						PDE1B_uc010soz.1_Intron|PDE1B_uc010spa.1_Intron|PDE1B_uc001sgf.2_Intron|PDE1B_uc001sge.2_Intron|PDE1B_uc009znq.2_Intron	NM_000924	NP_000915			phosphodiesterase 1B isoform 1						activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
PDE1B	5153	broad.mit.edu	37	12	54968026	54968027	+	Intron	DEL	TG	-	-	rs113679735		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54968026_54968027delTG	uc001sgd.1	+						PDE1B_uc010soz.1_Intron|PDE1B_uc010spa.1_Intron|PDE1B_uc001sgf.2_Intron|PDE1B_uc001sge.2_Intron|PDE1B_uc009znq.2_Intron	NM_000924	NP_000915			phosphodiesterase 1B isoform 1						activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
LRP1	4035	broad.mit.edu	37	12	57585723	57585728	+	Intron	DEL	ACCACA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57585723_57585728delACCACA	uc001snd.2	+						MIR1228_hsa-mir-1228|MI0006318_5'Flank	NM_002332	NP_002323			low density lipoprotein-related protein 1						aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	63028166	63028167	+	IGR	INS	-	TAAA	TAAA	rs141164813	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63028166_63028167insTAAA								MIRLET7I (30617 upstream) : PPM1H (9596 downstream)																																			---	---	---	---
GRIP1	23426	broad.mit.edu	37	12	66968568	66968568	+	Intron	DEL	T	-	-	rs112367513		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66968568delT	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973			glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	68666364	68666364	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68666364delA								IL22 (18979 upstream) : MDM1 (21982 downstream)																																			---	---	---	---
RAB3IP	117177	broad.mit.edu	37	12	70173325	70173325	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70173325delT	uc001svp.2	+						RAB3IP_uc001svl.1_Intron|RAB3IP_uc001svm.2_Intron|RAB3IP_uc001svn.2_Intron|RAB3IP_uc001svo.2_Intron|RAB3IP_uc001svq.2_Intron|RAB3IP_uc001svr.2_Intron|RAB3IP_uc001svs.2_Intron|RAB3IP_uc001svt.2_Intron	NM_175623	NP_783322			RAB3A interacting protein isoform alpha 2						cilium assembly|Golgi to plasma membrane transport|protein localization to organelle|protein transport	actin cortical patch|centrosome|cytosol|lamellipodium|microtubule basal body|nucleus	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	75169973	75169974	+	IGR	DEL	GA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75169973_75169974delGA								ATXN7L3B (234750 upstream) : KCNC2 (263923 downstream)																																			---	---	---	---
E2F7	144455	broad.mit.edu	37	12	77428004	77428005	+	Intron	INS	-	T	T	rs144053051	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77428004_77428005insT	uc001sym.3	-							NM_203394	NP_976328			E2F transcription factor 7						cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3																		---	---	---	---
PAWR	5074	broad.mit.edu	37	12	80033662	80033666	+	Intron	DEL	ATTCC	-	-	rs137876550		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80033662_80033666delATTCC	uc001syx.2	-							NM_002583	NP_002574			PRKC, apoptosis, WT1, regulator						actin filament bundle assembly|apoptosis|induction of apoptosis|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	actin binding|enzyme binding|leucine zipper domain binding|transcription corepressor activity				0																		---	---	---	---
PPP1R12A	4659	broad.mit.edu	37	12	80249484	80249484	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80249484delA	uc001syz.2	-						PPP1R12A_uc010suc.1_Intron|PPP1R12A_uc001sza.2_Intron|PPP1R12A_uc010sud.1_Intron|PPP1R12A_uc001szb.2_Intron|PPP1R12A_uc001szc.2_Intron	NM_002480	NP_002471			protein phosphatase 1, regulatory (inhibitor)							contractile fiber	protein binding|signal transducer activity			ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	89128728	89128728	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89128728delT								KITLG (154490 upstream) : DUSP6 (613111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	90327644	90327644	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90327644delT								LOC338758 (221916 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	90836341	90836342	+	IGR	DEL	GT	-	-	rs71920556		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90836341_90836342delGT								LOC338758 (730613 upstream) : C12orf12 (509651 downstream)																																			---	---	---	---
BTG1	694	broad.mit.edu	37	12	92501671	92501671	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92501671delT	uc001tbv.1	-						BTG1_uc001tbw.1_Intron|BTG1_uc001tbx.1_Intron|BTG1_uc009zss.1_Intron					Homo sapiens full length insert cDNA clone YW25A12.						cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)						T	MYC	BCLL								---	---	---	---
Unknown	0	broad.mit.edu	37	12	92646123	92646123	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92646123delA								BTG1 (106450 upstream) : CLLU1OS (167747 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98382057	98382057	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98382057delA								RMST (423264 upstream) : LOC100128191 (524696 downstream)																																			---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	99370063	99370063	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99370063delC	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc001tgk.2_Intron|ANKS1B_uc001tgd.1_Intron|ANKS1B_uc001tgi.2_Intron|ANKS1B_uc009ztr.2_Intron|ANKS1B_uc001tgj.2_Intron|ANKS1B_uc001tgg.3_Intron|ANKS1B_uc010svg.1_Intron|ANKS1B_uc009zts.1_Intron|ANKS1B_uc001tgm.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
SCYL2	55681	broad.mit.edu	37	12	100726147	100726148	+	Intron	DEL	AT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100726147_100726148delAT	uc001thn.2	+						SCYL2_uc001thm.1_Intron	NM_017988	NP_060458			SCY1-like 2 protein						endosome to lysosome transport|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of clathrin-mediated endocytosis|positive regulation of receptor internalization	clathrin-coated vesicle|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|protein kinase activity|receptor binding			lung(3)|ovary(2)|skin(1)	6																		---	---	---	---
CHST11	50515	broad.mit.edu	37	12	104952577	104952577	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104952577delA	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883			carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	105939677	105939677	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105939677delT								C12orf75 (174382 upstream) : NUAK1 (517448 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	106039955	106039956	+	IGR	INS	-	A	A	rs11477806		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106039955_106039956insA								C12orf75 (274660 upstream) : NUAK1 (417169 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	106095447	106095448	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106095447_106095448insA								C12orf75 (330152 upstream) : NUAK1 (361677 downstream)																																			---	---	---	---
WSCD2	9671	broad.mit.edu	37	12	108543394	108543394	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108543394delC	uc001tms.2	+						WSCD2_uc001tmt.2_Intron	NM_014653	NP_055468			WSC domain containing 2							integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3																		---	---	---	---
SELPLG	6404	broad.mit.edu	37	12	109026166	109026167	+	Intron	DEL	GT	-	-	rs34863745		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109026166_109026167delGT	uc001tni.2	-						SELPLG_uc001tnh.2_Intron|SELPLG_uc010sxe.1_5'Flank	NM_003006	NP_002997			selectin P ligand						blood coagulation|cellular response to interleukin-6	integral to plasma membrane|membrane fraction	bacterial cell surface binding|receptor binding				0																		---	---	---	---
TRPV4	59341	broad.mit.edu	37	12	110256888	110256889	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110256888_110256889delAC	uc001tpk.1	-						TRPV4_uc001tpl.1_Intron	NM_021625	NP_067638			transient receptor potential cation channel,						actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4																		---	---	---	---
PPTC7	160760	broad.mit.edu	37	12	111012241	111012241	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111012241delA	uc001trh.1	-							NM_139283	NP_644812			T-cell activation protein phosphatase 2C								metal ion binding|phosphoprotein phosphatase activity				0																		---	---	---	---
TMEM116	89894	broad.mit.edu	37	12	112444456	112444456	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112444456delA	uc001ttc.1	-						TMEM116_uc001ttd.1_Intron|TMEM116_uc001tte.1_Intron|TMEM116_uc001ttf.1_Intron|TMEM116_uc001ttg.1_Intron|TMEM116_uc001tth.1_Intron|TMEM116_uc001tti.1_Intron	NM_138341	NP_612350			transmembrane protein 116							integral to membrane				ovary(1)	1																		---	---	---	---
OAS1	4938	broad.mit.edu	37	12	113349366	113349367	+	Intron	DEL	CA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113349366_113349367delCA	uc001tud.2	+						OAS1_uc010syn.1_Intron|OAS1_uc010syo.1_Intron|OAS1_uc001tub.2_Intron|OAS1_uc001tuc.2_Intron|OAS1_uc009zwf.2_Intron	NM_016816	NP_058132			2',5'-oligoadenylate synthetase 1 isoform 1						interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	114088210	114088211	+	IGR	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114088210_114088211delTG								LHX5 (178333 upstream) : RBM19 (166332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	115274964	115274964	+	IGR	DEL	A	-	-	rs35049971		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115274964delA								TBX3 (152995 upstream) : None (None downstream)																																			---	---	---	---
NCRNA00173	100287569	broad.mit.edu	37	12	116968764	116968764	+	5'Flank	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116968764delT	uc001tvx.1	+						NCRNA00173_uc001tvy.2_5'Flank	NR_027345				Homo sapiens cDNA FLJ42957 fis, clone BRSTN2010500.												0																		---	---	---	---
VSIG10	54621	broad.mit.edu	37	12	118506896	118506896	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118506896delT	uc001tws.2	-							NM_019086	NP_061959			V-set and immunoglobulin domain containing 10							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	119270506	119270506	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119270506delT								SUDS3 (414667 upstream) : SRRM4 (148890 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	120396905	120396905	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120396905delT								CIT (81813 upstream) : CCDC64 (30743 downstream)																																			---	---	---	---
RAB35	11021	broad.mit.edu	37	12	120550696	120550696	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120550696delT	uc001txm.1	-						RAB35_uc009zww.1_Intron|RAB35_uc010szh.1_Intron	NM_006861	NP_006852			RAB35, member RAS oncogene family						cytokinesis|endosome transport|protein transport|small GTPase mediated signal transduction	cell projection membrane|clathrin-coated endocytic vesicle|coated pit|endosome|intercellular bridge|melanosome	GTP binding|GTPase activity|phosphatidylinositol-4,5-bisphosphate binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.248)														---	---	---	---
GCN1L1	10985	broad.mit.edu	37	12	120602670	120602670	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120602670delT	uc001txo.2	-							NM_006836	NP_006827			GCN1 general control of amino-acid synthesis						regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
CAMKK2	10645	broad.mit.edu	37	12	121715772	121715773	+	Intron	INS	-	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121715772_121715773insG	uc001tzu.2	-						CAMKK2_uc001tzt.2_Intron|CAMKK2_uc001tzv.2_Intron|CAMKK2_uc001tzw.2_Intron|CAMKK2_uc001tzx.2_Intron|CAMKK2_uc001tzy.2_Intron|CAMKK2_uc001uab.2_Intron|CAMKK2_uc001uac.2_Intron|CAMKK2_uc001uad.1_Intron	NM_006549	NP_006540			calcium/calmodulin-dependent protein kinase						calcium-mediated signaling|MAPKKK cascade|positive regulation of transcription, DNA-dependent|protein autophosphorylation|regulation of protein kinase activity	cytoplasm	ATP binding|calcium ion binding|calmodulin binding|calmodulin-dependent protein kinase activity|protein tyrosine kinase activity			lung(1)|large_intestine(1)|stomach(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	122051058	122051059	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122051058_122051059insT								KDM2B (32138 upstream) : ORAI1 (13396 downstream)																																			---	---	---	---
PITPNM2	57605	broad.mit.edu	37	12	123619932	123619932	+	Intron	DEL	C	-	-	rs67862718		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123619932delC	uc001uek.1	-							NM_020845	NP_065896			phosphatidylinositol transfer protein,						metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)														---	---	---	---
ATP6V0A2	23545	broad.mit.edu	37	12	124205737	124205738	+	Intron	INS	-	TGTTT	TGTTT	rs142454152	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124205737_124205738insTGTTT	uc001ufr.2	+						ATP6V0A2_uc001ufq.1_Intron	NM_012463	NP_036595			ATPase, H+ transporting, lysosomal V0 subunit						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|immune response|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	124671080	124671080	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124671080delG								ZNF664 (171113 upstream) : FAM101A (102630 downstream)																																			---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	124923516	124923517	+	Intron	INS	-	AC	AC			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124923516_124923517insAC	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron	NM_001077261	NP_001070729			nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	125104741	125104741	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125104741delA								NCOR2 (52731 upstream) : SCARB1 (157434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	126727720	126727721	+	IGR	DEL	TT	-	-	rs10566206		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126727720_126727721delTT								TMEM132B (584131 upstream) : LOC100128554 (199306 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	126770122	126770122	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126770122delG								TMEM132B (626533 upstream) : LOC100128554 (156905 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	129479916	129479916	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129479916delC								GLT1D1 (10407 upstream) : TMEM132D (76355 downstream)																																			---	---	---	---
GPR133	283383	broad.mit.edu	37	12	131520172	131520173	+	Intron	DEL	GT	-	-	rs34106604		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131520172_131520173delGT	uc001uit.3	+						GPR133_uc010tbm.1_Intron	NM_198827	NP_942122			G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	132116074	132116081	+	IGR	DEL	ATGGATGG	-	-	rs72500899		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132116074_132116081delATGGATGG								LOC116437 (418599 upstream) : SFRS8 (79554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	132987942	132987943	+	IGR	INS	-	GC	GC			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132987942_132987943insGC								GALNT9 (82037 upstream) : FBRSL1 (79214 downstream)																																			---	---	---	---
ZNF268	10795	broad.mit.edu	37	12	133772312	133772313	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133772312_133772313insT	uc010tcf.1	+						ZNF268_uc010tbv.1_Intron|ZNF268_uc010tbw.1_Intron|ZNF268_uc010tbx.1_Intron|ZNF268_uc010tby.1_Intron|ZNF268_uc010tbz.1_Intron|ZNF268_uc010tca.1_Intron|ZNF268_uc010tcb.1_Intron|ZNF268_uc010tcc.1_Intron|ZNF268_uc010tcd.1_Intron|ZNF268_uc010tce.1_Intron|ZNF268_uc010tcg.1_Intron|ZNF268_uc010tch.1_Intron	NM_003415	NP_003406			zinc finger protein 268 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)														---	---	---	---
DKFZp686A1627	266695	broad.mit.edu	37	13	19645199	19645199	+	Intron	DEL	T	-	-	rs112500592		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19645199delT	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	20175375	20175376	+	IGR	INS	-	TG	TG			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20175375_20175376insTG								TPTE2 (39661 upstream) : MPHOSPH8 (32504 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	23577919	23577919	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23577919delT								None (None upstream) : SGCG (177141 downstream)																																			---	---	---	---
LOC374491	374491	broad.mit.edu	37	13	25150004	25150004	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25150004delT	uc001upm.2	+											Homo sapiens mRNA; cDNA DKFZp434J0717 (from clone DKFZp434J0717).												0																		---	---	---	---
ATP8A2	51761	broad.mit.edu	37	13	26024667	26024668	+	Intron	DEL	TG	-	-	rs35619440		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26024667_26024668delTG	uc001uqk.2	+							NM_016529	NP_057613			ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	27768491	27768491	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27768491delA								USP12 (22462 upstream) : RPL21 (57201 downstream)																																			---	---	---	---
MTUS2	23281	broad.mit.edu	37	13	29957893	29957894	+	Intron	INS	-	G	G	rs140672096	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29957893_29957894insG	uc001usl.3	+							NM_001033602	NP_001028774			hypothetical protein LOC23281 isoform a							cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	30255760	30255760	+	IGR	DEL	A	-	-	rs35880937		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30255760delA								SLC7A1 (85935 upstream) : UBL3 (82786 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	30617581	30617581	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30617581delT								UBL3 (192761 upstream) : KATNAL1 (159187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	31360028	31360029	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31360028_31360029insT								ALOX5AP (21472 upstream) : C13orf33 (120283 downstream)																																			---	---	---	---
N4BP2L2	10443	broad.mit.edu	37	13	33094795	33094796	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33094795_33094796insA	uc001uuk.3	-						N4BP2L2_uc001uuj.2_Intron|N4BP2L2_uc010abe.1_Intron|N4BP2L2_uc010tdz.1_Intron	NM_014887	NP_055702			phosphonoformate immuno-associated protein 5												0		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)														---	---	---	---
COG6	57511	broad.mit.edu	37	13	40255563	40255563	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40255563delT	uc001uxh.2	+						COG6_uc001uxi.2_Intron|COG6_uc010acb.2_Intron	NM_020751	NP_065802			component of oligomeric golgi complex 6 isoform						protein transport	Golgi membrane|Golgi transport complex				kidney(1)|skin(1)	2		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	40548526	40548527	+	IGR	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40548526_40548527delAC								COG6 (182724 upstream) : LOC646982 (372746 downstream)																																			---	---	---	---
FOXO1	2308	broad.mit.edu	37	13	41235086	41235088	+	Intron	DEL	AAC	-	-	rs111337241		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41235086_41235088delAAC	uc001uxl.3	-							NM_002015	NP_002006			forkhead box O1						anti-apoptosis|blood vessel development|embryo development|endocrine pancreas development|insulin receptor signaling pathway|negative regulation of stress-activated MAPK cascade|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|response to DNA damage stimulus|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding		PAX3/FOXO1(749)|PAX7/FOXO1(197)	soft_tissue(946)|lung(1)|central_nervous_system(1)	948		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	41251936	41251936	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41251936delT								FOXO1 (11202 upstream) : MIR320D-1 (50028 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	47852171	47852171	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47852171delT								HTR2A (381121 upstream) : SUCLA2 (664621 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	50273053	50273053	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50273053delC								EBPL (7430 upstream) : KPNA3 (390 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	50546600	50546600	+	IGR	DEL	T	-	-	rs78869142		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50546600delT								C13orf1 (35975 upstream) : DLEU2 (10088 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	52110665	52110665	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52110665delC								INTS6 (83390 upstream) : WDFY2 (47819 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57548562	57548562	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57548562delA								None (None upstream) : PRR20C (166490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57834176	57834177	+	IGR	INS	-	AAAA	AAAA	rs148281723	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57834176_57834177insAAAA								PRR20B (89824 upstream) : PCDH17 (371612 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59579565	59579566	+	IGR	INS	-	AC	AC	rs139296137	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59579565_59579566insAC								None (None upstream) : DIAPH3 (660159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	61290265	61290266	+	IGR	DEL	CA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61290265_61290266delCA								TDRD3 (142253 upstream) : PCDH20 (693555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62467704	62467706	+	IGR	DEL	TTG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62467704_62467706delTTG								PCDH20 (465625 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	65379554	65379557	+	IGR	DEL	TGTG	-	-	rs150876936		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65379554_65379557delTGTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69751640	69751640	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69751640delA								None (None upstream) : KLHL1 (523086 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	74843422	74843423	+	IGR	DEL	TC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74843422_74843423delTC								KLF12 (135028 upstream) : LOC647288 (968467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	75219413	75219413	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75219413delA								KLF12 (511019 upstream) : LOC647288 (592477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	81470711	81470711	+	IGR	DEL	A	-	-	rs35735609		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81470711delA								SPRY2 (555625 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	85756010	85756010	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85756010delG								None (None upstream) : SLITRK6 (610912 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	91150025	91150027	+	Intron	DEL	TTC	-	-	rs10566447		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91150025_91150027delTTC	uc001vlo.2	+											Homo sapiens, clone IMAGE:5164544, mRNA.																														---	---	---	---
GPC5	2262	broad.mit.edu	37	13	92819175	92819186	+	Intron	DEL	TCTCTCTCTCTC	-	-	rs35310453		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92819175_92819186delTCTCTCTCTCTC	uc010tif.1	+							NM_004466	NP_004457			glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94342590	94342590	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94342590delG	uc001vlt.2	+						GPC6_uc010tig.1_Intron|GPC6_uc001vlu.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94592667	94592670	+	Intron	DEL	ATGG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94592667_94592670delATGG	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
HS6ST3	266722	broad.mit.edu	37	13	96974251	96974252	+	Intron	INS	-	A	A	rs34643797		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96974251_96974252insA	uc001vmw.2	+							NM_153456	NP_703157			heparan sulfate 6-O-sulfotransferase 3							integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	98154807	98154808	+	IGR	INS	-	A	A	rs144486055		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98154807_98154808insA								RAP2A (34556 upstream) : IPO5 (451121 downstream)																																			---	---	---	---
SLC15A1	6564	broad.mit.edu	37	13	99402370	99402371	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99402370_99402371insT	uc001vno.2	-							NM_005073	NP_005064			solute carrier family 15 (oligopeptide						digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	99806507	99806507	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99806507delT								DOCK9 (67847 upstream) : UBAC2 (46172 downstream)																																			---	---	---	---
PCCA	5095	broad.mit.edu	37	13	101063480	101063480	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101063480delT	uc001voo.2	+						PCCA_uc010aga.2_Intron|PCCA_uc010tiz.1_Intron|PCCA_uc001vop.2_Intron	NM_000282	NP_000273			propionyl-Coenzyme A carboxylase, alpha						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)													---	---	---	---
PCCA	5095	broad.mit.edu	37	13	101104070	101104071	+	Intron	DEL	CT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101104070_101104071delCT	uc001voo.2	+						PCCA_uc010aga.2_Intron|PCCA_uc010tiz.1_Intron|PCCA_uc001vop.2_Intron	NM_000282	NP_000273			propionyl-Coenzyme A carboxylase, alpha						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	101544926	101544935	+	IGR	DEL	GTGTGTGTGT	-	-	rs72095755		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101544926_101544935delGTGTGTGTGT								TMTC4 (217823 upstream) : NALCN (161195 downstream)																																			---	---	---	---
FGF14	2259	broad.mit.edu	37	13	102474202	102474202	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102474202delT	uc001vpe.2	-						FGF14_uc001vpf.2_Intron	NM_004115	NP_004106			fibroblast growth factor 14 isoform 1A						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
TPP2	7174	broad.mit.edu	37	13	103322521	103322522	+	Intron	INS	-	G	G	rs145444732	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103322521_103322522insG	uc001vpi.3	+							NM_003291	NP_003282			tripeptidyl peptidase II						proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	103927838	103927838	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103927838delT								SLC10A2 (208642 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	106145662	106145662	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106145662delA								DAOA (2280 upstream) : EFNB2 (996436 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	110523548	110523548	+	IGR	DEL	A	-	-	rs5806836		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110523548delA								IRS2 (84634 upstream) : COL4A1 (277763 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	112850802	112850803	+	IGR	INS	-	C	C	rs150042706	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112850802_112850803insC								SOX1 (124782 upstream) : C13orf28 (179866 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	113012726	113012727	+	IGR	INS	-	TG	TG	rs144967484	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113012726_113012727insTG								SOX1 (286706 upstream) : C13orf28 (17942 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	113252031	113252031	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113252031delA								TUBGCP3 (9550 upstream) : C13orf35 (49327 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19094789	19094790	+	IGR	INS	-	AA	AA	rs55851211		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19094789_19094790insAA								None (None upstream) : OR11H12 (282804 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19816556	19816556	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19816556delG								POTEG (231614 upstream) : P704P (167398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20221035	20221036	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20221035_20221036insA								OR4Q3 (4509 upstream) : OR4M1 (27446 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	22750270	22750270	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22750270delA	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
SLC7A8	23428	broad.mit.edu	37	14	23650246	23650248	+	Intron	DEL	AAG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23650246_23650248delAAG	uc001wiz.2	-						SLC7A8_uc010akj.2_Intron	NM_012244	NP_036376			solute carrier family 7 (cationic amino acid						blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity			ovary(1)	1	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)													---	---	---	---
Unknown	0	broad.mit.edu	37	14	23915523	23915523	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23915523delA								MYH7 (10653 upstream) : NGDN (23375 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	24862222	24862223	+	IGR	INS	-	TC	TC			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24862222_24862223insTC								NFATC4 (13414 upstream) : NYNRIN (5769 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	25729092	25729092	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25729092delT								STXBP6 (209921 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	28309075	28309076	+	IGR	INS	-	TC	TC	rs137951977	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28309075_28309076insTC								None (None upstream) : FOXG1 (927211 downstream)																																			---	---	---	---
PRKD1	5587	broad.mit.edu	37	14	30149197	30149197	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30149197delG	uc001wqh.2	-							NM_002742	NP_002733			protein kinase D1						cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	30494725	30494726	+	IGR	INS	-	T	T	rs140283804	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30494725_30494726insT								PRKD1 (97826 upstream) : G2E3 (533603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	35791893	35791893	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35791893delA								KIAA0391 (5220 upstream) : NFKBIA (78824 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	36724783	36724784	+	IGR	DEL	AA	-	-	rs34588535		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36724783_36724784delAA								BRMS1L (383615 upstream) : MBIP (42980 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	45745035	45745036	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45745035_45745036insA								C14orf106 (22430 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	48314348	48314348	+	IGR	DEL	T	-	-	rs141395331		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48314348delT								MDGA2 (170360 upstream) : None (None downstream)																																			---	---	---	---
L2HGDH	79944	broad.mit.edu	37	14	50764672	50764674	+	Intron	DEL	AAC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50764672_50764674delAAC	uc001wxu.2	-						L2HGDH_uc010tqn.1_Intron|L2HGDH_uc010tqo.1_Intron	NM_024884	NP_079160			L-2-hydroxyglutarate dehydrogenase precursor						2-oxoglutarate metabolic process|cellular protein metabolic process	integral to mitochondrial inner membrane	2-hydroxyglutarate dehydrogenase activity			ovary(2)	2	all_epithelial(31;0.000599)|Breast(41;0.0102)																	---	---	---	---
C14orf37	145407	broad.mit.edu	37	14	58758499	58758499	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58758499delA	uc010tro.1	-						uc001xdl.2_Intron|uc001xdm.1_Intron|uc001xdn.1_Intron|uc010apd.1_Intron|uc010ape.1_Intron	NM_001001872	NP_001001872			hypothetical protein LOC145407 precursor							integral to membrane	binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	59377565	59377565	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59377565delG								DACT1 (262529 upstream) : DAAM1 (277834 downstream)																																			---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64607928	64607929	+	Intron	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64607928_64607929delGT	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc001xgn.2_Intron|SYNE2_uc001xgo.2_5'Flank	NM_015180	NP_055995			spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	69515506	69515506	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69515506delT								ACTN1 (69423 upstream) : DCAF5 (2132 downstream)																																			---	---	---	---
UPF0639	400224	broad.mit.edu	37	14	69953280	69953280	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69953280delT	uc010ttf.1	+						UPF0639_uc001xli.2_Intron	NM_001161498	NP_001154970			similar to pleckstrin homology domain protein												0																		---	---	---	---
UPF0639	400224	broad.mit.edu	37	14	69978382	69978382	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69978382delT	uc010ttf.1	+							NM_001161498	NP_001154970			similar to pleckstrin homology domain protein												0																		---	---	---	---
KIAA0247	9766	broad.mit.edu	37	14	70140144	70140144	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70140144delA	uc001xlk.2	+						KIAA0247_uc010aqz.2_Intron	NM_014734	NP_055549			hypothetical protein LOC9766 precursor							integral to membrane				ovary(3)	3				all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)														---	---	---	---
DCAF4	26094	broad.mit.edu	37	14	73391625	73391625	+	5'Flank	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73391625delT	uc001xng.2	+						DCAF4_uc001xnj.2_5'Flank|DCAF4_uc010ttr.1_5'Flank|DCAF4_uc001xnh.2_5'Flank|DCAF4_uc010tts.1_5'Flank|DCAF4_uc010ttt.1_5'Flank|DCAF4_uc001xni.2_5'Flank	NM_015604	NP_056419			DDB1 and CUL4 associated factor 4 isoform 1							CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
ESRRB	2103	broad.mit.edu	37	14	76842906	76842906	+	Intron	DEL	G	-	-	rs34803646		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76842906delG	uc001xsr.2	+						ESRRB_uc001xso.2_Intron	NM_004452	NP_004443			estrogen-related receptor beta							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	80146805	80146806	+	Intron	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80146805_80146806delTG	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc001xup.2_Intron|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
GTF2A1	2957	broad.mit.edu	37	14	81661686	81661687	+	Intron	DEL	AA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81661686_81661687delAA	uc001xvf.1	-						GTF2A1_uc010atb.1_Intron|GTF2A1_uc001xvg.1_Intron	NM_015859	NP_056943			TFIIA alpha, p55 isoform 1						regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|transcription factor TFIIA complex	DNA binding|protein binding|protein heterodimerization activity|TBP-class protein binding|transcription coactivator activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0287)														---	---	---	---
KCNK10	54207	broad.mit.edu	37	14	88693225	88693226	+	Intron	DEL	GA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88693225_88693226delGA	uc001xwo.2	-						KCNK10_uc001xwm.2_Intron|KCNK10_uc001xwn.2_Intron	NM_021161	NP_066984			potassium channel, subfamily K, member 10						signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5																		---	---	---	---
ZC3H14	79882	broad.mit.edu	37	14	89033269	89033269	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89033269delA	uc001xww.2	+						ZC3H14_uc010twd.1_Intron|ZC3H14_uc010twe.1_Intron|ZC3H14_uc001xwx.2_Intron|ZC3H14_uc010twf.1_Intron|ZC3H14_uc001xwy.2_Intron	NM_024824	NP_079100			zinc finger CCCH-type containing 14 isoform 1							cytoplasm|cytoplasm|nuclear speck	protein binding|RNA binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
ATXN3	4287	broad.mit.edu	37	14	92549251	92549251	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92549251delC	uc001yac.3	-						ATXN3_uc010aug.2_Intron|ATXN3_uc001yad.3_Intron|ATXN3_uc010auh.2_Intron|ATXN3_uc001yae.3_Intron|ATXN3_uc010twl.1_Intron	NM_004993	NP_004984			ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	92728744	92728745	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92728744_92728745insT								CPSF2 (98201 upstream) : SLC24A4 (60180 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	97647843	97647844	+	IGR	DEL	CA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97647843_97647844delCA								VRK1 (299893 upstream) : C14orf64 (744103 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99338580	99338580	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99338580delA								C14orf177 (154483 upstream) : BCL11B (297047 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99792697	99792697	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99792697delG								BCL11B (54875 upstream) : SETD3 (71387 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	102774863	102774866	+	IGR	DEL	GCCT	-	-	rs141856928		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102774863_102774866delGCCT								RAGE (3332 upstream) : ZNF839 (8848 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20862300	20862301	+	IGR	INS	-	A	A	rs141438585		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20862300_20862301insA								GOLGA8C (81274 upstream) : BCL8 (7755 downstream)																																			---	---	---	---
UBE3A	7337	broad.mit.edu	37	15	25600931	25600932	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25600931_25600932insT	uc001zaq.2	-						uc001zae.2_Intron|UBE3A_uc001zar.2_Intron|UBE3A_uc001zas.2_Intron|UBE3A_uc001zat.2_Intron	NM_000462	NP_000453			ubiquitin protein ligase E3A isoform 2						brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)														---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27247892	27247892	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27247892delA	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27773853	27773854	+	Intron	DEL	AA	-	-	rs140454202		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27773853_27773854delAA	uc001zbg.1	+							NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
FAM189A1	23359	broad.mit.edu	37	15	29791510	29791514	+	Intron	DEL	TACTA	-	-	rs113364095		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29791510_29791514delTACTA	uc010azk.1	-							NM_015307	NP_056122			hypothetical protein LOC23359							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	31492850	31492851	+	IGR	INS	-	TG	TG	rs146135266	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31492850_31492851insTG								TRPM1 (98926 upstream) : KLF13 (126232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	36122962	36122965	+	Intron	DEL	CATA	-	-	rs139040934		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36122962_36122965delCATA	uc001zjc.2	+											Homo sapiens, Similar to LOC161538, clone IMAGE:5199550, mRNA.																														---	---	---	---
RTF1	23168	broad.mit.edu	37	15	41720775	41720775	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41720775delT	uc001zny.2	+							NM_015138	NP_055953			Paf1/RNA polymerase II complex component						histone modification|regulation of transcription, DNA-dependent|transcription initiation, DNA-dependent	nucleoplasm	protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)														---	---	---	---
FRMD5	84978	broad.mit.edu	37	15	44192817	44192818	+	Intron	INS	-	T	T	rs678513	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44192817_44192818insT	uc001ztl.2	-						FRMD5_uc001ztj.1_Intron|FRMD5_uc001ztk.1_Intron|FRMD5_uc001ztm.2_Intron|FRMD5_uc001ztn.2_Intron	NM_032892	NP_116281			FERM domain containing 5 isoform 2							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	45203464	45203467	+	IGR	DEL	AGGA	-	-	rs142412926		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45203464_45203467delAGGA								TRIM69 (143439 upstream) : C15orf43 (45436 downstream)																																			---	---	---	---
SPATA5L1	79029	broad.mit.edu	37	15	45700564	45700565	+	Intron	DEL	TC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45700564_45700565delTC	uc001zve.2	+						SPATA5L1_uc001zvf.2_Intron	NM_024063	NP_076968			spermatogenesis associated 5-like 1							cytoplasm	ATP binding|nucleoside-triphosphatase activity			ovary(3)|skin(1)	4		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)														---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	48002077	48002078	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48002077_48002078insA	uc001zvw.2	+							NM_020858	NP_065909			semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
COPS2	9318	broad.mit.edu	37	15	49436170	49436170	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49436170delG	uc001zxf.2	-						COPS2_uc001zxh.2_Intron|COPS2_uc010ufa.1_Intron	NM_004236	NP_004227			COP9 constitutive photomorphogenic homolog						cullin deneddylation|transcription from RNA polymerase II promoter	cytoplasm|signalosome	protein binding|signal transducer activity			lung(1)	1		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)														---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54543490	54543490	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54543490delC	uc002ack.2	+							NM_001080534	NP_001074003			unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
GCOM1	145781	broad.mit.edu	37	15	57883065	57883066	+	5'Flank	INS	-	AGGACCAGT	AGGACCAGT	rs150323724	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57883065_57883066insAGGACCAGT	uc002aei.2	+						GCOM1_uc002aej.2_5'Flank|GCOM1_uc002aek.2_5'Flank|GCOM1_uc002ael.2_5'Flank|GCOM1_uc002aem.2_5'Flank|GCOM1_uc002aeq.2_5'Flank|GCOM1_uc002aen.2_5'Flank|GCOM1_uc010bfy.2_5'Flank|GCOM1_uc002aeo.2_5'Flank|GCOM1_uc002aep.2_5'Flank|GCOM1_uc010bfx.2_5'Flank	NM_001018100	NP_001018110			GRINL1A upstream protein isoform 7						intracellular signal transduction	extrinsic to internal side of plasma membrane|I band				ovary(1)	1																		---	---	---	---
ALDH1A2	8854	broad.mit.edu	37	15	58500219	58500219	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58500219delC	uc010ugw.1	-							NM_170697	NP_733798			aldehyde dehydrogenase 1A2 isoform 3						negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	60482489	60482489	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60482489delT								FOXB1 (154081 upstream) : ANXA2 (156862 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	61779266	61779266	+	IGR	DEL	T	-	-	rs36076960		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61779266delT								RORA (257764 upstream) : VPS13C (365326 downstream)																																			---	---	---	---
TRIP4	9325	broad.mit.edu	37	15	64678819	64678822	+	5'Flank	DEL	GTGT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64678819_64678822delGTGT	uc002anm.2	+							NM_016213	NP_057297			thyroid hormone receptor interactor 4						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ligand-dependent nuclear receptor binding|transcription coactivator activity|zinc ion binding			ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	68867682	68867682	+	IGR	DEL	T	-	-	rs147492952		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68867682delT								ITGA11 (143190 upstream) : CORO2B (3891 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	70335964	70335965	+	IGR	INS	-	A	A	rs34490462		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70335964_70335965insA								C15orf50 (200659 upstream) : TLE3 (4578 downstream)																																			---	---	---	---
THSD4	79875	broad.mit.edu	37	15	71621872	71621872	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71621872delA	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
PARP6	56965	broad.mit.edu	37	15	72560099	72560099	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72560099delT	uc002auc.2	-						PARP6_uc002aua.2_5'Flank|PARP6_uc002aub.2_5'Flank|PARP6_uc002aud.3_Intron|PARP6_uc002auf.1_5'Flank|CELF6_uc010biv.1_Intron	NM_020214	NP_064599			poly (ADP-ribose) polymerase family, member 6								NAD+ ADP-ribosyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	73668015	73668015	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73668015delG								HCN4 (6410 upstream) : C15orf60 (67484 downstream)																																			---	---	---	---
LMAN1L	79748	broad.mit.edu	37	15	75107495	75107496	+	Intron	DEL	CA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75107495_75107496delCA	uc002ayt.1	+						LMAN1L_uc010bkd.2_Intron|LMAN1L_uc010ulo.1_Intron|LMAN1L_uc010bke.1_Intron	NM_021819	NP_068591			lectin, mannose-binding, 1 like precursor							ER-Golgi intermediate compartment membrane|integral to membrane	sugar binding				0																		---	---	---	---
MAN2C1	4123	broad.mit.edu	37	15	75661418	75661420	+	5'Flank	DEL	CGC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75661418_75661420delCGC	uc002baf.2	-						MAN2C1_uc002bag.2_5'Flank|MAN2C1_uc002bah.2_5'Flank|MAN2C1_uc010bkk.2_5'Flank|MAN2C1_uc010umi.1_5'Flank|MAN2C1_uc010umj.1_5'Flank|MAN2C1_uc010umk.1_5'Flank	NM_006715	NP_006706			mannosidase, alpha, class 2C, member 1						mannose metabolic process		alpha-mannosidase activity|carbohydrate binding|protein binding|zinc ion binding				0																		---	---	---	---
LINGO1	84894	broad.mit.edu	37	15	77916588	77916589	+	Intron	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77916588_77916589delTG	uc002bct.1	-						LINGO1_uc002bcu.1_Intron	NM_032808	NP_116197			leucine-rich repeat neuronal 6A						negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)|lung(1)	2																		---	---	---	---
KIAA1024	23251	broad.mit.edu	37	15	79724927	79724928	+	Intron	INS	-	GT	GT	rs149415905	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79724927_79724928insGT	uc002bew.1	+							NM_015206	NP_056021			hypothetical protein LOC23251							integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	80334584	80334584	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80334584delT								BCL2A1 (70941 upstream) : ZFAND6 (17437 downstream)																																			---	---	---	---
FAH	2184	broad.mit.edu	37	15	80459399	80459400	+	Intron	INS	-	T	T	rs139528602	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80459399_80459400insT	uc002bfj.2	+						FAH_uc002bfk.1_Intron|FAH_uc002bfm.1_Intron|FAH_uc002bfn.1_Intron	NM_000137	NP_000128			fumarylacetoacetase						L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	fumarylacetoacetase activity|metal ion binding				0														Tyrosinemia_type_1				---	---	---	---
Unknown	0	broad.mit.edu	37	15	80646884	80646884	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80646884delT								FAH (168202 upstream) : ARNT2 (49808 downstream)																																			---	---	---	---
ADAMTSL3	57188	broad.mit.edu	37	15	84443604	84443604	+	Intron	DEL	T	-	-	rs72416427		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84443604delT	uc002bjz.3	+						ADAMTSL3_uc002bjy.1_Intron|ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400			ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	86418746	86418747	+	IGR	DEL	AA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86418746_86418747delAA								KLHL25 (80557 upstream) : AGBL1 (266495 downstream)																																			---	---	---	---
C15orf58	390637	broad.mit.edu	37	15	90784045	90784046	+	Intron	INS	-	A	A	rs77298979		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90784045_90784046insA	uc002bpc.2	+							NM_001013657	NP_001013679			hypothetical protein LOC390637						glucose metabolic process	cytoplasm	GDP-D-glucose phosphorylase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	91392462	91392462	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91392462delA								BLM (33778 upstream) : FURIN (19423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	91906454	91906455	+	IGR	INS	-	A	A	rs150453209	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91906454_91906455insA								SV2B (67806 upstream) : SLCO3A1 (490483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	92789389	92789389	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92789389delA								SLCO3A1 (73724 upstream) : ST8SIA2 (147751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	93576917	93576917	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93576917delT								CHD2 (5681 upstream) : RGMA (9720 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	93811687	93811687	+	IGR	DEL	A	-	-	rs35685752		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93811687delA								RGMA (179254 upstream) : MCTP2 (963114 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96339168	96339169	+	IGR	INS	-	AC	AC	rs58549413		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96339168_96339169insAC								LOC145820 (288094 upstream) : NR2F2 (529988 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	98235612	98235612	+	IGR	DEL	T	-	-	rs34449126		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98235612delT								SPATA8 (906768 upstream) : LOC91948 (50234 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	101796009	101796010	+	IGR	DEL	TG	-	-	rs111550448		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101796009_101796010delTG								CHSY1 (3883 upstream) : SELS (15204 downstream)																																			---	---	---	---
PCSK6	5046	broad.mit.edu	37	15	101903839	101903840	+	Intron	INS	-	T	T	rs35985370		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101903839_101903840insT	uc002bwy.2	-						PCSK6_uc010bpd.2_Intron|PCSK6_uc010bpe.2_Intron|PCSK6_uc002bxa.2_Intron|PCSK6_uc002bxb.2_Intron|PCSK6_uc002bxc.1_Intron|PCSK6_uc002bxd.1_Intron	NM_002570	NP_002561			paired basic amino acid cleaving system 4						glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	102056849	102056849	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102056849delA								PCSK6 (26662 upstream) : TM2D3 (116331 downstream)																																			---	---	---	---
TPSB2	64499	broad.mit.edu	37	16	1277888	1277889	+	Intron	INS	-	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1277888_1277889insC	uc010brk.1	-						TPSG1_uc002ckw.2_5'Flank					Homo sapiens mast cell alpha II tryptase mRNA, complete cds, alternatively spliced.						proteolysis	extracellular region	protein binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	10703906	10703906	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10703906delA								EMP2 (29367 upstream) : TEKT5 (17455 downstream)																																			---	---	---	---
SNX29	92017	broad.mit.edu	37	16	12607402	12607402	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12607402delA	uc002dby.3	+							NM_001080530	NP_001073999			sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	14126875	14126875	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14126875delT								ERCC4 (80670 upstream) : MKL2 (38321 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	16725099	16725100	+	IGR	INS	-	A	A	rs79076955	by1000genomes;by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16725099_16725100insA								LOC339047 (280662 upstream) : XYLT1 (471083 downstream)																																			---	---	---	---
XYLT1	64131	broad.mit.edu	37	16	17333446	17333447	+	Intron	INS	-	TCCA	TCCA	rs148354192	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17333446_17333447insTCCA	uc002dfa.2	-							NM_022166	NP_071449			xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	17770703	17770703	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17770703delT								XYLT1 (205965 upstream) : NOMO2 (740480 downstream)																																			---	---	---	---
UMOD	7369	broad.mit.edu	37	16	20356762	20356764	+	Intron	DEL	TTC	-	-	rs10568780		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20356762_20356764delTTC	uc002dgz.2	-						UMOD_uc002dha.2_Intron|UMOD_uc002dhb.2_Intron	NM_003361	NP_003352			uromodulin precursor						cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	22786251	22786252	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22786251_22786252insA								LOC653786 (198065 upstream) : HS3ST2 (39608 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	24852822	24852822	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24852822delC								TNRC6A (15277 upstream) : SLC5A11 (4494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	28512512	28512512	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28512512delA	uc010vct.1	-						IL27_uc002dqc.2_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	32517938	32517938	+	IGR	DEL	G	-	-	rs75617045		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32517938delG								HERC2P4 (354064 upstream) : TP53TG3B (166903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32528591	32528592	+	IGR	INS	-	CT	CT	rs139394420		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32528591_32528592insCT								HERC2P4 (364717 upstream) : TP53TG3B (156249 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32539797	32539798	+	IGR	INS	-	A	A	rs138179239		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32539797_32539798insA								HERC2P4 (375923 upstream) : TP53TG3B (145043 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32818642	32818645	+	IGR	DEL	TTCA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32818642_32818645delTTCA								TP53TG3B (129764 upstream) : SLC6A10P (70152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33038077	33038077	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33038077delG								SLC6A10P (141614 upstream) : MIR1826 (927431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33934069	33934070	+	IGR	INS	-	GAT	GAT	rs143490527		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33934069_33934070insGAT								None (None upstream) : MIR1826 (31438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33950129	33950132	+	IGR	DEL	GGAT	-	-	rs75785649		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33950129_33950132delGGAT								None (None upstream) : MIR1826 (15376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34014174	34014174	+	IGR	DEL	T	-	-	rs146297641		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34014174delT								MIR1826 (48582 upstream) : UBE2MP1 (389628 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	35274393	35274393	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:35274393delT								LOC146481 (559426 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	49047321	49047321	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49047321delT								N4BP1 (403201 upstream) : CBLN1 (264890 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	50944085	50944085	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50944085delT								CYLD (108239 upstream) : SALL1 (225801 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51064149	51064149	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51064149delG								CYLD (228303 upstream) : SALL1 (105737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52102392	52102393	+	IGR	DEL	TG	-	-	rs72181005		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52102392_52102393delTG								SALL1 (917209 upstream) : TOX3 (369525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52705626	52705627	+	IGR	INS	-	T	T	rs140802093	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52705626_52705627insT								TOX3 (123912 upstream) : CHD9 (383318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	54587158	54587159	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54587158_54587159insA								IRX3 (266780 upstream) : IRX5 (377952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	56030058	56030059	+	IGR	DEL	AG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56030058_56030059delAG								CES7 (70686 upstream) : LOC283856 (96840 downstream)																																			---	---	---	---
NUP93	9688	broad.mit.edu	37	16	56810954	56810955	+	Intron	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56810954_56810955delGT	uc002eka.2	+							NM_014669	NP_055484			nucleoporin 93kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	60094204	60094204	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60094204delT								None (None upstream) : None (None downstream)																																			---	---	---	---
TERF2	7014	broad.mit.edu	37	16	69392586	69392586	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69392586delA	uc002exd.2	-							NM_005652	NP_005643			telomeric repeat binding factor 2						age-dependent telomere shortening|cell cycle|cellular senescence|negative regulation of telomere maintenance via semi-conservative replication|protection from non-homologous end joining at telomere|protein localization to chromosome, telomeric region|regulation of transcription, DNA-dependent|telomeric loop formation	Golgi apparatus|nuclear telomere cap complex|nucleoplasm	double-stranded telomeric DNA binding|protein C-terminus binding|protein homodimerization activity			lung(1)	1		Ovarian(137;0.101)																---	---	---	---
VAC14	55697	broad.mit.edu	37	16	70837971	70837971	+	5'Flank	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70837971delC	uc002ezm.2	-						VAC14_uc010cfw.2_5'Flank|VAC14_uc002ezn.2_5'Flank	NM_018052	NP_060522			Vac14 homolog						interspecies interaction between organisms	endoplasmic reticulum|endosome membrane|microsome	protein binding|receptor activity			pancreas(1)|skin(1)	2		Ovarian(137;0.0699)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	71849513	71849513	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71849513delA								AP1G1 (6537 upstream) : ATXN1L (30386 downstream)																																			---	---	---	---
BCAR1	9564	broad.mit.edu	37	16	75280567	75280567	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75280567delC	uc002fdv.2	-						BCAR1_uc010vna.1_Intron|BCAR1_uc010vnb.1_Intron|BCAR1_uc002fdw.2_Intron|BCAR1_uc010vnc.1_Intron|BCAR1_uc010vnd.1_Intron|BCAR1_uc002fdx.2_Intron	NM_014567	NP_055382			breast cancer anti-estrogen resistance 1						actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity			central_nervous_system(5)|breast(2)|prostate(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.169)														---	---	---	---
VAT1L	57687	broad.mit.edu	37	16	77925388	77925388	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77925388delT	uc002ffg.1	+							NM_020927	NP_065978			vesicle amine transport protein 1 homolog (T.								oxidoreductase activity|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	80022300	80022301	+	IGR	INS	-	A	A	rs139689740	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80022300_80022301insA								MAF (387678 upstream) : DYNLRB2 (552553 downstream)																																			---	---	---	---
CMIP	80790	broad.mit.edu	37	16	81674344	81674345	+	Intron	DEL	TG	-	-	rs72519457		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81674344_81674345delTG	uc002fgp.2	+						CMIP_uc002fgq.1_Intron|CMIP_uc010vnq.1_Intron	NM_198390	NP_938204			c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0																		---	---	---	---
PLCG2	5336	broad.mit.edu	37	16	81843596	81843597	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81843596_81843597insT	uc002fgt.2	+						PLCG2_uc010chg.1_Intron	NM_002661	NP_002652			phospholipase C, gamma 2						intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	84564893	84564894	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84564893_84564894insT								KIAA1609 (26605 upstream) : COTL1 (34312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86175390	86175391	+	IGR	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86175390_86175391delGT								IRF8 (219181 upstream) : LOC732275 (190065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	88278000	88278003	+	IGR	DEL	TGGA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88278000_88278003delTGGA								BANP (167077 upstream) : ZNF469 (215876 downstream)																																			---	---	---	---
ACSF3	197322	broad.mit.edu	37	16	89211955	89211955	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89211955delC	uc002fmp.2	+						ACSF3_uc010cig.1_Intron|ACSF3_uc010cih.1_Intron|ACSF3_uc002fmq.1_Intron|ACSF3_uc010cii.1_Intron|ACSF3_uc002fmr.1_Intron	NM_174917	NP_777577			acyl-CoA synthetase family member 3 precursor						fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)														---	---	---	---
CDK10	8558	broad.mit.edu	37	16	89753068	89753099	+	5'UTR	DEL	GGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89753068_89753099delGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA	uc010cio.2	+	1					uc002fnz.3_5'Flank|CDK10_uc002foa.2_5'UTR|CDK10_uc010cip.2_5'UTR|CDK10_uc010vpl.1_5'UTR|CDK10_uc002fob.2_5'UTR|CDK10_uc002fod.2_5'UTR|CDK10_uc002foe.2_5'UTR|CDK10_uc002fof.2_5'UTR|CDK10_uc002fog.3_5'UTR|CDK10_uc002foh.3_5'UTR	NM_052988	NP_443714			cyclin-dependent kinase 10 isoform a						negative regulation of cell proliferation|traversing start control point of mitotic cell cycle		ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)														---	---	---	---
MC1R	4157	broad.mit.edu	37	16	89981374	89981375	+	5'Flank	INS	-	GCCTGTGTGGG	GCCTGTGTGGG			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89981374_89981375insGCCTGTGTGGG	uc002fpe.3	+						uc010ciy.1_RNA	NM_002386	NP_002377			melanocortin 1 receptor						G-protein signaling, coupled to cyclic nucleotide second messenger|intracellular protein kinase cascade|multicellular organismal development|negative regulation of tumor necrosis factor production|pigmentation|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|positive regulation of protein kinase B signaling cascade|positive regulation of protein kinase C signaling cascade|positive regulation of transcription from RNA polymerase II promoter|UV protection|UV-damage excision repair	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|ubiquitin protein ligase binding				0		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)										Melanoma_Familial_Clustering_of				---	---	---	---
P2RX1	5023	broad.mit.edu	37	17	3802504	3802504	+	Intron	DEL	T	-	-	rs71381525		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3802504delT	uc002fww.2	-							NM_002558	NP_002549			purinergic receptor P2X1						platelet activation	integral to plasma membrane	calcium channel activity|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity			ovary(1)|skin(1)	2				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)														---	---	---	---
MYBBP1A	10514	broad.mit.edu	37	17	4455005	4455005	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4455005delA	uc002fyb.3	-						MYBBP1A_uc002fxz.3_Intron	NM_014520	NP_055335			MYB binding protein 1a isoform 2						nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NLS-dependent protein nuclear import complex|nucleolus	DNA binding|DNA-directed DNA polymerase activity|transcription factor binding			ovary(1)|skin(1)	2																		---	---	---	---
ARRB2	409	broad.mit.edu	37	17	4611779	4611780	+	5'Flank	INS	-	ACC	ACC	rs144143638	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4611779_4611780insACC	uc002fyj.2	+						ARRB2_uc002fyk.2_5'Flank|ARRB2_uc002fyl.2_5'Flank|ARRB2_uc010vsg.1_5'Flank|ARRB2_uc002fym.2_5'Flank|ARRB2_uc002fyn.2_5'Flank|ARRB2_uc010ckq.2_5'Flank	NM_004313	NP_004304			arrestin, beta 2 isoform 1						cell chemotaxis|desensitization of G-protein coupled receptor protein signaling pathway by arrestin|G-protein coupled receptor internalization|negative regulation of natural killer cell mediated cytotoxicity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|transcription from RNA polymerase II promoter|transforming growth factor beta receptor signaling pathway	coated pit|cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	angiotensin receptor binding|ubiquitin protein ligase binding				0																		---	---	---	---
FGF11	2256	broad.mit.edu	37	17	7332553	7332553	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7332553delT	uc010vtw.1	+											Homo sapiens mRNA for fibroblast growth factor 11 variant protein.						cell-cell signaling|nervous system development|signal transduction		growth factor activity				0		Prostate(122;0.157)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	9702275	9702282	+	IGR	DEL	CGCAGCGT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9702275_9702282delCGCAGCGT								DHRS7C (7674 upstream) : GLP2R (27099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	17287644	17287644	+	IGR	DEL	G	-	-	rs115252562	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17287644delG								NT5M (36669 upstream) : MED9 (92656 downstream)																																			---	---	---	---
FBXW10	10517	broad.mit.edu	37	17	18671432	18671434	+	Intron	DEL	CAG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18671432_18671434delCAG	uc002guk.2	+						FBXW10_uc002guj.2_Intron|FBXW10_uc002gul.2_Intron|FBXW10_uc010cqh.1_Intron	NM_031456	NP_113644			F-box and WD-40 domain protein 10											ovary(1)	1																		---	---	---	---
KCNJ12	3768	broad.mit.edu	37	17	21306688	21306690	+	Intron	DEL	ACA	-	-	rs144651249	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21306688_21306690delACA	uc002gyv.1	+							NM_021012	NP_066292			potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)										Prostate(3;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21544107	21544110	+	IGR	DEL	CTTT	-	-	rs111972328		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21544107_21544110delCTTT								C17orf51 (66376 upstream) : FAM27L (281260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21561290	21561290	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21561290delA								C17orf51 (83559 upstream) : FAM27L (264080 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25274726	25274737	+	IGR	DEL	TCCAGTTCTAAC	-	-	rs112871657		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25274726_25274737delTCCAGTTCTAAC								None (None upstream) : WSB1 (346369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	26366570	26366570	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26366570delT								NOS2 (146161 upstream) : NLK (3118 downstream)																																			---	---	---	---
KIAA0100	9703	broad.mit.edu	37	17	26968676	26968677	+	Intron	INS	-	A	A	rs112718398		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26968676_26968677insA	uc002hbu.2	-						KIAA0100_uc002hbv.2_Intron|KIAA0100_uc010crr.1_Intron	NM_014680	NP_055495			hypothetical protein LOC9703 precursor							extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	28996750	28996750	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28996750delA								LRRC37B2 (4035 upstream) : SUZ12P (38964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	29989843	29989844	+	IGR	INS	-	T	T	rs72538110		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29989843_29989844insT								MIR365-2 (87303 upstream) : C17orf79 (189041 downstream)																																			---	---	---	---
RHBDL3	162494	broad.mit.edu	37	17	30647124	30647124	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30647124delA	uc002hhe.1	+						RHBDL3_uc010csw.1_Intron|RHBDL3_uc010csx.1_Intron|RHBDL3_uc010csy.1_Intron|RHBDL3_uc002hhf.1_Intron	NM_138328	NP_612201			rhomboid protease 3						proteolysis	integral to membrane	calcium ion binding|serine-type endopeptidase activity			ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)																---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31652139	31652142	+	Intron	DEL	AAAC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31652139_31652142delAAAC	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	36857323	36857323	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36857323delT								C17orf96 (26136 upstream) : MLLT6 (4550 downstream)																																			---	---	---	---
PIP4K2B	8396	broad.mit.edu	37	17	36952007	36952007	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36952007delA	uc002hqs.2	-						PIP4K2B_uc010wdt.1_Intron	NM_003559	NP_003550			phosphatidylinositol-5-phosphate 4-kinase, type						cell surface receptor linked signaling pathway	endoplasmic reticulum membrane|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|receptor signaling protein activity			ovary(1)	1																		---	---	---	---
FBXL20	84961	broad.mit.edu	37	17	37432600	37432600	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37432600delG	uc010wed.1	-						FBXL20_uc002hrt.2_Intron|FBXL20_uc010cvu.2_Intron	NM_032875	NP_116264			F-box and leucine-rich repeat protein 20							cytoplasm				ovary(1)	1			LUAD - Lung adenocarcinoma(14;0.146)															---	---	---	---
ACLY	47	broad.mit.edu	37	17	40050808	40050809	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40050808_40050809insA	uc002hyg.2	-						ACLY_uc002hyh.2_Intron|ACLY_uc002hyi.2_Intron|ACLY_uc010wfx.1_Intron|ACLY_uc010wfy.1_Intron	NM_001096	NP_001087			ATP citrate lyase isoform 1						ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	41792506	41792507	+	IGR	DEL	TT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41792506_41792507delTT								MEOX1 (53244 upstream) : SOST (38592 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	42087825	42087825	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42087825delA								NAGS (1390 upstream) : TMEM101 (732 downstream)																																			---	---	---	---
ASB16	92591	broad.mit.edu	37	17	42246750	42246750	+	5'Flank	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42246750delA	uc002ifl.1	+						ASB16_uc002ifm.1_5'Flank	NM_080863	NP_543139			ankyrin repeat and SOCS box-containing protein						intracellular signal transduction		protein binding			kidney(2)	2		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)														---	---	---	---
GPATCH8	23131	broad.mit.edu	37	17	42561193	42561194	+	Intron	INS	-	TTG	TTG	rs147675276	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42561193_42561194insTTG	uc002igw.1	-						GPATCH8_uc010wiz.1_Intron	NM_001002909	NP_001002909			G patch domain containing 8							intracellular	nucleic acid binding|zinc ion binding			ovary(2)|kidney(1)|skin(1)	4		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)														---	---	---	---
NMT1	4836	broad.mit.edu	37	17	43159641	43159641	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43159641delT	uc002ihz.2	+						NMT1_uc010dac.1_Intron|NMT1_uc002iia.2_Intron	NM_021079	NP_066565			N-myristoyltransferase 1						activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals|N-terminal protein myristoylation|protein lipoylation	actin cytoskeleton|cell junction|cytosol	glycylpeptide N-tetradecanoyltransferase activity				0		Prostate(33;0.155)																---	---	---	---
ARHGAP27	201176	broad.mit.edu	37	17	43491809	43491809	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43491809delT	uc002iix.2	-							NM_199282	NP_954976			Rho GTPase activating protein 27 isoform a						positive regulation of Cdc42 GTPase activity|receptor-mediated endocytosis|signal transduction	cytoplasm|membrane	Rac GTPase activator activity|SH3 domain binding				0	Renal(3;0.0405)																	---	---	---	---
TTLL6	284076	broad.mit.edu	37	17	46848043	46848043	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46848043delT	uc010wlo.1	-						TTLL6_uc002iob.2_Intron|TTLL6_uc010dbi.2_Intron|TTLL6_uc002ioc.2_Intron|TTLL6_uc002iod.2_Intron	NM_001130918	NP_001124390			tubulin tyrosine ligase-like family, member 6							cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity				0																		---	---	---	---
LRRC59	55379	broad.mit.edu	37	17	48475621	48475621	+	5'Flank	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48475621delC	uc002iqt.2	-							NM_018509	NP_060979			leucine rich repeat containing 59							endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial nucleoid	protein binding			central_nervous_system(1)	1	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)															---	---	---	---
CA10	56934	broad.mit.edu	37	17	50227276	50227276	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50227276delG	uc002itw.3	-						CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563			carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	52465780	52465781	+	IGR	DEL	TC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52465780_52465781delTC								KIF2B (563207 upstream) : TOM1L1 (512271 downstream)																																			---	---	---	---
TUBD1	51174	broad.mit.edu	37	17	57944904	57944904	+	Intron	DEL	A	-	-	rs80196333		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57944904delA	uc002ixw.1	-						TUBD1_uc010ddf.1_Intron|TUBD1_uc010ddg.1_Intron|TUBD1_uc010ddh.1_Intron|TUBD1_uc010wok.1_Intron|TUBD1_uc002ixx.1_Intron|TUBD1_uc010wol.1_Intron|TUBD1_uc010ddi.1_Intron	NM_016261	NP_057345			delta-tubulin						cell differentiation|microtubule-based movement|multicellular organismal development|protein polymerization|spermatogenesis	centriole|microtubule|nucleus	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	67670017	67670018	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67670017_67670018insT								MAP2K6 (131555 upstream) : KCNJ16 (401408 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69102171	69102172	+	Intron	DEL	TG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69102171_69102172delTG	uc002jis.3	-											Homo sapiens cDNA clone IMAGE:5267277.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	70553939	70553940	+	Intron	DEL	AC	-	-	rs145738290		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70553939_70553940delAC	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	71320056	71320056	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71320056delC								CDC42EP4 (11913 upstream) : SDK2 (10468 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	73160258	73160258	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73160258delA								HN1 (9483 upstream) : SUMO2 (3568 downstream)																																			---	---	---	---
MRPL38	64978	broad.mit.edu	37	17	73897033	73897034	+	Intron	INS	-	C	C	rs149514417	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73897033_73897034insC	uc010wso.1	-						FBF1_uc002jqa.1_Intron|MRPL38_uc002jpz.1_Intron	NM_032478	NP_115867			mitochondrial ribosomal protein L38 precursor							actin cytoskeleton|mitochondrion|ribosome				pancreas(1)	1			all cancers(21;0.000154)|Epithelial(20;0.000156)|BRCA - Breast invasive adenocarcinoma(9;0.00936)|LUSC - Lung squamous cell carcinoma(166;0.154)															---	---	---	---
SEPT9	10801	broad.mit.edu	37	17	75481316	75481318	+	Intron	DEL	TGG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75481316_75481318delTGG	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron|SEPT9_uc002jtv.2_Intron|SEPT9_uc002jtw.2_Intron|SEPT9_uc010wtl.1_Intron|SEPT9_uc002jty.3_Intron|SEPT9_uc010wtm.1_Intron|SEPT9_uc010wtn.1_Intron|SEPT9_uc010dhd.2_Intron	NM_001113491	NP_001106963			septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)															---	---	---	---
AATK	9625	broad.mit.edu	37	17	79122603	79122606	+	Intron	DEL	CACT	-	-	rs145531592		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79122603_79122606delCACT	uc010dia.2	-							NM_001080395	NP_001073864			apoptosis-associated tyrosine kinase							integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)															---	---	---	---
YES1	7525	broad.mit.edu	37	18	749169	749171	+	Intron	DEL	AAA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:749169_749171delAAA	uc002kky.2	-						YES1_uc002kkz.2_Intron	NM_005433	NP_005424			viral oncogene yes-1 homolog 1						blood coagulation|leukocyte migration|regulation of vascular permeability|T cell costimulation	cytosol|plasma membrane	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|ovary(1)	3					Dasatinib(DB01254)													---	---	---	---
TGIF1	7050	broad.mit.edu	37	18	3443868	3443870	+	Intron	DEL	AAT	-	-	rs71669729		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3443868_3443870delAAT	uc002klu.2	+							NM_174886	NP_777480			TG-interacting factor isoform d						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)																---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	3801407	3801407	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3801407delC	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron|DLGAP1_uc002kmk.2_Intron	NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
ANKRD12	23253	broad.mit.edu	37	18	9274171	9274171	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9274171delA	uc002knv.2	+						ANKRD12_uc002knw.2_Intron|ANKRD12_uc002knx.2_Intron	NM_015208	NP_056023			ankyrin repeat domain 12 isoform 1							nucleus				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	9417693	9417694	+	IGR	INS	-	T	T	rs139828987		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9417693_9417694insT								TWSG1 (15276 upstream) : RALBP1 (57313 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	9457283	9457285	+	IGR	DEL	AGG	-	-	rs66542513		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9457283_9457285delAGG								TWSG1 (54866 upstream) : RALBP1 (17722 downstream)																																			---	---	---	---
RALBP1	10928	broad.mit.edu	37	18	9521671	9521671	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9521671delT	uc002kob.2	+						RALBP1_uc002koc.2_Intron	NM_006788	NP_006779			ralA binding protein 1						chemotaxis|positive regulation of Cdc42 GTPase activity|small GTPase mediated signal transduction|transport	cytosol|membrane	ATPase activity, coupled to movement of substances|Rac GTPase activator activity|Rac GTPase binding|Ral GTPase binding			central_nervous_system(1)	1																		---	---	---	---
RAB31	11031	broad.mit.edu	37	18	9803238	9803238	+	Intron	DEL	T	-	-	rs72270506		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9803238delT	uc002kog.2	+							NM_006868	NP_006859			RAB31, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	10128168	10128169	+	IGR	DEL	CA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10128168_10128169delCA								VAPA (168151 upstream) : APCDD1 (326456 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	10150892	10150893	+	IGR	INS	-	GC	GC	rs72320644		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10150892_10150893insGC								VAPA (190875 upstream) : APCDD1 (303732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	10250366	10250366	+	5'Flank	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10250366delC	uc002kol.1	-											Homo sapiens cDNA FLJ34223 fis, clone FCBBF3023061.																														---	---	---	---
ANKRD30B	374860	broad.mit.edu	37	18	14773897	14773897	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14773897delC	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501			ankyrin repeat domain 30B											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	20002670	20002671	+	IGR	DEL	GT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20002670_20002671delGT								CTAGE1 (4792 upstream) : RBBP8 (510624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	22328645	22328646	+	IGR	INS	-	T	T	rs146299092	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22328645_22328646insT								HRH4 (268725 upstream) : ZNF521 (313242 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	24781153	24781154	+	IGR	DEL	TC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24781153_24781154delTC								C18orf16 (10503 upstream) : CDH2 (749776 downstream)																																			---	---	---	---
CDH2	1000	broad.mit.edu	37	18	25744630	25744631	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25744630_25744631delAC	uc002kwg.2	-							NM_001792	NP_001783			cadherin 2, type 1 preproprotein						adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	39201280	39201281	+	IGR	DEL	GA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39201280_39201281delGA								KC6 (100719 upstream) : PIK3C3 (333918 downstream)																																			---	---	---	---
SLC14A2	8170	broad.mit.edu	37	18	43226736	43226736	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43226736delA	uc010dnj.2	+						SLC14A2_uc002lbe.2_Intron	NM_007163	NP_009094			solute carrier family 14 (urea transporter),							apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	43267816	43267817	+	IGR	INS	-	GTGCT	GTGCT	rs146895916	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43267816_43267817insGTGCT								SLC14A2 (4758 upstream) : SLC14A1 (36275 downstream)																																			---	---	---	---
IER3IP1	51124	broad.mit.edu	37	18	44702246	44702246	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44702246delA	uc002lcu.2	-							NM_016097	NP_057181			immediate early response 3 interacting protein							endoplasmic reticulum membrane|Golgi apparatus|integral to membrane					0																		---	---	---	---
WDR7	23335	broad.mit.edu	37	18	54436451	54436452	+	Intron	DEL	TT	-	-	rs36006693		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54436451_54436452delTT	uc002lgk.1	+						WDR7_uc010dpk.1_Intron|WDR7_uc002lgl.1_Intron	NM_015285	NP_056100			rabconnectin-3 beta isoform 1											ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)														---	---	---	---
CCBE1	147372	broad.mit.edu	37	18	57141089	57141090	+	Intron	INS	-	T	T	rs140420396		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57141089_57141090insT	uc002lib.2	-							NM_133459	NP_597716			collagen and calcium binding EGF domains 1						lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)																---	---	---	---
PIGN	23556	broad.mit.edu	37	18	59740404	59740407	+	Intron	DEL	GTGT	-	-	rs34182707		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59740404_59740407delGTGT	uc002lii.3	-						PIGN_uc002lij.3_Intron	NM_176787	NP_789744			phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5		Colorectal(73;0.187)																---	---	---	---
BCL2	596	broad.mit.edu	37	18	60885975	60885975	+	Intron	DEL	T	-	-	rs113355863	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60885975delT	uc002lit.1	-						BCL2_uc002liu.1_Intron	NM_000633	NP_000624			B-cell lymphoma protein 2 alpha isoform						activation of pro-apoptotic gene products|anti-apoptosis|apoptosis in response to endoplasmic reticulum stress|B cell proliferation|B cell receptor signaling pathway|defense response to virus|female pregnancy|humoral immune response|induction of apoptosis by intracellular signals|negative regulation of cellular pH reduction|negative regulation of mitochondrial depolarization|negative regulation of neuron apoptosis|neuron apoptosis|positive regulation of B cell proliferation|positive regulation of cell growth|protein polyubiquitination|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|regulation of transmembrane transporter activity|release of cytochrome c from mitochondria|response to cytokine stimulus|response to DNA damage stimulus|response to drug|response to iron ion|response to nicotine|response to toxin	endoplasmic reticulum membrane|mitochondrial outer membrane|nuclear membrane|pore complex	BH3 domain binding|channel activity|protease binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|ubiquitin protein ligase binding			central_nervous_system(1)	1		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Fludarabine(DB01073)|Melatonin(DB01065)|Paclitaxel(DB01229)|Rasagiline(DB01367)			T	IGH@	NHL|CLL								---	---	---	---
Unknown	0	broad.mit.edu	37	18	78008879	78008882	+	IGR	DEL	TTGT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:78008879_78008882delTTGT								PARD6G (3482 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	395094	395094	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:395094delG								THEG (19085 upstream) : C2CD4C (10350 downstream)																																			---	---	---	---
SPPL2B	56928	broad.mit.edu	37	19	2348742	2348743	+	Intron	DEL	TC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2348742_2348743delTC	uc002lvs.2	+						SPPL2B_uc002lvr.2_Intron	NM_152988	NP_694533			signal peptide peptidase-like 2B isoform 2							Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
THOP1	7064	broad.mit.edu	37	19	2789751	2789751	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2789751delT	uc002lwj.2	+							NM_003249	NP_003240			thimet oligopeptidase 1						proteolysis	cytoplasm	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	5347560	5347560	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5347560delT								PTPRS (6746 upstream) : ZNRF4 (107866 downstream)																																			---	---	---	---
INSR	3643	broad.mit.edu	37	19	7227986	7227987	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7227986_7227987insA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199			insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
DNM2	1785	broad.mit.edu	37	19	10886927	10886927	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10886927delT	uc002mps.1	+						DNM2_uc010dxk.2_Intron|DNM2_uc002mpt.1_Intron|DNM2_uc002mpv.1_Intron|DNM2_uc002mpu.1_Intron|DNM2_uc010dxl.1_Intron	NM_001005361	NP_001005361			dynamin 2 isoform 2						G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding			central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)															---	---	---	---
DOCK6	57572	broad.mit.edu	37	19	11369115	11369117	+	Intron	DEL	TTT	-	-	rs115952271	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11369115_11369117delTTT	uc002mqs.3	-							NM_020812	NP_065863			dedicator of cytokinesis 6						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3																		---	---	---	---
RGL3	57139	broad.mit.edu	37	19	11495173	11495174	+	3'UTR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11495173_11495174insT	uc002mrn.2	-	19					EPOR_uc002mri.2_5'Flank|EPOR_uc002mrk.1_5'Flank|EPOR_uc002mrl.1_5'Flank|EPOR_uc002mrj.1_5'Flank|EPOR_uc010xlx.1_5'Flank|EPOR_uc010xly.1_5'Flank|RGL3_uc002mrm.2_3'UTR					SubName: Full=FLJ00153 protein; Flags: Fragment;						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	11994765	11994766	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11994765_11994766insA								ZNF439 (14460 upstream) : ZNF69 (3904 downstream)																																			---	---	---	---
ZNF490	57474	broad.mit.edu	37	19	12712202	12712202	+	Intron	DEL	A	-	-	rs111773160		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12712202delA	uc002mtz.2	-							NM_020714	NP_065765			zinc finger protein 490						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
C19orf44	84167	broad.mit.edu	37	19	16628260	16628261	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16628260_16628261delAC	uc002neh.1	+						MED26_uc002nee.2_Intron|C19orf44_uc002neg.2_Intron|C19orf44_uc010eai.1_Intron	NM_032207	NP_115583			hypothetical protein LOC84167												0																		---	---	---	---
ARRDC2	27106	broad.mit.edu	37	19	18111475	18111476	+	5'Flank	INS	-	GGAA	GGAA	rs141584055	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18111475_18111476insGGAA	uc002nhu.2	+							NM_001025604	NP_001020775			arrestin domain containing 2 isoform 2											pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	24550625	24550626	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24550625_24550626insT								LOC100101266 (204376 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28878257	28878258	+	IGR	DEL	AG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28878257_28878258delAG								LOC148189 (593409 upstream) : LOC148145 (577782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29127022	29127023	+	Intron	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29127022_29127023delAC	uc002nsa.1	-											Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	29651940	29651941	+	IGR	INS	-	A	A	rs77025198		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29651940_29651941insA								LOC148145 (191885 upstream) : UQCRFS1 (46226 downstream)																																			---	---	---	---
CCNE1	898	broad.mit.edu	37	19	30306530	30306531	+	Intron	DEL	TT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30306530_30306531delTT	uc002nsn.2	+						CCNE1_uc002nso.2_Intron	NM_001238	NP_001229			cyclin E1 isoform 1						androgen receptor signaling pathway|cell division|positive regulation of transcription, DNA-dependent|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm	androgen receptor binding|protein kinase binding|transcription coactivator activity			lung(2)	2	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	32668476	32668487	+	IGR	DEL	AGGAAGGCAGGC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32668476_32668487delAGGAAGGCAGGC								TSHZ3 (828286 upstream) : ZNF507 (168027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	32882997	32882998	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32882997_32882998insA								ZNF507 (4426 upstream) : DPY19L3 (13679 downstream)																																			---	---	---	---
CCDC123	84902	broad.mit.edu	37	19	33398583	33398583	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33398583delC	uc002nty.2	-						CCDC123_uc002ntx.2_Intron|CCDC123_uc010edg.2_Intron	NM_032816	NP_116205			coiled-coil domain containing 123							centrosome|spindle pole					0	Esophageal squamous(110;0.137)																	---	---	---	---
GPATCH1	55094	broad.mit.edu	37	19	33577876	33577876	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33577876delA	uc002nug.1	+							NM_018025	NP_060495			G patch domain containing 1							catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)																	---	---	---	---
WDR88	126248	broad.mit.edu	37	19	33645122	33645122	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33645122delT	uc002nui.2	+							NM_173479	NP_775750			PQQ repeat and WD repeat domain containing											ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	34109532	34109533	+	IGR	INS	-	TCT	TCT			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34109532_34109533insTCT								PEPD (96731 upstream) : CHST8 (3328 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	34308752	34308753	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34308752_34308753insA								KCTD15 (2087 upstream) : LSM14A (354599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	34572504	34572507	+	IGR	DEL	AGAC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34572504_34572507delAGAC								KCTD15 (265839 upstream) : LSM14A (90845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	35022271	35022271	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35022271delT								WTIP (30187 upstream) : LOC643719 (45368 downstream)																																			---	---	---	---
MAG	4099	broad.mit.edu	37	19	35783548	35783549	+	Intron	DEL	GT	-	-	rs72483562		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35783548_35783549delGT	uc002nyy.1	+						MAG_uc002nyx.1_Intron|MAG_uc010eds.1_Intron|MAG_uc002nyz.1_Intron	NM_002361	NP_002352			myelin associated glycoprotein isoform a						blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)															---	---	---	---
ZNF568	374900	broad.mit.edu	37	19	37476414	37476418	+	Intron	DEL	TTTGT	-	-	rs112585514		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37476414_37476418delTTTGT	uc010efg.2	+						ZNF568_uc010xtn.1_Intron|uc010efi.2_Intron					SubName: Full=cDNA FLJ57578, moderately similar to Mus musculus zinc finger protein 568 (Zfp568), mRNA;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
ZNF607	84775	broad.mit.edu	37	19	38208935	38208935	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38208935delA	uc002ohc.1	-						ZNF607_uc002ohb.1_Intron	NM_032689	NP_116078			zinc finger protein 607						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)															---	---	---	---
ZNF573	126231	broad.mit.edu	37	19	38277330	38277330	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38277330delA	uc010efs.2	-							NM_152360	NP_689573			zinc finger protein 573						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)															---	---	---	---
PAK4	10298	broad.mit.edu	37	19	39631960	39631961	+	Intron	INS	-	TT	TT	rs36112621		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39631960_39631961insTT	uc002okj.1	+						PAK4_uc002okl.1_Intron|PAK4_uc002okn.1_Intron|PAK4_uc002okm.1_Intron|PAK4_uc002oko.1_Intron|PAK4_uc002okp.1_Intron	NM_001014831	NP_001014831			p21-activated kinase 4 isoform 1						cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)															---	---	---	---
PSMC4	5704	broad.mit.edu	37	19	40479172	40479172	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40479172delA	uc002omq.2	+						PSMC4_uc002omr.2_Intron	NM_006503	NP_006494			proteasome 26S ATPase subunit 4 isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding			ovary(1)	1	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)																	---	---	---	---
AKT2	208	broad.mit.edu	37	19	40759767	40759767	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40759767delA	uc002onf.2	-						AKT2_uc010egs.2_Intron|AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_Intron|AKT2_uc010xvk.1_Intron	NM_001626	NP_001617			AKT2 kinase						insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)					A		ovarian|pancreatic 								---	---	---	---
Unknown	0	broad.mit.edu	37	19	41344722	41344722	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41344722delT								EGLN2 (30386 upstream) : CYP2A6 (4722 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	41542697	41542697	+	IGR	DEL	A	-	-	rs144323296		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41542697delA								CYP2A7 (8529 upstream) : CYP2A13 (51671 downstream)																																			---	---	---	---
CYP2F1	1572	broad.mit.edu	37	19	41634784	41634786	+	Intron	DEL	GAA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41634784_41634786delGAA	uc010xvw.1	+											SubName: Full=cDNA FLJ51986, highly similar to Homo sapiens cytochrome P450, family 2, subfamily F, polypeptide 1 (CYP2F1), mRNA;						naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0																		---	---	---	---
CYP2S1	29785	broad.mit.edu	37	19	41706982	41706982	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41706982delA	uc002opw.2	+						CYP2F1_uc010xvw.1_Intron|CYP2S1_uc010xvx.1_Intron	NM_030622	NP_085125			cytochrome P450, family 2, subfamily S,						xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity			skin(1)	1																		---	---	---	---
TEX101	83639	broad.mit.edu	37	19	43898625	43898625	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43898625delT	uc002owk.2	+							NM_031451	NP_113639			testis expressed 101 isoform 1							anchored to membrane|plasma membrane				ovary(1)	1		Prostate(69;0.0199)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	44913846	44913846	+	IGR	DEL	T	-	-	rs141099773	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44913846delT								ZFP112 (8069 upstream) : ZNF229 (16580 downstream)																																			---	---	---	---
CKM	1158	broad.mit.edu	37	19	45822685	45822685	+	Intron	DEL	C	-	-	rs68016783		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45822685delC	uc002pbd.2	-							NM_001824	NP_001815			muscle creatine kinase						creatine metabolic process	cytosol	ATP binding|creatine kinase activity			skin(1)	1		Ovarian(192;0.0336)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	Creatine(DB00148)													---	---	---	---
EHD2	30846	broad.mit.edu	37	19	48222825	48222825	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48222825delG	uc002phj.3	+						EHD2_uc010xyu.1_Intron	NM_014601	NP_055416			EH-domain containing 2						blood coagulation|endocytic recycling	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding			ovary(1)|skin(1)	2		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)														---	---	---	---
SULT2B1	6820	broad.mit.edu	37	19	49065644	49065644	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49065644delA	uc002pjl.2	+						MIR220C_hsa-mir-220c|MI0005536_5'Flank	NM_177973	NP_814444			sulfotransferase family, cytosolic, 2B, member 1						3'-phosphoadenosine 5'-phosphosulfate metabolic process|steroid metabolic process|xenobiotic metabolic process	cytosol	alcohol sulfotransferase activity|protein binding|steroid sulfotransferase activity			skin(1)	1		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000115)|all cancers(93;0.000147)|GBM - Glioblastoma multiforme(486;0.00707)|Epithelial(262;0.0178)														---	---	---	---
SNRNP70	6625	broad.mit.edu	37	19	49604873	49604874	+	Intron	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49604873_49604874insT	uc002pmk.2	+						SNRNP70_uc002pmh.1_Intron|SNRNP70_uc002pmi.1_Intron|SNRNP70_uc002pml.2_Intron|SNRNP70_uc002pmm.2_Intron	NM_003089	NP_003080			U1 small nuclear ribonucleoprotein 70 kDa						nuclear mRNA splicing, via spliceosome|regulation of RNA splicing	nucleoplasm|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	50345054	50345055	+	Intron	INS	-	A	A	rs146640590	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50345054_50345055insA	uc002ppy.3	-											Homo sapiens cDNA FLJ34894 fis, clone NT2NE2017982.																														---	---	---	---
ATF5	22809	broad.mit.edu	37	19	50433724	50433725	+	Intron	DEL	TC	-	-	rs150722566	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50433724_50433725delTC	uc010enq.1	+						IL4I1_uc002pqv.1_5'Flank|IL4I1_uc010eno.1_5'Flank|IL4I1_uc002pqw.1_5'Flank|IL4I1_uc002pqu.1_5'Flank|NUP62_uc002pqx.2_5'Flank|NUP62_uc002pqy.2_5'Flank|NUP62_uc002pqz.2_5'Flank|NUP62_uc002pra.2_5'Flank|NUP62_uc002prb.2_5'Flank|NUP62_uc002prc.2_5'Flank|ATF5_uc002prd.2_Intron	NM_012068	NP_036200			activating transcription factor 5						regulation of transcription from RNA polymerase II promoter	cytoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			skin(2)	2		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00221)|OV - Ovarian serous cystadenocarcinoma(262;0.017)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	50573212	50573213	+	IGR	DEL	AA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50573212_50573213delAA								FLJ26850 (3163 upstream) : SNAR-A4 (47764 downstream)																																			---	---	---	---
LILRA2	11027	broad.mit.edu	37	19	55087152	55087153	+	Intron	DEL	GC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55087152_55087153delGC	uc002qgg.3	+						LILRA2_uc010ern.2_Intron|LILRA2_uc002qgf.2_Intron|LILRA2_uc010yfe.1_Intron|LILRA2_uc010yff.1_Intron|LILRA2_uc010ero.2_Intron|LILRA2_uc010yfg.1_Intron	NM_001130917	NP_001124389			leukocyte immunoglobulin-like receptor,						defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	57583642	57583643	+	IGR	INS	-	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57583642_57583643insG								MIMT1 (223720 upstream) : USP29 (47866 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	845856	845856	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:845856delC								FAM110A (7753 upstream) : ANGPT4 (7443 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	1679690	1679695	+	IGR	DEL	ACACAC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1679690_1679695delACACAC								SIRPG (41265 upstream) : SIRPA (195118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	1949783	1949784	+	Intron	INS	-	T	T	rs148130467	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1949783_1949784insT	uc002wfu.1	+											Homo sapiens cDNA FLJ33362 fis, clone BRACE2005337.																														---	---	---	---
MCM8	84515	broad.mit.edu	37	20	5975125	5975126	+	3'UTR	DEL	AC	-	-	rs145346371		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5975125_5975126delAC	uc002wmi.2	+	19					MCM8_uc002wmj.2_3'UTR|MCM8_uc002wmk.2_3'UTR|MCM8_uc002wml.2_3'UTR|MCM8_uc010gbp.2_3'UTR|MCM8_uc002wmm.2_3'UTR	NM_032485	NP_115874			minichromosome maintenance complex component 8						cell cycle checkpoint|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|nucleoside-triphosphatase activity			skin(1)	1																		---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8560520	8560520	+	Intron	DEL	A	-	-	rs11087810		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8560520delA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc010gbv.1_Intron|PLCB1_uc002wmz.1_Intron|PLCB1_uc002wna.2_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
SNAP25	6616	broad.mit.edu	37	20	10200516	10200516	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10200516delT	uc002wnq.1	+						uc002wnn.1_5'Flank|SNAP25_uc002wnr.1_Intron|SNAP25_uc002wns.1_Intron|SNAP25_uc010gca.1_Intron|SNAP25_uc010gcb.1_Intron|SNAP25_uc010gcc.1_Intron	NM_130811	NP_570824			synaptosomal-associated protein 25 isoform						energy reserve metabolic process|glutamate secretion|neurotransmitter uptake|synaptic vesicle docking involved in exocytosis	cell junction|growth cone|perinuclear region of cytoplasm|synapse|synaptosome				skin(2)	2					Botulinum Toxin Type A(DB00083)													---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19239411	19239411	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19239411delC	uc002wrl.2	+						LOC100130264_uc010zsd.1_Intron	NM_020689	NP_065740			solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1																		---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19540106	19540106	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19540106delA	uc002wrl.2	+							NM_020689	NP_065740			solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1																		---	---	---	---
PLK1S1	55857	broad.mit.edu	37	20	21158015	21158015	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21158015delA	uc002wsb.2	+						PLK1S1_uc010zsh.1_Intron|PLK1S1_uc010zsi.1_Intron|PLK1S1_uc010zsj.1_Intron|uc002wsc.2_Intron|PLK1S1_uc002wsd.2_Intron	NM_018474	NP_060944			polo-like kinase 1 substrate 1 isoform 1						spindle organization	centrosome	protein kinase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	22105162	22105163	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22105162_22105163insA								PAX1 (408542 upstream) : LOC284788 (275808 downstream)																																			---	---	---	---
CST3	1471	broad.mit.edu	37	20	23619036	23619037	+	5'Flank	INS	-	CA	CA	rs141047611	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23619036_23619037insCA	uc002wtm.2	-						CST3_uc002wtn.1_5'Flank	NM_000099	NP_000090			cystatin C precursor						defense response|fibril organization|negative regulation of blood vessel remodeling|negative regulation of collagen catabolic process|negative regulation of elastin catabolic process|negative regulation of extracellular matrix disassembly	extracellular space	beta-amyloid binding|cysteine-type endopeptidase inhibitor activity|protease binding			ovary(1)	1	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	24752890	24752891	+	IGR	DEL	CC	-	-	rs148944208	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24752890_24752891delCC								TMEM90B (105723 upstream) : CST7 (176975 downstream)																																			---	---	---	---
NINL	22981	broad.mit.edu	37	20	25448849	25448849	+	Intron	DEL	T	-	-	rs11087522		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25448849delT	uc002wux.1	-						NINL_uc010gdn.1_Intron	NM_025176	NP_079452			ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25867976	25867976	+	IGR	DEL	G	-	-	rs111513763		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25867976delG								FAM182B (19190 upstream) : LOC100134868 (122459 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25878204	25878205	+	IGR	INS	-	A	A	rs35451775		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25878204_25878205insA								FAM182B (29418 upstream) : LOC100134868 (112230 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25889453	25889454	+	IGR	INS	-	T	T	rs148292572	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25889453_25889454insT								FAM182B (40667 upstream) : LOC100134868 (100981 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29554406	29554406	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29554406delA								None (None upstream) : FRG1B (57473 downstream)																																			---	---	---	---
C20orf118	140711	broad.mit.edu	37	20	35511100	35511100	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35511100delG	uc002xgg.1	+							NM_080628	NP_542195			hypothetical protein LOC140711												0		Myeloproliferative disorder(115;0.00874)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36041074	36041075	+	IGR	DEL	TG	-	-	rs66502814		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36041074_36041075delTG								SRC (7255 upstream) : BLCAP (104745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37751234	37751234	+	IGR	DEL	T	-	-	rs75483987		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37751234delT								DHX35 (82871 upstream) : LOC339568 (91190 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	38987408	38987411	+	IGR	DEL	ACAC	-	-	rs140085343		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38987408_38987411delACAC								None (None upstream) : MAFB (327108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	39176204	39176204	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39176204delA								None (None upstream) : MAFB (138315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	39582957	39582957	+	IGR	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39582957delG								MAFB (265081 upstream) : TOP1 (74505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	45492753	45492753	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45492753delA								SLC2A10 (127770 upstream) : EYA2 (30510 downstream)																																			---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45562995	45562996	+	Intron	INS	-	CCTCGTC	CCTCGTC	rs149968213	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45562995_45562996insCCTCGTC	uc002xsm.2	+						EYA2_uc010ghp.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
ZMYND8	23613	broad.mit.edu	37	20	45967173	45967173	+	Intron	DEL	A	-	-	rs67835508		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45967173delA	uc002xta.1	-						ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc010ghs.1_Intron|ZMYND8_uc002xth.2_Intron	NM_012408	NP_036540			zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	47199192	47199193	+	IGR	INS	-	T	T	rs72534978	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47199192_47199193insT								LOC284749 (199811 upstream) : PREX1 (41600 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48996424	48996425	+	IGR	INS	-	CATT	CATT	rs146191816	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48996424_48996425insCATT								CEBPB (187212 upstream) : PTPN1 (130466 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49998786	49998787	+	IGR	INS	-	T	T	rs142118006	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49998786_49998787insT								KCNG1 (359111 upstream) : NFATC2 (8979 downstream)																																			---	---	---	---
ZFP64	55734	broad.mit.edu	37	20	50786592	50786593	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50786592_50786593insA	uc002xwl.2	-						ZFP64_uc002xwk.2_Intron|ZFP64_uc002xwm.2_Intron|ZFP64_uc002xwn.2_Intron	NM_018197	NP_060667			zinc finger protein 64 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51649284	51649284	+	Intron	DEL	T	-	-	rs77144478		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51649284delT	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	54924059	54924059	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54924059delA								MC3R (99188 upstream) : C20orf108 (9924 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56556193	56556193	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56556193delC								PMEPA1 (269652 upstream) : C20orf85 (169790 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	57521830	57521831	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57521830_57521831insT								GNAS (35581 upstream) : TH1L (34480 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	57527351	57527351	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57527351delA								GNAS (41102 upstream) : TH1L (28960 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	59777283	59777283	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59777283delT								MIR646 (893658 upstream) : CDH4 (50276 downstream)																																			---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60381631	60381632	+	Intron	INS	-	CA	CA	rs141897200	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60381631_60381632insCA	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	21	9576271	9576271	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9576271delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10130988	10130989	+	IGR	DEL	AT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10130988_10130989delAT								None (None upstream) : TPTE (775754 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10620798	10620799	+	IGR	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10620798_10620799delAC								None (None upstream) : TPTE (285944 downstream)																																			---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11088127	11088127	+	Intron	DEL	T	-	-	rs139143393		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11088127delT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	14350509	14350509	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14350509delC								None (None upstream) : C21orf99 (59978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	17378073	17378073	+	IGR	DEL	A	-	-	rs67835083		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17378073delA								USP25 (125696 upstream) : C21orf34 (64769 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29318177	29318177	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29318177delT								NCRNA00113 (194625 upstream) : C21orf94 (67505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29482499	29482499	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29482499delC	uc002ymk.1	+											Homo sapiens cDNA FLJ35800 fis, clone TESTI2005933.																														---	---	---	---
CLDN14	23562	broad.mit.edu	37	21	37869178	37869181	+	Intron	DEL	AGGA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37869178_37869181delAGGA	uc002yvn.1	-						CLDN14_uc002yvo.1_Intron	NM_001146078	NP_001139550			claudin 14						calcium-independent cell-cell adhesion|protein complex assembly|tight junction assembly	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity				0																		---	---	---	---
KCNJ15	3772	broad.mit.edu	37	21	39646808	39646808	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39646808delT	uc002ywv.2	+						KCNJ15_uc002yww.2_Intron|KCNJ15_uc002ywx.2_Intron|uc002ywy.2_RNA	NM_002243	NP_002234			potassium inwardly-rectifying channel J15						synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity			ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	6																		---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	42166814	42166815	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42166814_42166815insA	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
TRAPPC10	7109	broad.mit.edu	37	21	45469760	45469760	+	Intron	DEL	T	-	-	rs67224636		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45469760delT	uc002zea.2	+						TRAPPC10_uc010gpo.2_Intron|TRAPPC10_uc002zdz.2_Intron	NM_003274	NP_003265			trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	46264165	46264165	+	IGR	DEL	A	-	-	rs112195275		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46264165delA								SUMO3 (26121 upstream) : PTTG1IP (5348 downstream)																																			---	---	---	---
PTTG1IP	754	broad.mit.edu	37	21	46273644	46273644	+	Intron	DEL	A	-	-	rs71326076		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46273644delA	uc002zgb.1	-						PTTG1IP_uc011afj.1_Intron|PTTG1IP_uc011afk.1_Intron	NM_004339	NP_004330			pituitary tumor-transforming gene 1						protein import into nucleus	cytoplasm|integral to membrane|nucleus				ovary(1)	1				Colorectal(79;0.0659)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	16667801	16667803	+	IGR	DEL	TTG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16667801_16667803delTTG								OR11H1 (217997 upstream) : CCT8L2 (403845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	16941653	16941654	+	IGR	INS	-	T	T	rs141080900		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16941653_16941654insT								OR11H1 (491849 upstream) : CCT8L2 (129994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	16943297	16943298	+	IGR	INS	-	A	A	rs146766102		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16943297_16943298insA								OR11H1 (493493 upstream) : CCT8L2 (128350 downstream)																																			---	---	---	---
psiTPTE22	387590	broad.mit.edu	37	22	17141436	17141437	+	Intron	INS	-	CGAA	CGAA	rs141487002	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17141436_17141437insCGAA	uc002zls.1	+											Homo sapiens cDNA FLJ10437 fis, clone NT2RP1000581.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	17237187	17237188	+	IGR	INS	-	T	T	rs143051422		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17237187_17237188insT								psiTPTE22 (57666 upstream) : XKR3 (27125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	17504140	17504143	+	IGR	DEL	TATC	-	-	rs60343151		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17504140_17504143delTATC								GAB4 (15028 upstream) : CECR7 (13317 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	17504999	17504999	+	IGR	DEL	A	-	-	rs35368678		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17504999delA								GAB4 (15887 upstream) : CECR7 (12461 downstream)																																			---	---	---	---
MICAL3	57553	broad.mit.edu	37	22	18310700	18310701	+	Intron	INS	-	ACAC	ACAC	rs140359300	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18310700_18310701insACAC	uc002zng.3	-						MICAL3_uc011agl.1_Intron	NM_015241	NP_056056			microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)														---	---	---	---
GNB1L	54584	broad.mit.edu	37	22	19802559	19802559	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19802559delA	uc002zqe.1	-						GNB1L_uc002zqd.1_Intron|GNB1L_uc002zqf.1_Intron	NM_053004	NP_443730			guanine nucleotide binding protein						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	internal side of plasma membrane|intracellular				breast(1)	1	Colorectal(54;0.0993)																	---	---	---	---
Unknown	0	broad.mit.edu	37	22	20149986	20149987	+	IGR	INS	-	ACT	ACT			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20149986_20149987insACT								ZDHHC8 (14457 upstream) : LOC150197 (43868 downstream)																																			---	---	---	---
UBE2L3	7332	broad.mit.edu	37	22	21976942	21976942	+	3'UTR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21976942delC	uc002zva.1	+	4					UBE2L3_uc002zuz.1_3'UTR|UBE2L3_uc010gti.1_RNA	NM_003347	NP_003338			ubiquitin-conjugating enzyme E2L 3						cell proliferation|cellular response to glucocorticoid stimulus|protein K11-linked ubiquitination|regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	ATP binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0	Colorectal(54;0.105)																	---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22655485	22655485	+	Intron	DEL	A	-	-	rs112903165		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22655485delA	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
RTDR1	27156	broad.mit.edu	37	22	23486876	23486877	+	5'Flank	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23486876_23486877insA	uc002zwt.2	-						RTDR1_uc010gtv.1_5'Flank|RAB36_uc002zwv.1_5'Flank|RAB36_uc010gtw.1_5'Flank	NM_014433	NP_055248			rhabdoid tumor deletion region protein 1								binding			ovary(1)	1	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	27414616	27414619	+	IGR	DEL	TCCA	-	-	rs67157394		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27414616_27414619delTCCA								MIAT (299667 upstream) : MN1 (729647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27497454	27497457	+	IGR	DEL	TCCA	-	-	rs140527542		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27497454_27497457delTCCA								MIAT (382505 upstream) : MN1 (646809 downstream)																																			---	---	---	---
ZNRF3	84133	broad.mit.edu	37	22	29326090	29326091	+	Intron	INS	-	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29326090_29326091insC	uc003aeg.2	+							NM_032173	NP_115549			zinc and ring finger 3							integral to membrane	zinc ion binding			ovary(1)	1																		---	---	---	---
SYN3	8224	broad.mit.edu	37	22	33107977	33107977	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33107977delG	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481			synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1																		---	---	---	---
MAFF	23764	broad.mit.edu	37	22	38605051	38605051	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38605051delT	uc011anp.1	+						MAFF_uc003avc.2_Intron|MAFF_uc011anq.1_Intron|MAFF_uc011anr.1_Intron	NM_001161572	NP_001155044			transcription factor MAFF isoform a						blood coagulation|parturition|transcription from RNA polymerase II promoter	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Melanoma(58;0.045)																	---	---	---	---
SUN2	25777	broad.mit.edu	37	22	39157839	39157840	+	Intron	INS	-	TG	TG	rs71743609		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39157839_39157840insTG	uc010gxr.1	-							NM_015374	NP_056189			unc-84 homolog B						centrosome localization|cytoskeletal anchoring at nuclear membrane|mitotic spindle organization|nuclear envelope organization|nuclear matrix anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	endosome membrane|integral to membrane|nuclear inner membrane|SUN-KASH complex	lamin binding|microtubule binding			large_intestine(1)|skin(1)	2																		---	---	---	---
PARVB	29780	broad.mit.edu	37	22	44495220	44495220	+	Intron	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44495220delT	uc003ben.2	+						PARVB_uc003bem.2_Intron|PARVB_uc010gzn.2_Intron|PARVB_uc003beo.2_Intron	NM_013327	NP_037459			parvin, beta isoform b						cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding				0		Ovarian(80;0.0246)|all_neural(38;0.0423)																---	---	---	---
TBC1D22A	25771	broad.mit.edu	37	22	47176337	47176337	+	Intron	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47176337delA	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161			TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	48669746	48669746	+	5'Flank	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48669746delA	hsa-mir-3201|MI0014250	+																																									---	---	---	---
Unknown	0	broad.mit.edu	37	22	49657286	49657287	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49657286_49657287insA								FAM19A5 (509544 upstream) : C22orf34 (150889 downstream)																																			---	---	---	---
PPP2R3B	28227	broad.mit.edu	37	X	321710	321711	+	Intron	INS	-	AG	AG			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:321710_321711insAG	uc004cpg.2	-						PPP2R3B_uc011mha.1_Intron	NM_013239	NP_037371			protein phosphatase 2, regulatory subunit B'',						cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
DHRSX	207063	broad.mit.edu	37	X	2150074	2150075	+	Intron	INS	-	CTCCTCCCTTACTT	CTCCTCCCTTACTT	rs116245834	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2150074_2150075insCTCCTCCCTTACTT	uc004cqf.3	-							NM_145177	NP_660160			dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	6252866	6252867	+	IGR	DEL	AG	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6252866_6252867delAG								NLGN4X (106160 upstream) : VCX3A (198793 downstream)																																			---	---	---	---
TBL1X	6907	broad.mit.edu	37	X	9633743	9633744	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9633743_9633744insA	uc010ndq.2	+						TBL1X_uc004csq.3_Intron|TBL1X_uc010ndr.2_Intron|TBL1X_uc004csr.2_Intron	NM_001139466	NP_001132938			transducin beta-like 1X isoform a						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|sensory perception of sound|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein C-terminus binding|protein domain specific binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Hepatocellular(5;0.000888)																---	---	---	---
BMX	660	broad.mit.edu	37	X	15528671	15528671	+	Intron	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15528671delG	uc004cww.2	+						BMX_uc004cwx.3_Intron|BMX_uc004cwy.3_Intron	NM_203281	NP_975010			BMX non-receptor tyrosine kinase						cellular component disassembly involved in apoptosis|intracellular signal transduction|mesoderm development	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity			lung(3)|ovary(2)	5	Hepatocellular(33;0.183)																	---	---	---	---
CDKL5	6792	broad.mit.edu	37	X	18607051	18607052	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18607051_18607052insA	uc004cym.2	+						CDKL5_uc004cyn.2_Intron	NM_003159	NP_003150			cyclin-dependent kinase-like 5						neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)																	---	---	---	---
PHKA2	5256	broad.mit.edu	37	X	18972855	18972855	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18972855delC	uc004cyv.3	-						PHKA2_uc010nfh.1_5'Flank|PHKA2_uc010nfi.1_5'Flank	NM_000292	NP_000283			phosphorylase kinase, alpha 2 (liver)						glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	37190450	37190450	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37190450delT								FAM47C (160711 upstream) : PRRG1 (18078 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	43868955	43868955	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:43868955delA								NDP (36034 upstream) : EFHC2 (138174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	44719794	44719794	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44719794delA								DUSP21 (15662 upstream) : KDM6A (12629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	45381816	45381817	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45381816_45381817insA	uc004dgj.1	+											Homo sapiens cDNA FLJ45797 fis, clone NT2RI2013373.																														---	---	---	---
UBA1	7317	broad.mit.edu	37	X	47049917	47049917	+	5'Flank	DEL	G	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47049917delG	uc004dhj.3	+							NM_153280	NP_695012			ubiquitin-activating enzyme E1						cell death|protein modification process		ATP binding|ligase activity|protein binding|small protein activating enzyme activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	49396496	49396496	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49396496delA								GAGE1 (25538 upstream) : PAGE1 (55560 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	55085438	55085438	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55085438delA								ALAS2 (27941 upstream) : PAGE2B (16066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	65341715	65341716	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65341715_65341716insT								VSIG4 (81748 upstream) : HEPH (40947 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	66176430	66176431	+	IGR	DEL	AC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66176430_66176431delAC								EDA2R (317322 upstream) : AR (587443 downstream)																																			---	---	---	---
EDA	1896	broad.mit.edu	37	X	69014065	69014066	+	Intron	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69014065_69014066insA	uc004dxs.2	+						EDA_uc004dxr.2_Intron|EDA_uc011mpj.1_Intron|EDA_uc004dxn.1_Intron|EDA_uc004dxm.1_Intron|EDA_uc004dxp.1_Intron|EDA_uc004dxq.1_Intron	NM_001399	NP_001390			ectodysplasin A isoform EDA-A1						cell differentiation|ectoderm development|immune response|positive regulation of NF-kappaB transcription factor activity|signal transduction	collagen|cytoskeleton|membrane fraction	tumor necrosis factor receptor binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	70310210	70310211	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70310210_70310211insA								SNX12 (21979 upstream) : FOXO4 (5815 downstream)																																			---	---	---	---
TAF1	6872	broad.mit.edu	37	X	70604618	70604618	+	Intron	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70604618delC	uc004dzu.3	+						BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Intron	NM_138923	NP_620278			TBP-associated factor 1 isoform 2						G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	75295802	75295802	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75295802delA								MAGEE2 (290731 upstream) : CXorf26 (96969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	76502485	76502486	+	IGR	DEL	CT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76502485_76502486delCT								MIR325 (276559 upstream) : FGF16 (207161 downstream)																																			---	---	---	---
ATP7A	538	broad.mit.edu	37	X	77193436	77193437	+	Intron	DEL	CT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77193436_77193437delCT	uc004ecx.3	+						ATP7A_uc004ecv.2_Intron|ATP7A_uc004ecw.2_Intron	NM_000052	NP_000043			ATPase, Cu++ transporting, alpha polypeptide						ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	78175386	78175387	+	IGR	DEL	GT	-	-	rs34464918		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78175386_78175387delGT								LPAR4 (162810 upstream) : P2RY10 (25442 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	87241514	87241514	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:87241514delT								KLHL4 (316464 upstream) : CPXCR1 (760712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	87505081	87505082	+	IGR	DEL	TT	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:87505081_87505082delTT								KLHL4 (580031 upstream) : CPXCR1 (497144 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	88407303	88407303	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:88407303delA								CPXCR1 (397520 upstream) : TGIF2LX (769637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	90042201	90042202	+	IGR	DEL	TG	-	-	rs71980600		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90042201_90042202delTG								TGIF2LX (864321 upstream) : PABPC5 (647395 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	95557566	95557567	+	IGR	INS	-	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:95557566_95557567insA								None (None upstream) : LOC643486 (34519 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	98622569	98622570	+	IGR	DEL	TG	-	-	rs72413153		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:98622569_98622570delTG								None (None upstream) : LOC442459 (94030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	102205538	102205538	+	IGR	DEL	T	-	-	rs66523136		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102205538delT								RAB40AL (12311 upstream) : BEX1 (112043 downstream)																																			---	---	---	---
LONRF3	79836	broad.mit.edu	37	X	118120015	118120024	+	Intron	DEL	ACACACACAC	-	-	rs10551159		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118120015_118120024delACACACACAC	uc004eqw.2	+						LONRF3_uc004eqx.2_Intron|LONRF3_uc004eqy.2_Intron|LONRF3_uc004eqz.2_Intron	NM_001031855	NP_001027026			LON peptidase N-terminal domain and ring finger						proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	125765614	125765614	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125765614delT								DCAF12L1 (78772 upstream) : CXorf64 (188133 downstream)																																			---	---	---	---
IGSF1	3547	broad.mit.edu	37	X	130611468	130611469	+	Intron	DEL	AA	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130611468_130611469delAA	uc004ewf.2	-							NM_001555	NP_001546			immunoglobulin superfamily, member 1 isoform 1						regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	134115997	134115997	+	IGR	DEL	A	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134115997delA								MOSPD1 (66700 upstream) : LOC644538 (8971 downstream)																																			---	---	---	---
GPR112	139378	broad.mit.edu	37	X	135393554	135393555	+	Intron	DEL	AC	-	-	rs72201867		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135393554_135393555delAC	uc004ezu.1	+						GPR112_uc010nsb.1_Intron	NM_153834	NP_722576			G-protein coupled receptor 112						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	136856838	136856839	+	IGR	INS	-	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136856838_136856839insT								ZIC3 (202581 upstream) : LOC158696 (840053 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	136873762	136873762	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136873762delT								ZIC3 (219505 upstream) : LOC158696 (823130 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	142711875	142711876	+	IGR	DEL	TC	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142711875_142711876delTC								SPANXN3 (106568 upstream) : SLITRK4 (4069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	146255659	146255659	+	IGR	DEL	T	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146255659delT								CXorf51 (363735 upstream) : MIR513C (15563 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9981809	9981809	+	IGR	DEL	C	-	-			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9981809delC								TTTY22 (330955 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13855828	13855829	+	IGR	INS	-	CTTCC	CTTCC			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13855828_13855829insCTTCC								None (None upstream) : TTTY15 (918469 downstream)																																			---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7798047	7798047	+	Silent	SNP	T	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7798047T>G	uc001aoi.2	+	16	3894	c.3687T>G	c.(3685-3687)TCT>TCG	p.S1229S	CAMTA1_uc010nzv.1_Silent_p.S316S|CAMTA1_uc001aok.3_Silent_p.S272S|CAMTA1_uc001aoj.2_Silent_p.S185S	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	1229					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
PTCHD2	57540	broad.mit.edu	37	1	11579408	11579408	+	Intron	SNP	A	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11579408A>C	uc001ash.3	+						PTCHD2_uc001asi.1_Intron	NM_020780	NP_065831			patched domain containing 2						cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)														---	---	---	---
PLOD1	5351	broad.mit.edu	37	1	12017075	12017075	+	Intron	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12017075G>T	uc001atm.2	+						PLOD1_uc010obb.1_Intron	NM_000302	NP_000293			lysyl hydroxylase 1 precursor						epidermis development|hydroxylysine biosynthetic process|protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein homodimerization activity			ovary(2)|breast(1)	3	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Minoxidil(DB00350)|Succinic acid(DB00139)|Vitamin C(DB00126)													---	---	---	---
IGSF21	84966	broad.mit.edu	37	1	18661497	18661497	+	Silent	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18661497C>T	uc001bau.1	+	4	800	c.417C>T	c.(415-417)AAC>AAT	p.N139N		NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor	139						extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)														---	---	---	---
GPATCH3	63906	broad.mit.edu	37	1	27219262	27219262	+	Silent	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27219262G>T	uc001bne.2	-	5	1161	c.1132C>A	c.(1132-1134)CGA>AGA	p.R378R	GPN2_uc001bnd.1_5'Flank|GPATCH3_uc009vsp.1_Silent_p.R189R	NM_022078	NP_071361	Q96I76	GPTC3_HUMAN	G patch domain containing 3	378						intracellular	nucleic acid binding				0		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
KIAA1522	57648	broad.mit.edu	37	1	33237770	33237770	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33237770G>T	uc001bvv.2	+	6	2949	c.2813G>T	c.(2812-2814)CGG>CTG	p.R938L	KIAA1522_uc001bvu.1_Missense_Mutation_p.R997L|KIAA1522_uc010ohm.1_Missense_Mutation_p.R949L|KIAA1522_uc010ohn.1_Intron	NM_020888	NP_065939	Q9P206	K1522_HUMAN	hypothetical protein LOC57648	938	Pro-rich.										0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)																---	---	---	---
JAK1	3716	broad.mit.edu	37	1	65304230	65304230	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65304230C>T	uc001dbu.1	-	21	3134	c.2885G>A	c.(2884-2886)GGA>GAA	p.G962E	JAK1_uc009wam.1_Missense_Mutation_p.G950E|JAK1_uc009wal.1_Missense_Mutation_p.G139E	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1	962	Protein kinase 2.				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)				Mis		ALL								---	---	---	---
ABCA4	24	broad.mit.edu	37	1	94476823	94476823	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94476823C>T	uc001dqh.2	-	39	5683	c.5579G>A	c.(5578-5580)CGG>CAG	p.R1860Q	ABCA4_uc001dqi.1_5'Flank|ABCA4_uc009wdp.1_Missense_Mutation_p.R128Q	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	1860					phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)														---	---	---	---
DCST2	127579	broad.mit.edu	37	1	155002628	155002628	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155002628C>T	uc001fgm.2	-	7	1189	c.1109G>A	c.(1108-1110)CGC>CAC	p.R370H	DCST2_uc009wpb.2_RNA	NM_144622	NP_653223	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	370	Cytoplasmic (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)															---	---	---	---
OR10K1	391109	broad.mit.edu	37	1	158435630	158435630	+	Silent	SNP	T	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158435630T>C	uc010pij.1	+	1	279	c.279T>C	c.(277-279)TCT>TCC	p.S93S		NM_001004473	NP_001004473	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K,	93	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)																	---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158581087	158581087	+	Silent	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158581087G>A	uc001fst.1	-	52	7426	c.7227C>T	c.(7225-7227)TAC>TAT	p.Y2409Y		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2409				GRSHLSGYDYVGFTNSYFGN -> VEAISLAMTTLASPIPT LATNKQLLVDRRKS (in Ref. 1; AAA60577/ AAA60994).	actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158617462	158617462	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158617462C>G	uc001fst.1	-	27	3962	c.3763G>C	c.(3763-3765)GAT>CAT	p.D1255H		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1255	Spectrin 12.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
GPR52	9293	broad.mit.edu	37	1	174417750	174417750	+	Silent	SNP	C	T	T	rs144638321	by1000genomes	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174417750C>T	uc001gka.1	+	1	539	c.501C>T	c.(499-501)ATC>ATT	p.I167I	RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjx.2_Intron|RABGAP1L_uc001gjy.2_Intron|RABGAP1L_uc001gjz.2_Intron|uc010pmu.1_RNA	NM_005684	NP_005675	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	167	Helical; Name=4; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			skin(1)	1																		---	---	---	---
CFHR5	81494	broad.mit.edu	37	1	196964906	196964906	+	Silent	SNP	A	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196964906A>C	uc001gts.3	+	5	795	c.667A>C	c.(667-669)AGA>CGA	p.R223R		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor	223	Sushi 4.				complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2																		---	---	---	---
ATP6V1C2	245973	broad.mit.edu	37	2	10908859	10908859	+	Silent	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10908859C>A	uc002ras.2	+	6	502	c.393C>A	c.(391-393)ATC>ATA	p.I131I	ATP6V1C2_uc002rat.2_Silent_p.I131I	NM_001039362	NP_001034451	Q8NEY4	VATC2_HUMAN	vacuolar H+ ATPase C2 isoform a	131					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting V-type ATPase, V1 domain				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)														---	---	---	---
WDR43	23160	broad.mit.edu	37	2	29135570	29135570	+	Silent	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29135570C>A	uc002rmo.2	+	4	632	c.600C>A	c.(598-600)GTC>GTA	p.V200V	SNORD92_uc002rmp.1_5'Flank	NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43	200	WD 4.					nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141625248	141625248	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141625248T>G	uc002tvj.1	-	27	5462	c.4490A>C	c.(4489-4491)AAG>ACG	p.K1497T	LRP1B_uc010fnl.1_Missense_Mutation_p.K679T	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1497	Extracellular (Potential).|LDL-receptor class B 13.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
RIF1	55183	broad.mit.edu	37	2	152315387	152315387	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152315387A>T	uc002txm.2	+	25	3048	c.2918A>T	c.(2917-2919)GAA>GTA	p.E973V	RIF1_uc002txl.2_Missense_Mutation_p.E973V|RIF1_uc002txn.2_Missense_Mutation_p.E973V|RIF1_uc002txo.2_Missense_Mutation_p.E973V	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1	973					cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)														---	---	---	---
TTN	7273	broad.mit.edu	37	2	179427031	179427031	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179427031C>T	uc010zfg.1	-	275	76348	c.76124G>A	c.(76123-76125)GGA>GAA	p.G25375E	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G19070E|TTN_uc010zfi.1_Missense_Mutation_p.G19003E|TTN_uc010zfj.1_Missense_Mutation_p.G18878E	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	26302							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
SESTD1	91404	broad.mit.edu	37	2	180008525	180008525	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180008525C>A	uc002uni.3	-	9	793	c.643G>T	c.(643-645)GAA>TAA	p.E215*		NM_178123	NP_835224	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	215					regulation of calcium ion transport via voltage-gated calcium channel activity		phosphatidic acid binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)															---	---	---	---
IRS1	3667	broad.mit.edu	37	2	227661537	227661537	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227661537C>G	uc002voh.3	-	1	1970	c.1918G>C	c.(1918-1920)GTA>CTA	p.V640L		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	640					fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)												OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
COL4A3	1285	broad.mit.edu	37	2	228109692	228109692	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228109692C>G	uc002vom.1	+	5	467	c.305C>G	c.(304-306)TCT>TGT	p.S102C	COL4A3_uc002von.1_Missense_Mutation_p.S102C|COL4A3_uc002voo.1_Missense_Mutation_p.S102C|COL4A3_uc002vop.1_Missense_Mutation_p.S102C|uc002voq.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	102	Triple-helical region.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)														---	---	---	---
ECEL1	9427	broad.mit.edu	37	2	233346556	233346556	+	Silent	SNP	A	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233346556A>G	uc002vsv.2	-	13	2005	c.1800T>C	c.(1798-1800)TCT>TCC	p.S600S	ECEL1_uc010fya.1_Silent_p.S598S|ECEL1_uc010fyb.1_Silent_p.S307S	NM_004826	NP_004817	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	600	Lumenal (Potential).				neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity			central_nervous_system(2)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)														---	---	---	---
COL7A1	1294	broad.mit.edu	37	3	48611921	48611921	+	Silent	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48611921C>T	uc003ctz.2	-	78	6457	c.6456G>A	c.(6454-6456)CCG>CCA	p.P2152P		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2152	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
C3orf74	100128378	broad.mit.edu	37	3	52097390	52097390	+	3'UTR	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52097390G>A	uc010hmb.1	-	1						NR_027331				Homo sapiens cDNA FLJ46069 fis, clone TESOP2004110.												0																		---	---	---	---
TMF1	7110	broad.mit.edu	37	3	69097149	69097149	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69097149T>A	uc003dnn.2	-	2	954	c.707A>T	c.(706-708)GAC>GTC	p.D236V	TMF1_uc011bfx.1_Missense_Mutation_p.D236V	NM_007114	NP_009045	P82094	TMF1_HUMAN	TATA element modulatory factor 1	236					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi membrane|nucleus	DNA binding|protein binding|transcription cofactor activity				0		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)														---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	96945267	96945267	+	Intron	SNP	A	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96945267A>C	uc010how.1	+						EPHA6_uc003drp.1_Intron	NM_001080448	NP_001073917			EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
IMPG2	50939	broad.mit.edu	37	3	100962847	100962847	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100962847T>C	uc003duq.1	-	13	2531	c.2328A>G	c.(2326-2328)ATA>ATG	p.I776M	IMPG2_uc011bhe.1_Missense_Mutation_p.I639M	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	776	Extracellular (Potential).				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3																		---	---	---	---
SLC7A14	57709	broad.mit.edu	37	3	170185112	170185112	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170185112C>T	uc003fgz.2	-	8	2363	c.2047G>A	c.(2047-2049)GCT>ACT	p.A683T	CLDN11_uc011bpt.1_Intron|uc003fha.1_RNA	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	683						integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)															---	---	---	---
ABCC5	10057	broad.mit.edu	37	3	183669315	183669315	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183669315C>T	uc003fmg.2	-	20	3023	c.2858G>A	c.(2857-2859)CGA>CAA	p.R953Q	ABCC5_uc011bqt.1_Missense_Mutation_p.R481Q|ABCC5_uc010hxl.2_Missense_Mutation_p.R953Q	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	953	ABC transmembrane type-1 2.					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
GNPDA2	132789	broad.mit.edu	37	4	44724108	44724108	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44724108T>G	uc003gwy.2	-	2	274	c.117A>C	c.(115-117)TTA>TTC	p.L39F	GNPDA2_uc010iga.2_Missense_Mutation_p.L39F|GNPDA2_uc011bzb.1_Intron|GNPDA2_uc003gwz.1_Missense_Mutation_p.L39F	NM_138335	NP_612208	Q8TDQ7	GNPI2_HUMAN	glucosamine-6-phosphate deaminase 2	39					N-acetylglucosamine metabolic process	cytoplasm	glucosamine-6-phosphate deaminase activity|hydrolase activity			ovary(1)	1																		---	---	---	---
LIN54	132660	broad.mit.edu	37	4	83860789	83860789	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83860789G>T	uc003hnx.3	-	7	1721	c.1343C>A	c.(1342-1344)CCC>CAC	p.P448H	LIN54_uc003hnz.3_Missense_Mutation_p.P227H|LIN54_uc003hny.3_Missense_Mutation_p.P47H|LIN54_uc010ijt.2_Missense_Mutation_p.P359H|LIN54_uc010iju.2_Missense_Mutation_p.P47H|LIN54_uc010ijv.2_Missense_Mutation_p.P227H	NM_194282	NP_919258	Q6MZP7	LIN54_HUMAN	lin-54 homolog isoform a	448					cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Hepatocellular(203;0.114)																---	---	---	---
FBXL7	23194	broad.mit.edu	37	5	15936828	15936828	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15936828G>A	uc003jfn.1	+	4	1490	c.1009G>A	c.(1009-1011)GTC>ATC	p.V337I		NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	337	LRR 7.				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3																		---	---	---	---
NNT	23530	broad.mit.edu	37	5	43702736	43702736	+	Silent	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43702736C>T	uc003joe.2	+	21	3264	c.3009C>T	c.(3007-3009)GTC>GTT	p.V1003V	NNT_uc003jof.2_Silent_p.V1003V	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	1003	Mitochondrial matrix.				tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)													---	---	---	---
EMB	133418	broad.mit.edu	37	5	49698154	49698154	+	Splice_Site	SNP	C	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49698154C>G	uc003jom.2	-	7	1127	c.878_splice	c.e7-1	p.D293_splice	EMB_uc010ivq.2_Splice_Site_p.D87_splice|EMB_uc003jol.2_Splice_Site_p.D224_splice|EMB_uc011cpy.1_Splice_Site_p.D243_splice|EMB_uc010ivr.2_Splice_Site_p.D239_splice	NM_198449	NP_940851			embigin precursor							integral to membrane					0	Lung SC(58;0.218)	Lung NSC(810;0.0795)																---	---	---	---
NLN	57486	broad.mit.edu	37	5	65083961	65083961	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65083961G>C	uc003juf.2	+	8	1091	c.975G>C	c.(973-975)AAG>AAC	p.K325N	NLN_uc003jue.2_Missense_Mutation_p.K325N|NLN_uc003jug.2_Missense_Mutation_p.K154N|NLN_uc010iww.2_Missense_Mutation_p.K20N	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor	325					proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)														---	---	---	---
FBN2	2201	broad.mit.edu	37	5	127647027	127647027	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127647027C>A	uc003kuu.2	-	39	5478	c.5039G>T	c.(5038-5040)GGC>GTC	p.G1680V		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1680	EGF-like 27; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)														---	---	---	---
PDLIM4	8572	broad.mit.edu	37	5	131606647	131606647	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131606647G>T	uc003kwn.2	+	4	444	c.367G>T	c.(367-369)GGG>TGG	p.G123W	uc003kwm.3_Intron|PDLIM4_uc003kwp.2_Missense_Mutation_p.G123W|PDLIM4_uc003kwo.2_Missense_Mutation_p.G123W	NM_003687	NP_003678	P50479	PDLI4_HUMAN	PDZ and LIM domain 4 isoform 1	123							protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
PCDHB15	56121	broad.mit.edu	37	5	140626736	140626736	+	Silent	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140626736C>T	uc003lje.2	+	1	1590	c.1590C>T	c.(1588-1590)CGC>CGT	p.R530R		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	530	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PDE6A	5145	broad.mit.edu	37	5	149274761	149274761	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149274761C>T	uc003lrg.3	-	13	1833	c.1713G>A	c.(1711-1713)ATG>ATA	p.M571I		NM_000440	NP_000431	P16499	PDE6A_HUMAN	phosphodiesterase 6A	571					cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)															---	---	---	---
NDST1	3340	broad.mit.edu	37	5	149931402	149931402	+	Silent	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149931402C>A	uc003lsk.3	+	14	3016	c.2514C>A	c.(2512-2514)CCC>CCA	p.P838P	NDST1_uc011dcj.1_Silent_p.P781P	NM_001543	NP_001534	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan	838	Heparan sulfate N-sulfotransferase 1.|Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process|inflammatory response	Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			breast(1)|skin(1)	2		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
EBF1	1879	broad.mit.edu	37	5	158223376	158223376	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158223376C>T	uc010jip.2	-	9	1188	c.886G>A	c.(886-888)GGT>AGT	p.G296S	EBF1_uc011ddw.1_Missense_Mutation_p.G164S|EBF1_uc011ddx.1_Missense_Mutation_p.G297S|EBF1_uc003lxl.3_Missense_Mutation_p.G265S	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor	296	IPT/TIG.				multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)					T	HMGA2	lipoma								---	---	---	---
HIST1H1B	3009	broad.mit.edu	37	6	27835014	27835014	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27835014C>G	uc003njx.2	-	1	346	c.294G>C	c.(292-294)CAG>CAC	p.Q98H		NM_005322	NP_005313	P16401	H15_HUMAN	histone cluster 1, H1b	98	H15.				nucleosome assembly	nucleosome|nucleus	DNA binding			large_intestine(2)|lung(1)	3																		---	---	---	---
HIST1H2AM	8336	broad.mit.edu	37	6	27860599	27860599	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27860599G>C	uc003nkb.1	-	1	365	c.329C>G	c.(328-330)CCT>CGT	p.P110R	HIST1H3J_uc003nka.2_5'Flank|HIST1H2BO_uc003nkc.1_5'Flank	NM_003514	NP_003505	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	110					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding			ovary(2)	2																		---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38820534	38820534	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38820534G>A	uc003ooe.1	+	38	5480	c.4880G>A	c.(4879-4881)CGC>CAC	p.R1627H		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
OGFRL1	79627	broad.mit.edu	37	6	72011753	72011753	+	3'UTR	SNP	A	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72011753A>G	uc003pfx.1	+	7						NM_024576	NP_078852			opioid growth factor receptor-like 1							membrane	receptor activity				0																		---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75799851	75799851	+	Silent	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75799851C>A	uc003phs.2	-	63	9082	c.8916G>T	c.(8914-8916)GGG>GGT	p.G2972G	COL12A1_uc003pht.2_Silent_p.G1808G	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	2972	Triple-helical region (COL1) with 2 imperfections.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
DOPEY1	23033	broad.mit.edu	37	6	83818773	83818773	+	Silent	SNP	A	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83818773A>G	uc003pjs.1	+	5	725	c.465A>G	c.(463-465)TTA>TTG	p.L155L	DOPEY1_uc011dyy.1_Silent_p.L155L|DOPEY1_uc010kbl.1_Silent_p.L155L	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1	155					protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)														---	---	---	---
ME1	4199	broad.mit.edu	37	6	83933606	83933606	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83933606A>G	uc003pjy.2	-	12	1428	c.1322T>C	c.(1321-1323)CTT>CCT	p.L441P	ME1_uc011dzb.1_Missense_Mutation_p.L366P|ME1_uc011dzc.1_Missense_Mutation_p.L275P	NM_002395	NP_002386	P48163	MAOX_HUMAN	cytosolic malic enzyme 1	441					carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)													---	---	---	---
RFX6	222546	broad.mit.edu	37	6	117250008	117250008	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117250008C>T	uc003pxm.2	+	18	2548	c.2485C>T	c.(2485-2487)CGT>TGT	p.R829C		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	829					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
HSF2	3298	broad.mit.edu	37	6	122743329	122743329	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122743329G>C	uc003pyu.2	+	8	903	c.716G>C	c.(715-717)AGG>ACG	p.R239T	HSF2_uc003pyv.2_Missense_Mutation_p.R239T	NM_004506	NP_004497	Q03933	HSF2_HUMAN	heat shock transcription factor 2 isoform a	239					response to stress|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)														---	---	---	---
SUN1	23353	broad.mit.edu	37	7	897561	897561	+	Silent	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:897561C>A	uc011jvp.1	+	14	1570	c.1491C>A	c.(1489-1491)ACC>ACA	p.T497T	GET4_uc003sjj.1_RNA|SUN1_uc003sjf.2_Silent_p.T414T|SUN1_uc011jvq.1_Silent_p.T394T|SUN1_uc003sjg.2_Silent_p.T402T|SUN1_uc011jvr.1_Silent_p.T295T|SUN1_uc003sji.2_Silent_p.T335T|SUN1_uc003sjk.2_Silent_p.T136T	NM_001130965	NP_001124437	O94901	SUN1_HUMAN	unc-84 homolog A isoform a	524	Perinuclear space.				cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding				0																		---	---	---	---
ELMO1	9844	broad.mit.edu	37	7	37172750	37172750	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37172750T>G	uc003tfk.1	-	14	1483	c.1176A>C	c.(1174-1176)CAA>CAC	p.Q392H	ELMO1_uc011kbc.1_Missense_Mutation_p.Q296H|ELMO1_uc010kxg.1_Missense_Mutation_p.Q392H	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	392	ELMO.				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
TRIM50	135892	broad.mit.edu	37	7	72730655	72730655	+	Silent	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72730655G>A	uc010lbd.1	-	6	908	c.783C>T	c.(781-783)GGC>GGT	p.G261G	FKBP6_uc003twz.2_Intron|TRIM50_uc003txy.1_Silent_p.G261G|TRIM50_uc003txz.1_Silent_p.G260G	NM_178125	NP_835226	Q86XT4	TRI50_HUMAN	tripartite motif protein 50A	261						cytoplasm|intracellular membrane-bounded organelle	ligase activity|zinc ion binding			skin(1)	1																		---	---	---	---
ARHGEF10	9639	broad.mit.edu	37	8	1905283	1905283	+	Silent	SNP	C	A	A	rs138710067		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1905283C>A	uc003wpr.2	+	29	4067	c.3889C>A	c.(3889-3891)CGG>AGG	p.R1297R	ARHGEF10_uc003wps.2_Silent_p.R1259R|ARHGEF10_uc010lre.2_Silent_p.R948R	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	1322					centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)														---	---	---	---
C8orf74	203076	broad.mit.edu	37	8	10532169	10532169	+	Missense_Mutation	SNP	G	A	A	rs113424148		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10532169G>A	uc003wtd.1	+	2	91	c.62G>A	c.(61-63)CGG>CAG	p.R21Q	C8orf74_uc003wte.1_RNA	NM_001040032	NP_001035121	Q6P047	CH074_HUMAN	hypothetical protein LOC203076	21											0				COAD - Colon adenocarcinoma(149;0.0811)														---	---	---	---
ADAM28	10863	broad.mit.edu	37	8	24207406	24207406	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24207406C>A	uc003xdy.2	+	19	2103	c.2020C>A	c.(2020-2022)CCA>ACA	p.P674T	ADAM28_uc011laa.1_RNA|ADAM28_uc010lua.2_Missense_Mutation_p.P361T	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1	674	Helical; (Potential).				proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)														---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52366325	52366325	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52366325G>A	uc003xqu.3	-	10	1104	c.1003C>T	c.(1003-1005)CAG>TAG	p.Q335*		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	335	Ig-like C2-type 2.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
CA8	767	broad.mit.edu	37	8	61135238	61135238	+	Silent	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61135238G>A	uc003xtz.1	-	7	956	c.708C>T	c.(706-708)TTC>TTT	p.F236F	CA8_uc003xua.1_Silent_p.F236F	NM_004056	NP_004047	P35219	CAH8_HUMAN	carbonic anhydrase VIII	236					one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)																---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69012059	69012059	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69012059G>C	uc003xxv.1	+	23	2723	c.2696G>C	c.(2695-2697)AGA>ACA	p.R899T	PREX2_uc003xxu.1_Missense_Mutation_p.R899T|PREX2_uc011lez.1_Missense_Mutation_p.R834T	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	899					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
MMP16	4325	broad.mit.edu	37	8	89068352	89068352	+	Intron	SNP	T	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89068352T>C	uc003yeb.3	-							NM_005941	NP_005932			matrix metalloproteinase 16 isoform 1						collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8																		---	---	---	---
TMEM67	91147	broad.mit.edu	37	8	94798550	94798550	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94798550G>A	uc011lgk.1	+	13	1459	c.1388G>A	c.(1387-1389)CGA>CAA	p.R463Q	TMEM67_uc010mat.1_Missense_Mutation_p.R378Q|TMEM67_uc010maw.2_Missense_Mutation_p.R169Q|TMEM67_uc003yga.3_Missense_Mutation_p.R382Q	NM_153704	NP_714915	Q5HYA8	MKS3_HUMAN	meckelin isoform 1	463					cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding			ovary(2)	2	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)															---	---	---	---
ESRP1	54845	broad.mit.edu	37	8	95690588	95690588	+	Silent	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95690588G>A	uc003ygq.3	+	13	1992	c.1809G>A	c.(1807-1809)GCG>GCA	p.A603A	ESRP1_uc003ygr.3_Silent_p.A599A|ESRP1_uc003ygs.3_Silent_p.A599A|ESRP1_uc003ygt.3_Silent_p.A603A|ESRP1_uc003ygu.3_Silent_p.A599A|ESRP1_uc003ygv.2_Silent_p.A443A|ESRP1_uc003ygw.2_Silent_p.A443A	NM_017697	NP_060167	Q6NXG1	ESRP1_HUMAN	RNA binding motif protein 35A isoform 1	603					mRNA processing|regulation of RNA splicing|RNA splicing	nucleus|plasma membrane	mRNA binding|nucleotide binding		ESRP1/RAF1(4)	prostate(4)	4																		---	---	---	---
VPS13B	157680	broad.mit.edu	37	8	100396445	100396445	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100396445T>G	uc003yiv.2	+	20	2945	c.2834T>G	c.(2833-2835)CTT>CGT	p.L945R	VPS13B_uc003yiw.2_Missense_Mutation_p.L945R|VPS13B_uc003yiu.1_Missense_Mutation_p.L945R|VPS13B_uc003yix.1_Missense_Mutation_p.L416R	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	945					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)															---	---	---	---
ADCY8	114	broad.mit.edu	37	8	132051772	132051772	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132051772C>T	uc003ytd.3	-	1	1064	c.808G>A	c.(808-810)GGC>AGC	p.G270S	ADCY8_uc010mds.2_Missense_Mutation_p.G270S	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	270					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)												HNSCC(32;0.087)			---	---	---	---
BAI1	575	broad.mit.edu	37	8	143570753	143570753	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143570753G>A	uc003ywm.2	+	15	2768	c.2585G>A	c.(2584-2586)CGC>CAC	p.R862H		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	862	Extracellular (Potential).				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)																	---	---	---	---
VLDLR	7436	broad.mit.edu	37	9	2643311	2643311	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2643311C>A	uc003zhk.1	+	5	997	c.600C>A	c.(598-600)TGC>TGA	p.C200*	VLDLR_uc003zhl.1_Nonsense_Mutation_p.C200*|VLDLR_uc003zhm.1_RNA|VLDLR_uc003zhn.1_Nonsense_Mutation_p.C159*	NM_003383	NP_003374	P98155	VLDLR_HUMAN	very low density lipoprotein receptor isoform a	200	LDL-receptor class A 5.|Extracellular (Potential).				cholesterol metabolic process|endocytosis|lipid transport|memory|very-low-density lipoprotein particle clearance	coated pit|integral to membrane|membrane fraction|plasma membrane|very-low-density lipoprotein particle	apolipoprotein binding|calcium ion binding|low-density lipoprotein receptor activity|very-low-density lipoprotein particle receptor activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)														---	---	---	---
RUSC2	9853	broad.mit.edu	37	9	35557979	35557979	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35557979G>T	uc003zww.2	+	6	3307	c.3052G>T	c.(3052-3054)GGG>TGG	p.G1018W	RUSC2_uc010mkq.2_RNA|RUSC2_uc003zwx.3_Missense_Mutation_p.G1018W	NM_014806	NP_055621	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1018						cytosol				ovary(1)	1			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
TRPM6	140803	broad.mit.edu	37	9	77457091	77457091	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77457091A>C	uc004ajl.1	-	4	559	c.321T>G	c.(319-321)CAT>CAG	p.H107Q	TRPM6_uc004ajk.1_Missense_Mutation_p.H102Q|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.H107Q|TRPM6_uc010mpd.1_Missense_Mutation_p.H107Q|TRPM6_uc010mpe.1_Missense_Mutation_p.H107Q|TRPM6_uc004ajn.1_Missense_Mutation_p.H107Q	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	107	Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
OR13F1	138805	broad.mit.edu	37	9	107267332	107267332	+	Silent	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107267332C>A	uc011lvm.1	+	1	789	c.789C>A	c.(787-789)TCC>TCA	p.S263S		NM_001004485	NP_001004485	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F,	263	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
PAPPA	5069	broad.mit.edu	37	9	119033647	119033647	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119033647G>A	uc004bjn.2	+	9	3286	c.2905G>A	c.(2905-2907)GAT>AAT	p.D969N	PAPPA_uc011lxp.1_Missense_Mutation_p.D664N|PAPPA_uc011lxq.1_Missense_Mutation_p.D344N	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	969					cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9																		---	---	---	---
TLR4	7099	broad.mit.edu	37	9	120475322	120475322	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120475322T>C	uc004bjz.2	+	3	1207	c.916T>C	c.(916-918)TGT>CGT	p.C306R	TLR4_uc004bka.2_Missense_Mutation_p.C266R|TLR4_uc004bkb.2_Missense_Mutation_p.C106R	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	306	Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16																		---	---	---	---
LAMC3	10319	broad.mit.edu	37	9	133914292	133914292	+	Silent	SNP	C	A	A	rs146887458		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133914292C>A	uc004caa.1	+	5	1116	c.1018C>A	c.(1018-1020)CGG>AGG	p.R340R		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	340	Laminin EGF-like 2.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)														---	---	---	---
BAT2L1	84726	broad.mit.edu	37	9	134350480	134350480	+	Silent	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134350480C>T	uc004can.3	+	15	3019	c.2964C>T	c.(2962-2964)GAC>GAT	p.D988D	BAT2L1_uc010mzj.1_Silent_p.D571D|BAT2L1_uc004cao.3_Silent_p.D346D	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	988							protein binding				0																		---	---	---	---
PTCHD3	374308	broad.mit.edu	37	10	27687683	27687683	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27687683C>T	uc001itu.2	-	4	1962	c.1844G>A	c.(1843-1845)AGC>AAC	p.S615N		NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	615	Helical; (Potential).				spermatid development	integral to membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
BMS1	9790	broad.mit.edu	37	10	43318651	43318651	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43318651A>G	uc001jaj.2	+	20	3576	c.3218A>G	c.(3217-3219)AAA>AGA	p.K1073R		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	1073					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3																		---	---	---	---
LDB3	11155	broad.mit.edu	37	10	88476402	88476402	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88476402G>A	uc001kdv.2	+	9	1573	c.1550G>A	c.(1549-1551)GGA>GAA	p.G517E	LDB3_uc010qml.1_Missense_Mutation_p.G454E|LDB3_uc010qmm.1_Missense_Mutation_p.G522E|LDB3_uc001kdu.2_Missense_Mutation_p.G407E|LDB3_uc009xsz.2_Missense_Mutation_p.G146E|LDB3_uc009xta.1_5'Flank	NM_007078	NP_009009	O75112	LDB3_HUMAN	LIM domain binding 3 isoform 1	517						cytoskeleton|perinuclear region of cytoplasm|pseudopodium	zinc ion binding			ovary(1)	1																		---	---	---	---
CRTAC1	55118	broad.mit.edu	37	10	99683050	99683050	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99683050C>T	uc001kou.1	-	4	885	c.529G>A	c.(529-531)GGA>AGA	p.G177R	CRTAC1_uc001kov.2_Missense_Mutation_p.G166R|CRTAC1_uc001kot.1_5'UTR	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1 precursor	177						proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)														---	---	---	---
GPAM	57678	broad.mit.edu	37	10	113920445	113920445	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113920445G>T	uc009xxy.1	-	16	1874	c.1676C>A	c.(1675-1677)CCC>CAC	p.P559H	GPAM_uc001kzp.2_Missense_Mutation_p.P559H|GPAM_uc001kzq.1_Missense_Mutation_p.P559H	NM_020918	NP_065969	Q9HCL2	GPAT1_HUMAN	mitochondrial glycerol 3-phosphate	559	Mitochondrial intermembrane (Potential).|Cytoplasmic (Potential).				phospholipid biosynthetic process|triglyceride biosynthetic process	integral to membrane|mitochondrial outer membrane	glycerol-3-phosphate O-acyltransferase activity			ovary(1)|skin(1)	2				Epithelial(162;0.0306)|all cancers(201;0.123)														---	---	---	---
MUC6	4588	broad.mit.edu	37	11	1017526	1017526	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1017526G>C	uc001lsw.2	-	31	5326	c.5275C>G	c.(5275-5277)CCT>GCT	p.P1759A		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1759	Thr-rich.|Approximate repeats.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---
OR52I2	143502	broad.mit.edu	37	11	4608296	4608296	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4608296G>A	uc010qyh.1	+	1	254	c.254G>A	c.(253-255)CGG>CAG	p.R85Q		NM_001005170	NP_001005170	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I,	85	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
OR52I1	390037	broad.mit.edu	37	11	4615444	4615444	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4615444G>A	uc010qyi.1	+	1	176	c.176G>A	c.(175-177)CGG>CAG	p.R59Q		NM_001005169	NP_001005169	Q8NGK6	O52I1_HUMAN	olfactory receptor, family 52, subfamily I,	59	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;7.98e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
HBD	3045	broad.mit.edu	37	11	5254327	5254327	+	Intron	SNP	G	A	A	rs35769679		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5254327G>A	uc001maf.1	-							NM_000519	NP_000510			delta globin						blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
SCUBE2	57758	broad.mit.edu	37	11	9069032	9069032	+	Missense_Mutation	SNP	C	T	T	rs72550810	byFrequency	TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9069032C>T	uc001mhh.1	-	15	1866	c.1786G>A	c.(1786-1788)GTC>ATC	p.V596I	SCUBE2_uc001mhi.1_Missense_Mutation_p.V625I|SCUBE2_uc001mhj.1_Missense_Mutation_p.V470I	NM_020974	NP_066025	Q9NQ36	SCUB2_HUMAN	CEGP1 protein precursor	596						extracellular region	calcium ion binding			ovary(1)|skin(1)	2				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)														---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19854054	19854054	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19854054T>C	uc010rdm.1	+	2	653	c.292T>C	c.(292-294)TAC>CAC	p.Y98H	NAV2_uc001mpp.2_Missense_Mutation_p.Y34H|NAV2_uc001mpr.3_Missense_Mutation_p.Y98H	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	98	CH.					nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
ACCS	84680	broad.mit.edu	37	11	44096167	44096167	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44096167G>T	uc009yks.1	+	5	569	c.425G>T	c.(424-426)CGG>CTG	p.R142L	EXT2_uc010rfo.1_5'Flank|ACCS_uc010rfm.1_Missense_Mutation_p.R69L|ACCS_uc010rfn.1_Silent_p.P118P|ACCS_uc001mxx.2_Missense_Mutation_p.R142L	NM_001127219	NP_001120691	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase	142							1-aminocyclopropane-1-carboxylate synthase activity|protein homodimerization activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			breast(2)|ovary(1)|lung(1)	4																		---	---	---	---
AMBRA1	55626	broad.mit.edu	37	11	46569819	46569819	+	Silent	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46569819G>T	uc010rgu.1	-	2	472	c.112C>A	c.(112-114)CGG>AGG	p.R38R	AMBRA1_uc009ylc.1_Silent_p.R38R|AMBRA1_uc001ncu.1_Silent_p.R38R|AMBRA1_uc001ncv.2_Silent_p.R38R|AMBRA1_uc001ncw.2_Silent_p.R38R|AMBRA1_uc001ncx.2_Silent_p.R38R	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated	38					autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)														---	---	---	---
MYBPC3	4607	broad.mit.edu	37	11	47353761	47353761	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47353761G>T	uc001nfa.3	-	32	3731	c.3676C>A	c.(3676-3678)CGC>AGC	p.R1226S		NM_000256	NP_000247	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	1225	Ig-like C2-type 7.				cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding			ovary(2)|central_nervous_system(1)	3				Lung(87;0.176)														---	---	---	---
OR4X1	390113	broad.mit.edu	37	11	48285685	48285685	+	Silent	SNP	T	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48285685T>C	uc010rht.1	+	1	273	c.273T>C	c.(271-273)TCT>TCC	p.S91S		NM_001004726	NP_001004726	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X,	91	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
PLCB3	5331	broad.mit.edu	37	11	64023052	64023052	+	Silent	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64023052G>A	uc001nzb.2	+	7	561	c.561G>A	c.(559-561)GAG>GAA	p.E187E	PLCB3_uc009ypg.1_Silent_p.E187E|PLCB3_uc009yph.1_Silent_p.E120E|PLCB3_uc009ypi.2_Silent_p.E187E	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C beta 3	187					intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2																		---	---	---	---
SF1	7536	broad.mit.edu	37	11	64535567	64535567	+	Intron	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64535567C>A	uc001obb.1	-						SF1_uc010rnm.1_Intron|SF1_uc010rnn.1_Intron|SF1_uc001oaz.1_Intron|SF1_uc001oba.1_Intron|SF1_uc001obc.1_Intron|SF1_uc001obd.1_Intron|SF1_uc001obe.1_Intron|SF1_uc010rno.1_Intron	NM_004630	NP_004621			splicing factor 1 isoform 1						nuclear mRNA 3'-splice site recognition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ribosome|spliceosomal complex	protein binding|RNA binding|transcription corepressor activity|zinc ion binding			ovary(1)|breast(1)|skin(1)	3																OREG0004010|OREG0021062	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=REGULATORY REGION|Gene=LOC476031|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
C11orf57	55216	broad.mit.edu	37	11	111953248	111953248	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111953248C>A	uc001pmr.3	+	6	1112	c.431C>A	c.(430-432)ACC>AAC	p.T144N	C11orf57_uc001pmw.3_Missense_Mutation_p.T145N|C11orf57_uc001pmt.3_Missense_Mutation_p.T145N|C11orf57_uc001pmv.3_Missense_Mutation_p.T144N|C11orf57_uc001pms.3_Missense_Mutation_p.T116N	NM_001082970	NP_001076439	Q6ZUT1	CK057_HUMAN	hypothetical protein LOC55216 isoform b	144	Lys-rich.									breast(2)|ovary(1)	3		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)														---	---	---	---
A2ML1	144568	broad.mit.edu	37	12	9020963	9020963	+	Intron	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9020963G>A	uc001quz.3	+						A2ML1_uc001qva.1_Intron|A2ML1_uc010sgm.1_Intron|A2ML1_uc001qvb.1_Intron	NM_144670	NP_653271			alpha-2-macroglobulin-like 1 precursor							extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3																		---	---	---	---
C12orf71	728858	broad.mit.edu	37	12	27234291	27234291	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27234291C>G	uc001rhq.2	-	2	665	c.626G>C	c.(625-627)TGC>TCC	p.C209S		NM_001080406	NP_001073875	A8MTZ7	CL071_HUMAN	hypothetical protein LOC728858	209											0																		---	---	---	---
SLC38A2	54407	broad.mit.edu	37	12	46756367	46756367	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46756367G>A	uc001rpg.2	-	14	1674	c.1234C>T	c.(1234-1236)CGT>TGT	p.R412C	SLC38A2_uc010sli.1_Missense_Mutation_p.R250C|SLC38A2_uc001rph.2_Missense_Mutation_p.R312C	NM_018976	NP_061849	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	412	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|glutamate secretion|neurotransmitter secretion|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			urinary_tract(1)|skin(1)	2	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)														---	---	---	---
OR6C76	390326	broad.mit.edu	37	12	55820957	55820957	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55820957A>C	uc010spm.1	+	1	920	c.920A>C	c.(919-921)CAC>CCC	p.H307P		NM_001005183	NP_001005183	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C,	307	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---
ZFC3H1	196441	broad.mit.edu	37	12	72025750	72025750	+	Splice_Site	SNP	A	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72025750A>G	uc001swo.2	-	15	3719	c.3360_splice	c.e15+1	p.Q1120_splice		NM_144982	NP_659419			proline/serine-rich coiled-coil 2						RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
LIN7A	8825	broad.mit.edu	37	12	81205429	81205429	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81205429C>A	uc001szj.1	-	5	710	c.517G>T	c.(517-519)GAA>TAA	p.E173*	LIN7A_uc001szk.1_RNA	NM_004664	NP_004655	O14910	LIN7A_HUMAN	lin-7 homolog A	173	PDZ.				exocytosis|protein complex assembly|protein transport	basolateral plasma membrane|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	L27 domain binding			ovary(1)|skin(1)	2																		---	---	---	---
PLXNC1	10154	broad.mit.edu	37	12	94692545	94692545	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94692545C>G	uc001tdc.2	+	27	4461	c.4212C>G	c.(4210-4212)GAC>GAG	p.D1404E	PLXNC1_uc010sut.1_Missense_Mutation_p.D451E|PLXNC1_uc009zsv.2_Missense_Mutation_p.D143E	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	1404	Cytoplasmic (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
CIT	11113	broad.mit.edu	37	12	120150008	120150008	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120150008G>T	uc001txi.1	-	36	4756	c.4703C>A	c.(4702-4704)TCT>TAT	p.S1568Y	CIT_uc001txh.1_Missense_Mutation_p.S1087Y|CIT_uc001txj.1_Missense_Mutation_p.S1610Y	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	1568					intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)														---	---	---	---
ATP6V0A2	23545	broad.mit.edu	37	12	124206886	124206886	+	Intron	SNP	T	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124206886T>C	uc001ufr.2	+						ATP6V0A2_uc001ufq.1_Intron	NM_012463	NP_036595			ATPase, H+ transporting, lysosomal V0 subunit						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|immune response|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)														---	---	---	---
ZNF664	144348	broad.mit.edu	37	12	124496854	124496854	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124496854G>A	uc001ufz.2	+	6	1993	c.163G>A	c.(163-165)GGA>AGA	p.G55R	ZNF664_uc001uga.2_Missense_Mutation_p.G55R|ZNF664_uc001ugb.2_Missense_Mutation_p.G55R	NM_152437	NP_689650	Q8N3J9	ZN664_HUMAN	zinc finger protein 664	55					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.000239)|OV - Ovarian serous cystadenocarcinoma(86;0.000247)|all cancers(50;0.00155)|BRCA - Breast invasive adenocarcinoma(302;0.249)														---	---	---	---
POLE	5426	broad.mit.edu	37	12	133215719	133215719	+	Silent	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133215719G>A	uc001uks.1	-	40	5588	c.5544C>T	c.(5542-5544)CTC>CTT	p.L1848L	POLE_uc001ukq.1_Silent_p.L58L|POLE_uc001ukr.1_Silent_p.L652L|POLE_uc010tbq.1_RNA	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	1848					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)									DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage			OREG0022269	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
POLE	5426	broad.mit.edu	37	12	133226398	133226398	+	Silent	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133226398C>A	uc001uks.1	-	30	3704	c.3660G>T	c.(3658-3660)CTG>CTT	p.L1220L	POLE_uc001ukr.1_Silent_p.L24L|POLE_uc010tbq.1_RNA|POLE_uc009zyu.1_Silent_p.L1193L	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	1220					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)									DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
TUBA3C	7278	broad.mit.edu	37	13	19751462	19751462	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19751462G>T	uc009zzj.2	-	4	710	c.661C>A	c.(661-663)CGT>AGT	p.R221S		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	221					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)														---	---	---	---
LRCH1	23143	broad.mit.edu	37	13	47262044	47262044	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47262044A>T	uc001vbj.2	+	6	1116	c.880A>T	c.(880-882)ATT>TTT	p.I294F	LRCH1_uc010acp.2_Missense_Mutation_p.I294F|LRCH1_uc001vbk.2_Missense_Mutation_p.I294F|LRCH1_uc001vbl.3_Missense_Mutation_p.I294F	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)	294	LRR 9.									ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)														---	---	---	---
SLITRK5	26050	broad.mit.edu	37	13	88328266	88328266	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88328266G>T	uc001vln.2	+	2	842	c.623G>T	c.(622-624)CGG>CTG	p.R208L	SLITRK5_uc010tic.1_Intron	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	208	Extracellular (Potential).|LRR 6.					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)																	---	---	---	---
HOMEZ	57594	broad.mit.edu	37	14	23745671	23745671	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23745671G>A	uc001wja.2	-	2	914	c.766C>T	c.(766-768)CAG>TAG	p.Q256*	HOMEZ_uc001wjb.2_Nonsense_Mutation_p.Q258*	NM_020834	NP_065885	Q8IX15	HOMEZ_HUMAN	homeodomain leucine zipper protein	256						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)														---	---	---	---
LTB4R2	56413	broad.mit.edu	37	14	24780822	24780822	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24780822G>A	uc001woq.1	+	1	2662	c.1045G>A	c.(1045-1047)GGC>AGC	p.G349S	CIDEB_uc001woo.2_5'Flank|CIDEB_uc001wop.2_5'Flank|LTB4R2_uc010alo.2_Missense_Mutation_p.G318S|LTB4R2_uc001wor.2_Missense_Mutation_p.G318S|LTB4R_uc001wos.2_5'UTR|LTB4R_uc010alp.2_5'Flank	NM_019839	NP_062813	Q9NPC1	LT4R2_HUMAN	leukotriene B4 receptor 2	349	Cytoplasmic (Potential).				chemotaxis|negative regulation of adenylate cyclase activity	integral to plasma membrane					0				GBM - Glioblastoma multiforme(265;0.018)														---	---	---	---
DLGAP5	9787	broad.mit.edu	37	14	55621518	55621518	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55621518G>C	uc001xbs.2	-	15	2097	c.1880C>G	c.(1879-1881)TCT>TGT	p.S627C	DLGAP5_uc001xbt.2_Missense_Mutation_p.S627C	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a	627					cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106539491	106539491	+	RNA	SNP	A	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106539491A>C	uc010tyt.1	-	1518		c.31282T>G								Parts of antibodies, mostly variable regions.												0																		---	---	---	---
RPAP1	26015	broad.mit.edu	37	15	41819119	41819119	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41819119C>A	uc001zod.2	-	14	2018	c.1894G>T	c.(1894-1896)GGG>TGG	p.G632W	RPAP1_uc001zoc.2_5'Flank	NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	632						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)														---	---	---	---
FRMD5	84978	broad.mit.edu	37	15	44166164	44166164	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44166164G>T	uc001ztl.2	-	14	1809	c.1632C>A	c.(1630-1632)TTC>TTA	p.F544L	FRMD5_uc001ztj.1_Intron|FRMD5_uc001ztk.1_Intron|FRMD5_uc010uef.1_Missense_Mutation_p.F217L|FRMD5_uc001ztm.2_Missense_Mutation_p.F217L|FRMD5_uc001ztn.2_Missense_Mutation_p.F310L	NM_032892	NP_116281	Q7Z6J6	FRMD5_HUMAN	FERM domain containing 5 isoform 2	544						cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)														---	---	---	---
TRPM7	54822	broad.mit.edu	37	15	50904892	50904892	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50904892C>A	uc001zyt.3	-	16	2169	c.1905G>T	c.(1903-1905)CAG>CAT	p.Q635H	TRPM7_uc010bew.1_Missense_Mutation_p.Q635H|TRPM7_uc001zyu.2_Missense_Mutation_p.Q193H	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,	635	Cytoplasmic (Potential).				cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)														---	---	---	---
ZNF597	146434	broad.mit.edu	37	16	3487102	3487102	+	Silent	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3487102C>A	uc002cvd.2	-	4	781	c.597G>T	c.(595-597)CTG>CTT	p.L199L		NM_152457	NP_689670	Q96LX8	ZN597_HUMAN	zinc finger protein 597	199	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
CACNG3	10368	broad.mit.edu	37	16	24268252	24268252	+	Silent	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24268252C>A	uc002dmf.2	+	1	1377	c.177C>A	c.(175-177)ACC>ACA	p.T59T		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3	59					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)														---	---	---	---
ATXN2L	11273	broad.mit.edu	37	16	28847767	28847767	+	3'UTR	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28847767C>A	uc002drc.2	+	22					uc010vct.1_Intron|ATXN2L_uc002drb.2_Intron|ATXN2L_uc002dqy.2_Missense_Mutation_p.P1087Q|ATXN2L_uc002dra.2_Intron|ATXN2L_uc002dqz.2_Intron|ATXN2L_uc010vdb.1_Intron|ATXN2L_uc002dre.2_Intron|ATXN2L_uc002drf.2_3'UTR|ATXN2L_uc002drg.2_3'UTR	NM_007245	NP_009176			ataxin 2 related protein isoform A							membrane				upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
ITGAL	3683	broad.mit.edu	37	16	30532868	30532868	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30532868C>A	uc002dyi.3	+	31	3571	c.3395C>A	c.(3394-3396)CCG>CAG	p.P1132Q	ITGAL_uc002dyj.3_Missense_Mutation_p.P1048Q|ITGAL_uc010vev.1_Missense_Mutation_p.P366Q	NM_002209	NP_002200	P20701	ITAL_HUMAN	integrin alpha L isoform a precursor	1132	Cytoplasmic (Potential).				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10					Efalizumab(DB00095)													---	---	---	---
PHKB	5257	broad.mit.edu	37	16	47727319	47727319	+	Silent	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47727319G>A	uc002eev.3	+	28	2848	c.2796G>A	c.(2794-2796)GGG>GGA	p.G932G	PHKB_uc002eeu.3_Silent_p.G925G|PHKB_uc002eew.3_Silent_p.G173G	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a	932	Calmodulin-binding (Potential).				glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)																---	---	---	---
POLR2C	5432	broad.mit.edu	37	16	57504210	57504210	+	Silent	SNP	G	C	C	rs146268816		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57504210G>C	uc002elt.1	+	8	713	c.627G>C	c.(625-627)TCG>TCC	p.S209S		NM_032940	NP_116558	P19387	RPB3_HUMAN	DNA directed RNA polymerase II polypeptide C	209					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|protein dimerization activity				0																		---	---	---	---
PMFBP1	83449	broad.mit.edu	37	16	72198737	72198737	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72198737C>T	uc002fcc.3	-	3	263	c.91G>A	c.(91-93)GAT>AAT	p.D31N	PMFBP1_uc002fcd.2_Missense_Mutation_p.D31N|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_5'UTR	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	31	Potential.									ovary(2)	2		Ovarian(137;0.179)																---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577085	7577085	+	Missense_Mutation	SNP	C	T	T	rs112431538		TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577085C>T	uc002gim.2	-	8	1047	c.853G>A	c.(853-855)GAG>AAG	p.E285K	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.E285K|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E153K|TP53_uc010cng.1_Missense_Mutation_p.E153K|TP53_uc002gii.1_Missense_Mutation_p.E153K|TP53_uc010cnh.1_Missense_Mutation_p.E285K|TP53_uc010cni.1_Missense_Mutation_p.E285K|TP53_uc002gij.2_Missense_Mutation_p.E285K	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	285	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> K (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> A (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E285K(95)|p.E285*(16)|p.E285V(13)|p.0?(7)|p.E285Q(4)|p.E285E(3)|p.E285G(3)|p.E285A(2)|p.?(2)|p.R283fs*16(2)|p.E285_N288delEEEN(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.G279fs*59(1)|p.E285fs*13(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.V272_K292del21(1)|p.R283fs*59(1)|p.C275fs*20(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.E285fs*20(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
MYH8	4626	broad.mit.edu	37	17	10317561	10317561	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10317561C>T	uc002gmm.2	-	11	1051	c.956G>A	c.(955-957)GGG>GAG	p.G319E	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	319	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11														Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				---	---	---	---
MEOX1	4222	broad.mit.edu	37	17	41738775	41738775	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41738775A>C	uc002idz.2	-	1	157	c.128T>G	c.(127-129)TTC>TGC	p.F43C	MEOX1_uc002iea.2_Missense_Mutation_p.F43C|MEOX1_uc002ieb.2_Intron	NM_004527	NP_004518	P50221	MEOX1_HUMAN	mesenchyme homeobox 1 isoform 1	43						nucleus	sequence-specific DNA binding				0		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)														---	---	---	---
FMNL1	752	broad.mit.edu	37	17	43323949	43323949	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43323949G>A	uc002iin.2	+	26	3489	c.3289G>A	c.(3289-3291)GAG>AAG	p.E1097K	FMNL1_uc002iiq.2_Intron|FMNL1_uc010dag.2_Intron|LOC100133991_uc010dah.2_5'Flank	NM_005892	NP_005883	O95466	FMNL_HUMAN	formin-like 1	1097					actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1																OREG0024478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SCN4A	6329	broad.mit.edu	37	17	62034558	62034558	+	Silent	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62034558G>T	uc002jds.1	-	13	2417	c.2340C>A	c.(2338-2340)ACC>ACA	p.T780T		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	780	II.|Helical; Name=S6 of repeat II; (Potential).				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)													---	---	---	---
LAMA1	284217	broad.mit.edu	37	18	7023227	7023227	+	Silent	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7023227G>A	uc002knm.2	-	19	2731	c.2637C>T	c.(2635-2637)GGC>GGT	p.G879G	LAMA1_uc010wzj.1_Silent_p.G355G	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	879	Laminin EGF-like 8.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	7888265	7888265	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7888265G>C	uc002knn.3	+	3	861	c.358G>C	c.(358-360)GTC>CTC	p.V120L	PTPRM_uc010dkv.2_Missense_Mutation_p.V120L	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	120	MAM.|Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
ZNF519	162655	broad.mit.edu	37	18	14106062	14106062	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14106062C>A	uc002kst.1	-	3	630	c.477G>T	c.(475-477)CAG>CAT	p.Q159H	ZNF519_uc002ksq.1_Intron|ZNF519_uc002ksr.1_Intron|ZNF519_uc010dlm.1_Intron	NM_145287	NP_660330	Q8TB69	ZN519_HUMAN	zinc finger protein 519	159					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
SYT4	6860	broad.mit.edu	37	18	40853972	40853972	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40853972G>T	uc002law.2	-	2	791	c.422C>A	c.(421-423)TCC>TAC	p.S141Y	SYT4_uc010dng.2_Intron|SYT4_uc010xcm.1_Missense_Mutation_p.S123Y|SYT4_uc010dnh.2_Intron	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	141	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			skin(5)	5																		---	---	---	---
NCLN	56926	broad.mit.edu	37	19	3205998	3205998	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3205998C>T	uc002lxi.2	+	10	1424	c.1270C>T	c.(1270-1272)CGA>TGA	p.R424*	NCLN_uc002lxh.1_RNA|NCLN_uc002lxj.1_RNA|NCLN_uc002lxk.2_Nonsense_Mutation_p.R69*	NM_020170	NP_064555	Q969V3	NCLN_HUMAN	nicalin precursor	424	Lumenal (Potential).				proteolysis|regulation of signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	peptidase activity|protein binding				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.83e-113)|Epithelial(107;1.65e-111)|all cancers(105;1.53e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00139)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9056991	9056991	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9056991A>C	uc002mkp.2	-	3	30659	c.30455T>G	c.(30454-30456)TTT>TGT	p.F10152C		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10154	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9063821	9063821	+	Silent	SNP	A	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9063821A>C	uc002mkp.2	-	3	23829	c.23625T>G	c.(23623-23625)GCT>GCG	p.A7875A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	7877	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9090348	9090348	+	Silent	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9090348G>T	uc002mkp.2	-	1	1671	c.1467C>A	c.(1465-1467)ACC>ACA	p.T489T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	489	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
OR7A5	26659	broad.mit.edu	37	19	14938943	14938943	+	Silent	SNP	G	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14938943G>C	uc002mzw.2	-	1	334	c.111C>G	c.(109-111)GTC>GTG	p.V37V	OR7A5_uc010xoa.1_Silent_p.V37V	NM_017506	NP_059976	Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A,	37	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(2)	2																		---	---	---	---
SLC1A6	6511	broad.mit.edu	37	19	15082662	15082662	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15082662C>T	uc002naa.1	-	2	238	c.230G>A	c.(229-231)CGC>CAC	p.R77H	SLC1A6_uc010dzu.1_Missense_Mutation_p.R77H|SLC1A6_uc010xod.1_Silent_p.A81A|SLC1A6_uc002nab.2_Missense_Mutation_p.R77H|SLC1A6_uc002nac.2_Missense_Mutation_p.R77H|SLC1A6_uc002nad.1_Missense_Mutation_p.R77H	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	77					synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)													---	---	---	---
ZNF626	199777	broad.mit.edu	37	19	20808322	20808322	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20808322C>T	uc002npb.1	-	4	511	c.361G>A	c.(361-363)GAT>AAT	p.D121N	ZNF626_uc002npc.1_Missense_Mutation_p.D45N	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	121					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
ZNF546	339327	broad.mit.edu	37	19	40521049	40521049	+	Silent	SNP	T	C	C			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40521049T>C	uc002oms.2	+	7	2128	c.1872T>C	c.(1870-1872)CTT>CTC	p.L624L	ZNF546_uc002omt.2_Silent_p.L598L	NM_178544	NP_848639	Q86UE3	ZN546_HUMAN	zinc finger protein 546	624	C2H2-type 15.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)																	---	---	---	---
CYTH2	9266	broad.mit.edu	37	19	48973600	48973600	+	Intron	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48973600C>A	uc002pjj.3	+						uc002pjg.2_5'Flank|CYTH2_uc010xzr.1_Intron|CYTH2_uc002pji.2_Intron	NM_017457	NP_059431			cytohesin 2 isoform 1						actin cytoskeleton organization|endocytosis|regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|membrane fraction|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1																		---	---	---	---
MIR1283-1	100302265	broad.mit.edu	37	19	54191792	54191792	+	RNA	SNP	G	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54191792G>A	hsa-mir-1283-1|MI0003832	+			c.58G>A			MIR520A_hsa-mir-520a|MI0003149_5'Flank																	0																		---	---	---	---
SAMHD1	25939	broad.mit.edu	37	20	35526907	35526907	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35526907A>G	uc002xgh.1	-	14	1674	c.1544T>C	c.(1543-1545)ATT>ACT	p.I515T	SAMHD1_uc010gft.1_Intron	NM_015474	NP_056289	Q9Y3Z3	SAMH1_HUMAN	SAM domain- and HD domain-containing protein 1	515					defense response to virus|innate immune response|regulation of innate immune response	nucleus	metal ion binding|phosphoric diester hydrolase activity				0		Myeloproliferative disorder(115;0.00878)																---	---	---	---
PI4KA	5297	broad.mit.edu	37	22	21119388	21119388	+	Silent	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21119388G>T	uc002zsz.3	-	21	2631	c.2400C>A	c.(2398-2400)CCC>CCA	p.P800P		NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	800					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)															---	---	---	---
FANCB	2187	broad.mit.edu	37	X	14882719	14882719	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14882719G>T	uc004cwg.1	-	3	1182	c.914C>A	c.(913-915)TCC>TAC	p.S305Y	FANCB_uc004cwh.1_Missense_Mutation_p.S305Y	NM_001018113	NP_001018123	Q8NB91	FANCB_HUMAN	Fanconi anemia complementation group B	305					DNA repair	nucleoplasm				lung(1)	1	Hepatocellular(33;0.183)												Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
IL13RA2	3598	broad.mit.edu	37	X	114249104	114249104	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114249104C>A	uc004epx.2	-	4	405	c.280G>T	c.(280-282)GGG>TGG	p.G94W	IL13RA2_uc010nqd.1_Missense_Mutation_p.G94W	NM_000640	NP_000631	Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2 precursor	94	Extracellular (Potential).|Fibronectin type-III 1.					extracellular space|integral to membrane|soluble fraction	cytokine receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3																		---	---	---	---
WDR44	54521	broad.mit.edu	37	X	117576527	117576527	+	Splice_Site	SNP	G	T	T			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117576527G>T	uc004eqn.2	+	17	2694	c.2269_splice	c.e17-1	p.I757_splice	WDR44_uc004eqo.2_Splice_Site_p.I757_splice|WDR44_uc011mtr.1_Splice_Site_p.I668_splice|WDR44_uc010nqi.2_Splice_Site_p.I467_splice	NM_019045	NP_061918			WD repeat domain 44 protein							cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm				lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5																		---	---	---	---
DDX26B	203522	broad.mit.edu	37	X	134680324	134680324	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BR-4278-01A-01D-1126-08	TCGA-BR-4278-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134680324T>A	uc004eyw.3	+	4	722	c.359T>A	c.(358-360)TTA>TAA	p.L120*		NM_182540	NP_872346	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide	120	VWFA.										0	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
