Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PEX14	5195	broad.mit.edu	37	1	10683249	10683249	+	Intron	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10683249C>T	uc001arn.2	+						PEX14_uc009vmu.1_3'UTR|PEX14_uc009vmv.2_Intron|PEX14_uc010oam.1_Intron|PEX14_uc010oan.1_Intron|PEX14_uc009vmw.2_Intron	NM_004565	NP_004556	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14						negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|protein homooligomerization|protein import into peroxisome matrix|transmembrane transport	integral to membrane|nucleus|peroxisomal membrane|protein complex	protein N-terminus binding|transcription corepressor activity			breast(1)	1	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		TGCCCCTCCCCTCTCCCTCTG	0.502													3	18	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16959646	16959646	+	Intron	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16959646G>T	uc001azf.2	-						CROCCL1_uc009vov.1_5'Flank|CROCCL1_uc001aze.2_5'Flank|CROCCL1_uc001azg.1_RNA|CROCCL1_uc001azi.1_RNA|uc001azj.1_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						CTGGCACTGAGGTCAGCCTTG	0.607													4	15	---	---	---	---	PASS
TMEM50A	23585	broad.mit.edu	37	1	25687310	25687310	+	3'UTR	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25687310C>T	uc001bke.2	+	7					TMEM50A_uc010oeq.1_3'UTR|TMEM50A_uc009vrr.2_RNA|TMEM50A_uc009vrs.2_RNA	NM_014313	NP_055128	O95807	TM50A_HUMAN	small membrane protein 1							endoplasmic reticulum|integral to membrane					0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;3.47e-27)|Colorectal(126;1.1e-08)|COAD - Colon adenocarcinoma(152;7.48e-07)|STAD - Stomach adenocarcinoma(196;0.00035)|BRCA - Breast invasive adenocarcinoma(304;0.00047)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|GBM - Glioblastoma multiforme(114;0.00106)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.204)		AGTGTAGTCTCAGCTTAAAGT	0.358													19	55	---	---	---	---	PASS
ZMYM1	79830	broad.mit.edu	37	1	35578967	35578967	+	Silent	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35578967G>A	uc001bym.2	+	11	1684	c.1536G>A	c.(1534-1536)AAG>AAA	p.K512K	ZMYM1_uc001byn.2_Silent_p.K512K|ZMYM1_uc010ohu.1_Silent_p.K493K|ZMYM1_uc001byo.2_Silent_p.K152K|ZMYM1_uc009vut.2_Silent_p.K437K	NM_024772	NP_079048	Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM domain containing 1	512	TTF-type.					nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AATTCAGAAAGCATGAAAAAA	0.363													31	99	---	---	---	---	PASS
FAM183A	440585	broad.mit.edu	37	1	43616487	43616487	+	Silent	SNP	A	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43616487A>C	uc009vwo.2	+	2	218	c.189A>C	c.(187-189)GCA>GCC	p.A63A		NM_001101376	NP_001094846	A6NL82	F183A_HUMAN	hCG23177	63										ovary(3)	3						AGGAACCTGCAGATGGTAAGT	0.468													45	228	---	---	---	---	PASS
CYP4A11	1579	broad.mit.edu	37	1	47402390	47402390	+	Nonsense_Mutation	SNP	A	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47402390A>C	uc001cqp.3	-	4	507	c.456T>G	c.(454-456)TAT>TAG	p.Y152*	CYP4A11_uc001cqq.2_Nonsense_Mutation_p.Y152*|CYP4A11_uc010omm.1_RNA	NM_000778	NP_000769	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A,	152					long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding			ovary(2)|skin(2)	4					NADH(DB00157)	TCAGGATGTCATAGTGGAAGG	0.522													9	59	---	---	---	---	PASS
SCP2	6342	broad.mit.edu	37	1	53516318	53516318	+	Missense_Mutation	SNP	T	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53516318T>A	uc001cur.1	+	16	1707	c.1586T>A	c.(1585-1587)ATG>AAG	p.M529K	SCP2_uc001cus.1_RNA|SCP2_uc010ono.1_Missense_Mutation_p.M448K|SCP2_uc010onp.1_Missense_Mutation_p.M505K|SCP2_uc009vzi.1_Missense_Mutation_p.M485K|SCP2_uc010onq.1_3'UTR|SCP2_uc001cut.1_Missense_Mutation_p.M122K|SCP2_uc001cuu.1_3'UTR	NM_002979	NP_002970	P22307	NLTP_HUMAN	sterol carrier protein 2 isoform 1 proprotein	529	SCP2.				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase|lipid transport	mitochondrion|nucleus|peroxisomal matrix	propanoyl-CoA C-acyltransferase activity|propionyl-CoA C2-trimethyltridecanoyltransferase activity|protein binding|sterol binding			breast(1)	1						ACTGGCAACATGGGTCTCGCT	0.373													102	245	---	---	---	---	PASS
SFRS11	9295	broad.mit.edu	37	1	70694139	70694139	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70694139T>G	uc001des.2	+	3	362	c.238T>G	c.(238-240)TTT>GTT	p.F80V	SFRS11_uc009wbi.2_Missense_Mutation_p.F80V|SFRS11_uc009wbj.1_Missense_Mutation_p.F80V|SFRS11_uc010oqo.1_Missense_Mutation_p.F80V|SFRS11_uc001det.2_Missense_Mutation_p.F80V|SFRS11_uc001deu.2_Missense_Mutation_p.F80V|SFRS11_uc001dev.2_5'Flank	NM_004768	NP_004759	Q05519	SRS11_HUMAN	splicing factor, arginine/serine-rich 11	80	RRM.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						TCGTGTCTGCTTTGTTAAGTT	0.383													78	227	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86196352	86196352	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86196352C>G	uc001dlj.2	-	60	5064	c.5022G>C	c.(5020-5022)AAG>AAC	p.K1674N	COL24A1_uc001dli.2_Missense_Mutation_p.K789N|COL24A1_uc010osd.1_Missense_Mutation_p.K974N|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	1674	Fibrillar collagen NC1.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		GAAATGTTGCCTTATGCCAGC	0.363													8	391	---	---	---	---	PASS
HS2ST1	9653	broad.mit.edu	37	1	87549934	87549934	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87549934G>A	uc010osk.1	+	3	806	c.421G>A	c.(421-423)GGA>AGA	p.G141R	HS2ST1_uc001dmc.3_Missense_Mutation_p.G141R|LOC339524_uc001dme.1_Missense_Mutation_p.G102R	NM_012262	NP_036394	Q7LGA3	HS2ST_HUMAN	heparan sulfate 2-O-sulfotransferase 1 isoform	141	Lumenal (Potential).					Golgi membrane|integral to membrane				central_nervous_system(1)	1		Lung NSC(277;0.153)		all cancers(265;0.00699)|Epithelial(280;0.0261)		ATTTTATCATGGACACGTTTC	0.313													7	496	---	---	---	---	PASS
EVI5	7813	broad.mit.edu	37	1	93089777	93089777	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93089777C>T	uc001dox.2	-	14	1745	c.1735G>A	c.(1735-1737)GAA>AAA	p.E579K	EVI5_uc010otf.1_Missense_Mutation_p.E590K|EVI5_uc001doy.1_RNA	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5	579	Targeting to the centrosomes.|Potential.|Dimerization.|Interaction with AURKB and INCENP.				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		TCTCTTATTTCTGCTTGTGTT	0.378													177	514	---	---	---	---	PASS
PDIA3P	171423	broad.mit.edu	37	1	146651135	146651135	+	3'UTR	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146651135C>A	uc001epg.1	+	1						NR_002305				SubName: Full=cDNA FLJ53558, highly similar to Protein disulfide-isomerase A3 (EC 5.3.4.1);												0						CTATCTACAACGAGAAGCTAC	0.393													5	120	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152191921	152191921	+	Silent	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152191921T>C	uc001ezt.1	-	3	2260	c.2184A>G	c.(2182-2184)AAA>AAG	p.K728K		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	728	7.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TAGAGCCGTGTTTTCTGTAGC	0.542													5	141	---	---	---	---	PASS
ALDH9A1	223	broad.mit.edu	37	1	165632351	165632351	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165632351A>G	uc001gdh.1	-	11	1598	c.1493T>C	c.(1492-1494)ATC>ACC	p.I498T	ALDH9A1_uc010pky.1_Missense_Mutation_p.I404T|ALDH9A1_uc010pkz.1_Missense_Mutation_p.I488T	NM_000696	NP_000687	P49189	AL9A1_HUMAN	aldehyde dehydrogenase 9A1	474					carnitine biosynthetic process|cellular aldehyde metabolic process|hormone metabolic process|neurotransmitter biosynthetic process	cytosol|plasma membrane	3-chloroallyl aldehyde dehydrogenase activity|4-trimethylammoniobutyraldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|aminobutyraldehyde dehydrogenase activity				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				NADH(DB00157)	ATAATATTCGATTGTCACACG	0.453													6	270	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196250087	196250087	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196250087C>A	uc001gtd.1	-	25	2873	c.2813G>T	c.(2812-2814)AGA>ATA	p.R938I	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.R864I|KCNT2_uc001gtf.1_Missense_Mutation_p.R914I|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Missense_Mutation_p.R914I|KCNT2_uc001gth.1_Missense_Mutation_p.R435I	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	938	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						GGCATAAGTTCTGATCCATAA	0.343													106	295	---	---	---	---	PASS
KIF21B	23046	broad.mit.edu	37	1	200960791	200960791	+	Silent	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200960791G>T	uc001gvs.1	-	17	2765	c.2448C>A	c.(2446-2448)ACC>ACA	p.T816T	KIF21B_uc001gvr.1_Silent_p.T816T|KIF21B_uc009wzl.1_Silent_p.T816T|KIF21B_uc010ppn.1_Silent_p.T816T	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	816	Potential.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						TCACCTCCTGGGTCTTCCTCC	0.612													15	28	---	---	---	---	PASS
HSD11B1	3290	broad.mit.edu	37	1	209880307	209880307	+	Silent	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209880307T>C	uc001hhj.2	+	5	458	c.351T>C	c.(349-351)ATT>ATC	p.I117I	HSD11B1_uc001hhk.2_Silent_p.I117I	NM_181755	NP_861420	P28845	DHI1_HUMAN	11-beta-hydroxysteroid dehydrogenase 1	117	Lumenal (Potential).				glucocorticoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	11-beta-hydroxysteroid dehydrogenase (NADP+) activity|11-beta-hydroxysteroid dehydrogenase|binding			breast(1)	1				OV - Ovarian serous cystadenocarcinoma(81;1.04e-55)|Epithelial(68;1.57e-52)|all cancers(67;1.83e-46)|Colorectal(1306;0.115)	NADH(DB00157)	ACATGCTCATTCTCAACCACA	0.438													6	150	---	---	---	---	PASS
URB2	9816	broad.mit.edu	37	1	229773365	229773365	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229773365G>A	uc001hts.1	+	4	3141	c.3005G>A	c.(3004-3006)GGG>GAG	p.G1002E	URB2_uc009xfd.1_Missense_Mutation_p.G1002E	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	1002						nucleolus				central_nervous_system(2)|ovary(1)	3						CAAGTGATAGGGACGTTCTTA	0.433													67	191	---	---	---	---	PASS
E2F6	1876	broad.mit.edu	37	2	11590167	11590167	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11590167T>C	uc002rbh.2	-	5	914	c.622A>G	c.(622-624)ACC>GCC	p.T208A	E2F6_uc002rbe.2_Missense_Mutation_p.T133A|E2F6_uc002rbf.2_Missense_Mutation_p.T176A|E2F6_uc002rbg.2_Missense_Mutation_p.T133A|E2F6_uc002rbi.2_Missense_Mutation_p.T133A|E2F6_uc010yjl.1_Intron	NM_198256	NP_937987	O75461	E2F6_HUMAN	E2F transcription factor 6	208	Transcription repression.|Dimerization (Potential).				negative regulation of transcription from RNA polymerase II promoter	MLL1 complex|transcription factor complex	DNA binding|transcription corepressor activity			skin(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.114)|OV - Ovarian serous cystadenocarcinoma(76;0.168)		TCCAATCTGGTTTCTGCTGGA	0.423													6	264	---	---	---	---	PASS
SEMA4F	10505	broad.mit.edu	37	2	74902021	74902021	+	Silent	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74902021G>T	uc002sna.1	+	9	1119	c.1008G>T	c.(1006-1008)GGG>GGT	p.G336G	SEMA4F_uc010ffq.1_Silent_p.G303G|SEMA4F_uc010ffr.1_5'UTR|SEMA4F_uc002snb.1_5'UTR|SEMA4F_uc002snc.1_Silent_p.G181G	NM_004263	NP_004254	O95754	SEM4F_HUMAN	semaphorin W precursor	336	Sema.|Extracellular (Potential).				cell-cell signaling	endoplasmic reticulum|integral to plasma membrane	receptor activity			ovary(2)|pancreas(1)|skin(1)	4						CCAGGGAGGGGGCTACTATCT	0.522													21	55	---	---	---	---	PASS
TSGA10	80705	broad.mit.edu	37	2	99725301	99725301	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99725301C>T	uc002szg.3	-	5	833	c.205G>A	c.(205-207)GAA>AAA	p.E69K	TSGA10_uc002szh.3_Missense_Mutation_p.E69K|TSGA10_uc002szi.3_Missense_Mutation_p.E69K|TSGA10_uc010fin.1_Missense_Mutation_p.E69K|TSGA10_uc010yvn.1_Missense_Mutation_p.E69K	NM_182911	NP_878915	Q9BZW7	TSG10_HUMAN	testis specific, 10	69					spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2						TTTACCTGTTCATAAAGAAGG	0.323													95	251	---	---	---	---	PASS
IL1F5	26525	broad.mit.edu	37	2	113820280	113820280	+	3'UTR	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113820280G>A	uc002tis.2	+	5					IL1F5_uc002tit.2_3'UTR	NM_173170	NP_775262	Q9UBH0	I36RA_HUMAN	interleukin 1 family, member 5							extracellular space	cytokine activity|interleukin-1 receptor antagonist activity				0						AGAACTCCCTGGGCAGAGCCA	0.607													5	14	---	---	---	---	PASS
GALNT5	11227	broad.mit.edu	37	2	158114785	158114785	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158114785G>A	uc002tzg.2	+	1	446	c.191G>A	c.(190-192)GGA>GAA	p.G64E	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	64	Lumenal (Potential).				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						CCAGACCAAGGAAAAATTTTT	0.478													65	179	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166901756	166901756	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166901756A>G	uc010zcz.1	-	10	1477	c.1459T>C	c.(1459-1461)TCT>CCT	p.S487P	SCN1A_uc002udo.3_Missense_Mutation_p.S356P|SCN1A_uc010fpk.2_Missense_Mutation_p.S356P	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	487						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	CTCAACTTAGAGGCTTCAGAT	0.468													6	300	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	167760143	167760143	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167760143G>T	uc002udx.2	+	1	169	c.151G>T	c.(151-153)GTA>TTA	p.V51L	XIRP2_uc010fpn.2_Missense_Mutation_p.V51L|XIRP2_uc010fpo.2_Missense_Mutation_p.V51L|XIRP2_uc010fpp.2_Missense_Mutation_p.V51L	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	Error:Variant_position_missing_in_A4UGR9_after_alignment					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						AGGAGAGGTAGTATCAGCACC	0.483													30	83	---	---	---	---	PASS
SPC25	57405	broad.mit.edu	37	2	169745777	169745777	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169745777T>G	uc002uel.2	-	3	289	c.158A>C	c.(157-159)GAA>GCA	p.E53A		NM_020675	NP_065726	Q9HBM1	SPC25_HUMAN	spindle pole body component 25	53	Interaction with the NDC80-NUF2 subcomplex.|Interaction with the N-terminus of SPBC24.				cell division|chromosome segregation|mitotic prometaphase|mitotic spindle organization	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding			central_nervous_system(1)	1						TCGTTCTTCTTCCTTTAATTT	0.299													112	437	---	---	---	---	PASS
ITGA6	3655	broad.mit.edu	37	2	173352130	173352130	+	Silent	SNP	G	A	A	rs141344340		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173352130G>A	uc002uhp.1	+	15	2312	c.2109G>A	c.(2107-2109)ACG>ACA	p.T703T	ITGA6_uc010zdy.1_Silent_p.T584T|ITGA6_uc002uho.1_Silent_p.T703T|ITGA6_uc010fqm.1_Silent_p.T349T	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	742	Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			TGATTGCAACGTTTCCAGACA	0.433													43	121	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179544657	179544657	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179544657T>C	uc010zfg.1	-	137	30036	c.29812A>G	c.(29812-29814)ACT>GCT	p.T9938A	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.T6599A|TTN_uc010fre.1_Intron|TTN_uc002una.1_5'Flank|TTN_uc010frf.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10865							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTCCTCAGTTATGAACTCC	0.443													7	511	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179582267	179582267	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179582267G>A	uc010zfg.1	-	84	21826	c.21602C>T	c.(21601-21603)GCC>GTC	p.A7201V	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.A3862V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8128							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATGAGCTTGGCACTGGATGA	0.458													48	141	---	---	---	---	PASS
NBEAL1	65065	broad.mit.edu	37	2	204067500	204067500	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204067500A>G	uc002uzt.3	+	50	7748	c.7415A>G	c.(7414-7416)CAA>CGA	p.Q2472R	NBEAL1_uc002uzs.3_Missense_Mutation_p.Q1113R	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	2472	WD 1.						binding			ovary(1)|skin(1)	2						CAAATAACACAACAGGTAGTC	0.353													6	368	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216245513	216245513	+	Intron	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216245513G>T	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron|FN1_uc002vez.2_5'UTR|FN1_uc010zjp.1_Intron|FN1_uc002vfk.1_5'Flank|FN1_uc010fva.1_5'Flank|FN1_uc010fvb.1_5'Flank|FN1_uc010fvc.1_Intron|FN1_uc010fvd.1_Intron	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGGGCACCTGGTGGTGCAATT	0.483													7	17	---	---	---	---	PASS
CCDC108	255101	broad.mit.edu	37	2	219900064	219900064	+	Intron	SNP	T	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219900064T>G	uc002vjl.1	-						CCDC108_uc010zkp.1_Intron|CCDC108_uc010zkq.1_Intron|CCDC108_uc002vjn.2_Missense_Mutation_p.Q162P	NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1							integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTATTCATACTGCACGTATTT	0.164													41	109	---	---	---	---	PASS
WDFY1	57590	broad.mit.edu	37	2	224744929	224744929	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224744929A>G	uc002vnq.2	-	11	1136	c.1085T>C	c.(1084-1086)TTT>TCT	p.F362S		NM_020830	NP_065881	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1	362						cytosol|early endosome|nucleus	1-phosphatidylinositol binding|zinc ion binding			lung(1)	1		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		TCCTTCATGAAAGGTCGCTAG	0.438													5	149	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228883640	228883640	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228883640T>C	uc002vpq.2	-	7	1977	c.1930A>G	c.(1930-1932)AAC>GAC	p.N644D	SPHKAP_uc002vpp.2_Missense_Mutation_p.N644D|SPHKAP_uc010zlx.1_Missense_Mutation_p.N644D	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	644						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		ATTCTCCTGTTCATGGAGTCC	0.478													53	142	---	---	---	---	PASS
UGT1A7	54577	broad.mit.edu	37	2	234591037	234591037	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234591037G>A	uc002vut.2	+	1	454	c.454G>A	c.(454-456)GCC>ACC	p.A152T	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Missense_Mutation_p.A152T	NM_019077	NP_061950	Q9HAW7	UD17_HUMAN	UDP glycosyltransferase 1 family, polypeptide A7	152					drug metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	drug binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|retinoic acid binding			ovary(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)		TCCTTTTGATGCCTGTGGCTT	0.408													97	400	---	---	---	---	PASS
UGT1A7	54577	broad.mit.edu	37	2	234591142	234591142	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234591142C>G	uc002vut.2	+	1	559	c.559C>G	c.(559-561)CTT>GTT	p.L187V	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Missense_Mutation_p.L187V	NM_019077	NP_061950	Q9HAW7	UD17_HUMAN	UDP glycosyltransferase 1 family, polypeptide A7	187					drug metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	drug binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|retinoic acid binding			ovary(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CCCTGCTCCTCTTTCCTATGT	0.468													58	179	---	---	---	---	PASS
AGXT	189	broad.mit.edu	37	2	241816834	241816834	+	Intron	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241816834T>C	uc002waa.3	+						AGXT_uc002wab.3_Missense_Mutation_p.S121P	NM_000030	NP_000021	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase						glyoxylate metabolic process|protein targeting to peroxisome	mitochondrial matrix|peroxisomal matrix	alanine-glyoxylate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|serine-pyruvate transaminase activity				0		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	AACTGGGGGCTCCAGGGGCTC	0.647													3	4	---	---	---	---	PASS
RFTN1	23180	broad.mit.edu	37	3	16368331	16368331	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16368331T>C	uc003cay.2	-	8	1481	c.1199A>G	c.(1198-1200)TAT>TGT	p.Y400C	RFTN1_uc010hes.2_Missense_Mutation_p.Y364C|OXNAD1_uc003cax.2_Intron|OXNAD1_uc011awb.1_Intron	NM_015150	NP_055965	Q14699	RFTN1_HUMAN	raft-linking protein	400						plasma membrane				ovary(3)|central_nervous_system(1)	4						CTGCCAGCCATAGGCCGCCAG	0.473													8	13	---	---	---	---	PASS
PLXNB1	5364	broad.mit.edu	37	3	48463743	48463743	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48463743G>T	uc003csw.2	-	5	1686	c.1416C>A	c.(1414-1416)AGC>AGA	p.S472R	PLXNB1_uc003csu.2_Missense_Mutation_p.S472R|PLXNB1_uc003csx.2_Missense_Mutation_p.S472R|PLXNB1_uc010hjx.1_RNA	NM_002673	NP_002664	O43157	PLXB1_HUMAN	plexin B1 precursor	472	Extracellular (Potential).|Sema.				axon guidance|cell migration|intracellular signal transduction|regulation of cell shape|regulation of cytoskeleton organization|regulation of small GTPase mediated signal transduction|semaphorin-plexin signaling pathway	extracellular region|integral to plasma membrane|intracellular|semaphorin receptor complex	GTPase activator activity|semaphorin receptor activity|semaphorin receptor binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CACTCACTGTGCTCTGGGTCA	0.602													3	31	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52442521	52442521	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52442521T>C	uc003ddx.2	-	4	339	c.224A>G	c.(223-225)GAT>GGT	p.D75G	PHF7_uc003ddy.2_5'Flank|PHF7_uc003ddz.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	75					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		ATTCACAATATCATCATCAAT	0.478			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								17	43	---	---	---	---	PASS
PTPRG	5793	broad.mit.edu	37	3	62258667	62258667	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62258667C>G	uc003dlb.2	+	22	3948	c.3229C>G	c.(3229-3231)CTG>GTG	p.L1077V	PTPRG_uc003dlc.2_Missense_Mutation_p.L1048V|PTPRG_uc011bfi.1_Missense_Mutation_p.L323V|uc010hno.2_Intron|uc003dld.3_Intron|uc010hnp.2_Intron|uc003dle.3_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	1077	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		AGACAGCATGCTGCAACAGAT	0.433													75	157	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154856020	154856020	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154856020G>T	uc010hvr.1	+	9	1061	c.850G>T	c.(850-852)GCC>TCC	p.A284S	MME_uc003fab.1_Missense_Mutation_p.A284S|MME_uc003fac.1_Missense_Mutation_p.A284S|MME_uc003fad.1_Missense_Mutation_p.A284S|MME_uc003fae.1_Missense_Mutation_p.A284S	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	284	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	AAAAGAAATTGCCAATGTAAA	0.353													130	283	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154856021	154856021	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154856021C>G	uc010hvr.1	+	9	1062	c.851C>G	c.(850-852)GCC>GGC	p.A284G	MME_uc003fab.1_Missense_Mutation_p.A284G|MME_uc003fac.1_Missense_Mutation_p.A284G|MME_uc003fad.1_Missense_Mutation_p.A284G|MME_uc003fae.1_Missense_Mutation_p.A284G	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	284	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	AAAGAAATTGCCAATGTAAAA	0.353													124	281	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	159819101	159819101	+	Intron	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159819101T>C	uc003fcw.1	-						uc003fcz.1_RNA					Homo sapiens cDNA FLJ39842 fis, clone SPLEN2014293.																		AGTGCTTTCTTTTCATTTCCT	0.373													6	398	---	---	---	---	PASS
SERPINI2	5276	broad.mit.edu	37	3	167189395	167189395	+	Silent	SNP	T	C	C	rs139710300	byFrequency	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167189395T>C	uc003fer.1	-	1	286	c.228A>G	c.(226-228)AAA>AAG	p.K76K	SERPINI2_uc003fes.1_Silent_p.K86K|SERPINI2_uc003fet.1_Silent_p.K76K	NM_006217	NP_006208	O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin),	76					cellular component movement|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(2)|urinary_tract(1)	3						TTTCCTGTTGTTTTAAAGTTT	0.368													10	792	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195507059	195507059	+	Missense_Mutation	SNP	T	C	C	rs76367261		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195507059T>C	uc011bto.1	-	3	11468	c.11008A>G	c.(11008-11010)ACT>GCT	p.T3670A	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_5'Flank|MUC4_uc011btg.1_5'Flank|MUC4_uc011bth.1_5'Flank|MUC4_uc011bti.1_5'Flank|MUC4_uc011btj.1_5'Flank|MUC4_uc011btk.1_5'Flank|MUC4_uc011btl.1_5'Flank|MUC4_uc011btm.1_5'Flank|MUC4_uc011btn.1_5'Flank|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGTGTCGGTGACA	0.602													4	11	---	---	---	---	PASS
RGS12	6002	broad.mit.edu	37	4	3388137	3388137	+	Intron	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3388137T>C	uc003ggw.2	+						RGS12_uc003ggu.2_Intron|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_Intron|RGS12_uc003ggv.2_Intron|RGS12_uc003ggy.1_Intron|RGS12_uc010ict.1_Intron|RGS12_uc003ggz.2_Intron|RGS12_uc010icu.1_Intron|RGS12_uc011bvs.1_Missense_Mutation_p.F7L|RGS12_uc003gha.2_Missense_Mutation_p.F7L|RGS12_uc010icv.2_5'UTR	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1							condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTCTCTTTTCTTTCAGTCTGC	0.378													8	591	---	---	---	---	PASS
FBXL5	26234	broad.mit.edu	37	4	15607173	15607173	+	3'UTR	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15607173G>T	uc003goc.1	-	11					FBXL5_uc010idw.1_3'UTR|FBXL5_uc003gob.1_3'UTR|FBXL5_uc010idx.1_3'UTR|FBXL5_uc003god.1_3'UTR	NM_012161	NP_036293	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5 isoform						iron ion homeostasis|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|SCF ubiquitin ligase complex	iron ion binding|protein binding|ubiquitin-protein ligase activity				0						ATTTGCAAGAGAAACAACATT	0.318													9	13	---	---	---	---	PASS
GPR125	166647	broad.mit.edu	37	4	22390201	22390201	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22390201A>C	uc003gqm.1	-	19	3358	c.3093T>G	c.(3091-3093)TTT>TTG	p.F1031L	GPR125_uc010ieo.1_Missense_Mutation_p.F887L|GPR125_uc003gql.1_Missense_Mutation_p.F158L	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor	1031	Helical; Name=7; (Potential).				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				TTGTGGCTCCAAAAACGAAGC	0.463													9	142	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126329836	126329836	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126329836A>G	uc003ifj.3	+	4	5807	c.5807A>G	c.(5806-5808)GAT>GGT	p.D1936G	FAT4_uc011cgp.1_Missense_Mutation_p.D234G	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1936	Cadherin 18.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						AATATTCTAGATGTAAATGAT	0.338													6	327	---	---	---	---	PASS
TMEM184C	55751	broad.mit.edu	37	4	148539066	148539066	+	5'UTR	SNP	A	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148539066A>C	uc003ila.3	+	1						NM_018241	NP_060711	Q9NVA4	T184C_HUMAN	transmembrane protein 184C							integral to membrane					0						AATCTTTTCGAGATCTTTTCC	0.493											OREG0016353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	51	127	---	---	---	---	PASS
RPS3A	6189	broad.mit.edu	37	4	152025085	152025085	+	Intron	SNP	A	T	T	rs139835933	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152025085A>T	uc003ilz.2	+						RPS3A_uc011cie.1_3'UTR	NM_001006	NP_000997	P61247	RS3A_HUMAN	ribosomal protein S3a						cell differentiation|endocrine pancreas development|induction of apoptosis|translational elongation|translational initiation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_hematologic(180;0.093)					taatggaaaaagcataaggct	0.184													3	3	---	---	---	---	PASS
SH3D19	152503	broad.mit.edu	37	4	152043042	152043042	+	3'UTR	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152043042G>T	uc010ipl.1	-	21					SH3D19_uc003imb.2_3'UTR|SH3D19_uc003imc.2_3'UTR|SH3D19_uc003ime.2_3'UTR|SH3D19_uc010ipm.2_3'UTR	NM_001009555	NP_001009555	Q5HYK7	SH319_HUMAN	SH3 domain containing 19 isoform a						cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding			ovary(1)|skin(1)	2	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				CTAGCTCATGGGTTTCCATGT	0.413													6	13	---	---	---	---	PASS
DDX60	55601	broad.mit.edu	37	4	169201556	169201556	+	Silent	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169201556T>C	uc003irp.2	-	14	2200	c.1908A>G	c.(1906-1908)AAA>AAG	p.K636K		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	636							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CAACCTGAAGTTTCACACAGC	0.363													9	333	---	---	---	---	PASS
SNX25	83891	broad.mit.edu	37	4	186231811	186231811	+	Silent	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186231811A>G	uc003ixh.2	+	7	882	c.693A>G	c.(691-693)AAA>AAG	p.K231K	SNX25_uc010ish.2_Silent_p.K2K	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25	231					cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		CGGCAATGAAAGCTGATCTCC	0.488													5	155	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11018139	11018139	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11018139G>T	uc003jfa.1	-	18	3176	c.3031C>A	c.(3031-3033)CAG>AAG	p.Q1011K	CTNND2_uc010itt.2_Missense_Mutation_p.Q920K|CTNND2_uc011cmy.1_Missense_Mutation_p.Q674K|CTNND2_uc011cmz.1_Missense_Mutation_p.Q578K|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.Q603K	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	1011	ARM 9.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						TTGAGGACCTGAGATGCAGCC	0.448													76	192	---	---	---	---	PASS
MTMR12	54545	broad.mit.edu	37	5	32242165	32242165	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32242165A>G	uc003jhq.2	-	12	1339	c.1169T>C	c.(1168-1170)TTA>TCA	p.L390S	MTMR12_uc010iuk.2_Missense_Mutation_p.L390S|MTMR12_uc010iul.2_Missense_Mutation_p.L390S	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	390	Myotubularin phosphatase.					cytoplasm	phosphatase activity			ovary(1)	1						TATATTACCTAAAAGAAGAAC	0.333													138	380	---	---	---	---	PASS
TNFAIP8	25816	broad.mit.edu	37	5	118691785	118691785	+	5'UTR	SNP	T	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118691785T>A	uc003ksh.2	+	2					TNFAIP8_uc003ksf.1_Intron|TNFAIP8_uc003ksg.2_Intron|TNFAIP8_uc011cwf.1_Intron|TNFAIP8_uc003ksi.2_5'UTR	NM_014350	NP_055165	O95379	TFIP8_HUMAN	tumor necrosis factor, alpha-induced protein 8						anti-apoptosis|apoptosis|negative regulation of anti-apoptosis	cytoplasm	caspase inhibitor activity|protein binding			ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)		ATCCTGACATTATGCACTCCG	0.537													20	136	---	---	---	---	PASS
AFF4	27125	broad.mit.edu	37	5	132270528	132270528	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132270528T>C	uc003kyd.2	-	3	637	c.229A>G	c.(229-231)ATT>GTT	p.I77V	AFF4_uc011cxk.1_5'UTR|AFF4_uc003kye.1_Missense_Mutation_p.I77V|AFF4_uc003kyf.3_Missense_Mutation_p.I77V	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31	77					transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGCTTGGGAATTGCAACAAGC	0.398													212	297	---	---	---	---	PASS
HSPA9	3313	broad.mit.edu	37	5	137892505	137892505	+	Silent	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137892505T>C	uc003ldf.2	-	15	1887	c.1779A>G	c.(1777-1779)GAA>GAG	p.E593E	HSPA9_uc003lde.2_Silent_p.E10E	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor	593					anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCATCTTGGTTTCTGTGTCGT	0.368													8	576	---	---	---	---	PASS
PCDHA12	56137	broad.mit.edu	37	5	140256584	140256584	+	Silent	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140256584G>A	uc003lic.2	+	1	1654	c.1527G>A	c.(1525-1527)TCG>TCA	p.S509S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.S509S	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	509	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTACGTGTCGGTGCACGCGG	0.701													3	8	---	---	---	---	PASS
GABRG2	2566	broad.mit.edu	37	5	161524855	161524855	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161524855A>G	uc003lyz.3	+	4	897	c.539A>G	c.(538-540)TAC>TGC	p.Y180C	GABRG2_uc010jjc.2_Missense_Mutation_p.Y180C|GABRG2_uc003lyy.3_Missense_Mutation_p.Y180C|GABRG2_uc011dej.1_Missense_Mutation_p.Y85C	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	180	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		CGAGTGCTCTACACCCTAAGG	0.368													43	186	---	---	---	---	PASS
CANX	821	broad.mit.edu	37	5	179136022	179136022	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179136022T>C	uc003mkk.2	+	6	667	c.490T>C	c.(490-492)TAT>CAT	p.Y164H	CANX_uc011dgp.1_Missense_Mutation_p.Y199H|CANX_uc010jlb.1_Missense_Mutation_p.Y100H|CANX_uc003mkl.2_Missense_Mutation_p.Y164H|CANX_uc011dgq.1_Missense_Mutation_p.Y56H	NM_001746	NP_001737	P27824	CALX_HUMAN	calnexin precursor	164	Lumenal (Potential).	Carbohydrate (By similarity).			post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein secretion	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane|melanosome	calcium ion binding|sugar binding|unfolded protein binding				0	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGGTGGTGCCTATGTGAAACT	0.378													7	680	---	---	---	---	PASS
SLC17A3	10786	broad.mit.edu	37	6	25850416	25850416	+	Intron	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25850416A>G	uc003nfi.3	-						SLC17A3_uc003nfk.3_Intron|SLC17A3_uc011djz.1_3'UTR|SLC17A3_uc011dka.1_3'UTR	NM_006632	NP_006623	O00476	NPT4_HUMAN	solute carrier family 17 (sodium phosphate),						glucose-6-phosphate transport|urate metabolic process	apical plasma membrane|brush border membrane|endoplasmic reticulum membrane|integral to plasma membrane|perinuclear region of cytoplasm	drug transmembrane transporter activity|efflux transmembrane transporter activity|organic anion transmembrane transporter activity|sodium:phosphate symporter activity|toxin transporter activity|urate transmembrane transporter activity|voltage-gated anion channel activity				0						CTAAAGAGAAAAGATTGAGTA	0.358													30	77	---	---	---	---	PASS
CYP21A2	1589	broad.mit.edu	37	6	32006526	32006526	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32006526C>A	uc003nze.1	+	2	348	c.230C>A	c.(229-231)ACC>AAC	p.T77N	CYP21A2_uc003nzf.1_Intron	NM_000500	NP_000491	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A,	76					glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|steroid 21-monooxygenase activity|steroid binding				0						TCCAAGAGGACCATTGAGGAA	0.532													11	66	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38957827	38957827	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38957827T>C	uc003ooe.1	+	86	13042	c.12442T>C	c.(12442-12444)TTT>CTT	p.F4148L		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GTCATTCTGCTTTTATACTGG	0.373													7	374	---	---	---	---	PASS
PM20D2	135293	broad.mit.edu	37	6	89862796	89862796	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89862796T>C	uc003pmz.2	+	3	744	c.649T>C	c.(649-651)TCT>CCT	p.S217P		NM_001010853	NP_001010853	Q8IYS1	P20D2_HUMAN	aminoacylase 1-like 2	217							hydrolase activity				0		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00813)		AGCATCTCATTCTGCTTCTTA	0.363													6	329	---	---	---	---	PASS
SLC22A16	85413	broad.mit.edu	37	6	110746162	110746162	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110746162A>G	uc003puf.2	-	8	1715	c.1648T>C	c.(1648-1650)TCA>CCA	p.S550P	SLC22A16_uc003pue.2_Missense_Mutation_p.S531P	NM_033125	NP_149116	Q86VW1	S22AG_HUMAN	solute carrier family 22, member 16	550					acid secretion|cell differentiation|multicellular organismal development|single fertilization|sperm motility|spermatogenesis	integral to membrane	carnitine transporter activity			ovary(1)	1		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)		AATTTGCTTGACTTGCTTTCA	0.458													6	281	---	---	---	---	PASS
SAMD3	154075	broad.mit.edu	37	6	130497092	130497092	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130497092T>C	uc003qbv.2	-	9	1042	c.716A>G	c.(715-717)GAT>GGT	p.D239G	SAMD3_uc003qbx.2_Missense_Mutation_p.D239G|SAMD3_uc003qbw.2_Missense_Mutation_p.D239G|SAMD3_uc010kfg.1_3'UTR	NM_001017373	NP_001017373	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3 isoform	239										ovary(1)	1				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		CACTTGCTCATCATCTTCTAT	0.353													7	537	---	---	---	---	PASS
IGF2R	3482	broad.mit.edu	37	6	160468352	160468352	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160468352G>A	uc003qta.2	+	16	2361	c.2213G>A	c.(2212-2214)GGC>GAC	p.G738D		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	738	5.|Lumenal (Potential).				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		GCGGGAGTGGGCTTCCCTGAA	0.502													39	76	---	---	---	---	PASS
CARD11	84433	broad.mit.edu	37	7	2954892	2954892	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2954892G>C	uc003smv.2	-	21	3222	c.2818C>G	c.(2818-2820)CTC>GTC	p.L940V		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	940					positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TCAGTCAAGAGCTTGGTGGCG	0.622			Mis		DLBCL								14	59	---	---	---	---	PASS
DDC	1644	broad.mit.edu	37	7	50611748	50611748	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50611748C>G	uc003tpf.3	-	2	122	c.36G>C	c.(34-36)GAG>GAC	p.E12D	DDC_uc010kza.2_Missense_Mutation_p.E12D|DDC_uc003tpg.3_Missense_Mutation_p.E12D	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid	12					cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	AATCCACCATCTCCTTCCCTC	0.537													55	147	---	---	---	---	PASS
C7orf23	79161	broad.mit.edu	37	7	86826037	86826037	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86826037A>T	uc003uio.2	-	4	484	c.272T>A	c.(271-273)TTT>TAT	p.F91Y		NM_024315	NP_077291	Q9BU79	CG023_HUMAN	chromosome 7 open reading frame 23	91						integral to membrane					0	Esophageal squamous(14;0.0058)|all_lung(186;0.191)|Lung NSC(181;0.192)					TAGCTTTCTAAATTTCGGTTC	0.313										HNSCC(41;0.11)			103	276	---	---	---	---	PASS
CAPZA2	830	broad.mit.edu	37	7	116556165	116556165	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116556165A>T	uc003vil.2	+	9	812	c.709A>T	c.(709-711)AAT>TAT	p.N237Y	CAPZA2_uc011knk.1_RNA	NM_006136	NP_006127	P47755	CAZA2_HUMAN	capping protein (actin filament) muscle Z-line,	237					actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement|innate immune response|protein complex assembly	cytosol|extracellular region|F-actin capping protein complex	actin binding				0	all_cancers(3;8.53e-08)|all_epithelial(6;7.79e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)		GBM - Glioblastoma multiforme(2;5.01e-06)|STAD - Stomach adenocarcinoma(10;0.000512)|all cancers(2;0.00326)			AGCTGCAGAAAATGAATACCA	0.244													57	142	---	---	---	---	PASS
FAM71F1	84691	broad.mit.edu	37	7	128358917	128358917	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128358917T>C	uc003vno.1	+	3	520	c.467T>C	c.(466-468)GTA>GCA	p.V156A	FAM71F1_uc010llo.1_Missense_Mutation_p.V57A|FAM71F1_uc011koq.1_Intron|FAM71F1_uc003vnm.1_Intron|FAM71F1_uc003vnn.1_Intron|FAM71F1_uc010llp.1_RNA|FAM71F1_uc003vnp.1_Missense_Mutation_p.V156A	NM_032599	NP_115988	Q96KD3	F71F1_HUMAN	testes development-related NYD-SP18	156										skin(1)	1						GAGCTCCAGGTATGTGACCAC	0.478													57	167	---	---	---	---	PASS
GIMAP6	474344	broad.mit.edu	37	7	150324711	150324711	+	3'UTR	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150324711C>A	uc003whn.2	-	3					GIMAP6_uc003whm.2_3'UTR	NM_024711	NP_078987	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6								GTP binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GACCTGGAGACTGGGAAGCAC	0.473													4	3	---	---	---	---	PASS
NAT1	9	broad.mit.edu	37	8	18079815	18079815	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18079815A>T	uc010ltd.2	+	5	626	c.259A>T	c.(259-261)ACG>TCG	p.T87S	NAT1_uc003wyt.2_Missense_Mutation_p.T149S|NAT1_uc003wyu.2_Missense_Mutation_p.T87S|NAT1_uc003wyv.2_Missense_Mutation_p.T87S|NAT1_uc010ltc.2_Missense_Mutation_p.T87S|NAT1_uc003wys.2_Missense_Mutation_p.T149S|NAT1_uc003wyr.2_Missense_Mutation_p.T87S|NAT1_uc003wyq.2_Missense_Mutation_p.T87S|NAT1_uc011kyl.1_Missense_Mutation_p.T87S	NM_001160179	NP_001153651	P18440	ARY1_HUMAN	N-acetyltransferase 1 isoform a	87					xenobiotic metabolic process	cytosol	arylamine N-acetyltransferase activity				0				Colorectal(111;0.0519)|COAD - Colon adenocarcinoma(73;0.208)		TTTTGAGACCACGATGTTGGG	0.473													82	214	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25265588	25265588	+	Missense_Mutation	SNP	G	A	A	rs62502357		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25265588G>A	uc003xeg.2	+	49	5320	c.5183G>A	c.(5182-5184)CGG>CAG	p.R1728Q	PPP2R2A_uc003xek.2_Intron|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1728						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AGCGAGAACCGGATCAGCAAG	0.488													5	171	---	---	---	---	PASS
HOOK3	84376	broad.mit.edu	37	8	42828459	42828459	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42828459G>A	uc003xpr.2	+	12	1392	c.1150G>A	c.(1150-1152)GAA>AAA	p.E384K	HOOK3_uc010lxq.1_Missense_Mutation_p.E384K	NM_032410	NP_115786	Q86VS8	HOOK3_HUMAN	golgi-associated microtubule-binding protein	384	Potential.				cytoplasmic microtubule organization|early endosome to late endosome transport|endosome organization|endosome to lysosome transport|Golgi localization|interkinetic nuclear migration|lysosome organization|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome|protein transport	cis-Golgi network|FHF complex|microtubule|pericentriolar material	identical protein binding|microtubule binding			ovary(1)|breast(1)	2	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			CAGATTATCCGAAGAATCAAA	0.299			T	RET	papillary thyroid								73	246	---	---	---	---	PASS
SNTG1	54212	broad.mit.edu	37	8	51363159	51363159	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51363159G>C	uc010lxy.1	+	8	692	c.321G>C	c.(319-321)CAG>CAC	p.Q107H	SNTG1_uc003xqs.1_Missense_Mutation_p.Q107H|SNTG1_uc010lxz.1_Missense_Mutation_p.Q107H|SNTG1_uc011ldl.1_RNA	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	107	PDZ.				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				CAATTCTACAGGTATACATTT	0.323													20	746	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110454282	110454282	+	Silent	SNP	T	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110454282T>A	uc003yne.2	+	35	4355	c.4251T>A	c.(4249-4251)TCT>TCA	p.S1417S		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1417	Extracellular (Potential).|IPT/TIG 7.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TAAATGTGTCTGTGGGGGACA	0.398										HNSCC(38;0.096)			5	280	---	---	---	---	PASS
HHLA1	10086	broad.mit.edu	37	8	133078189	133078189	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133078189A>G	uc011liy.1	-	15	1496	c.1496T>C	c.(1495-1497)TTT>TCT	p.F499S	HHLA1_uc003yth.2_Missense_Mutation_p.F356S	NM_001145095	NP_001138567	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1	499						extracellular region					0						ATTCTTCAGAAACCAGGAATA	0.398													6	368	---	---	---	---	PASS
UHRF2	115426	broad.mit.edu	37	9	6460776	6460776	+	Missense_Mutation	SNP	T	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6460776T>A	uc003zjy.2	+	4	1188	c.848T>A	c.(847-849)GTG>GAG	p.V283E	UHRF2_uc003zjz.2_RNA|UHRF2_uc003zka.1_Missense_Mutation_p.V60E	NM_152896	NP_690856	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains	283	Interaction with PCNP.				cell cycle|cell differentiation|cell proliferation|protein autoubiquitination|regulation of cell cycle|ubiquitin-dependent protein catabolic process	nucleus	DNA binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		GAACTTCGTGTGAAAATTTTC	0.348													7	263	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37486216	37486216	+	Silent	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37486216C>T	uc001iza.1	+	28	2553	c.2454C>T	c.(2452-2454)CCC>CCT	p.P818P		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	874						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	p.P818P(1)		ovary(7)|breast(1)|skin(1)	9						TAGAGCCTCCCGAGAAGCCAT	0.323													7	850	---	---	---	---	PASS
LOC441666	441666	broad.mit.edu	37	10	42833429	42833429	+	RNA	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42833429A>G	uc010qey.1	-	3		c.546T>C				NR_024380				Homo sapiens noncoding mRNA sequence.												0						TCTTCTCCTAAGTCTATTTGA	0.333													5	14	---	---	---	---	PASS
SLC18A3	6572	broad.mit.edu	37	10	50819157	50819157	+	Missense_Mutation	SNP	T	G	G	rs142721677		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50819157T>G	uc001jhw.2	+	1	811	c.371T>G	c.(370-372)ATC>AGC	p.I124S	CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank	NM_003055	NP_003046	Q16572	VACHT_HUMAN	vesicular acetylcholine transporter	124	Lumenal, vesicle (Potential).				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity			ovary(2)	2						GACGTGAAGATCGGGGTGCTG	0.647													8	28	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61836008	61836008	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61836008G>A	uc001jky.2	-	37	4823	c.4631C>T	c.(4630-4632)TCG>TTG	p.S1544L	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	1544	Ser-rich.				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						AGAAGGTGTCGAAACAGACCA	0.438													5	287	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69970177	69970177	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69970177T>C	uc001jnm.3	+	21	4113	c.3928T>C	c.(3928-3930)TCT>CCT	p.S1310P	MYPN_uc001jnn.3_Missense_Mutation_p.S1035P|MYPN_uc001jno.3_Missense_Mutation_p.S1310P|MYPN_uc009xpt.2_Missense_Mutation_p.S1310P|MYPN_uc010qit.1_Missense_Mutation_p.S1016P|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	1310	Interaction with ACTN.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						GTATTCATGCTCTTCTCGGAG	0.493													6	288	---	---	---	---	PASS
GLUD1	2746	broad.mit.edu	37	10	88820788	88820788	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88820788G>A	uc001keh.2	-	7	1040	c.943C>T	c.(943-945)CAC>TAC	p.H315Y	GLUD1_uc001keg.2_Missense_Mutation_p.H148Y|GLUD1_uc010qmp.1_Missense_Mutation_p.H182Y	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor	315					glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	CTCATAGAGTGTAGGCCCACA	0.378													7	632	---	---	---	---	PASS
KIF20B	9585	broad.mit.edu	37	10	91469205	91469205	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91469205T>G	uc001kgs.1	+	4	410	c.338T>G	c.(337-339)TTC>TGC	p.F113C	KIF20B_uc001kgr.1_Missense_Mutation_p.F113C	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	113	Kinesin-motor.				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						GCACAGAAATTCAGTTTTTCC	0.358													59	179	---	---	---	---	PASS
TNKS2	80351	broad.mit.edu	37	10	93602060	93602060	+	Silent	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93602060T>C	uc001khp.2	+	16	2268	c.1971T>C	c.(1969-1971)TGT>TGC	p.C657C		NM_025235	NP_079511	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related	657					positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding			kidney(3)|skin(3)|ovary(1)|lung(1)	8		Colorectal(252;0.162)				AGAAGGGTTGTTTAGCCAGAG	0.413													7	346	---	---	---	---	PASS
AFAP1L2	84632	broad.mit.edu	37	10	116082996	116082996	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116082996T>G	uc001lbn.2	-	5	641	c.340A>C	c.(340-342)ATC>CTC	p.I114L	AFAP1L2_uc001lbo.2_Missense_Mutation_p.I114L|AFAP1L2_uc010qse.1_Missense_Mutation_p.I167L|AFAP1L2_uc001lbp.2_Missense_Mutation_p.I114L|AFAP1L2_uc001lbr.1_Missense_Mutation_p.I114L	NM_001001936	NP_001001936	Q8N4X5	AF1L2_HUMAN	KIAA1914 protein isoform 1	114					inflammatory response|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of transcription, DNA-dependent|regulation of interleukin-6 production|regulation of mitotic cell cycle	cytoplasm	protein tyrosine kinase activator activity|SH2 domain binding|SH3 domain binding			ovary(1)|breast(1)	2		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		GTCTTTGGGATGGCAAGCTGT	0.502													57	170	---	---	---	---	PASS
VAX1	11023	broad.mit.edu	37	10	118893391	118893391	+	3'UTR	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118893391G>T	uc009xyx.2	-	3					VAX1_uc001ldb.1_Intron	NM_001112704	NP_001106175	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1 isoform a							nucleus	sequence-specific DNA binding			ovary(2)	2				all cancers(201;0.0108)		TAGTGGGAAAGGAGAGCTGTC	0.493													3	3	---	---	---	---	PASS
EBF3	253738	broad.mit.edu	37	10	131761171	131761171	+	Intron	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131761171G>T	uc001lki.1	-						EBF3_uc010qur.1_3'UTR	NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		AGAGCCAGCCGCTGCAGGGGC	0.468													53	129	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1097746	1097746	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1097746C>T	uc001lsx.1	+	39	13952	c.13925C>T	c.(13924-13926)TCC>TTC	p.S4642F		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4642	VWFD 4.					inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GAGATCGTCTCCAACTGTGAG	0.637													13	45	---	---	---	---	PASS
ZDHHC5	25921	broad.mit.edu	37	11	57440598	57440598	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57440598C>A	uc001nkx.1	+	2	1292	c.36C>A	c.(34-36)AGC>AGA	p.S12R	ZDHHC5_uc001nky.1_Intron	NM_015457	NP_056272	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC domain containing 5	12						integral to membrane	acyltransferase activity|zinc ion binding			skin(1)	1						TCAAACCCAGCAAGTATGTCC	0.562													45	146	---	---	---	---	PASS
PRPF19	27339	broad.mit.edu	37	11	60658678	60658678	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60658678G>A	uc001nqf.2	-	16	1682	c.1475C>T	c.(1474-1476)TCA>TTA	p.S492L		NM_014502	NP_055317	Q9UMS4	PRP19_HUMAN	PRP19/PSO4 pre-mRNA processing factor 19	492	WD 7.				DNA repair|protein polyubiquitination|spliceosome assembly	catalytic step 2 spliceosome|nuclear speck|spindle|ubiquitin ligase complex	DNA binding|identical protein binding|ubiquitin-ubiquitin ligase activity			ovary(1)	1						CATGCCTGTTGAAGCGATGAA	0.542													19	42	---	---	---	---	PASS
TRIM53	642569	broad.mit.edu	37	11	89727208	89727208	+	3'UTR	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89727208G>A	uc010rtz.1	-	7						NM_001146208	NP_001139680			RecName: Full=Tripartite motif-containing protein 48; AltName: Full=RING finger protein 101;												0						TCCCCCACATGGACCTCCCAG	0.448													5	168	---	---	---	---	PASS
KIAA1731	85459	broad.mit.edu	37	11	93460789	93460789	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93460789T>C	uc009ywb.1	+	24	7298	c.7147T>C	c.(7147-7149)TCT>CCT	p.S2383P	KIAA1731_uc001pdu.1_Missense_Mutation_p.S563P|KIAA1731_uc001pdw.1_Missense_Mutation_p.S395P|KIAA1731_uc001pdx.1_Missense_Mutation_p.S249P	NM_033395	NP_203753	Q9C0D2	K1731_HUMAN	hypothetical protein LOC85459	2383						centrosome					0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ATTACAGAGCTCTATACCAGT	0.284													5	119	---	---	---	---	PASS
KDM4D	55693	broad.mit.edu	37	11	94730799	94730799	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94730799A>G	uc001pfe.2	+	3	1095	c.263A>G	c.(262-264)CAA>CGA	p.Q88R		NM_018039	NP_060509	Q6B0I6	KDM4D_HUMAN	jumonji domain containing 2D	88					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GTGTTTACTCAATACCATAAA	0.443													13	39	---	---	---	---	PASS
ABCG4	64137	broad.mit.edu	37	11	119031335	119031335	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119031335C>A	uc001pvs.2	+	14	2020	c.1684C>A	c.(1684-1686)CTG>ATG	p.L562M	ABCG4_uc009zar.2_Missense_Mutation_p.L562M	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN	ATP-binding cassette, subfamily G, member 4	562	Extracellular (Potential).|ABC transmembrane type-2.				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CCCCACTTACCTGCAATGGAG	0.582													38	156	---	---	---	---	PASS
TMEM225	338661	broad.mit.edu	37	11	123754864	123754864	+	Silent	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123754864A>G	uc001pzi.2	-	3	589	c.381T>C	c.(379-381)GGT>GGC	p.G127G		NM_001013743	NP_001013765	Q6GV28	TM225_HUMAN	transmembrane protein 225	127						integral to membrane				upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	3						GCATGGATTGACCTTGCTTCA	0.368													8	404	---	---	---	---	PASS
OR8B12	219858	broad.mit.edu	37	11	124413242	124413242	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124413242G>T	uc010sam.1	-	1	309	c.309C>A	c.(307-309)TTC>TTA	p.F103L		NM_001005195	NP_001005195	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		CAAAGAAGCAGAAGAAGAAGA	0.468													25	119	---	---	---	---	PASS
CDON	50937	broad.mit.edu	37	11	125859613	125859613	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125859613T>C	uc009zbw.2	-	15	2820	c.2692A>G	c.(2692-2694)ACC>GCC	p.T898A	CDON_uc001qdb.3_Missense_Mutation_p.T275A|CDON_uc001qdc.3_Missense_Mutation_p.T898A	NM_016952	NP_058648	Q4KMG0	CDON_HUMAN	surface glycoprotein, Ig superfamily member	898	Extracellular (Potential).|Fibronectin type-III 3.				cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TCATAGGAGGTTTCTGGCTGC	0.373													6	238	---	---	---	---	PASS
SLC6A12	6539	broad.mit.edu	37	12	312002	312002	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:312002A>G	uc001qhz.2	-	6	937	c.394T>C	c.(394-396)TAC>CAC	p.Y132H	SLC6A12_uc001qia.2_Missense_Mutation_p.Y132H|SLC6A12_uc001qib.2_Missense_Mutation_p.Y132H|SLC6A12_uc009zdh.1_Missense_Mutation_p.Y132H|SLC6A12_uc009zdi.1_RNA	NM_003044	NP_003035	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter	132	Helical; Name=3; (Potential).				cellular nitrogen compound metabolic process|neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			ATGATGTAGTAGACATTCAAA	0.483													7	163	---	---	---	---	PASS
CLEC9A	283420	broad.mit.edu	37	12	10217396	10217396	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10217396G>C	uc001qxa.2	+	8	1150	c.537G>C	c.(535-537)CAG>CAC	p.Q179H		NM_207345	NP_997228	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A	179	Extracellular (Potential).|C-type lectin.				positive regulation of cytokine secretion|receptor-mediated endocytosis	cell surface|integral to membrane	receptor activity|sugar binding			ovary(1)	1						GGTTGTCTCAGGATGGACACA	0.438													105	346	---	---	---	---	PASS
KCNJ8	3764	broad.mit.edu	37	12	21919499	21919499	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21919499C>T	uc001rff.2	-	3	771	c.433G>A	c.(433-435)GGG>AGG	p.G145R		NM_004982	NP_004973	Q15842	IRK8_HUMAN	potassium inwardly-rectifying channel J8	145	Selectivity filter (By similarity).					voltage-gated potassium channel complex					0					Levosimendan(DB00922)	ATCATCCTCCCTCCAAACCCA	0.423													7	202	---	---	---	---	PASS
CAPRIN2	65981	broad.mit.edu	37	12	30869460	30869460	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30869460C>T	uc001rji.1	-	14	3197	c.2446G>A	c.(2446-2448)GTC>ATC	p.V816I	CAPRIN2_uc001rjf.1_Missense_Mutation_p.V613I|CAPRIN2_uc001rjg.1_Missense_Mutation_p.V483I|CAPRIN2_uc001rjh.1_Missense_Mutation_p.V767I|CAPRIN2_uc001rjj.1_Missense_Mutation_p.V483I|CAPRIN2_uc001rjk.3_Missense_Mutation_p.V816I|CAPRIN2_uc001rjl.3_Missense_Mutation_p.V781I|CAPRIN2_uc001rjm.1_Missense_Mutation_p.V448I	NM_001002259	NP_001002259	Q6IMN6	CAPR2_HUMAN	C1q domain containing 1 isoform 1	816					negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TGAGAATGGACAGTTTGTTCT	0.423													7	675	---	---	---	---	PASS
ZNF641	121274	broad.mit.edu	37	12	48737147	48737147	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48737147C>T	uc001rrn.1	-	6	1091	c.926G>A	c.(925-927)AGG>AAG	p.R309K	ZNF641_uc001rro.1_Missense_Mutation_p.R295K|ZNF641_uc010sls.1_Missense_Mutation_p.R286K	NM_152320	NP_689533	Q96N77	ZN641_HUMAN	zinc finger protein 641	309	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2						TTTCTGGTGCCTGATGAGGTG	0.537													59	160	---	---	---	---	PASS
MIR196A2	406973	broad.mit.edu	37	12	54385596	54385596	+	RNA	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54385596C>T	hsa-mir-196a-2|MI0000279	+			c.75C>T			uc001seo.2_RNA																	0						CAACAAGAAACTGCCTGAGTT	0.552													54	103	---	---	---	---	PASS
MBD6	114785	broad.mit.edu	37	12	57921633	57921633	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57921633G>T	uc001soj.1	+	9	2463	c.2239G>T	c.(2239-2241)GAC>TAC	p.D747Y	MBD6_uc001sok.1_Missense_Mutation_p.D614Y|MBD6_uc001sol.1_RNA	NM_052897	NP_443129	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	747	Pro-rich.					chromosome|nucleus	chromatin binding|DNA binding			central_nervous_system(3)|ovary(1)	4						CTCAACAGGTGACCTGTCTTC	0.557													26	47	---	---	---	---	PASS
CAND1	55832	broad.mit.edu	37	12	67700071	67700071	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67700071G>A	uc001stn.2	+	10	3060	c.2623G>A	c.(2623-2625)GCT>ACT	p.A875T	CAND1_uc001sto.2_Missense_Mutation_p.A385T	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	875	HEAT 20.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		AGTCAAATCAGCTGCATCCTA	0.413													67	225	---	---	---	---	PASS
DYRK2	8445	broad.mit.edu	37	12	68052356	68052356	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68052356A>C	uc001str.3	+	3	2071	c.1669A>C	c.(1669-1671)ACC>CCC	p.T557P	DYRK2_uc001sts.3_Missense_Mutation_p.T484P	NM_006482	NP_006473	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	557					apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|positive regulation of glycogen biosynthetic process|smoothened signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|manganese ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(1)|central_nervous_system(1)	4			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		AACTGAGAGCACCGGTGCTAT	0.532													28	61	---	---	---	---	PASS
SLC35E3	55508	broad.mit.edu	37	12	69158504	69158504	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69158504T>C	uc001suh.2	+	5	998	c.776T>C	c.(775-777)TTC>TCC	p.F259S		NM_018656	NP_061126	Q7Z769	S35E3_HUMAN	solute carrier family 35, member E2	259	Helical; (Potential).					integral to membrane					0	Breast(13;2.31e-06)|Renal(347;0.0684)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00372)			TTCGGACACTTCAAGTTCTGC	0.348													8	552	---	---	---	---	PASS
ZFC3H1	196441	broad.mit.edu	37	12	72017954	72017954	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72017954T>C	uc001swo.2	-	23	4795	c.4436A>G	c.(4435-4437)GAG>GGG	p.E1479G		NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	1479					RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						CAAAAGAGCCTCTAAAAGCTG	0.398													6	254	---	---	---	---	PASS
SLC41A2	84102	broad.mit.edu	37	12	105322048	105322048	+	Silent	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105322048A>G	uc001tla.2	-	1	425	c.258T>C	c.(256-258)TAT>TAC	p.Y86Y		NM_032148	NP_115524	Q96JW4	S41A2_HUMAN	solute carrier family 41, member 2	86	Extracellular.					integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity			ovary(1)|skin(1)	2						AGAAACTGTGATACTCCATGT	0.403													6	184	---	---	---	---	PASS
RIC8B	55188	broad.mit.edu	37	12	107279850	107279850	+	3'UTR	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107279850C>T	uc001tlx.2	+	9					RIC8B_uc001tly.2_3'UTR|RIC8B_uc001tlz.2_RNA|RIC8B_uc009zur.2_RNA	NM_018157	NP_060627	Q9NVN3	RIC8B_HUMAN	resistance to inhibitors of cholinesterase 8						regulation of G-protein coupled receptor protein signaling pathway	cell cortex|cytosol|plasma membrane	G-protein alpha-subunit binding|guanyl-nucleotide exchange factor activity			ovary(1)	1						CTCTGTAGCTCCAGGGGAATC	0.413													5	147	---	---	---	---	PASS
SUDS3	64426	broad.mit.edu	37	12	118818034	118818034	+	Silent	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118818034A>G	uc001twz.2	+	2	349	c.210A>G	c.(208-210)GAA>GAG	p.E70E		NM_022491	NP_071936	Q9H7L9	SDS3_HUMAN	suppressor of defective silencing 3	70	Potential.				chromatin modification|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	Sin3 complex	histone deacetylase binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AAATGAAGGAACAGTGAGTAT	0.284													7	464	---	---	---	---	PASS
B3GNT4	79369	broad.mit.edu	37	12	122691608	122691608	+	Silent	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122691608C>A	uc001ubx.2	+	3	1028	c.810C>A	c.(808-810)ACC>ACA	p.T270T	B3GNT4_uc001uby.2_Silent_p.T245T	NM_030765	NP_110392	Q9C0J1	B3GN4_HUMAN	UDP-GlcNAc:betaGal	270	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000297)|Epithelial(86;0.000497)|BRCA - Breast invasive adenocarcinoma(302;0.222)		ACAGGGCCACCCACTACCCAC	0.572													4	107	---	---	---	---	PASS
RILPL1	353116	broad.mit.edu	37	12	123957223	123957223	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123957223G>T	uc001ufe.2	-	7	1310	c.1074C>A	c.(1072-1074)AGC>AGA	p.S358R	RILPL1_uc001ufd.2_Missense_Mutation_p.S207R|RILPL1_uc010tas.1_3'UTR	NM_178314	NP_847884	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	358					neuroprotection	cytosol					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		GGGAGAAGAAGCTAAACCTTT	0.498													9	140	---	---	---	---	PASS
STX2	2054	broad.mit.edu	37	12	131311785	131311785	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131311785C>G	uc001uio.2	-	2	225	c.58G>C	c.(58-60)GTT>CTT	p.V20L	STX2_uc001uip.2_Missense_Mutation_p.V20L|STX2_uc010tbj.1_Missense_Mutation_p.V20L	NM_194356	NP_919337	P32856	STX2_HUMAN	syntaxin 2 isoform 2	20	Cytoplasmic (Potential).				acrosome reaction|ectoderm development|intracellular protein transport|organ morphogenesis|signal transduction	basolateral plasma membrane|integral to membrane|microsome|soluble fraction	calcium-dependent protein binding|SNAP receptor activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.79e-06)|all cancers(50;5.27e-05)|Epithelial(86;5.29e-05)		ACCACAACAACTGTGTCTCCA	0.328													77	207	---	---	---	---	PASS
FRY	10129	broad.mit.edu	37	13	32826048	32826048	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32826048T>C	uc001utx.2	+	50	7700	c.7204T>C	c.(7204-7206)TCT>CCT	p.S2402P	FRY_uc010tdw.1_RNA|FRY_uc001uty.2_5'Flank	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	2402					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ACATGTCCTTTCTCTGTGTGG	0.383													8	584	---	---	---	---	PASS
NBEA	26960	broad.mit.edu	37	13	35738588	35738588	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35738588A>G	uc001uvb.2	+	25	4381	c.4175A>G	c.(4174-4176)AAC>AGC	p.N1392S	NBEA_uc010abi.2_Missense_Mutation_p.N83S	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	1392						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		ATGGTAGACAACATCATCATT	0.333													140	472	---	---	---	---	PASS
KIAA0564	23078	broad.mit.edu	37	13	42263606	42263606	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42263606G>T	uc001uyj.2	-	34	4085	c.4015C>A	c.(4015-4017)CAA>AAA	p.Q1339K		NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a	1339						extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		GATGATAGTTGATCACTGGAA	0.363													99	294	---	---	---	---	PASS
RBM23	55147	broad.mit.edu	37	14	23371499	23371499	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23371499C>A	uc001whg.2	-	11	1222	c.1023G>T	c.(1021-1023)GAG>GAT	p.E341D	RBM23_uc001whh.2_Missense_Mutation_p.E325D|RBM23_uc001whi.2_Missense_Mutation_p.E307D|RBM23_uc010tne.1_Missense_Mutation_p.E171D|RBM23_uc001whj.2_Missense_Mutation_p.E91D	NM_001077351	NP_001070819	Q86U06	RBM23_HUMAN	RNA binding motif protein 23 isoform 1	341	RRM 2.				mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		CATCCAGTCGCTCAGTCACAT	0.547													28	49	---	---	---	---	PASS
SNW1	22938	broad.mit.edu	37	14	78203318	78203318	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78203318A>G	uc001xuf.2	-	6	661	c.634T>C	c.(634-636)TTC>CTC	p.F212L	SNW1_uc010tvm.1_Missense_Mutation_p.F137L|SNW1_uc010asu.2_Missense_Mutation_p.F50L|SNW1_uc010tvn.1_Missense_Mutation_p.F212L	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein	212	SNW.				negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		acttactTGAACCTTGGAGGC	0.239													7	368	---	---	---	---	PASS
SETD3	84193	broad.mit.edu	37	14	99924707	99924707	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99924707C>A	uc001ygc.2	-	6	754	c.584G>T	c.(583-585)CGG>CTG	p.R195L	SETD3_uc001ygd.2_Missense_Mutation_p.R195L|SETD3_uc001ygf.2_Missense_Mutation_p.R195L	NM_032233	NP_115609	Q86TU7	SETD3_HUMAN	SET domain containing 3 isoform a	195	SET.				peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity				0		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				CTGAAGATACCGAACTTCATC	0.468													6	356	---	---	---	---	PASS
CAPN3	825	broad.mit.edu	37	15	42703124	42703124	+	Missense_Mutation	SNP	G	A	A	rs80338802		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42703124G>A	uc001zpn.1	+	22	2612	c.2306G>A	c.(2305-2307)CGG>CAG	p.R769Q	CAPN3_uc001zpk.1_Missense_Mutation_p.R536Q|CAPN3_uc001zpl.1_Missense_Mutation_p.R676Q|CAPN3_uc010udf.1_Missense_Mutation_p.R682Q|CAPN3_uc010udg.1_Missense_Mutation_p.R634Q|CAPN3_uc001zpo.1_Missense_Mutation_p.R763Q|CAPN3_uc001zpp.1_Missense_Mutation_p.R677Q|CAPN3_uc001zpq.1_Missense_Mutation_p.R257Q|CAPN3_uc010bcv.1_Missense_Mutation_p.R104Q|CAPN3_uc001zpr.1_Missense_Mutation_p.R104Q|CAPN3_uc001zps.1_Missense_Mutation_p.R104Q|CAPN3_uc001zpt.1_Missense_Mutation_p.R104Q	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a	769	Domain IV.		R -> Q (in LGMD2A).		muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		ATTACCATGCGGTACGCAGAC	0.547													5	382	---	---	---	---	PASS
TRPM7	54822	broad.mit.edu	37	15	50867063	50867063	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50867063G>A	uc001zyt.3	-	34	5269	c.5005C>T	c.(5005-5007)CAT>TAT	p.H1669Y	TRPM7_uc001zyr.2_Missense_Mutation_p.H106Y	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,	1669	Cytoplasmic (Potential).|Alpha-type protein kinase.				cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		AGACAGAGATGCAGAACTGTA	0.299													9	262	---	---	---	---	PASS
VPS13C	54832	broad.mit.edu	37	15	62234032	62234032	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62234032T>C	uc002agz.2	-	46	5457	c.5383A>G	c.(5383-5385)ATG>GTG	p.M1795V	VPS13C_uc002aha.2_Missense_Mutation_p.M1752V|VPS13C_uc002ahb.1_Missense_Mutation_p.M1795V|VPS13C_uc002ahc.1_Missense_Mutation_p.M1752V	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	1795					protein localization					ovary(2)	2						TAATGTTCCATAGGAACCAAG	0.353													5	261	---	---	---	---	PASS
PIAS1	8554	broad.mit.edu	37	15	68445966	68445966	+	Silent	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68445966C>T	uc002aqz.2	+	7	963	c.867C>T	c.(865-867)TCC>TCT	p.S289S	PIAS1_uc010ujx.1_Silent_p.S289S	NM_016166	NP_057250	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	289					androgen receptor signaling pathway|interferon-gamma-mediated signaling pathway|JAK-STAT cascade|positive regulation of protein sumoylation|positive regulation of transcription, DNA-dependent|regulation of interferon-gamma-mediated signaling pathway|transcription, DNA-dependent	nuclear speck	androgen receptor binding|DNA binding|enzyme binding|SUMO ligase activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)	2						AACAGTTGTCCTCAACAGTTC	0.323													119	337	---	---	---	---	PASS
UACA	55075	broad.mit.edu	37	15	70960385	70960385	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70960385T>C	uc002asr.2	-	16	2742	c.2638A>G	c.(2638-2640)AAC>GAC	p.N880D	UACA_uc010uke.1_Missense_Mutation_p.N771D|UACA_uc002asq.2_Missense_Mutation_p.N867D|UACA_uc010bin.1_Missense_Mutation_p.N855D	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	880	Potential.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						AATTCTCTGTTAGTTTTGGCT	0.284													7	338	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2158399	2158399	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2158399C>A	uc002cos.1	-	15	6978	c.6769G>T	c.(6769-6771)GTG>TTG	p.V2257L	PKD1_uc002cot.1_Missense_Mutation_p.V2257L	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2257	Extracellular (Potential).|REJ.				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						ATGATGGGCACCAGGCGCTCG	0.622													7	10	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2158400	2158400	+	Silent	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2158400C>A	uc002cos.1	-	15	6977	c.6768G>T	c.(6766-6768)CTG>CTT	p.L2256L	PKD1_uc002cot.1_Silent_p.L2256L	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2256	Extracellular (Potential).|REJ.				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						TGATGGGCACCAGGCGCTCGG	0.622													7	9	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268080	70268080	+	RNA	SNP	T	C	C	rs149244259	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268080T>C	uc010cfp.1	-	3		c.335A>G								Homo sapiens cDNA, FLJ98908.																		GTCTTACTGTTGGCTAAAAGG	0.373													6	32	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268081	70268081	+	RNA	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268081G>A	uc010cfp.1	-	3		c.334C>T								Homo sapiens cDNA, FLJ98908.																		TCTTACTGTTGGCTAAAAGGC	0.373													4	34	---	---	---	---	PASS
ZNF19	7567	broad.mit.edu	37	16	71509833	71509833	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71509833C>T	uc010cgc.1	-	6	1123	c.617G>A	c.(616-618)CGG>CAG	p.R206Q	ZNF23_uc002fai.2_Intron|ZNF19_uc002fak.1_Missense_Mutation_p.R194Q|ZNF19_uc002fal.1_Missense_Mutation_p.R194Q|ZNF19_uc002fam.1_Missense_Mutation_p.R206Q	NM_006961	NP_008892	P17023	ZNF19_HUMAN	zinc finger protein 19	206	C2H2-type 2.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(137;0.00965)		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)		CCTCTGGTGCCGAATTAACGA	0.443													4	175	---	---	---	---	PASS
KARS	3735	broad.mit.edu	37	16	75678248	75678248	+	Intron	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75678248G>A	uc002feq.2	-						KARS_uc002fer.2_Silent_p.L27L|KARS_uc002fes.2_5'UTR|KARS_uc010cha.1_Intron	NM_005548	NP_005539	Q15046	SYK_HUMAN	lysyl-tRNA synthetase isoform 2						interspecies interaction between organisms|lysyl-tRNA aminoacylation|tRNA processing	cytosol|extracellular region|mitochondrial matrix|nucleus|plasma membrane|soluble fraction	ATP binding|lysine-tRNA ligase activity|metal ion binding|tRNA binding			ovary(2)	2					L-Lysine(DB00123)	CCCAGTCGCAGTTCCCTGTGA	0.522													32	73	---	---	---	---	PASS
RPAIN	84268	broad.mit.edu	37	17	5335932	5335932	+	3'UTR	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5335932A>G	uc002gbq.2	+	7					RPAIN_uc010vtb.1_3'UTR|RPAIN_uc002gbs.2_3'UTR|RPAIN_uc002gbt.2_3'UTR|RPAIN_uc002gbu.2_3'UTR|RPAIN_uc002gbv.2_RNA|RPAIN_uc002gbr.2_RNA|RPAIN_uc002gbw.2_3'UTR	NM_001033002	NP_001028174	Q86UA6	RIP_HUMAN	RPA interacting protein isoform b						DNA recombination|DNA repair|DNA-dependent DNA replication|protein import into nucleus|response to UV	cytoplasm|cytoplasm|nucleolus|PML body|PML body	metal ion binding|protein complex binding				0						GTTGAAGACAACTCATTCCCT	0.363													7	380	---	---	---	---	PASS
CHD3	1107	broad.mit.edu	37	17	7805978	7805978	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7805978C>A	uc002gje.2	+	21	3453	c.3303C>A	c.(3301-3303)TAC>TAA	p.Y1101*	CHD3_uc002gjd.2_Nonsense_Mutation_p.Y1160*|CHD3_uc002gjf.2_Nonsense_Mutation_p.Y1101*|CHD3_uc002gjh.2_5'Flank	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1101	Helicase C-terminal.				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)				ATGAAGGCTACAAGTATGAGC	0.502													77	210	---	---	---	---	PASS
ABHD15	116236	broad.mit.edu	37	17	27893483	27893483	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27893483C>G	uc002hed.1	-	1	566	c.502G>C	c.(502-504)GGT>CGT	p.G168R	TP53I13_uc002hee.2_5'Flank	NM_198147	NP_937790	Q6UXT9	ABH15_HUMAN	abhydrolase domain containing 15 precursor	168						extracellular region	carboxylesterase activity				0						GTGAGGCGACCCCACGCATTG	0.682													3	3	---	---	---	---	PASS
CCL5	6352	broad.mit.edu	37	17	34205534	34205534	+	Silent	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34205534G>A	uc002hkf.2	-	2	254	c.186C>T	c.(184-186)GTC>GTT	p.V62V		NM_002985	NP_002976	P13501	CCL5_HUMAN	small inducible cytokine A5 precursor	62					activation of phospholipase D activity|cell-cell signaling|cellular protein complex assembly|chemokine-mediated signaling pathway|dendritic cell chemotaxis|eosinophil chemotaxis|immune response|leukocyte cell-cell adhesion|macrophage chemotaxis|negative regulation of T cell apoptosis|negative regulation of viral genome replication|neutrophil activation|positive regulation of activation of JAK2 kinase activity|positive regulation of cell-cell adhesion mediated by integrin|positive regulation of homotypic cell-cell adhesion|positive regulation of innate immune response|positive regulation of macrophage chemotaxis|positive regulation of monocyte chemotaxis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of T cell apoptosis|positive regulation of T cell chemotaxis|positive regulation of T cell proliferation|positive regulation of translational initiation|positive regulation of tyrosine phosphorylation of STAT protein|positive regulation of viral genome replication|protein tetramerization|regulation of chronic inflammatory response|response to virus	extracellular space	CCR1 chemokine receptor binding|CCR4 chemokine receptor binding|CCR5 chemokine receptor binding|chemoattractant activity|chemokine activity|chemokine receptor antagonist activity|protein homodimerization activity|protein self-association|receptor signaling protein tyrosine kinase activator activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0183)		AGACTCACACGACTGCTGGGT	0.597													4	114	---	---	---	---	PASS
ACACA	31	broad.mit.edu	37	17	35608950	35608950	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35608950A>G	uc002hnm.2	-	16	2142	c.1951T>C	c.(1951-1953)TTC>CTC	p.F651L	ACACA_uc002hnk.2_Missense_Mutation_p.F573L|ACACA_uc002hnl.2_Missense_Mutation_p.F593L|ACACA_uc002hnn.2_Missense_Mutation_p.F651L|ACACA_uc002hno.2_Missense_Mutation_p.F688L|ACACA_uc010cuz.2_Missense_Mutation_p.F651L	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	651					acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	GAGTGAAGGAAGTTAGAGACG	0.493													6	125	---	---	---	---	PASS
TBC1D3P2	440452	broad.mit.edu	37	17	60342432	60342432	+	RNA	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60342432T>C	uc010woz.1	-	14		c.1697A>G				NR_027486				Homo sapiens cDNA FLJ60189 complete cds, highly similar to TBC1 domain family member 3.												0						AGAGGCAAGGTCCTGAGGTGG	0.597													3	3	---	---	---	---	PASS
CCDC40	55036	broad.mit.edu	37	17	78039368	78039368	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78039368C>G	uc010dht.2	+	10	1552	c.1525C>G	c.(1525-1527)CGC>GGC	p.R509G	CCDC40_uc010wub.1_Intron|CCDC40_uc002jxm.3_Missense_Mutation_p.R292G	NM_017950	NP_060420	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	509					axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CATGAAGCACCGCGACGAGGC	0.692													3	5	---	---	---	---	PASS
CCDC40	55036	broad.mit.edu	37	17	78058619	78058619	+	Silent	SNP	C	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78058619C>T	uc010dht.2	+	13	2094	c.2067C>T	c.(2065-2067)GAC>GAT	p.D689D	CCDC40_uc002jxm.3_Silent_p.D472D|CCDC40_uc002jxn.3_Silent_p.D85D	NM_017950	NP_060420	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	689	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			GCAGGCTGGACGCACACCAGA	0.532													13	70	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78337077	78337077	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78337077A>C	uc002jyh.1	+	15	5973	c.5750A>C	c.(5749-5751)GAA>GCA	p.E1917A	uc002jyi.1_Intron|RNF213_uc010dhw.1_Missense_Mutation_p.E299A	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AGCCTGATGGAAGCCCGTTGG	0.562													4	34	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78337081	78337081	+	Silent	SNP	C	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78337081C>G	uc002jyh.1	+	15	5977	c.5754C>G	c.(5752-5754)GCC>GCG	p.A1918A	uc002jyi.1_Intron|RNF213_uc010dhw.1_Silent_p.A300A	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TGATGGAAGCCCGTTGGAACC	0.572													5	37	---	---	---	---	PASS
ZFP161	7541	broad.mit.edu	37	18	5291167	5291167	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5291167T>C	uc002kmq.2	-	4	1201	c.1040A>G	c.(1039-1041)GAC>GGC	p.D347G	ZFP161_uc002kmr.2_Missense_Mutation_p.D347G|ZFP161_uc010dkp.2_Missense_Mutation_p.D347G	NM_003409	NP_003400	O43829	ZF161_HUMAN	zinc finger protein 161 homolog	347	C2H2-type 3.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CTTCTTTAAGTCTGGGGCACG	0.448													7	381	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8113697	8113697	+	Silent	SNP	T	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8113697T>A	uc002knn.3	+	12	2573	c.2070T>A	c.(2068-2070)ACT>ACA	p.T690T	PTPRM_uc010dkv.2_Silent_p.T690T|PTPRM_uc010wzl.1_Silent_p.T477T	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	690	Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				ACTGGAACACTCCCCTTCTCC	0.423													41	114	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28991165	28991165	+	Intron	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28991165G>T	uc002kwq.2	+						DSG4_uc002kwr.2_Silent_p.A722A	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein						homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CAACTCCAGCGCTGTTAAACC	0.587													8	103	---	---	---	---	PASS
MYO5B	4645	broad.mit.edu	37	18	47363917	47363917	+	Missense_Mutation	SNP	A	G	G	rs138128932	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47363917A>G	uc002leb.2	-	37	5396	c.5108T>C	c.(5107-5109)GTC>GCC	p.V1703A	MYO5B_uc002ldz.2_Missense_Mutation_p.V273A|MYO5B_uc002lea.2_Missense_Mutation_p.V818A	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB	1703	Dilute.				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		CCAAGAGCAGACGTCCTTCCG	0.527													7	58	---	---	---	---	PASS
RINL	126432	broad.mit.edu	37	19	39362295	39362295	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39362295T>G	uc002ojq.2	-	6	489	c.101A>C	c.(100-102)GAA>GCA	p.E34A	RINL_uc002ojr.1_5'Flank|RINL_uc010xuo.1_Missense_Mutation_p.E148A	NM_198445	NP_940847	Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	34							GTPase activator activity			pancreas(1)	1						ACCTGTGTGTTCATCTCTGGG	0.567													47	121	---	---	---	---	PASS
ZNF224	7767	broad.mit.edu	37	19	44610924	44610924	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44610924A>G	uc002oyh.1	+	6	913	c.611A>G	c.(610-612)TAT>TGT	p.Y204C	uc002oyi.2_RNA	NM_013398	NP_037530	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	204	C2H2-type 2.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	DNA binding|protein binding|zinc ion binding			ovary(2)	2		Prostate(69;0.0435)				GAGAAATGCTATAAGTGTGAC	0.433													30	135	---	---	---	---	PASS
ZNF235	9310	broad.mit.edu	37	19	44792129	44792129	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44792129A>T	uc002oza.3	-	5	1562	c.1459T>A	c.(1459-1461)TAT>AAT	p.Y487N	ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF235_uc002ozb.3_Missense_Mutation_p.Y483N|ZNF235_uc010xwx.1_Missense_Mutation_p.Y401N	NM_004234	NP_004225	Q14590	ZN235_HUMAN	zinc finger protein 93 homolog	487	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)	3		Prostate(69;0.0352)|all_neural(266;0.116)				TCACATTTATATGGTTTTTCT	0.413													71	173	---	---	---	---	PASS
MIR520D	574482	broad.mit.edu	37	19	54223429	54223429	+	RNA	SNP	G	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54223429G>T	hsa-mir-520d|MI0003164	+			c.80G>T			MIR517B_hsa-mir-517b|MI0003165_5'Flank|MIR520G_hsa-mir-520g|MI0003166_5'Flank																	0						GTGGGTTACGGTTTGAGAAAA	0.438													46	173	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56228189	56228189	+	Silent	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56228189T>C	uc002qly.2	-	5	2263	c.2235A>G	c.(2233-2235)AAA>AAG	p.K745K		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	745	LRR 1.					cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AGGAGAGGTGTTTCAGCTTGC	0.512													5	176	---	---	---	---	PASS
SIRPB1	10326	broad.mit.edu	37	20	1585397	1585397	+	Intron	SNP	T	C	C	rs148754551	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1585397T>C	uc010gai.2	-						SIRPB1_uc002wfk.3_Intron|SIRPB1_uc002wfl.3_Missense_Mutation_p.T248A	NM_006065	NP_006056	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1 isoform 1						cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding			ovary(1)	1						CCTCGGATGGTCTCAGACAAG	0.627													4	27	---	---	---	---	PASS
RALGAPA2	57186	broad.mit.edu	37	20	20493446	20493446	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20493446A>C	uc002wrz.2	-	32	4710	c.4567T>G	c.(4567-4569)TTA>GTA	p.L1523V	RALGAPA2_uc010gcx.2_Missense_Mutation_p.L1227V|RALGAPA2_uc010zsg.1_Missense_Mutation_p.L971V|RALGAPA2_uc002wsa.1_Missense_Mutation_p.L295V	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	1523					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						TTTTCAAGTAATTTGTCAAGA	0.423													70	189	---	---	---	---	PASS
USP16	10600	broad.mit.edu	37	21	30415797	30415797	+	Silent	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30415797A>G	uc002ymy.2	+	13	1435	c.1233A>G	c.(1231-1233)GAA>GAG	p.E411E	USP16_uc002ymx.2_Silent_p.E410E|USP16_uc002ymw.2_Silent_p.E411E|USP16_uc011acm.1_Silent_p.E396E|USP16_uc011acn.1_Silent_p.E77E|USP16_uc011aco.1_Silent_p.E101E	NM_006447	NP_006438	Q9Y5T5	UBP16_HUMAN	ubiquitin specific protease 16 isoform a	411					cell division|histone deubiquitination|mitosis|positive regulation of transcription, DNA-dependent|protein homotetramerization|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|histone binding|transcription coactivator activity|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(2)|breast(1)|pancreas(1)	4						TGGAGGATGAAGATCAAGATA	0.308													7	424	---	---	---	---	PASS
EWSR1	2130	broad.mit.edu	37	22	29668371	29668371	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29668371A>G	uc003aet.2	+	3	381	c.53A>G	c.(52-54)TAC>TGC	p.Y18C	EWSR1_uc003aes.3_Missense_Mutation_p.Y18C|EWSR1_uc003aev.2_Missense_Mutation_p.Y18C|EWSR1_uc003aew.2_Missense_Mutation_p.Y18C|EWSR1_uc003aex.2_Missense_Mutation_p.Y18C	NM_005243	NP_005234	Q01844	EWS_HUMAN	Ewing sarcoma breakpoint region 1 isoform 2	18	EAD (Gln/Pro/Thr-rich).|2.|31 X approximate tandem repeats.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding		EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						TTTTGCAGCTACAGTGCTTAC	0.363			T	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1	Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma								221	513	---	---	---	---	PASS
SYTL5	94122	broad.mit.edu	37	X	37984722	37984722	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37984722C>A	uc004ddu.2	+	17	2547	c.2013C>A	c.(2011-2013)AAC>AAA	p.N671K	SYTL5_uc004ddv.2_Missense_Mutation_p.N671K|SYTL5_uc004ddx.2_Missense_Mutation_p.N693K	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	671	C2 2.				intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						TTTCCAGCAACATCTTTCTGG	0.488													73	64	---	---	---	---	PASS
MED14	9282	broad.mit.edu	37	X	40568603	40568603	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40568603T>G	uc004dex.3	-	10	1422	c.1282A>C	c.(1282-1284)AAC>CAC	p.N428H	MED14_uc010nhe.1_Missense_Mutation_p.N312H	NM_004229	NP_004220	O60244	MED14_HUMAN	mediator complex subunit 14	428	Interaction with STAT2.				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			breast(2)|kidney(1)|skin(1)	4						AACCTACAGTTTTCATTGGCA	0.323													70	53	---	---	---	---	PASS
LAS1L	81887	broad.mit.edu	37	X	64749701	64749701	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64749701T>C	uc004dwa.1	-	5	644	c.572A>G	c.(571-573)AAC>AGC	p.N191S	LAS1L_uc004dwc.1_Missense_Mutation_p.N191S|LAS1L_uc004dwd.1_Missense_Mutation_p.N149S	NM_031206	NP_112483	Q9Y4W2	LAS1L_HUMAN	LAS1-like	191						MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4						TCTCAGGCTGTTCTCCAGTTG	0.527													6	220	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2492	2492	+	5'Flank	SNP	G	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2492G>A	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		AAACCTTACCCCGCCTGTTTA	0.468													9	479	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2749	2749	+	5'Flank	SNP	A	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2749A>G	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		tttaatttaTTAATGCAAACA	0.244													6	194	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	11139	11139	+	RNA	SNP	T	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:11139T>C	uc004cov.3	+	1		c.562T>C			uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens potential LAG1 interactor mRNA, partial cds.																		AACCACACTTATCCCCACCTT	0.443													8	216	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	1881003	1881004	+	IGR	INS	-	G	G	rs72502757		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1881003_1881004insG								TMEM52 (30263 upstream) : KIAA1751 (3748 downstream)																							tggaactttcttaagttttgac	0.050													1	6	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	7443984	7443984	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7443984delC	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		agagaatctgcccccattttt	0.214													4	2	---	---	---	---	
RERE	473	broad.mit.edu	37	1	8424985	8424985	+	Intron	DEL	A	-	-	rs34269918		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8424985delA	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc010nzx.1_Intron|RERE_uc001apd.2_Intron	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GGGAGGGGGGAACACCTGTGA	0.637													5	3	---	---	---	---	
PEX14	5195	broad.mit.edu	37	1	10535827	10535827	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10535827delG	uc001arn.2	+						PEX14_uc001arm.1_Intron|PEX14_uc009vmu.1_Intron|PEX14_uc009vmv.2_Intron|PEX14_uc010oam.1_Intron|PEX14_uc010oan.1_Intron|PEX14_uc001arl.2_Intron	NM_004565	NP_004556	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14						negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|protein homooligomerization|protein import into peroxisome matrix|transmembrane transport	integral to membrane|nucleus|peroxisomal membrane|protein complex	protein N-terminus binding|transcription corepressor activity			breast(1)	1	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		GTCCAAAGGTGGGGTAGGGTG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	17053517	17053521	+	IGR	DEL	AAAAG	-	-	rs67944636		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17053517_17053521delAAAAG								ESPNP (6865 upstream) : CROCC (13247 downstream)																							AAGATTAGAAAAAAGAAACATGAAT	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	22339321	22339321	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22339321delC								CELA3A (288 upstream) : HSPC157 (12386 downstream)																							aagtcagtagcTTTTCAATGC	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	22442351	22442351	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22442351delT								CDC42 (22916 upstream) : WNT4 (1449 downstream)																							AATAGTAATATTTCCAGTGAG	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	27534362	27534362	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27534362delT								SLC9A1 (52911 upstream) : WDTC1 (26645 downstream)																							CTGGCTGTCCTTTTTTTTTTT	0.184													4	5	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39917223	39917223	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39917223delT	uc010oiu.1	+						MACF1_uc010ois.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AAATGAGTGATTTTTTTTTTA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	41892548	41892548	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41892548delA								SCMH1 (184760 upstream) : EDN2 (51901 downstream)																							ACTCTGTTCTAGCATTTGAGG	0.602													4	2	---	---	---	---	
HIVEP3	59269	broad.mit.edu	37	1	42439315	42439316	+	Intron	DEL	TC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42439315_42439316delTC	uc001chb.1	-									Q5T1R4	ZEP3_HUMAN	Homo sapiens kappa B and V(D)J recombination signal sequences binding protein (KRC) mRNA, complete cds.						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				catctctttttctctcttttat	0.089													4	2	---	---	---	---	
PPIH	10465	broad.mit.edu	37	1	43131362	43131362	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43131362delA	uc001chq.2	+						PPIH_uc009vwl.2_Intron	NM_006347	NP_006338	O43447	PPIH_HUMAN	peptidylprolyl isomerase H						protein complex assembly|protein folding	cytoplasm|nuclear speck|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity|protein binding|ribonucleoprotein binding				0	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)			L-Proline(DB00172)	cttaaaaaagaaaaaaaaaat	0.000													4	2	---	---	---	---	
IL12RB2	3595	broad.mit.edu	37	1	67787765	67787766	+	Intron	DEL	TC	-	-	rs71945445		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67787765_67787766delTC	uc001ddu.2	+						IL12RB2_uc010oqi.1_Intron|IL12RB2_uc010oqj.1_Intron|IL12RB2_uc010oqk.1_Intron|IL12RB2_uc010oql.1_Intron|IL12RB2_uc010oqm.1_Intron|IL12RB2_uc010oqn.1_Intron	NM_001559	NP_001550	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2 precursor						positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3						ATTTGGCAAGtctctctctctc	0.342													4	4	---	---	---	---	
DDAH1	23576	broad.mit.edu	37	1	85815856	85815856	+	Intron	DEL	T	-	-	rs72424090		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85815856delT	uc001dlb.2	-						DDAH1_uc001dlc.2_Intron|uc001dla.1_Intron|DDAH1_uc010osb.1_Intron|DDAH1_uc009wco.2_Intron	NM_012137	NP_036269	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)	AATCATGGCCTTTTTTTTAGG	0.403													4	2	---	---	---	---	
LRRC8D	55144	broad.mit.edu	37	1	90400298	90400298	+	Frame_Shift_Del	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90400298delT	uc001dnm.2	+	3	2096	c.1671delT	c.(1669-1671)TATfs	p.Y557fs	LRRC8D_uc001dnn.2_Frame_Shift_Del_p.Y557fs	NM_001134479	NP_001127951	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member	557	LRR 2.					integral to membrane	protein binding			ovary(2)	2		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		CCTGGGTGTATTTGCTCAAAA	0.423													74	33	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	92912458	92912458	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92912458delA								RPAP2 (58726 upstream) : GFI1 (27861 downstream)																							AGGCTATCTCATCTGTGAATT	0.458													4	2	---	---	---	---	
BCAR3	8412	broad.mit.edu	37	1	94187924	94187924	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94187924delC	uc001dqb.2	-							NM_003567	NP_003558	O75815	BCAR3_HUMAN	breast cancer antiestrogen resistance 3						response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		TCTTGGCAGTCAAACAATACC	0.453													4	2	---	---	---	---	
FAM46C	54855	broad.mit.edu	37	1	118158503	118158503	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118158503delG	uc001ehe.2	+							NM_017709	NP_060179	Q5VWP2	FA46C_HUMAN	hypothetical protein LOC54855												0	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)		TGGTGGGGACGGGGCAATGGA	0.433										Multiple Myeloma(3;1.13e-06)			4	2	---	---	---	---	
APOA1BP	128240	broad.mit.edu	37	1	156562641	156562642	+	Intron	INS	-	CA	CA	rs148811958	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156562641_156562642insCA	uc001fph.2	+						APOA1BP_uc001fpg.2_Intron|APOA1BP_uc001fpi.2_Intron|APOA1BP_uc001fpj.2_Intron|APOA1BP_uc001fpk.2_Intron|APOA1BP_uc010php.1_Intron	NM_144772	NP_658985	Q8NCW5	AIBP_HUMAN	apolipoprotein A-I binding protein precursor							extracellular region	protein binding			central_nervous_system(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCCATGAGTCCCACACACCACC	0.495													7	4	---	---	---	---	
FCRL5	83416	broad.mit.edu	37	1	157496830	157496830	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157496830delG	uc001fqu.2	-						FCRL5_uc009wsm.2_Intron|FCRL5_uc010phv.1_Intron|FCRL5_uc010phw.1_Intron	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5							integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CACTGAGAGTGGGCATAACTA	0.443													4	2	---	---	---	---	
IGSF8	93185	broad.mit.edu	37	1	160068142	160068142	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160068142delC	uc001fva.2	-						IGSF8_uc001fuz.2_Intron|IGSF8_uc009wtf.2_Intron	NM_052868	NP_443100	Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8						cell proliferation|cellular component movement|nervous system development|single fertilization|skeletal muscle tissue development	integral to membrane	protein binding				0	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TAGGGGGGTGCTGGATGGCAG	0.567													4	2	---	---	---	---	
DNM3	26052	broad.mit.edu	37	1	171955774	171955774	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171955774delT	uc001gie.2	+						DNM3_uc001gid.3_Intron|DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						CACATCTGGCttttttttttt	0.189													4	2	---	---	---	---	
TNFSF4	7292	broad.mit.edu	37	1	173176572	173176572	+	5'Flank	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173176572delT	uc001giw.2	-						TNFSF4_uc001giv.2_5'Flank	NM_003326	NP_003317	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily,						acute inflammatory response|cellular response to lipopolysaccharide|cellular response to prostaglandin E stimulus|chemokine (C-C motif) ligand 11 production|defense response to nematode|interleukin-4-dependent isotype switching to IgE isotypes|memory T cell activation|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of regulatory T cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T-helper 1 cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of alpha-beta T cell proliferation|positive regulation of B cell activation|positive regulation of immunoglobulin mediated immune response|positive regulation of immunoglobulin secretion|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-6 production|positive regulation of memory T cell differentiation|positive regulation of T cell cytokine production|positive regulation of T-helper 2 cell differentiation|positive regulation of type 2 immune response|response to virus|signal transduction|T-helper 2 cell activation	cell surface|extracellular space|integral to plasma membrane	cytokine activity			central_nervous_system(1)	1						ACTTTCTTTCTTTTTTTTTTT	0.398													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	182120675	182120675	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182120675delC								ZNF648 (89828 upstream) : GLUL (230994 downstream)																							tgtcacctatcttgcatgcta	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	198902516	198902517	+	Intron	DEL	AT	-	-	rs72231038		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198902516_198902517delAT	uc001guz.2	-											Homo sapiens familial acute myelogenous leukemia related factor mRNA, complete cds.																		atatatatacatatatatatat	0.267													5	3	---	---	---	---	
NR5A2	2494	broad.mit.edu	37	1	200123348	200123349	+	Intron	DEL	TG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200123348_200123349delTG	uc001gvb.2	+						NR5A2_uc001gvc.2_Intron|NR5A2_uc009wzh.2_Intron|NR5A2_uc010pph.1_Intron	NM_205860	NP_995582	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2						embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Prostate(682;0.19)					GTCCTGAAGTTGTGTGTGTGTG	0.450													4	2	---	---	---	---	
TRAF3IP3	80342	broad.mit.edu	37	1	209944408	209944409	+	Intron	INS	-	GT	GT			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209944408_209944409insGT	uc001hho.2	+						TRAF3IP3_uc001hhl.2_Intron|TRAF3IP3_uc001hhm.1_Intron|TRAF3IP3_uc001hhn.2_Intron|TRAF3IP3_uc009xcr.2_Intron	NM_025228	NP_079504	Q9Y228	T3JAM_HUMAN	TRAF3-interacting JNK-activating modulator							integral to membrane	protein binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.045)		tgcatgtggaggtgtgtgtgca	0.030													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	228322553	228322553	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228322553delT								MRPL55 (25540 upstream) : GUK1 (5376 downstream)																							ACACGGGGCCTTTTACATTGT	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230632918	230632918	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230632918delA								PGBD5 (119551 upstream) : COG2 (145284 downstream)																							GGAGCCCCCTAAGTTGACCAT	0.507													4	2	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241030217	241030218	+	Intron	DEL	AA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241030217_241030218delAA	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron|RGS7_uc001hyt.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CATGGAAGCTAAACGAGGCTAG	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242154107	242154107	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242154107delA								EXO1 (101060 upstream) : MAP1LC3C (4685 downstream)																							ACTCCACCTCAAAAAAAAAAA	0.234													3	3	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245443046	245443046	+	Intron	DEL	T	-	-	rs78944806		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245443046delT	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GTAATCACTCTTTTTTTTTTT	0.333													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	725903	725904	+	IGR	DEL	AG	-	-	rs149618787		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:725903_725904delAG								TMEM18 (48464 upstream) : SNTG2 (220651 downstream)																							acagagagaaagagagtgtcgc	0.000													4	2	---	---	---	---	
GRHL1	29841	broad.mit.edu	37	2	10138954	10138955	+	Intron	DEL	AT	-	-	rs113891349		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10138954_10138955delAT	uc002raa.2	+						GRHL1_uc002rab.2_Intron|GRHL1_uc002rad.2_Intron|GRHL1_uc010yjb.1_Intron	NM_198182	NP_937825	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1						cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding			pancreas(1)|skin(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		atatgtacacatatatatatac	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	10689752	10689752	+	IGR	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10689752delG								ODC1 (101299 upstream) : NOL10 (21142 downstream)																							GGTACCAGCTGGAAGAAGGGG	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11580668	11580669	+	IGR	INS	-	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11580668_11580669insT								ROCK2 (95957 upstream) : E2F6 (3833 downstream)																							TCTGATTTTCATTTTTAATTAT	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	22967215	22967215	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22967215delT								None (None upstream) : KLHL29 (788240 downstream)																							TGCTTTCTGGTTTTTCTGAGA	0.423													4	2	---	---	---	---	
FKBP1B	2281	broad.mit.edu	37	2	24282050	24282050	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24282050delG	uc002rer.2	+						FKBP1B_uc002res.2_Intron|FKBP1B_uc002ret.2_Intron|FKBP1B_uc002reu.2_Intron	NM_004116	NP_004107	P68106	FKB1B_HUMAN	FK506 binding protein 1B, 12.6 kDa isoform a						'de novo' protein folding|negative regulation of heart rate|negative regulation of protein phosphatase type 2B activity|protein maturation by protein folding|protein refolding|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|regulation of ryanodine-sensitive calcium-release channel activity|response to redox state	calcium channel complex|sarcoplasmic reticulum membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity|receptor binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ctTTTGTGGTGGTCCAGGGAC	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	41628184	41628184	+	IGR	DEL	G	-	-	rs17027606	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41628184delG								SLC8A1 (888609 upstream) : PKDCC (646977 downstream)																							AATTAGCTCTGAAGTTAACAG	0.373													4	2	---	---	---	---	
THADA	63892	broad.mit.edu	37	2	43768645	43768645	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43768645delT	uc002rsw.3	-						THADA_uc010far.2_Intron|THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron|THADA_uc010fas.1_Intron|THADA_uc002rsz.2_Intron|THADA_uc010fat.1_Intron|THADA_uc002rta.2_Intron	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TCATGCTAAGttttttttttt	0.174													6	3	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	50956853	50956854	+	Intron	DEL	GG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50956853_50956854delGG	uc010fbq.2	-						NRXN1_uc002rxe.3_Intron	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTCGGGGACTGGGTAGAGTTGC	0.475													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67194128	67194128	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67194128delA								MEIS1 (394238 upstream) : ETAA1 (430314 downstream)																							AGTCTAGGGGAAAAAAAGCAG	0.338													4	2	---	---	---	---	
AAK1	22848	broad.mit.edu	37	2	69747001	69747002	+	Intron	DEL	TT	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69747001_69747002delTT	uc002sfp.2	-						AAK1_uc010fdk.2_Intron|AAK1_uc010yqm.1_Intron	NM_014911	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1							coated pit|mitochondrion|plasma membrane	ATP binding|protein serine/threonine kinase activity				0						CTTGTTTCTATTTTTTTTTTAG	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	73598724	73598724	+	IGR	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73598724delG								EGR4 (77895 upstream) : ALMS1 (14162 downstream)																							TCTTTCTCTTGGGCTCATCTT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	74195704	74195704	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74195704delC								DGUOK (9618 upstream) : TET3 (77746 downstream)																							ggttgccctacccccccacac	0.199													4	2	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	80236438	80236438	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80236438delC	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GTTTTTCTCTCCCCCAACATC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127489303	127489303	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127489303delT								GYPC (35058 upstream) : BIN1 (316304 downstream)																							CAAGGCCACCTCAGCATGCAG	0.488													4	2	---	---	---	---	
NCKAP5	344148	broad.mit.edu	37	2	133706788	133706789	+	Intron	DEL	GA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133706788_133706789delGA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1								protein binding				0						AGTCTGCAATGAACACGTCCTT	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	139331427	139331427	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139331427delC								SPOPL (624 upstream) : NXPH2 (95302 downstream)																							TGCAGCCAGTCCCCTTAATAC	0.408													4	2	---	---	---	---	
FMNL2	114793	broad.mit.edu	37	2	153497698	153497698	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153497698delT	uc002tye.2	+						FMNL2_uc010fob.2_Intron|FMNL2_uc002tyf.2_Intron	NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						TCATGCTCCATTTTTTTTTTC	0.423													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	183490728	183490728	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183490728delA								PDE1A (103221 upstream) : DNAJC10 (90271 downstream)																							GAGACAGAGGAAAAAAACACC	0.433													4	2	---	---	---	---	
ZC3H15	55854	broad.mit.edu	37	2	187350884	187350884	+	5'Flank	DEL	G	-	-	rs67756346		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187350884delG	uc002upo.2	+							NM_018471	NP_060941	Q8WU90	ZC3HF_HUMAN	erythropoietin 4 immediate early response							cytoplasm|nucleolus|plasma membrane	nucleic acid binding|zinc ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			GGGACGCAGTGGGCGCGCACG	0.632													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	189043598	189043598	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189043598delT								TFPI (624379 upstream) : GULP1 (113006 downstream)																							Gttttttttctttttttttga	0.164													4	2	---	---	---	---	
NAB1	4664	broad.mit.edu	37	2	191513341	191513341	+	5'Flank	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191513341delT	uc002usb.2	+						NAB1_uc010fsc.2_5'Flank	NM_005966	NP_005957	Q13506	NAB1_HUMAN	NGFI-A binding protein 1						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			TCACACATAATTTTTTTTTTT	0.458													4	5	---	---	---	---	
ANKRD44	91526	broad.mit.edu	37	2	197893638	197893640	+	Intron	DEL	TGC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197893638_197893640delTGC	uc002uua.1	-						ANKRD44_uc002utz.3_Intron	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CTAGTGCTAGTGCTGCTGCTGCT	0.325													4	2	---	---	---	---	
AOX1	316	broad.mit.edu	37	2	201461171	201461171	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201461171delA	uc002uvx.2	+							NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1						inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TTCTTTGTTTAAGGACCAGTA	0.289													4	2	---	---	---	---	
IGFBP5	3488	broad.mit.edu	37	2	217544151	217544152	+	Intron	DEL	GA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217544151_217544152delGA	uc002vgj.3	-							NM_000599	NP_000590	P24593	IBP5_HUMAN	insulin-like growth factor binding protein 5						negative regulation of insulin-like growth factor receptor signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of translation|signal transduction		insulin-like growth factor I binding				0		Renal(323;0.0822)		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGCAAGGATGAAGGTGGCAGC	0.594													4	2	---	---	---	---	
EPHA4	2043	broad.mit.edu	37	2	222317432	222317432	+	Intron	DEL	T	-	-	rs67814125		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222317432delT	uc002vmq.2	-						EPHA4_uc002vmr.2_Intron|EPHA4_uc010zlm.1_Intron|EPHA4_uc010zln.1_Intron	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GGAAGTGACATTTTTTTTTTA	0.423													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	223684374	223684375	+	IGR	INS	-	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223684374_223684375insT								MOGAT1 (109725 upstream) : ACSL3 (41357 downstream)																							GTTTTTACTCATTTTTTTAGGC	0.337													4	2	---	---	---	---	
CAB39	51719	broad.mit.edu	37	2	231627127	231627127	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231627127delC	uc002vqx.2	+						CAB39_uc010fxr.2_Intron|CAB39_uc010fxq.2_Intron	NM_016289	NP_057373	Q9Y376	CAB39_HUMAN	calcium binding protein 39						cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	kinase binding			central_nervous_system(1)	1		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)		CACAGTTGGACATCTTCAACT	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	231691003	231691003	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231691003delT								CAB39 (5214 upstream) : ITM2C (38618 downstream)																							ttccattacgtttttttttTC	0.080													6	3	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241727058	241727058	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241727058delG	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GACCTGCCCAGGGGAATGGCT	0.612													4	2	---	---	---	---	
PASK	23178	broad.mit.edu	37	2	242065481	242065481	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242065481delA	uc002wao.1	-						PASK_uc010zol.1_Intron|PASK_uc010zom.1_Intron|PASK_uc010fzl.1_Intron|PASK_uc010zon.1_Intron|PASK_uc002wap.2_Intron|PASK_uc002waq.2_Intron	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase						regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		ATTCTCCTTGAAAACATGATT	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	5453645	5453645	+	IGR	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5453645delG								EDEM1 (191996 upstream) : None (None downstream)																							aggcctatgtggtgaggaaca	0.000													4	2	---	---	---	---	
NEK10	152110	broad.mit.edu	37	3	27332981	27332982	+	Frame_Shift_Ins	INS	-	AA	AA			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27332981_27332982insAA	uc003cdt.1	-	18	1743_1744	c.1469_1470insTT	c.(1468-1470)TTAfs	p.L490fs	NEK10_uc003cds.1_5'UTR	NM_199347	NP_955379	Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10 isoform 3	490	Potential.						ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						TTACCACTAATAAATTCAGCTT	0.356													236	127	---	---	---	---	
P4HTM	54681	broad.mit.edu	37	3	49034227	49034227	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49034227delC	uc003cvg.2	+						P4HTM_uc003cvh.2_Intron	NM_177939	NP_808808	Q9NXG6	P4HTM_HUMAN	hypoxia-inducible factor prolyl 4-hydroxylase							endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)	GTCCGGGGTTCGACAAACAGC	0.542													4	2	---	---	---	---	
MST1R	4486	broad.mit.edu	37	3	49940468	49940476	+	In_Frame_Del	DEL	CCTTGCTCA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49940468_49940476delCCTTGCTCA	uc003cxy.3	-	1	831_839	c.567_575delTGAGCAAGG	c.(565-576)GTTGAGCAAGGC>GTC	p.EQG190del	MST1R_uc011bdd.1_In_Frame_Del_p.EQG190del|MST1R_uc011bde.1_In_Frame_Del_p.EQG190del|MST1R_uc011bdf.1_In_Frame_Del_p.EQG190del|MST1R_uc011bdg.1_In_Frame_Del_p.EQG190del	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	190_192	Extracellular (Potential).|Sema.				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		GGAGGCCTGGCCTTGCTCAACCACAGTTA	0.627													6	3	---	---	---	---	
TUSC2	11334	broad.mit.edu	37	3	50362462	50362462	+	3'UTR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50362462delA	uc003czy.1	-	3					HYAL2_uc003czx.2_5'Flank|HYAL2_uc003czv.2_5'Flank|HYAL2_uc003czw.2_5'Flank|HYAL2_uc010hlj.2_5'Flank|TUSC2_uc003czz.1_RNA	NM_007275	NP_009206	O75896	TUSC2_HUMAN	tumor suppressor candidate 2						cell cycle|cell proliferation|cell-cell signaling		protein binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CACAGTACTTAAAAAAAAAGT	0.373											OREG0015585	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	59309594	59309595	+	IGR	DEL	GT	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59309594_59309595delGT								C3orf67 (273836 upstream) : FHIT (425443 downstream)																							AGCACTCATGgtgtgtgtgtgt	0.297													4	2	---	---	---	---	
UBA3	9039	broad.mit.edu	37	3	69112886	69112886	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69112886delA	uc003dno.2	-						UBA3_uc003dnq.2_Intron|UBA3_uc011bfy.1_Intron|UBA3_uc011bfz.1_Intron	NM_003968	NP_003959	Q8TBC4	UBA3_HUMAN	ubiquitin-activating enzyme 3 isoform 1						protein neddylation|proteolysis	nucleus	acid-amino acid ligase activity|ATP binding|protein heterodimerization activity			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.98e-05)|Epithelial(33;0.000363)|LUSC - Lung squamous cell carcinoma(21;0.012)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.206)|Kidney(39;0.241)		tttactaattaaaaaAAAAAA	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	73398288	73398288	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73398288delA								PPP4R2 (283277 upstream) : PDZRN3 (33364 downstream)																							ggtgtcagtgaagaaagaagt	0.000													4	2	---	---	---	---	
CD200	4345	broad.mit.edu	37	3	112080819	112080820	+	3'UTR	INS	-	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112080819_112080820insA	uc003dyw.2	+	7					CD200_uc003dyx.2_3'UTR|CD200_uc003dyy.2_3'UTR|CD200_uc003dyz.2_3'UTR	NM_001004196	NP_001004196	P41217	OX2G_HUMAN	CD200 antigen isoform b						regulation of immune response	integral to plasma membrane					0		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)				TGTAATTCCAGAAAAAAAAAGG	0.277													4	2	---	---	---	---	
KBTBD12	166348	broad.mit.edu	37	3	127641713	127641713	+	5'Flank	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127641713delT	uc010hsr.2	+						KBTBD12_uc003ejy.3_Intron|KBTBD12_uc010hsq.2_Intron|KBTBD12_uc003eka.3_5'Flank|KBTBD12_uc003ejz.2_5'Flank	NM_207335	NP_997218	Q3ZCT8	KBTBC_HUMAN	kelch domain containing 6											ovary(1)	1						TTATAAATACTTTTTTTAGAA	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	133241109	133241109	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133241109delC								BFSP2 (47053 upstream) : CDV3 (51325 downstream)																							TTAACAACGACAGAGACCATT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137063074	137063075	+	IGR	DEL	TC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137063074_137063075delTC								IL20RB (333154 upstream) : SOX14 (420504 downstream)																							AATGCTTTCTTCTAGCAACATT	0.248													4	2	---	---	---	---	
CEP70	80321	broad.mit.edu	37	3	138217180	138217180	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138217180delC	uc003esl.2	-						CEP70_uc011bmk.1_Intron|CEP70_uc011bml.1_Intron|CEP70_uc011bmm.1_Intron	NM_024491	NP_077817	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70 kDa						G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding			skin(1)	1						ATATAACAttctttttttttt	0.109													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161949679	161949680	+	IGR	INS	-	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161949679_161949680insC								OTOL1 (727951 upstream) : None (None downstream)																							GACTTTTTTTTCAGTCTGTTCT	0.396													4	2	---	---	---	---	
MCF2L2	23101	broad.mit.edu	37	3	182912742	182912742	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182912742delT	uc003fli.1	-							NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			aatttttgtatttttttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193814815	193814815	+	IGR	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193814815delG								LOC100128023 (102788 upstream) : HES1 (39119 downstream)																							agcacaaaaaggataagccct	0.075													1	5	---	---	---	---	
GP5	2814	broad.mit.edu	37	3	194117151	194117151	+	3'UTR	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194117151delG	uc003ftv.1	-	2						NM_004488	NP_004479	P40197	GPV_HUMAN	glycoprotein V (platelet) precursor						blood coagulation, intrinsic pathway|cell adhesion|platelet activation	integral to plasma membrane				skin(2)|breast(1)	3	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		CTGTGAGAATGAAGAGCACag	0.318													4	2	---	---	---	---	
ATP13A3	79572	broad.mit.edu	37	3	194154890	194154890	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194154890delT	uc003fty.3	-						ATP13A3_uc003ftz.1_Intron	NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		TTGTGTAGTATCCAAAAATAA	0.284													4	2	---	---	---	---	
ZNF595	152687	broad.mit.edu	37	4	54709	54710	+	Intron	INS	-	CTA	CTA			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54709_54710insCTA	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc010iay.1_Intron|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		GAATCAGAGCGTAGCCCTGCCT	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3580680	3580683	+	Intron	DEL	ATCC	-	-	rs112972386		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3580680_3580683delATCC	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																		ccacccatctatccatccatccat	0.147													4	3	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7592979	7592980	+	Intron	INS	-	CT	CT			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7592979_7592980insCT	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						gctgctgcctcctctctccttc	0.243													4	2	---	---	---	---	
SLC34A2	10568	broad.mit.edu	37	4	25664605	25664605	+	Intron	DEL	T	-	-	rs34583336		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25664605delT	uc003grr.2	+						SLC34A2_uc003grs.2_Intron|SLC34A2_uc010iev.2_Intron	NM_006424	NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (sodium phosphate),						cellular phosphate ion homeostasis	apical plasma membrane|brush border membrane|integral to plasma membrane	phosphate binding|sodium ion binding|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			skin(3)|ovary(1)|kidney(1)	5		Breast(46;0.0503)				CCCTCTCATCttttttttttt	0.269													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31173195	31173196	+	IGR	DEL	CA	-	-	rs116579900	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31173195_31173196delCA								PCDH7 (24774 upstream) : None (None downstream)																							catccacccccacacacacaca	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	32535238	32535238	+	IGR	DEL	A	-	-	rs71653428		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32535238delA								None (None upstream) : None (None downstream)																							ccaaaaaatgaaaaaaaaaat	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	47445047	47445049	+	IGR	DEL	CTT	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47445047_47445049delCTT								GABRB1 (16602 upstream) : COMMD8 (7766 downstream)																							ctcctgactccttgacacacaca	0.005													1	5	---	---	---	---	
OCIAD1	54940	broad.mit.edu	37	4	48832853	48832854	+	5'Flank	DEL	CA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48832853_48832854delCA	uc003gyo.2	+						OCIAD1_uc011bzk.1_5'Flank|OCIAD1_uc003gyr.2_5'Flank|OCIAD1_uc003gyp.2_5'Flank|OCIAD1_uc003gys.2_5'Flank|OCIAD1_uc003gyq.2_5'Flank|OCIAD1_uc010igk.2_5'Flank	NM_017830	NP_060300	Q9NX40	OCAD1_HUMAN	OCIA domain containing 1 isoform 1							endosome	protein binding				0						AGAGGTGCATCACAACAGCCCA	0.584													4	2	---	---	---	---	
LRRC66	339977	broad.mit.edu	37	4	52886328	52886328	+	5'Flank	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52886328delA	uc003gzi.2	-							NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66							integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						AAGGCAGCACAAAAAAACAAA	0.368													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	61982630	61982632	+	IGR	DEL	AGA	-	-	rs13134004	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61982630_61982632delAGA								None (None upstream) : LPHN3 (84342 downstream)																							AAACAATTGCAGAGGAAAAAGCA	0.320													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	69417850	69417851	+	IGR	INS	-	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69417850_69417851insT								YTHDC1 (202026 upstream) : UGT2B15 (94465 downstream)																							AAAAAATGACATTTCTAACTTA	0.183													3	3	---	---	---	---	
UGT2A3	79799	broad.mit.edu	37	4	69811393	69811393	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69811393delG	uc003hef.2	-						UGT2A3_uc010ihp.1_Intron	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,							integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						agggaaggaagaaaggaagga	0.104													4	2	---	---	---	---	
SLC4A4	8671	broad.mit.edu	37	4	72319489	72319489	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72319489delA	uc003hfy.2	+						SLC4A4_uc010iic.2_Intron|SLC4A4_uc010iib.2_Intron|SLC4A4_uc003hfz.2_Intron|SLC4A4_uc003hgc.3_Intron|SLC4A4_uc010iid.2_Intron|SLC4A4_uc003hga.2_Intron|SLC4A4_uc003hgb.3_Intron	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate							basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			ACTCAGCGTGATTTTCTTTCT	0.428													47	32	---	---	---	---	
LIN54	132660	broad.mit.edu	37	4	83858821	83858821	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83858821delT	uc003hnx.3	-						LIN54_uc003hnz.3_Intron|LIN54_uc003hny.3_Intron|LIN54_uc010ijt.2_Intron|LIN54_uc010iju.2_Intron|LIN54_uc010ijv.2_Intron	NM_194282	NP_919258	Q6MZP7	LIN54_HUMAN	lin-54 homolog isoform a						cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Hepatocellular(203;0.114)				ACTCTTGGGATTCAATTATAA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	88770941	88770941	+	IGR	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88770941delG								MEPE (2999 upstream) : SPP1 (125861 downstream)																							GTAGGGTTCAGGGGAGTTGGA	0.483													4	2	---	---	---	---	
C4orf17	84103	broad.mit.edu	37	4	100444009	100444009	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100444009delT	uc003huw.2	+						C4orf17_uc003hux.2_Intron	NM_032149	NP_115525	Q53FE4	CD017_HUMAN	hypothetical protein LOC84103												0				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		TGTTATATAATTTTTTTTCAC	0.338													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	108725349	108725349	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108725349delC								PAPSS1 (83930 upstream) : SGMS2 (20372 downstream)																							tattgaaattccccaggtctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	115026290	115026290	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115026290delT								ARSJ (125412 upstream) : UGT8 (493321 downstream)																							GCTGAGAGAATAAAACACAAT	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	117213946	117213947	+	IGR	DEL	TT	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117213946_117213947delTT								None (None upstream) : MIR1973 (6934 downstream)																							CTAATTGCTATTAAAAAGATGA	0.361													4	2	---	---	---	---	
IL15	3600	broad.mit.edu	37	4	142561735	142561735	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142561735delA	uc003iis.2	+						IL15_uc003iit.2_Intron|IL15_uc010iol.2_Intron|IL15_uc003iiu.2_Intron	NM_000585	NP_000576	P40933	IL15_HUMAN	interleukin 15 preproprotein						cell-cell signaling|immune response|positive regulation of interleukin-17 production	endosome|extracellular space|Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	cytokine activity|cytokine receptor binding|signal transducer activity				0	all_hematologic(180;0.158)					TTAAACAAACAAAAAAAAAAG	0.328													5	5	---	---	---	---	
FGB	2244	broad.mit.edu	37	4	155489835	155489835	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155489835delA	uc003ioa.3	+						FGB_uc003iob.3_Intron|FGB_uc010ipv.2_Intron|FGB_uc010ipw.2_Intron|FGB_uc003ioc.3_Intron	NM_005141	NP_005132	P02675	FIBB_HUMAN	fibrinogen, beta chain preproprotein						platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen|soluble fraction	chaperone binding|eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	ctaactctacaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	157586870	157586870	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157586870delT								CTSO (711822 upstream) : PDGFC (95894 downstream)																							attctcagggttttttttgcc	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	160428017	160428017	+	IGR	DEL	T	-	-	rs71798752		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160428017delT								RAPGEF2 (146718 upstream) : None (None downstream)																							ATTCAAACTCTTTTTTTTTTC	0.254													6	3	---	---	---	---	
MARCH1	55016	broad.mit.edu	37	4	164781486	164781486	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164781486delA	uc003iqs.1	-							NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				ttttactgctaagcaacttat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	179351298	179351299	+	IGR	DEL	TG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179351298_179351299delTG								LOC285501 (439395 upstream) : None (None downstream)																							tcatgggaaatgtgatgccttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	189745272	189745272	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189745272delA								TRIML1 (676623 upstream) : None (None downstream)																							ttccacagtgaagcatacaca	0.020													3	4	---	---	---	---	
TERT	7015	broad.mit.edu	37	5	1282210	1282210	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1282210delA	uc003jcb.1	-						TERT_uc003jbz.1_Intron|TERT_uc003jca.1_Intron|TERT_uc003jcc.1_Intron|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1						anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			ctcaaaaaagaaaaaaaaaag	0.174									TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3323983	3323983	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3323983delT								C5orf38 (568471 upstream) : IRX1 (272185 downstream)																							gatgtgtgtgtTgtgtggtat	0.000													5	3	---	---	---	---	
CDH18	1016	broad.mit.edu	37	5	19503468	19503468	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19503468delT	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AACGCATTGATTTTTTTTTTC	0.313													6	3	---	---	---	---	
EGFLAM	133584	broad.mit.edu	37	5	38304759	38304759	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38304759delT	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					acacacaaagtttacaatgag	0.000													4	2	---	---	---	---	
ZNF131	7690	broad.mit.edu	37	5	43126916	43126916	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43126916delG	uc011cpw.1	+						ZNF131_uc010ivl.1_Intron|ZNF131_uc003jnj.3_Intron|ZNF131_uc003jnk.2_Intron|ZNF131_uc003jnn.3_Intron|ZNF131_uc003jnl.1_Intron|ZNF131_uc010ivm.1_Intron	NM_003432	NP_003423	P52739	ZN131_HUMAN	zinc finger protein 131							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ggcttgctttgaggcagagct	0.000													4	2	---	---	---	---	
NNT	23530	broad.mit.edu	37	5	43659663	43659664	+	Intron	INS	-	C	C	rs145982973	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43659663_43659664insC	uc003joe.2	+						NNT_uc003jof.2_Intron	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase						tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	aaaccctgtctctactaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	78525661	78525661	+	IGR	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78525661delG								BHMT (97549 upstream) : JMY (6293 downstream)																							TGCCATTGTTGTCATGGTGGT	0.358													4	2	---	---	---	---	
THBS4	7060	broad.mit.edu	37	5	79356719	79356719	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79356719delA	uc003kgh.2	+							NM_003248	NP_003239	P35443	TSP4_HUMAN	thrombospondin 4 precursor						endothelial cell-cell adhesion|myoblast migration|negative regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation	basement membrane|extracellular space	calcium ion binding|heparin binding|integrin binding|structural molecule activity				0		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		CTGAAAGGAGAAGCGCAGGGG	0.522													4	2	---	---	---	---	
GPR98	84059	broad.mit.edu	37	5	90021671	90021672	+	Intron	INS	-	G	G			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90021671_90021672insG	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjv.2_Intron	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TATTATCTTCAAGAGCCAAGGA	0.183													4	2	---	---	---	---	
TSLP	85480	broad.mit.edu	37	5	110407274	110407274	+	5'Flank	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110407274delT	uc003kpb.2	+						TSLP_uc003kpa.2_Intron|TSLP_uc010jbt.1_5'Flank	NM_033035	NP_149024	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin isoform 1							extracellular space	cytokine activity				0		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)		TAGCTACTCCTTTTTTTTTTT	0.368													7	6	---	---	---	---	
EPB41L4A	64097	broad.mit.edu	37	5	111717991	111717991	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111717991delA	uc003kpv.1	-						EPB41L4A_uc003kpw.1_Intron	NM_022140	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte protein band 4.1-like 4							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		CAGGCTCAAGAAAAAAAAAAG	0.323													4	2	---	---	---	---	
SEMA6A	57556	broad.mit.edu	37	5	115814626	115814627	+	Intron	DEL	GT	-	-	rs113477307		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115814626_115814627delGT	uc010jck.2	-						SEMA6A_uc003krx.3_Intron|SEMA6A_uc003krw.3_5'Flank|SEMA6A_uc010jcj.2_Intron	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and						apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		GTGTGAGAGAgtgtgtgtgtgt	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	115919817	115919817	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115919817delC								SEMA6A (9266 upstream) : None (None downstream)																							caaaatatatccagagtctga	0.000													4	2	---	---	---	---	
MEGF10	84466	broad.mit.edu	37	5	126746488	126746488	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126746488delA	uc003kuh.3	+						MEGF10_uc010jdc.1_Intron|MEGF10_uc010jdd.1_Intron|MEGF10_uc003kui.3_Intron	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor						cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TTGAGGTGCTAAAATTGTTCA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	126827878	126827879	+	IGR	DEL	CA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126827878_126827879delCA								MEGF10 (30970 upstream) : PRRC1 (25430 downstream)																							Tacacatgcgcacacacacaca	0.228													4	2	---	---	---	---	
RAD50	10111	broad.mit.edu	37	5	131931696	131931696	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131931696delT	uc003kxi.2	+						RAD50_uc003kxh.2_Intron	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1						DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			tttctttttcttttttttttc	0.144								Homologous_recombination					3	3	---	---	---	---	
MYOT	9499	broad.mit.edu	37	5	137135527	137135528	+	Intron	DEL	TC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137135527_137135528delTC	uc011cye.1	+						NPY6R_uc011cyf.1_5'Flank	NM_001135940	NP_001129412	Q9UBF9	MYOTI_HUMAN	myotilin isoform b						muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ACTAAAATGATCTCTTAATATC	0.257													4	2	---	---	---	---	
FAM13B	51306	broad.mit.edu	37	5	137290194	137290195	+	Intron	INS	-	AC	AC	rs151026681	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137290194_137290195insAC	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						catacacacatacacacacaca	0.228													4	2	---	---	---	---	
LARS	51520	broad.mit.edu	37	5	145540213	145540214	+	Intron	INS	-	ATTT	ATTT	rs140796536	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145540213_145540214insATTT	uc003lnx.1	-						LARS_uc011dbq.1_Intron|LARS_uc011dbr.1_Intron|LARS_uc011dbs.1_Intron	NM_020117	NP_064502	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase						leucyl-tRNA aminoacylation	cytosol	ATP binding|leucine-tRNA ligase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	CAATTACTTTAATTTACTTAAA	0.208													9	4	---	---	---	---	
SLC26A2	1836	broad.mit.edu	37	5	149353126	149353126	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149353126delA	uc003lrh.2	+							NM_000112	NP_000103	P50443	S26A2_HUMAN	solute carrier family 26 member 2							integral to plasma membrane|membrane fraction	secondary active sulfate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CGTTCCCCCCACATATATATG	0.164													4	2	---	---	---	---	
CNOT8	9337	broad.mit.edu	37	5	154242596	154242597	+	Intron	DEL	TG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154242596_154242597delTG	uc003lvu.2	+						CNOT8_uc011ddf.1_Intron|CNOT8_uc011ddg.1_Intron|CNOT8_uc011ddh.1_Intron|CNOT8_uc003lvv.2_Intron|CNOT8_uc010jig.2_Intron|CNOT8_uc010jif.2_Intron|CNOT8_uc003lvw.2_Intron|CNOT8_uc011ddi.1_Intron|CNOT8_uc011ddj.1_Intron	NM_004779	NP_004770	Q9UFF9	CNOT8_HUMAN	CCR4-NOT transcription complex, subunit 8						negative regulation of cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			cgtgtgtgcatgtgtgtgtgtg	0.257								Direct_reversal_of_damage					3	3	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	155348096	155348096	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155348096delA	uc003lwa.1	+							NM_172244	NP_758447	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 2						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			agcccaggataaaaacacggt	0.000													4	2	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	155384124	155384125	+	Intron	INS	-	G	G	rs149764635	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155384124_155384125insG	uc003lwa.1	+							NM_172244	NP_758447	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 2						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ttcactgagaatgacatttgat	0.035													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157154176	157154176	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157154176delA								C5orf52 (47016 upstream) : THG1L (4147 downstream)																							aaaataaaacaaaaaaaaGaa	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157802436	157802436	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157802436delA								CLINT1 (516268 upstream) : EBF1 (320488 downstream)																							atctgagtataaggcaatagg	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163283725	163283725	+	IGR	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163283725delG								MAT2B (337392 upstream) : None (None downstream)																							CTCCTACAGTGAAGAAGAAGG	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174972267	174972267	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174972267delT								SFXN1 (16646 upstream) : HRH2 (112773 downstream)																							tgcattgttcttacgttgatt	0.114													4	2	---	---	---	---	
UIMC1	51720	broad.mit.edu	37	5	176395374	176395374	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176395374delA	uc011dfp.1	-						UIMC1_uc003mfc.1_Intron|UIMC1_uc003mfd.1_Intron|UIMC1_uc003mfg.1_Intron|UIMC1_uc003mff.1_Intron	NM_016290	NP_057374	Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1						double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|negative regulation of transcription, DNA-dependent|positive regulation of DNA repair|response to ionizing radiation|transcription, DNA-dependent	BRCA1-A complex	histone binding|K63-linked polyubiquitin binding			ovary(3)|skin(1)	4	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			actccaactcaaaaaaaaaaa	0.045													3	3	---	---	---	---	
CANX	821	broad.mit.edu	37	5	179155908	179155908	+	3'UTR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179155908delT	uc003mkk.2	+	15					CANX_uc011dgp.1_3'UTR|CANX_uc003mkl.2_3'UTR|CANX_uc011dgq.1_3'UTR	NM_001746	NP_001737	P27824	CALX_HUMAN	calnexin precursor						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein secretion	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane|melanosome	calcium ion binding|sugar binding|unfolded protein binding				0	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCAAACTAACTTTTTTTTTTT	0.279													4	4	---	---	---	---	
CAGE1	285782	broad.mit.edu	37	6	7369244	7369244	+	Intron	DEL	T	-	-	rs34755964		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7369244delT	uc003mxi.2	-						CAGE1_uc003mxh.2_Intron|CAGE1_uc003mxj.2_Intron|CAGE1_uc003mxk.1_Intron	NM_205864	NP_995586	Q8TC20	CAGE1_HUMAN	cancer antigen 1												0	Ovarian(93;0.0418)					tttattttaattttttttttt	0.139													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	11181621	11181621	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11181621delT								LOC221710 (42657 upstream) : NEDD9 (1910 downstream)																							ctgctccggctttttaagaaa	0.000													4	2	---	---	---	---	
PHACTR1	221692	broad.mit.edu	37	6	13160173	13160174	+	Intron	INS	-	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13160173_13160174insA	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			ctctgtctcagaaaaaaaaaag	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14015886	14015886	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14015886delA								RNF182 (35653 upstream) : CD83 (101979 downstream)																							tccttttctcatccctcccac	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	22375816	22375816	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22375816delA								PRL (72734 upstream) : HDGFL1 (193862 downstream)																							gcaggttgggaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	27293740	27293740	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27293740delA								FKSG83 (1 upstream) : ZNF204P (31862 downstream)																							accctgtctgaaaaaaaaaaa	0.080													8	4	---	---	---	---	
HLA-A	3105	broad.mit.edu	37	6	29913374	29913374	+	3'UTR	DEL	C	-	-	rs112619883		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29913374delC	uc003nol.2	+	8					HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_5'Flank|HLA-A_uc003non.2_3'UTR|HLA-A_uc003noo.2_3'UTR|HLA-A_uc010jrr.2_3'UTR|HLA-A_uc003nom.2_3'UTR|HLA-A_uc011dmc.1_3'UTR|HLA-A_uc011dmd.1_3'UTR	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						GGTGGGGAGACCACCCCACCC	0.557									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	31346468	31346469	+	IGR	INS	-	AGA	AGA	rs33920640		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31346468_31346469insAGA								HLA-B (21479 upstream) : MICA (21092 downstream)																							TGACCTCACGGAGTTCTGAAGG	0.554													5	3	---	---	---	---	
SYNGAP1	8831	broad.mit.edu	37	6	33387939	33387941	+	5'UTR	DEL	CTC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33387939_33387941delCTC	uc011dri.1	+	1					CUTA_uc003oej.1_5'Flank|CUTA_uc003oek.1_5'Flank|CUTA_uc003oel.1_5'Flank|CUTA_uc003oem.1_5'Flank|CUTA_uc003oen.1_5'Flank|SYNGAP1_uc003oeo.1_5'UTR|SYNGAP1_uc010juy.2_5'UTR	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4						ctcctcctctctcctcctcctcc	0.207													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	43944874	43944874	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43944874delT								LOC100132354 (38931 upstream) : C6orf223 (23465 downstream)																							atgtcattcattttgactgct	0.000													0	7	---	---	---	---	
SUPT3H	8464	broad.mit.edu	37	6	44864513	44864513	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44864513delA	uc003oxo.2	-						SUPT3H_uc003oxn.1_Intron|SUPT3H_uc011dvv.1_Intron|SUPT3H_uc003oxp.2_Intron|SUPT3H_uc011dvw.1_Intron	NM_181356	NP_852001	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog isoform 2						histone deubiquitination|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	STAGA complex|transcription factor TFTC complex	DNA binding|transcription coactivator activity			ovary(2)|breast(1)	3						TCTATGTTTTAAAAAAACAGA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	50039880	50039882	+	IGR	DEL	GGT	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50039880_50039882delGGT								DEFB112 (23516 upstream) : TFAP2D (641375 downstream)																							aggtcatagaggtgaaagggaca	0.000													4	2	---	---	---	---	
DST	667	broad.mit.edu	37	6	56498032	56498032	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56498032delT	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Intron|DST_uc003pdd.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGTTTCACTCttttttttttt	0.134													4	2	---	---	---	---	
BEND6	221336	broad.mit.edu	37	6	56849981	56849983	+	Intron	DEL	ACC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56849981_56849983delACC	uc010kab.2	+						BEND6_uc003pdg.2_Intron	NM_152731	NP_689944	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6												0						cctgtgcgctaccacctgacctc	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	83124616	83124617	+	IGR	DEL	AG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83124616_83124617delAG								TPBG (48002 upstream) : UBE2CBP (477569 downstream)																							ATTCTTCCTTAGCCGTCCTACC	0.545													4	2	---	---	---	---	
ASCC3	10973	broad.mit.edu	37	6	101315536	101315536	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101315536delA	uc003pqk.2	-						ASCC3_uc011eai.1_Intron|ASCC3_uc003pql.2_Intron|ASCC3_uc010kcv.2_Intron|ASCC3_uc003pqm.2_Intron	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GGAGCTGAACAAAAAAAAAAT	0.318													6	3	---	---	---	---	
PDE7B	27115	broad.mit.edu	37	6	136235261	136235261	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136235261delC	uc003qgp.2	+						uc003qgq.1_Intron	NM_018945	NP_061818	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)	CCTCAACCTTCCACAGGCATG	0.383													4	2	---	---	---	---	
OLIG3	167826	broad.mit.edu	37	6	137816335	137816335	+	5'Flank	DEL	G	-	-	rs147389957	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137816335delG	uc003qhp.1	-							NM_175747	NP_786923	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		CAAAAACTGCGAAAAAAAAAT	0.383													4	2	---	---	---	---	
FNDC1	84624	broad.mit.edu	37	6	159692702	159692702	+	3'UTR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159692702delT	uc010kjv.2	+	23						NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1							extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GCTTCTCTACTTTTTTTTGTT	0.418													4	2	---	---	---	---	
WDR27	253769	broad.mit.edu	37	6	170049863	170049863	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170049863delT	uc003qwx.2	-						WDR27_uc003qwv.1_Intron|WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron			A2RRH5	WDR27_HUMAN	RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		ctccatcccctccatccatcc	0.104													4	2	---	---	---	---	
C7orf50	84310	broad.mit.edu	37	7	1146104	1146104	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1146104delT	uc003sju.2	-						C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron	NM_032350	NP_115726	Q9BRJ6	CG050_HUMAN	hypothetical protein LOC84310								protein binding				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)		GGGATCAACGTGGAGAGGGGC	0.652													4	2	---	---	---	---	
PHF14	9678	broad.mit.edu	37	7	11078284	11078284	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11078284delA	uc003sry.1	+						PHF14_uc011jxi.1_Intron|PHF14_uc003srz.2_Intron|PHF14_uc011jxj.1_Intron	NM_014660	NP_055475	O94880	PHF14_HUMAN	PHD finger protein 14 isoform 2								zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		actctgtctcaaaaaaaaaaa	0.090													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	11255275	11255276	+	IGR	DEL	TG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11255275_11255276delTG								PHF14 (46034 upstream) : THSD7A (158897 downstream)																							GAAATCATGCTGAAGCGGAATC	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	15741003	15741003	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15741003delT								MEOX2 (14695 upstream) : ISPD (386149 downstream)																							ttttcttttcttttttttGAA	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	25108818	25108819	+	IGR	DEL	CC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25108818_25108819delCC								OSBPL3 (89058 upstream) : CYCS (49458 downstream)																							gcaatgacaaccaatatggatg	0.000													4	2	---	---	---	---	
HIBADH	11112	broad.mit.edu	37	7	27689454	27689455	+	Intron	INS	-	GC	GC			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27689454_27689455insGC	uc003szf.2	-						HIBADH_uc003szg.2_Intron|HIBADH_uc003szh.2_Intron|HIBADH_uc003szi.2_5'Flank	NM_152740	NP_689953	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase precursor						branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(2)	2			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)	gagttttagaacagcctaggca	0.079													4	2	---	---	---	---	
PDE1C	5137	broad.mit.edu	37	7	32105636	32105637	+	Intron	DEL	GC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32105636_32105637delGC	uc003tcm.1	-						PDE1C_uc003tcn.1_Intron|PDE1C_uc003tco.1_Intron|PDE1C_uc003tcr.2_Intron|PDE1C_uc003tcs.2_Intron	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			TAGCCTCACTGCCTCCTATCAT	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	33822518	33822518	+	IGR	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33822518delG								BBS9 (176838 upstream) : BMPER (122594 downstream)																							tgtgggtggtgttcaagggcc	0.000													4	2	---	---	---	---	
AOAH	313	broad.mit.edu	37	7	36636821	36636822	+	Intron	DEL	AA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36636821_36636822delAA	uc003tfh.3	-						AOAH_uc010kxf.2_Intron|AOAH_uc011kba.1_Intron	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						AGCTCCCAGTAAATCTCAGAGG	0.460													4	2	---	---	---	---	
AOAH	313	broad.mit.edu	37	7	36763985	36763986	+	5'UTR	DEL	CA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36763985_36763986delCA	uc003tfh.3	-	1					AOAH_uc010kxf.2_5'UTR|AOAH_uc011kba.1_5'UTR	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						CTGAGAGAGCCACACACAAAGA	0.480													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	43896295	43896295	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43896295delT								BLVRA (49359 upstream) : MRPS24 (9862 downstream)																							tctaatgaggttcagtatcag	0.174													4	2	---	---	---	---	
TNS3	64759	broad.mit.edu	37	7	47535819	47535819	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47535819delA	uc003tnv.2	-						TNS3_uc003tnw.2_Intron|TNS3_uc010kyo.1_Intron	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3							focal adhesion	protein binding			ovary(4)	4						TAAGCACGTCAAAAAAGGACA	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63886714	63886715	+	IGR	INS	-	A	A	rs150379650	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63886714_63886715insA								ZNF679 (159414 upstream) : ZNF680 (93540 downstream)																							TCGCAGTTTCTAAAAGACAGAC	0.411													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68156699	68156699	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68156699delC								None (None upstream) : AUTS2 (907206 downstream)																							TTCCCTCTGACCACAAATTAT	0.443													4	2	---	---	---	---	
YWHAG	7532	broad.mit.edu	37	7	75976269	75976270	+	Intron	DEL	AC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75976269_75976270delAC	uc011kgj.1	-							NM_012479	NP_036611	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan						G2/M transition of mitotic cell cycle|regulation of neuron differentiation|regulation of signal transduction|regulation of synaptic plasticity	cytosol	insulin-like growth factor receptor binding|protein kinase C binding|protein kinase C inhibitor activity			ovary(1)|lung(1)	2						caaggactaaacaaatcacgcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	91350276	91350278	+	IGR	DEL	ACA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91350276_91350278delACA								FZD1 (452145 upstream) : MTERF (81182 downstream)																							ccacaccactacagctgcccatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	119663632	119663633	+	IGR	INS	-	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119663632_119663633insT								None (None upstream) : KCND2 (250089 downstream)																							cactccataactttttttttct	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	140135450	140135450	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140135450delC								RAB19 (9400 upstream) : MKRN1 (17390 downstream)																							CGCCGCTGTGCCCCATCTGGC	0.677													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142255613	142255613	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142255613delA	uc011krp.1	+						uc011krr.1_Intron					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		TTTCTCTGACAACCCCTGTCA	0.532											OREG0018378	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148257854	148257854	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148257854delA								CNTNAP2 (139768 upstream) : C7orf33 (29803 downstream)																							CTACAGAAGGAAAAAAAAAAT	0.408													3	3	---	---	---	---	
REPIN1	29803	broad.mit.edu	37	7	150070103	150070103	+	3'UTR	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150070103delG	uc010lpq.1	+	4					REPIN1_uc003whd.2_3'UTR|REPIN1_uc010lpr.1_3'UTR|REPIN1_uc003whc.2_3'UTR|REPIN1_uc003whe.2_3'UTR	NM_013400	NP_037532	Q9BWE0	REPI1_HUMAN	replication initiator 1 isoform 1						DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			GCAGTGGGCTGGGGGTGCCTG	0.652													4	2	---	---	---	---	
PRKAG2	51422	broad.mit.edu	37	7	151311292	151311292	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151311292delG	uc003wkk.2	-						PRKAG2_uc003wki.2_Intron|PRKAG2_uc011kvl.1_Intron|PRKAG2_uc003wkj.2_Intron|PRKAG2_uc010lqe.1_Intron	NM_016203	NP_057287	Q9UGJ0	AAKG2_HUMAN	AMP-activated protein kinase gamma2 subunit						ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)		GCTGTGTCTTGAAGGCAGGAA	0.647													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155997461	155997461	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155997461delC								SHH (392494 upstream) : C7orf4 (335724 downstream)																							CATTATTGCACCCCCAGACCC	0.557													4	2	---	---	---	---	
LMBR1	64327	broad.mit.edu	37	7	156569104	156569104	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156569104delA	uc003wmw.3	-						LMBR1_uc003wmv.3_Intron|LMBR1_uc003wmx.3_Intron|LMBR1_uc010lqn.2_Intron|LMBR1_uc011kvx.1_Intron	NM_022458	NP_071903	Q8WVP7	LMBR1_HUMAN	limb region 1 protein							integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		CTGCCCTCGTAAGTAACATCC	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	1039329	1039329	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1039329delA	uc003wpj.1	+											Homo sapiens cDNA clone IMAGE:4824304.																		CCACAATATGAAAACAAATGT	0.488													4	2	---	---	---	---	
INTS10	55174	broad.mit.edu	37	8	19706609	19706610	+	Intron	INS	-	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19706609_19706610insT	uc003wzj.2	+							NM_018142	NP_060612	Q9NVR2	INT10_HUMAN	integrator complex subunit 10						snRNA processing	integrator complex	protein binding			ovary(1)	1				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		CTGGAGTGTTGTTTTTGCAGTG	0.485													4	2	---	---	---	---	
EBF2	64641	broad.mit.edu	37	8	25744634	25744635	+	Intron	DEL	TC	-	-	rs67623458		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25744634_25744635delTC	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_Intron	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		tatgtctctgtctctctctctc	0.203													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	50314126	50314126	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50314126delC								C8orf22 (325485 upstream) : SNTG1 (508223 downstream)																							TAACGCACCGCCCCCCactcc	0.318													3	3	---	---	---	---	
PXDNL	137902	broad.mit.edu	37	8	52425738	52425738	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52425738delT	uc003xqu.3	-							NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AAGTGGTGGGTGGGGTGGAGG	0.532													4	2	---	---	---	---	
NSMAF	8439	broad.mit.edu	37	8	59500895	59500896	+	Intron	INS	-	TC	TC			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59500895_59500896insTC	uc003xtt.2	-						NSMAF_uc011lee.1_Intron	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation						ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				gacattttCTTTTTTTTTTTTT	0.188													4	2	---	---	---	---	
GGH	8836	broad.mit.edu	37	8	63939144	63939145	+	Intron	DEL	AA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63939144_63939145delAA	uc003xuw.2	-							NM_003878	NP_003869	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase precursor						glutamine metabolic process	extracellular space|lysosome|melanosome	gamma-glutamyl-peptidase activity				0	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|L-Glutamic Acid(DB00142)	TTCAAAGGCTAAAAACAGTTAT	0.351													4	2	---	---	---	---	
NCOA2	10499	broad.mit.edu	37	8	71044384	71044384	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71044384delA	uc003xyn.1	-						NCOA2_uc011lfb.1_Intron	NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2						cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			ACAAAAGGACAGTCTGAAATA	0.363			T	RUNXBP2	AML								16	7	---	---	---	---	
PDP1	54704	broad.mit.edu	37	8	94929889	94929890	+	Intron	INS	-	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94929889_94929890insC	uc003yge.2	+						PDP1_uc003ygf.2_Intron|PDP1_uc010max.2_Intron|PDP1_uc011lgm.1_Intron|PDP1_uc011lgn.1_5'Flank	NM_018444	NP_060914	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic						pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						TTGCCTCCCCGGCGGGGTGGGT	0.698													9	4	---	---	---	---	
PGCP	10404	broad.mit.edu	37	8	97955410	97955410	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97955410delC	uc003yhw.2	+						PGCP_uc010mbe.2_Intron	NM_016134	NP_057218	Q9Y646	PGCP_HUMAN	plasma glutamate carboxypeptidase precursor						peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity			upper_aerodigestive_tract(1)	1	Breast(36;1.86e-05)					AACAGATAATCCCAGGCCAGA	0.393													4	2	---	---	---	---	
MATN2	4147	broad.mit.edu	37	8	98953740	98953740	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98953740delT	uc003yic.2	+						MATN2_uc003yib.1_Intron|MATN2_uc010mbh.1_Intron|MATN2_uc003yid.2_Intron|MATN2_uc003yie.1_Intron|MATN2_uc010mbi.1_Intron	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor							proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			AATTTCTTGCTTTtttttgta	0.274													4	2	---	---	---	---	
DEPDC6	64798	broad.mit.edu	37	8	120946636	120946637	+	Intron	DEL	AG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120946636_120946637delAG	uc003yow.3	+						DEPDC6_uc011lid.1_Intron	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GGAAAGCTTTAGAGGAACTGGA	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131652430	131652431	+	IGR	DEL	AA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131652430_131652431delAA								ASAP1 (238214 upstream) : ADCY8 (140117 downstream)																							ACTCTGTGCTAAGCACTAGGAA	0.475													4	2	---	---	---	---	
NDRG1	10397	broad.mit.edu	37	8	134280676	134280677	+	Intron	DEL	AA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134280676_134280677delAA	uc003yuh.2	-						NDRG1_uc003yug.2_Intron|NDRG1_uc010mee.2_Intron|NDRG1_uc010mef.2_Intron|NDRG1_uc011ljh.1_Intron|NDRG1_uc011lji.1_Intron	NM_001135242	NP_001128714	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1						cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			AGCAGGACTCAAAAAAGAGGCT	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	139560012	139560013	+	IGR	DEL	CC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139560012_139560013delCC								FAM135B (50947 upstream) : COL22A1 (40466 downstream)																							TTTAACCTTTCCCCATGACTCC	0.465													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141242629	141242630	+	Intron	DEL	CA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141242629_141242630delCA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						GTGTTCTCTTCACTTGCCCAGA	0.505													4	2	---	---	---	---	
CD274	29126	broad.mit.edu	37	9	5467203	5467208	+	Intron	DEL	AGAGAG	-	-	rs112071324		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5467203_5467208delAGAGAG	uc003zje.2	+						C9orf46_uc003zjd.2_Intron|CD274_uc010mhn.2_Intron|CD274_uc003zjf.2_Intron	NM_014143	NP_054862	Q9NZQ7	PD1L1_HUMAN	CD274 molecule precursor						cell proliferation|cell surface receptor linked signaling pathway|immune response|T cell costimulation	endomembrane system|integral to membrane	receptor activity			lung(1)|central_nervous_system(1)	2	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000742)|Lung(218;0.111)		ccattaccaaagagagagagagagag	0.010			T	CIITA	PMBL|Hodgkin Lymphona|								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	31816015	31816015	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31816015delA								None (None upstream) : ACO1 (568586 downstream)																							CTCTGACATCAAAAAAAAATT	0.383													8	4	---	---	---	---	
B4GALT1	2683	broad.mit.edu	37	9	33120193	33120193	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33120193delA	uc003zsg.2	-							NM_001497	NP_001488	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-						oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	basolateral plasma membrane|brush border membrane|desmosome|external side of plasma membrane|extracellular region|glycocalyx|Golgi cisterna membrane|Golgi trans cisterna|integral to membrane	alpha-tubulin binding|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity|beta-tubulin binding|lactose synthase activity|metal ion binding|N-acetyllactosamine synthase activity|protein binding|protein homodimerization activity				0			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	aaaaacaaacaaaaaaaaaaa	0.189													5	3	---	---	---	---	
RECK	8434	broad.mit.edu	37	9	36091594	36091599	+	Intron	DEL	CTTCTA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36091594_36091599delCTTCTA	uc003zyv.2	+						RECK_uc003zyw.2_Intron|RECK_uc003zyx.2_Intron	NM_021111	NP_066934	O95980	RECK_HUMAN	RECK protein precursor							anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			TCCCCTCTCCCTTCTACTGTACCACC	0.393													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	74264954	74264954	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74264954delA								TRPM3 (203134 upstream) : TMEM2 (33328 downstream)																							gccctgtctcaaaaaataaaa	0.000													4	2	---	---	---	---	
GNA14	9630	broad.mit.edu	37	9	80183581	80183581	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80183581delA	uc004aku.2	-							NM_004297	NP_004288	O95837	GNA14_HUMAN	G alpha 14						activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(2)	2						CACAACAGTTAACCTGAGGAG	0.507													4	2	---	---	---	---	
PTCH1	5727	broad.mit.edu	37	9	98272284	98272285	+	5'Flank	INS	-	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98272284_98272285insA	uc004avk.3	-						PTCH1_uc010mro.2_5'Flank|PTCH1_uc010mrp.2_5'Flank|PTCH1_uc010mrq.2_5'Flank|PTCH1_uc004avl.3_5'Flank|PTCH1_uc010mrr.2_Intron|PTCH1_uc004avm.3_Intron|PTCH1_uc004avo.2_Intron|PTCH1_uc010mrv.1_Intron|PTCH1_uc010mrw.1_Intron	NM_000264	NP_000255	Q13635	PTC1_HUMAN	patched isoform L						embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity			skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CCCCCCAACTTAAAAAAAAAAA	0.426									Basal_Cell_Nevus_syndrome				9	4	---	---	---	---	
NR4A3	8013	broad.mit.edu	37	9	102626286	102626286	+	3'UTR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102626286delC	uc004baf.1	+	8					NR4A3_uc004bag.1_3'UTR|NR4A3_uc004bai.2_3'UTR	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				CAAAGACTTTCTTTTTTTTCT	0.433			T	EWSR1	extraskeletal myxoid chondrosarcoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	105262397	105262397	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105262397delA								GRIN3A (761535 upstream) : CYLC2 (495196 downstream)																							actctgtctcaaaaaaaaaaa	0.159													3	3	---	---	---	---	
DENND1A	57706	broad.mit.edu	37	9	126463834	126463834	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126463834delA	uc004bnz.1	-						DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						gagcttctagacccaccccag	0.000													4	2	---	---	---	---	
GAPVD1	26130	broad.mit.edu	37	9	128075108	128075108	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128075108delT	uc010mwx.2	+						GAPVD1_uc011lzs.1_Intron|GAPVD1_uc004bpp.2_Intron|GAPVD1_uc004bpq.2_Intron|GAPVD1_uc004bpr.2_Intron|GAPVD1_uc004bps.2_Intron|GAPVD1_uc010mwy.1_Intron	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1						endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						tttgggcttatttttttttga	0.000													4	2	---	---	---	---	
LRSAM1	90678	broad.mit.edu	37	9	130258077	130258078	+	Intron	INS	-	CTAT	CTAT			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130258077_130258078insCTAT	uc004brb.1	+						LRSAM1_uc010mxk.1_Intron|LRSAM1_uc004brc.1_Intron|LRSAM1_uc004brd.1_Intron|LRSAM1_uc004bre.1_Intron|uc004brf.1_5'Flank|LRSAM1_uc004brg.1_Intron	NM_001005373	NP_001005373	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif						negative regulation of endocytosis|non-lytic virus budding|protein autoubiquitination|protein catabolic process|protein polyubiquitination|protein transport|ubiquitin-dependent endocytosis	cytoplasm|extracellular region|membrane part	hormone activity|ubiquitin-protein ligase activity|zinc ion binding				0						aacccctgggcctatCTATCTA	0.218													4	2	---	---	---	---	
BARHL1	56751	broad.mit.edu	37	9	135461623	135461624	+	Intron	DEL	TG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135461623_135461624delTG	uc004cbp.1	+							NM_020064	NP_064448	Q9BZE3	BARH1_HUMAN	BarH-like homeobox 1							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				OV - Ovarian serous cystadenocarcinoma(145;1.79e-06)|Epithelial(140;3.12e-05)		TGCATTCAGCTGAACCCCGTCA	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	139075386	139075387	+	IGR	DEL	GC	-	-	rs147045664	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139075386_139075387delGC								C9orf69 (64655 upstream) : LHX3 (12711 downstream)																							tggatccggggcaaggacagtc	0.000													4	2	---	---	---	---	
ADARB2	105	broad.mit.edu	37	10	1402599	1402600	+	Intron	DEL	GT	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1402599_1402600delGT	uc009xhq.2	-							NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CCACCATGCAGTGGGACCAGGG	0.579													4	2	---	---	---	---	
TAF3	83860	broad.mit.edu	37	10	7876003	7876003	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7876003delT	uc010qbd.1	+							NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140						maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1						atattttgcctttttttttgg	0.189													4	2	---	---	---	---	
FAM171A1	221061	broad.mit.edu	37	10	15352137	15352137	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15352137delC	uc001iob.2	-							NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061 precursor							integral to membrane				ovary(2)|breast(1)|skin(1)	4						TTTCCAGTTTCTGTTGCAATG	0.398													4	2	---	---	---	---	
PLXDC2	84898	broad.mit.edu	37	10	20357398	20357399	+	Intron	DEL	TC	-	-	rs35815344		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20357398_20357399delTC	uc001iqg.1	+						PLXDC2_uc001iqh.1_Intron	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN	plexin domain containing 2 precursor							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4						CCTCTGCTTTTCTTCTAAATTT	0.322													4	2	---	---	---	---	
ACBD5	91452	broad.mit.edu	37	10	27512592	27512593	+	Intron	INS	-	G	G	rs150713509	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27512592_27512593insG	uc010qdp.1	-						ACBD5_uc010qdm.1_Intron|ACBD5_uc010qdn.1_Intron|ACBD5_uc010qdo.1_Intron|ACBD5_uc001ito.2_Intron|ACBD5_uc001itp.2_Intron|ACBD5_uc001itq.2_Intron|ACBD5_uc001itr.1_Intron	NM_145698	NP_663736	Q5T8D3	ACBD5_HUMAN	acyl-Coenzyme A binding domain containing 5						transport	integral to membrane|peroxisomal membrane	fatty-acyl-CoA binding				0						cccagcactttgggaggccaag	0.084													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42905765	42905765	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42905765delT	uc001izx.2	-											Homo sapiens cyclin Y-like 2, mRNA (cDNA clone IMAGE:4704933), with apparent retained intron.																		CTACtttttgttttttttggt	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	44397520	44397520	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44397520delA								HNRNPA3P1 (111655 upstream) : CXCL12 (468087 downstream)																							CAATGATTTCAAAAAAAAAAC	0.413													4	2	---	---	---	---	
FAM35B2	439965	broad.mit.edu	37	10	47386406	47386406	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47386406delT	uc010qfz.1	+							NR_027634				Homo sapiens cDNA FLJ59018 complete cds, highly similar to Protein FAM35A.												0						GATCAGAATGTTTTTTTCTCT	0.259													1	5	---	---	---	---	
ASCC1	51008	broad.mit.edu	37	10	73956412	73956412	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73956412delT	uc001jst.1	-						ASCC1_uc001jsr.1_Intron|ASCC1_uc001jss.1_Intron|ASCC1_uc001jsu.1_Intron|ASCC1_uc010qju.1_Intron			Q8N9N2	ASCC1_HUMAN	RecName: Full=Activating signal cointegrator 1 complex subunit 1; AltName: Full=ASC-1 complex subunit p50; AltName: Full=Trip4 complex subunit p50;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	RNA binding				0						GTCCATACACTTTTTTTTTCA	0.239													4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	79395653	79395653	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79395653delA	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	AACAGGATGTATAATTAATGA	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	80529379	80529379	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80529379delT								RPS24 (712809 upstream) : LOC283050 (173705 downstream)																							CTCGTCCTGCTTCCCACGTCC	0.592													4	2	---	---	---	---	
HPSE2	60495	broad.mit.edu	37	10	100481813	100481813	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100481813delC	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		ATAACCTAATCAACACCGGAG	0.249													4	2	---	---	---	---	
C10orf79	80217	broad.mit.edu	37	10	105905588	105905588	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105905588delA	uc001kxw.2	-						C10orf79_uc009xxq.2_Intron	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217												0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		GAAGTGTCCCAAAATATATTT	0.204													4	2	---	---	---	---	
PNLIPRP2	5408	broad.mit.edu	37	10	118390023	118390023	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118390023delT	uc001lcq.2	+						PNLIPRP2_uc009xyu.1_Intron|PNLIPRP2_uc009xyv.1_Intron	NM_005396	NP_005387	P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity			large_intestine(1)	1				all cancers(201;0.015)		AAAATCAGTGTTTTTTTTTCA	0.219													4	2	---	---	---	---	
BCCIP	56647	broad.mit.edu	37	10	127520367	127520368	+	Intron	DEL	TG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127520367_127520368delTG	uc001ljb.3	+						BCCIP_uc001ljd.3_Intron|BCCIP_uc010qui.1_Intron|BCCIP_uc001ljc.3_Intron|BCCIP_uc010quj.1_Intron	NM_078468	NP_510868	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A-interacting protein isoform						cell cycle|DNA repair|neuroendocrine cell differentiation|regulation of cyclin-dependent protein kinase activity	nuclear cyclin-dependent protein kinase holoenzyme complex	kinase regulator activity|protein binding			ovary(1)|breast(1)	2		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TTGAAGAGTTTGTGACAATAAT	0.322													4	2	---	---	---	---	
ODF3	113746	broad.mit.edu	37	11	194850	194851	+	5'Flank	INS	-	CACT	CACT	rs143036825		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:194850_194851insCACT	uc001lob.2	+						ODF3_uc010qvk.1_5'Flank|ODF3_uc001loc.2_5'Flank	NM_053280	NP_444510	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm				ovary(1)	1		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CATCAGGAACACAGGGCCACAG	0.545													4	2	---	---	---	---	
KCNQ1	3784	broad.mit.edu	37	11	2758741	2758741	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2758741delA	uc001lwn.2	+						KCNQ1_uc009ydp.1_Intron|KCNQ1_uc001lwo.2_Intron	NM_000218	NP_000209	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like						blood circulation|membrane depolarization|muscle contraction|sensory perception of sound		delayed rectifier potassium channel activity|protein binding			ovary(1)	1		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	CTTGTGTTTTAAAAATCAGTA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	4829860	4829861	+	IGR	DEL	TG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4829860_4829861delTG								OR52R1 (4013 upstream) : OR51F2 (12755 downstream)																							AACCAGTTTCTGTCTTCCCATT	0.475													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15928964	15928965	+	IGR	INS	-	CA	CA	rs145492452	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15928964_15928965insCA								INSC (660212 upstream) : SOX6 (59031 downstream)																							acctggccctccacacacacac	0.114													6	3	---	---	---	---	
ABCC8	6833	broad.mit.edu	37	11	17461172	17461173	+	Intron	INS	-	A	A	rs4148616		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17461172_17461173insA	uc001mnc.2	-						ABCC8_uc010rcy.1_Intron	NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	CTAACGGAGGGAAAAAAAAACA	0.550													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19425331	19425331	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19425331delG	uc001mpp.2	+							NM_001111018	NP_001104488	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						tatgtgctatggggaaaaata	0.000													4	2	---	---	---	---	
RAG1	5896	broad.mit.edu	37	11	36605384	36605385	+	Intron	DEL	TT	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36605384_36605385delTT	uc001mwt.2	+							NM_000448		P15918	RAG1_HUMAN	recombination activating gene 1						histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				attgtcagtgtttaggacctga	0.139									Familial_Hemophagocytic_Lymphohistiocytosis				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	64345919	64345920	+	IGR	INS	-	C	C	rs141443095	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64345919_64345920insC								SLC22A11 (6921 upstream) : SLC22A12 (12362 downstream)																							AGCGTGGGGGACTGGGCCTGGC	0.619													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	71514248	71514249	+	Intron	INS	-	TTGTT	TTGTT			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71514248_71514249insTTGTT	uc001oqx.1	-											Homo sapiens cDNA clone IMAGE:5297769.																		ttttgttgtcgttgttttgttt	0.203													4	4	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76924280	76924280	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76924280delC	uc001oyb.2	+						MYO7A_uc001oyc.2_Intron|MYO7A_uc001oye.2_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						cctgaagttactaacaaactc	0.289													4	2	---	---	---	---	
PRCP	5547	broad.mit.edu	37	11	82547517	82547518	+	Intron	DEL	AC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82547517_82547518delAC	uc001ozs.2	-						PRCP_uc001ozr.2_Intron	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein						blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1						GTAAACTATTACATCAACAGCC	0.297													4	2	---	---	---	---	
DYNC2H1	79659	broad.mit.edu	37	11	103004676	103004676	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103004676delT	uc001pho.2	+						DYNC2H1_uc001phn.1_Intron|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1						cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		actaacattcttttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115681790	115681790	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115681790delC								CADM1 (306549 upstream) : BUD13 (937098 downstream)																							gaggatgagtcaaagctagcg	0.100													4	2	---	---	---	---	
NLRX1	79671	broad.mit.edu	37	11	119053629	119053629	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119053629delA	uc001pvu.2	+						NLRX1_uc001pvv.2_Intron|NLRX1_uc001pvw.2_Intron|NLRX1_uc001pvx.2_Intron|PDZD3_uc001pvy.2_5'Flank|PDZD3_uc001pvz.2_5'Flank|PDZD3_uc010rzd.1_5'Flank|PDZD3_uc001pwa.2_5'Flank|PDZD3_uc001pwb.2_5'Flank	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1						innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		aaacaaaaacaaaaaaaaaaA	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	128326944	128326944	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128326944delC								None (None upstream) : ETS1 (1712 downstream)																							CCAAAGACATCCCATTAACCT	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	134518793	134518793	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134518793delA								B3GAT1 (236981 upstream) : None (None downstream)																							ggcctttggtaggcgatgagg	0.000													4	2	---	---	---	---	
CLEC9A	283420	broad.mit.edu	37	12	10197962	10197962	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10197962delT	uc001qxa.2	+							NM_207345	NP_997228	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A						positive regulation of cytokine secretion|receptor-mediated endocytosis	cell surface|integral to membrane	receptor activity|sugar binding			ovary(1)	1						AATGAGAAACTTTTTTTTTTA	0.348													5	4	---	---	---	---	
SOX5	6660	broad.mit.edu	37	12	23891202	23891202	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23891202delG	uc001rfw.2	-						SOX5_uc001rfx.2_Intron|SOX5_uc001rfy.2_Intron|SOX5_uc010siv.1_Intron|SOX5_uc010siw.1_Intron|SOX5_uc001rfz.1_Intron	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						AGGGAGTGCTGGGAGGAGTGT	0.408													4	2	---	---	---	---	
C12orf71	728858	broad.mit.edu	37	12	27235489	27235489	+	5'Flank	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27235489delA	uc001rhq.2	-							NM_001080406	NP_001073875	A8MTZ7	CL071_HUMAN	hypothetical protein LOC728858												0						AGGTGGGACTAAGGAGAAGAG	0.269													4	3	---	---	---	---	
CAPRIN2	65981	broad.mit.edu	37	12	30867725	30867725	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30867725delT	uc001rji.1	-						CAPRIN2_uc001rjf.1_Intron|CAPRIN2_uc001rjg.1_Intron|CAPRIN2_uc001rjh.1_Intron|CAPRIN2_uc001rjj.1_Intron|CAPRIN2_uc001rjk.3_Intron|CAPRIN2_uc001rjl.3_Intron	NM_001002259	NP_001002259	Q6IMN6	CAPR2_HUMAN	C1q domain containing 1 isoform 1						negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					AATTAGTTCCTCTGTTATGGA	0.308													4	2	---	---	---	---	
SYT10	341359	broad.mit.edu	37	12	33546580	33546580	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33546580delA	uc001rll.1	-						SYT10_uc009zju.1_Intron	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN	synaptotagmin X							cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					acttctcaacaaaagccatca	0.020													3	5	---	---	---	---	
GRIP1	23426	broad.mit.edu	37	12	66861162	66861163	+	Intron	DEL	TC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66861162_66861163delTC	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stj.2_5'Flank|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TGTCCTGGCTTCTCTCTCTCCT	0.480													4	2	---	---	---	---	
BTG1	694	broad.mit.edu	37	12	92495190	92495191	+	Intron	INS	-	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92495190_92495191insA	uc001tbv.1	-						BTG1_uc001tbw.1_Intron|BTG1_uc001tbx.1_Intron|BTG1_uc009zss.1_Intron			P62324	BTG1_HUMAN	Homo sapiens full length insert cDNA clone YW25A12.						cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				aagaaagaaagaaagaaagaaa	0.000			T	MYC	BCLL								4	2	---	---	---	---	
BTG1	694	broad.mit.edu	37	12	92495194	92495195	+	Intron	INS	-	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92495194_92495195insA	uc001tbv.1	-						BTG1_uc001tbw.1_Intron|BTG1_uc001tbx.1_Intron|BTG1_uc009zss.1_Intron			P62324	BTG1_HUMAN	Homo sapiens full length insert cDNA clone YW25A12.						cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				aagaaagaaagaaagaaagaaa	0.000			T	MYC	BCLL								4	2	---	---	---	---	
BTG1	694	broad.mit.edu	37	12	92495198	92495199	+	Intron	INS	-	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92495198_92495199insA	uc001tbv.1	-						BTG1_uc001tbw.1_Intron|BTG1_uc001tbx.1_Intron|BTG1_uc009zss.1_Intron			P62324	BTG1_HUMAN	Homo sapiens full length insert cDNA clone YW25A12.						cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				aagaaagaaagaaagaaagaaa	0.010			T	MYC	BCLL								4	2	---	---	---	---	
TMPO	7112	broad.mit.edu	37	12	98922030	98922030	+	Intron	DEL	T	-	-	rs72519624		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98922030delT	uc001tfj.2	+						TMPO_uc001tfi.1_Intron|TMPO_uc001tfk.2_Intron|TMPO_uc001tfl.2_Intron|TMPO_uc001tfh.1_Intron	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta							integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						TATATCGTACttttttttttt	0.070													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110536982	110536982	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110536982delT								C12orf76 (25543 upstream) : IFT81 (25158 downstream)																							CTTTGTTTTGTTTTTtggtgg	0.169													4	2	---	---	---	---	
C12orf51	283450	broad.mit.edu	37	12	112607181	112607215	+	Intron	DEL	CTTCTGCAGCACAAGTGCTGAGGATGTGGCTTTTA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112607181_112607215delCTTCTGCAGCACAAGTGCTGAGGATGTGGCTTTTA	uc009zwc.2	-							NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						GCAGACCTGGCTTCTGCAGCACAAGTGCTGAGGATGTGGCTTTTACTCTTGGAAA	0.626													4	2	---	---	---	---	
CAMKK2	10645	broad.mit.edu	37	12	121697886	121697886	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121697886delA	uc001tzu.2	-						CAMKK2_uc001tzt.2_Intron|CAMKK2_uc001tzv.2_Intron|CAMKK2_uc001tzw.2_Intron|CAMKK2_uc001tzx.2_Intron|CAMKK2_uc001tzy.2_Intron|CAMKK2_uc001tzz.1_Intron|CAMKK2_uc001uaa.1_Intron|CAMKK2_uc001uab.2_Intron|CAMKK2_uc001uac.2_Intron	NM_006549	NP_006540	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase						calcium-mediated signaling|MAPKKK cascade|positive regulation of transcription, DNA-dependent|protein autophosphorylation|regulation of protein kinase activity	cytoplasm	ATP binding|calcium ion binding|calmodulin binding|calmodulin-dependent protein kinase activity|protein tyrosine kinase activity			lung(1)|large_intestine(1)|stomach(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					accctgactcaaaaaaaataa	0.219													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128648868	128648870	+	IGR	DEL	CAT	-	-	rs142216809		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128648868_128648870delCAT								None (None upstream) : TMEM132C (250421 downstream)																							ctacctccaccatcatcatctcc	0.172													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131830001	131830001	+	5'Flank	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131830001delC	uc001uiy.2	+											Homo sapiens cDNA FLJ25657 fis, clone TST00324.																		TTGTTGCTGACCCCCTGTGAC	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131962092	131962093	+	IGR	INS	-	ATA	ATA			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131962092_131962093insATA								LOC116437 (264617 upstream) : SFRS8 (233542 downstream)																							tggtaatggtggtggtgatggt	0.079													4	2	---	---	---	---	
SLC25A30	253512	broad.mit.edu	37	13	45971672	45971672	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45971672delA	uc001vag.2	-						SLC25A30_uc010tfs.1_Intron|SLC25A30_uc001vah.2_Intron|SLC25A30_uc010tft.1_Intron|SLC25A30_uc001vaf.2_3'UTR	NM_001010875	NP_001010875	Q5SVS4	KMCP1_HUMAN	solute carrier family 25, member 30						mitochondrial transport	integral to membrane|mitochondrial inner membrane	binding			breast(1)	1		Lung NSC(96;0.00227)|Prostate(109;0.00578)|Breast(56;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.95e-05)		ctaaaaatacaaaaaaaaaat	0.000													3	3	---	---	---	---	
UCHL3	7347	broad.mit.edu	37	13	76168726	76168727	+	Intron	INS	-	A	A	rs146987523	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76168726_76168727insA	uc001vjq.2	+						UCHL3_uc001vjr.2_Intron	NM_006002	NP_005993	P15374	UCHL3_HUMAN	ubiquitin carboxyl-terminal esterase L3						ubiquitin-dependent protein catabolic process	cytoplasm	cysteine-type peptidase activity|ubiquitin binding|ubiquitin thiolesterase activity				0				GBM - Glioblastoma multiforme(99;0.0125)		atttcattcagtaagtatgcaa	0.139													2	8	---	---	---	---	
MBNL2	10150	broad.mit.edu	37	13	98027294	98027295	+	Intron	DEL	CA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98027294_98027295delCA	uc010aft.2	+						MBNL2_uc001vmz.2_Intron|MBNL2_uc001vna.2_Intron|MBNL2_uc001vnb.2_Intron|MBNL2_uc010tij.1_Intron	NM_144778	NP_659002	Q5VZF2	MBNL2_HUMAN	muscleblind-like 2 isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	cytoplasm|nucleus	RNA binding|zinc ion binding				0	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)			CCTACCTTCTCACACGTCTGCC	0.520													4	2	---	---	---	---	
NIN	51199	broad.mit.edu	37	14	51248354	51248354	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51248354delC	uc001wym.2	-						NIN_uc001wyi.2_Intron|NIN_uc001wyj.2_Intron|NIN_uc001wyk.2_Intron|NIN_uc010tqp.1_Intron|NIN_uc001wyo.2_Intron|NIN_uc001wyp.1_Intron	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5						centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					acttaggaggcagagtgcctg	0.204			T	PDGFRB	MPD								4	2	---	---	---	---	
LTBP2	4053	broad.mit.edu	37	14	75035201	75035201	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75035201delG	uc001xqa.2	-							NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding						protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GGAATGTGCTGGCATGGTGTT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86651585	86651586	+	IGR	INS	-	T	T	rs147403299	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86651585_86651586insT								FLRT2 (557316 upstream) : None (None downstream)																							TACAATGTTTATTTTTCTATGG	0.332													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	87395852	87395852	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87395852delA								None (None upstream) : GALC (908312 downstream)																							tgttgcagacagctgcctcct	0.114													4	2	---	---	---	---	
MIR539	664612	broad.mit.edu	37	14	101513129	101513130	+	5'Flank	INS	-	TGG	TGG	rs138069781	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101513129_101513130insTGG	hsa-mir-539|MI0003514	+						MIR889_hsa-mir-889|MI0005540_5'Flank|MIR544_hsa-mir-544|MI0003515_5'Flank|MIR655_hsa-mir-655|MI0003677_5'Flank																	0						GAAACTATCATtggtggtggtg	0.213													4	3	---	---	---	---	
EIF5	1983	broad.mit.edu	37	14	103805966	103805967	+	Intron	INS	-	T	T			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103805966_103805967insT	uc001ymq.2	+						EIF5_uc001ymr.2_Intron|EIF5_uc001yms.2_Intron|EIF5_uc001ymt.2_Intron|EIF5_uc001ymu.2_Intron	NM_001969	NP_001960	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5						regulation of translational initiation|RNA metabolic process	cytosol	GTP binding|GTPase activity|translation initiation factor activity			pancreas(1)|breast(1)|skin(1)	3		Melanoma(154;0.155)	Epithelial(46;0.182)			ACCAAGGTGTCTATTTGCAGTT	0.401													97	51	---	---	---	---	
RYR3	6263	broad.mit.edu	37	15	33833295	33833295	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33833295delT	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ATCCCTGAACTTTTTTTTTTA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	39648407	39648407	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39648407delA								C15orf54 (101359 upstream) : THBS1 (224873 downstream)																							aagcaaaatgattttagggga	0.000													4	2	---	---	---	---	
CASC5	57082	broad.mit.edu	37	15	40894859	40894860	+	Intron	INS	-	A	A			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40894859_40894860insA	uc010bbs.1	+						CASC5_uc010ucq.1_Intron|CASC5_uc001zme.2_Intron|CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		taattttgtattttggtagaga	0.000													6	3	---	---	---	---	
FRMD5	84978	broad.mit.edu	37	15	44281522	44281522	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44281522delC	uc001ztl.2	-						FRMD5_uc001ztk.1_Intron|FRMD5_uc001ztm.2_Intron|FRMD5_uc001ztn.2_Intron	NM_032892	NP_116281	Q7Z6J6	FRMD5_HUMAN	FERM domain containing 5 isoform 2							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)		TTGAGGATGTCCACATCACAC	0.572													4	2	---	---	---	---	
UNC13C	440279	broad.mit.edu	37	15	54542859	54542859	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54542859delA	uc002ack.2	+							NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CAGGGTGAGTACCTGGAGTGA	0.358													4	2	---	---	---	---	
ADAMTSL3	57188	broad.mit.edu	37	15	84682985	84682985	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84682985delC	uc002bjz.3	+						ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			CAACCACACTCCCACTACCCT	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	90496059	90496059	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90496059delC								AP3S2 (39837 upstream) : ZNF710 (48693 downstream)																							GGCCGAGAGTCCACAAGAGTG	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92115421	92115422	+	IGR	DEL	CA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92115421_92115422delCA								SV2B (276773 upstream) : SLCO3A1 (281516 downstream)																							gagagaagagcacacacacacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	96637866	96637866	+	IGR	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96637866delG								LOC145820 (586792 upstream) : NR2F2 (231291 downstream)																							gagttattaaggaggaggcta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	18152849	18152850	+	IGR	DEL	TG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18152849_18152850delTG								XYLT1 (588111 upstream) : NOMO2 (358333 downstream)																							ggttgtgagttgtgtgtgttgc	0.050													4	2	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	20986786	20986787	+	Intron	INS	-	AA	AA			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20986786_20986787insAA	uc010vbe.1	-						DNAH3_uc010vbd.1_Intron	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		CTGAAAATGGCAAAGTAGACAA	0.421													67	32	---	---	---	---	
NSMCE1	197370	broad.mit.edu	37	16	27236887	27236887	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27236887delT	uc002doi.1	-						NSMCE1_uc002doj.1_Intron	NM_145080	NP_659547	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog						DNA recombination|DNA repair|intracellular signal transduction	nucleus	zinc ion binding				0						TAGCTCAGCCTTTACTTCCTG	0.552													4	2	---	---	---	---	
RNF40	9810	broad.mit.edu	37	16	30778395	30778395	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30778395delG	uc002dzq.2	+						RNF40_uc010caa.2_Intron|RNF40_uc010cab.2_Intron|RNF40_uc010vfa.1_Intron|RNF40_uc002dzr.2_Intron|RNF40_uc010vfb.1_Intron|RNF40_uc010vfc.1_5'Flank	NM_014771	NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40						histone H2B ubiquitination|histone monoubiquitination|ubiquitin-dependent protein catabolic process	nucleus|synaptosome|ubiquitin ligase complex	protein homodimerization activity|ubiquitin protein ligase binding|zinc ion binding			central_nervous_system(1)	1			Colorectal(24;0.198)			TGATGGAGCAGGCACATGCAG	0.498													4	2	---	---	---	---	
ITGAD	3681	broad.mit.edu	37	16	31436100	31436103	+	Intron	DEL	AGTA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31436100_31436103delAGTA	uc002ebv.1	+						ITGAD_uc010cap.1_Intron	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor						cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						ttgtatttttagtagagatggagt	0.000													4	4	---	---	---	---	
C16orf87	388272	broad.mit.edu	37	16	46836599	46836599	+	3'UTR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46836599delT	uc002eek.1	-	4						NM_001001436	NP_001001436	Q6PH81	CP087_HUMAN	hypothetical protein LOC388272												0						TTTTTGTTGGTTTTTTTTTGT	0.363													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	48669431	48669432	+	IGR	DEL	GA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48669431_48669432delGA								N4BP1 (25311 upstream) : CBLN1 (642779 downstream)																							GCAGGGAGGGGAGATGGATGCC	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	49511613	49511615	+	IGR	DEL	GAA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49511613_49511615delGAA								C16orf78 (78296 upstream) : ZNF423 (12907 downstream)																							ggaagaacaggaagaagaagaag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	50080933	50080933	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50080933delA								TMEM188 (9935 upstream) : HEATR3 (18948 downstream)																							ctccatctctaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55005964	55005972	+	IGR	DEL	TTCCTTTCC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55005964_55005972delTTCCTTTCC								IRX5 (37571 upstream) : IRX6 (352499 downstream)																							ttcctttcctttcctttccttccttcctt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	58937588	58937588	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58937588delT								GOT2 (169342 upstream) : None (None downstream)																							ggcatgcttcttttttttttt	0.174													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	59517419	59517419	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59517419delT								GOT2 (749173 upstream) : None (None downstream)																							cttctttgccttttttttgtt	0.000													4	2	---	---	---	---	
GFOD2	81577	broad.mit.edu	37	16	67719767	67719767	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67719767delT	uc002eub.2	-						GFOD2_uc002euc.2_Intron|GFOD2_uc010cen.2_Intron	NM_030819	NP_110446	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain							proteinaceous extracellular matrix	binding|oxidoreductase activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		GGCTACtttcttttttttttg	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	76828309	76828309	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76828309delT								CNTNAP4 (235174 upstream) : MON1B (396527 downstream)																							tgttactttgttttttttttt	0.000													3	3	---	---	---	---	
CDYL2	124359	broad.mit.edu	37	16	80709357	80709358	+	Intron	DEL	CT	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80709357_80709358delCT	uc002ffs.2	-							NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2							nucleus	catalytic activity|protein binding			central_nervous_system(1)	1						GCAGTAAGACCTCAAGAAATGT	0.312													4	2	---	---	---	---	
KIAA1609	57707	broad.mit.edu	37	16	84518295	84518295	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84518295delC	uc002fib.2	-						KIAA1609_uc010vod.1_Intron|KIAA1609_uc002fic.2_Intron	NM_020947	NP_065998	Q6P9B6	K1609_HUMAN	hypothetical protein LOC57707								protein binding			ovary(2)	2						CATTGTTTGTCCCACAGCTAT	0.473											OREG0023986	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	1124069	1124069	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1124069delT								ABR (33453 upstream) : TUSC5 (58888 downstream)																							AGGGAATGTATTTTTTTCACT	0.453													4	2	---	---	---	---	
POLR2A	5430	broad.mit.edu	37	17	7391328	7391329	+	Intron	INS	-	T	T	rs149101585		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7391328_7391329insT	uc002ghf.3	+						POLR2A_uc002ghe.2_Intron	NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				aatggcatatcttttttttttt	0.000													4	2	---	---	---	---	
CYTSB	92521	broad.mit.edu	37	17	20037779	20037779	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20037779delA	uc002gwq.2	+						CYTSB_uc010cqx.2_Intron|CYTSB_uc002gwr.2_Intron|CYTSB_uc002gws.2_Intron	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b							nucleus					0						TTGCCCTGGGAAGGGAAAAAA	0.458													4	2	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21322860	21322861	+	3'UTR	DEL	TG	-	-	rs112563903		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21322860_21322861delTG	uc002gyv.1	+	3						NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	TGTAGGAGGCTGTGTGTGTGCC	0.589										Prostate(3;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21553409	21553409	+	IGR	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21553409delG								C17orf51 (75678 upstream) : FAM27L (271961 downstream)																							Tgatgatgatgatgatggtga	0.179													4	2	---	---	---	---	
NOS2	4843	broad.mit.edu	37	17	26157184	26157185	+	Intron	DEL	TT	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26157184_26157185delTT	uc010crh.1	-							NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A						arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	atcaccctggtttttttacttt	0.000													4	2	---	---	---	---	
SSH2	85464	broad.mit.edu	37	17	27993706	27993707	+	Intron	DEL	CA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27993706_27993707delCA	uc002heo.1	-						SSH2_uc010wbh.1_Intron|SSH2_uc002hep.1_Intron	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2						actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						CACACACACGCACACACACACt	0.064													4	2	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39821341	39821341	+	Intron	DEL	T	-	-	rs34833532		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39821341delT	uc010wfs.1	-							NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		cttcactttattTTTTTTTTC	0.259													4	2	---	---	---	---	
HOXB8	3218	broad.mit.edu	37	17	46693184	46693184	+	5'Flank	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46693184delG	uc002inw.2	-							NM_024016	NP_076921	P17481	HXB8_HUMAN	homeobox B8							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CTGGATAACCGGCCCCCCAAA	0.383													4	2	---	---	---	---	
IGF2BP1	10642	broad.mit.edu	37	17	47114882	47114883	+	Intron	DEL	TG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47114882_47114883delTG	uc002iom.2	+						IGF2BP1_uc010dbj.2_Intron	NM_006546	NP_006537	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding						CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			kidney(1)	1						GACTCAAGAATGTGTGTTTGCT	0.287													6	7	---	---	---	---	
MSI2	124540	broad.mit.edu	37	17	55743108	55743108	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55743108delC	uc002iuz.1	+						MSI2_uc010wnm.1_Intron	NM_138962	NP_620412	Q96DH6	MSI2H_HUMAN	musashi 2 isoform a							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		GGACTGAGATCAGCTCTCTGG	0.572			T	HOXA9	CML								4	2	---	---	---	---	
CLTC	1213	broad.mit.edu	37	17	57746520	57746520	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57746520delA	uc002ixq.1	+						CLTC_uc002ixp.2_Intron|CLTC_uc002ixr.1_Intron	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TTAAAAGAAGAAAAAAAAAAT	0.284			T	ALK|TFE3	ALCL|renal 								7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70425703	70425703	+	Intron	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70425703delC	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																		AAACTCACCACAACAGAGCAA	0.502													4	2	---	---	---	---	
C17orf70	80233	broad.mit.edu	37	17	79512603	79512603	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79512603delG	uc002kaq.2	-						C17orf70_uc002kao.1_Intron|C17orf70_uc010wuq.1_Intron|C17orf70_uc002kap.2_Intron	NM_001109760	NP_001103230	Q0VG06	FP100_HUMAN	Fanconi anemia core complex 100 kDa subunit						DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding			ovary(1)|skin(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CTGCCTGAGTGGGGTCTGCTT	0.647													4	2	---	---	---	---	
PTPRM	5797	broad.mit.edu	37	18	8276742	8276742	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8276742delT	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				aacaAAAAAATACAATCTCCA	0.254													4	2	---	---	---	---	
KIAA0802	23255	broad.mit.edu	37	18	8821082	8821083	+	Intron	DEL	CT	-	-	rs72938187	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8821082_8821083delCT	uc002knr.2	+						KIAA0802_uc002knq.2_Intron|KIAA0802_uc002kns.2_Intron	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255												0						CACATGCACACTCTCTCTCTCT	0.455													4	2	---	---	---	---	
FAM38B	63895	broad.mit.edu	37	18	10756407	10756407	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10756407delA	uc002kos.1	-									Q9H5I5	PIEZ2_HUMAN	SubName: Full=cDNA FLJ45725 fis, clone HCHON2009766; Flags: Fragment;							integral to membrane	ion channel activity			ovary(1)	1						ggacggatggaagaggagaag	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22371968	22371968	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22371968delT								HRH4 (312048 upstream) : ZNF521 (269920 downstream)																							GCCAGGAGAATTTAAAGCAAC	0.433													4	2	---	---	---	---	
ZNF521	25925	broad.mit.edu	37	18	22679015	22679016	+	Intron	DEL	CT	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22679015_22679016delCT	uc002kvk.2	-						ZNF521_uc010xbe.1_Intron|ZNF521_uc010dly.2_Intron|ZNF521_uc002kvl.2_Intron	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GTGTTGAGAACTCAGTTTGGGG	0.257			T	PAX5	ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	61491321	61491323	+	IGR	DEL	AAT	-	-	rs1720910	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61491321_61491323delAAT								SERPINB7 (18718 upstream) : SERPINB2 (63616 downstream)																							cggtaatggaaatgatgataatg	0.335													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	62192403	62192403	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62192403delA								C18orf20 (376143 upstream) : None (None downstream)																							ATGTATTATTAACACTTTGAC	0.418													4	2	---	---	---	---	
DENND1C	79958	broad.mit.edu	37	19	6477590	6477590	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6477590delT	uc002mfe.2	-						DENND1C_uc002mfb.2_5'Flank|DENND1C_uc002mfc.2_5'Flank|DENND1C_uc002mfd.2_Intron|DENND1C_uc010xje.1_Intron	NM_024898	NP_079174	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity			large_intestine(1)	1						GTCCTGGGAGTTTtttttttt	0.308													6	4	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153090	7153091	+	Intron	INS	-	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153090_7153091insC	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	cacacatcacacaacacaccac	0.000													5	3	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153092	7153093	+	Intron	INS	-	C	C			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153092_7153093insC	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	cacatcacacaacacaccacac	0.000													5	3	---	---	---	---	
CYP4F3	4051	broad.mit.edu	37	19	15763094	15763094	+	Intron	DEL	T	-	-	rs35461125		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15763094delT	uc002nbj.2	+						CYP4F3_uc010xok.1_Intron|CYP4F3_uc010xol.1_Intron|CYP4F3_uc010xom.1_Intron|CYP4F3_uc002nbk.2_Intron|CYP4F3_uc010xon.1_Intron	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,						leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						ttgccagtgatttttttctca	0.090													4	6	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17768693	17768693	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17768693delA	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						aaaagaaaagaaaaaaaaaaa	0.199													7	4	---	---	---	---	
ZNF675	171392	broad.mit.edu	37	19	23845628	23845628	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23845628delA	uc002nri.2	-							NM_138330	NP_612203	Q8TD23	ZN675_HUMAN	zinc finger protein 675						bone resorption|cytokine-mediated signaling pathway|hemopoiesis|I-kappaB kinase/NF-kappaB cascade|negative regulation of JNK cascade|negative regulation of osteoclast differentiation|negative regulation of protein kinase activity|negative regulation of transcription, DNA-dependent|regulation of ossification|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				ccaaaaatacaaaaaaaaatt	0.000													6	3	---	---	---	---	
TYROBP	7305	broad.mit.edu	37	19	36395748	36395748	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36395748delA	uc002ocm.2	-						TYROBP_uc002ocn.2_Intron	NM_003332	NP_003323	O43914	TYOBP_HUMAN	TYRO protein tyrosine kinase binding protein						axon guidance|cell junction assembly|cellular defense response|intracellular signal transduction|regulation of immune response	integral to plasma membrane|intracellular	identical protein binding|receptor signaling protein activity				0	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			tcctctgcctaaaactctgtt	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	36913800	36913800	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36913800delA								ZFP82 (4250 upstream) : ZNF566 (22222 downstream)																							CTTTGTCATTAAAAAAAAAAA	0.194													5	3	---	---	---	---	
SPTBN4	57731	broad.mit.edu	37	19	41029222	41029223	+	Intron	DEL	CA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41029222_41029223delCA	uc002ony.2	+						SPTBN4_uc002onx.2_Intron|SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			gaggtgggaccacaactggaat	0.252													4	2	---	---	---	---	
APOC1P1	342	broad.mit.edu	37	19	45431268	45431268	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45431268delA	uc010eju.2	+											Homo sapiens clone DKFZp781C1677 mRNA sequence.												0						GAACAGATTGAAAAAAAAAAC	0.527													4	4	---	---	---	---	
IL4I1	259307	broad.mit.edu	37	19	50399704	50399704	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50399704delT	uc002pqt.1	-						IL4I1_uc002pqv.1_Intron|IL4I1_uc010eno.1_Intron|IL4I1_uc002pqw.1_Intron|IL4I1_uc002pqu.1_Intron	NM_152899	NP_690863	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1 isoform 1 precursor							lysosome	L-amino-acid oxidase activity			lung(1)|ovary(1)|prostate(1)	3		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)		cctttctttctttttttttta	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	53529953	53529953	+	IGR	DEL	A	-	-	rs75753639		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53529953delA								ZNF702P (33169 upstream) : ZNF160 (39915 downstream)																							cacaaaaagcaaaaaaaaaAA	0.020													6	3	---	---	---	---	
LILRB3	11025	broad.mit.edu	37	19	54733630	54733631	+	Intron	INS	-	T	T	rs141238984	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54733630_54733631insT	uc010erh.1	-						LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Intron|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Intron|LILRB3_uc002qer.1_Intron|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Intron|LILRA6_uc010yeq.1_Intron	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		atttttttgtattttcagtaga	0.005													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	22639398	22639399	+	IGR	DEL	CC	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22639398_22639399delCC								FOXA2 (73297 upstream) : SSTR4 (376658 downstream)																							ATGCACATATCCCCACTGAGAG	0.416													4	2	---	---	---	---	
PIGU	128869	broad.mit.edu	37	20	33152565	33152566	+	Intron	DEL	GG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33152565_33152566delGG	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron	NM_080476	NP_536724	Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0						tgtgaatggtggactcccgctg	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	38284537	38284537	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38284537delA								LOC339568 (431146 upstream) : None (None downstream)																							GCCGGaaaacaaaacaaaaca	0.403													4	2	---	---	---	---	
PKIG	11142	broad.mit.edu	37	20	43199398	43199398	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43199398delA	uc002xmg.2	+						PKIG_uc002xmh.2_Intron|PKIG_uc002xmi.2_Intron	NM_181805	NP_861521	Q9Y2B9	IPKG_HUMAN	cAMP-dependent protein kinase inhibitor gamma								cAMP-dependent protein kinase inhibitor activity|protein binding				0		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.001)|COAD - Colon adenocarcinoma(18;0.00189)			aatgaacaacaaaaaaaagtg	0.000													4	2	---	---	---	---	
ZMYND8	23613	broad.mit.edu	37	20	45877719	45877720	+	Intron	INS	-	AGA	AGA	rs3972363		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45877719_45877720insAGA	uc002xta.1	-						ZMYND8_uc010ghq.1_Intron|ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xtg.2_Intron|ZMYND8_uc010ghs.1_Intron	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			GATGCGTACTGAGGAGAGCAGA	0.371													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	50461533	50461534	+	IGR	DEL	AT	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50461533_50461534delAT								SALL4 (42485 upstream) : ZFP64 (239017 downstream)																							TTTTTCCTTCATAAAAGTTTAT	0.347													4	2	---	---	---	---	
PHACTR3	116154	broad.mit.edu	37	20	58213865	58213866	+	Intron	INS	-	T	T	rs56087006	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58213865_58213866insT	uc002yau.2	+						PHACTR3_uc002yat.2_Intron|PHACTR3_uc010zzw.1_Intron	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1							nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			ggatggatggacgaatggatgg	0.000													4	2	---	---	---	---	
PHACTR3	116154	broad.mit.edu	37	20	58213868	58213869	+	Intron	INS	-	TGG	TGG	rs62643374	by1000genomes	TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58213868_58213869insTGG	uc002yau.2	+						PHACTR3_uc002yat.2_Intron|PHACTR3_uc010zzw.1_Intron	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1							nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			tggatggacgaatggatgggta	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11078694	11078695	+	Intron	DEL	TA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11078694_11078695delTA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		tttagaatactatataacctta	0.000													4	2	---	---	---	---	
CHODL	140578	broad.mit.edu	37	21	19274029	19274029	+	Intron	DEL	G	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19274029delG	uc002ykr.2	+							NM_024944	NP_079220	Q9H9P2	CHODL_HUMAN	chondrolectin precursor						muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		cctcccttctgccatgagctc	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	21798492	21798493	+	IGR	DEL	GA	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21798492_21798493delGA								None (None upstream) : C21orf131 (316421 downstream)																							TGTCTGGGAGGAGAGAGAGAGG	0.446													4	2	---	---	---	---	
DSCAM	1826	broad.mit.edu	37	21	41553784	41553784	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41553784delT	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGCAGCCTGGTTTAGGAAGAT	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	42832861	42832861	+	IGR	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42832861delT								MX1 (1721 upstream) : TMPRSS2 (3618 downstream)																							CAGGATTCTATTTTGCTGTTG	0.448											OREG0026226	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CECR2	27443	broad.mit.edu	37	22	18032368	18032368	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18032368delA	uc010gqw.1	+						CECR2_uc010gqv.1_Intron|CECR2_uc002zml.2_Intron|CECR2_uc002zmo.2_Intron	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2						chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		AGGACTCTAGAACCTACCCTC	0.413													14	7	---	---	---	---	
C22orf25	128989	broad.mit.edu	37	22	20040745	20040745	+	Intron	DEL	T	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20040745delT	uc010grw.1	+						C22orf25_uc002zrb.1_Intron|C22orf25_uc002zrc.1_Intron|C22orf25_uc002zrd.1_Intron|C22orf25_uc002zre.2_Intron|C22orf25_uc010grx.2_Intron|C22orf25_uc011ahe.1_Intron|C22orf25_uc011ahf.1_Intron|C22orf25_uc011ahg.1_Intron|C22orf25_uc002zrg.2_Intron|C22orf25_uc011ahh.1_Intron|C22orf25_uc002zrf.2_Intron|C22orf25_uc011ahi.1_Intron|C22orf25_uc010gry.1_Intron|C22orf25_uc002zrh.1_Intron	NM_152906	NP_690870	Q6ICL3	CV025_HUMAN	hypothetical protein LOC128989												0	Colorectal(54;0.0533)					AGTGGGGaaatttttttttta	0.493													4	2	---	---	---	---	
TFIP11	24144	broad.mit.edu	37	22	26894669	26894669	+	Intron	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26894669delA	uc003acr.2	-						TFIP11_uc003acs.2_Intron|TFIP11_uc003act.2_Intron	NM_012143	NP_036275	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11						biomineral tissue development	catalytic step 2 spliceosome|cytoplasm|nuclear speck	DNA binding|sequence-specific DNA binding transcription factor activity				0						Caaaaaaattaaaaaaaaaaa	0.204													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39686391	39686391	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39686391delC								PDGFB (45434 upstream) : RPL3 (22497 downstream)																							GAATAATAGTCAAGTTCATTC	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	12088129	12088129	+	IGR	DEL	C	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12088129delC								MSL3 (294259 upstream) : FRMPD4 (68456 downstream)																							taaagacaaacaaagaaatga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	12844472	12844472	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12844472delA								PRPS2 (2130 upstream) : TLR7 (40730 downstream)																							AGCTTCCTTGAAAAAAAAAAG	0.239													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	71042863	71042864	+	IGR	DEL	TG	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71042863_71042864delTG								BCYRN1 (93901 upstream) : NHSL2 (88074 downstream)																							TGGAGCCTTCTGTGCCTTTCCA	0.579													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	98684620	98684620	+	IGR	DEL	A	-	-			TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:98684620delA								None (None upstream) : LOC442459 (31980 downstream)																							TAGAATGTCTAAAAATGTCTA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13270122	13270122	+	IGR	DEL	T	-	-	rs75692746		TCGA-AK-3451-01A-02D-1251-10	TCGA-AK-3451-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13270122delT								None (None upstream) : None (None downstream)																							atttcttttctttttcttttg	0.000													3	3	---	---	---	---	
