Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SDF4	51150	broad.mit.edu	37	1	1153053	1153053	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1153053T>C	uc001adh.3	-	7	1257	c.928A>G	c.(928-930)ATG>GTG	p.M310V	SDF4_uc001adg.2_RNA|SDF4_uc001adi.3_Silent_p.P348P|SDF4_uc009vjv.2_Missense_Mutation_p.M188V|SDF4_uc009vjw.2_RNA	NM_016176	NP_057260	Q9BRK5	CAB45_HUMAN	stromal cell derived factor 4 isoform 2	310	EF-hand 5.|Necessary for intracellular retention in Golgi apparatus lumen (By similarity).				cerebellum development|fat cell differentiation|response to ethanol|UV protection|zymogen granule exocytosis	bleb|Golgi lumen|late endosome|soluble fraction	calcium ion binding|calcium ion binding|identical protein binding|protein binding			upper_aerodigestive_tract(1)|large_intestine(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)		TACTCGTTCATGGGGTCCATG	0.637													31	103	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12409404	12409404	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12409404T>G	uc001atv.2	+	46	9545	c.9404T>G	c.(9403-9405)ATG>AGG	p.M3135R	VPS13D_uc001atw.2_Missense_Mutation_p.M3110R|VPS13D_uc001atx.2_Missense_Mutation_p.M2322R	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	3134					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TGCCACTCTATGGACACAGAA	0.398													46	131	---	---	---	---	PASS
TMEM54	113452	broad.mit.edu	37	1	33360935	33360935	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33360935G>A	uc001bwi.1	-	5	679	c.565C>T	c.(565-567)CCC>TCC	p.P189S	TMEM54_uc001bwj.1_Missense_Mutation_p.P136S|TMEM54_uc001bwk.1_Missense_Mutation_p.P169S	NM_033504	NP_277039	Q969K7	TMM54_HUMAN	transmembrane protein 54	189						integral to membrane					0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CCCCACCAGGGCCTCAGCTCC	0.637													9	33	---	---	---	---	PASS
EIF2C1	26523	broad.mit.edu	37	1	36372683	36372683	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36372683C>T	uc001bzl.2	+	12	1758	c.1545C>T	c.(1543-1545)CTC>CTT	p.L515L	EIF2C1_uc001bzk.2_Silent_p.L440L|EIF2C1_uc009vuy.2_RNA	NM_012199	NP_036331	Q9UL18	AGO1_HUMAN	eukaryotic translation initiation factor 2C, 1	515	Piwi.				negative regulation of translation involved in gene silencing by miRNA|nuclear-transcribed mRNA catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|polysome	protein binding|RNA binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GGCTGCAGCTCATTATTGTCA	0.522													26	74	---	---	---	---	PASS
PTPRF	5792	broad.mit.edu	37	1	44085866	44085866	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44085866C>G	uc001cjr.2	+	30	5552	c.5212C>G	c.(5212-5214)CTG>GTG	p.L1738V	PTPRF_uc001cjs.2_Missense_Mutation_p.L1729V|PTPRF_uc001cju.2_Missense_Mutation_p.L1127V|PTPRF_uc009vwt.2_Missense_Mutation_p.L1298V|PTPRF_uc001cjv.2_Missense_Mutation_p.L1209V|PTPRF_uc001cjw.2_Missense_Mutation_p.L964V	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1738	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CATCGTCATGCTGACCAAGCT	0.617													46	134	---	---	---	---	PASS
DOCK7	85440	broad.mit.edu	37	1	63021612	63021612	+	Missense_Mutation	SNP	C	T	T	rs78144896		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63021612C>T	uc001daq.2	-	21	2514	c.2480G>A	c.(2479-2481)CGA>CAA	p.R827Q	DOCK7_uc001dan.2_Missense_Mutation_p.R719Q|DOCK7_uc001dao.2_Missense_Mutation_p.R719Q|DOCK7_uc001dap.2_Missense_Mutation_p.R827Q|DOCK7_uc001dam.2_Missense_Mutation_p.R7Q	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	827					activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						TTTGTGAAGTCGATTTATAAT	0.348													69	193	---	---	---	---	PASS
RPE65	6121	broad.mit.edu	37	1	68910517	68910517	+	Missense_Mutation	SNP	C	T	T	rs143056561	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68910517C>T	uc001dei.1	-	4	349	c.295G>A	c.(295-297)GTC>ATC	p.V99I		NM_000329	NP_000320	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein	99					visual perception	cytoplasm|plasma membrane	all-trans-retinyl-palmitate hydrolase activity|metal ion binding|retinol isomerase activity			ovary(1)	1						TCTGTTATGACGATCCTTTTC	0.418													6	170	---	---	---	---	PASS
FCGR1A	2209	broad.mit.edu	37	1	149762912	149762912	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149762912A>G	uc001esp.3	+	6	1014	c.964A>G	c.(964-966)AAG>GAG	p.K322E	HIST2H2BF_uc010pbj.1_Intron|FCGR1A_uc009wlg.2_RNA	NM_000566	NP_000557	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor	322	Cytoplasmic (Potential).|Interaction with EPB41L2.				interferon-gamma-mediated signaling pathway|phagocytosis, engulfment	integral to membrane|plasma membrane	IgG binding|receptor activity|receptor signaling protein activity			ovary(1)	1	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AAGAAAGAAAAAGTGGGATTT	0.378													6	268	---	---	---	---	PASS
SSR2	6746	broad.mit.edu	37	1	155981770	155981770	+	Intron	SNP	A	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155981770A>C	uc001fmx.2	-						SSR2_uc001fmv.2_RNA|SSR2_uc001fmw.2_RNA|SSR2_uc001fmy.2_Intron|SSR2_uc010pgv.1_Intron|SSR2_uc010pgw.1_3'UTR	NM_003145	NP_003136	P43308	SSRB_HUMAN	signal sequence receptor, beta precursor						cotranslational protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	signal sequence binding				0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					AACCAACCCAACTCTATGCAT	0.438													11	24	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186275897	186275897	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186275897A>G	uc001gru.3	+	7	1097	c.1046A>G	c.(1045-1047)GAG>GGG	p.E349G	PRG4_uc001grt.3_Missense_Mutation_p.E308G|PRG4_uc009wyl.2_Missense_Mutation_p.E256G|PRG4_uc009wym.2_Missense_Mutation_p.E215G|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	349	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|1.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						ACTCCCAAGGAGCCCACGCCC	0.552													26	70	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215820889	215820889	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215820889C>T	uc001hku.1	-	67	15153	c.14766G>A	c.(14764-14766)TGG>TGA	p.W4922*		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4922	Extracellular (Potential).|Fibronectin type-III 34.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGAAACTGATCCACTCGGAAG	0.413										HNSCC(13;0.011)			27	66	---	---	---	---	PASS
RRP15	51018	broad.mit.edu	37	1	218458677	218458677	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218458677G>C	uc001hlj.2	+	1	49	c.19G>C	c.(19-21)GAC>CAC	p.D7H		NM_016052	NP_057136	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog	7						mitochondrion|nucleolus	protein binding				0				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)		CGCCGCTCCGGACTCACGTGT	0.547													10	26	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1647244	1647244	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1647244C>G	uc002qxa.2	-	19	3912	c.3848G>C	c.(3847-3849)CGG>CCG	p.R1283P		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	1283					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GCTCTGCACCCGGGTGATGTT	0.627													32	67	---	---	---	---	PASS
COLEC11	78989	broad.mit.edu	37	2	3665178	3665178	+	Intron	SNP	T	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3665178T>G	uc002qya.2	+						COLEC11_uc002qxz.2_Intron|COLEC11_uc002qyb.2_Intron|COLEC11_uc002qyc.2_Intron|COLEC11_uc010ewo.2_Intron|COLEC11_uc010ewp.2_Intron|COLEC11_uc010ewq.2_Intron|COLEC11_uc010ewr.2_Intron|COLEC11_uc010ews.2_Intron|uc002qyd.1_RNA	NM_024027	NP_076932	Q9BWP8	COL11_HUMAN	collectin sub-family member 11 isoform a							collagen	mannose binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		AGTCGTTTCTTTGGAAGGCAG	0.443													45	122	---	---	---	---	PASS
TP53I3	9540	broad.mit.edu	37	2	24307267	24307267	+	Intron	SNP	A	G	G	rs72078174		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24307267A>G	uc002rey.1	-						LOC375190_uc002rew.2_Intron|TP53I3_uc002rex.1_5'Flank|TP53I3_uc002rez.1_5'UTR|TP53I3_uc010ykk.1_5'UTR	NM_147184	NP_671713	Q53FA7	QORX_HUMAN	tumor protein p53 inducible protein 3						induction of apoptosis by oxidative stress|NADP metabolic process		NADPH binding|NADPH:quinone reductase activity|protein homodimerization activity|quinone binding|zinc ion binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					aggacagggcagggcaggaca	0.408											OREG0014492	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	13	---	---	---	---	PASS
ABHD1	84696	broad.mit.edu	37	2	27346840	27346840	+	Silent	SNP	C	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27346840C>G	uc002rit.2	+	1	184	c.24C>G	c.(22-24)CCC>CCG	p.P8P	ABHD1_uc002riu.2_RNA|ABHD1_uc002riv.2_RNA|ABHD1_uc002riw.2_Silent_p.P8P	NM_032604	NP_115993	Q96SE0	ABHD1_HUMAN	abhydrolase domain-containing protein 1	8						integral to membrane	carboxylesterase activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCTGAGCCCCCAGAATGGCA	0.637													29	91	---	---	---	---	PASS
RPIA	22934	broad.mit.edu	37	2	89036070	89036070	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89036070C>T	uc002ste.2	+	7	656	c.615C>T	c.(613-615)CTC>CTT	p.L205L		NM_144563	NP_653164	P49247	RPIA_HUMAN	ribose 5-phosphate isomerase A	205					pentose-phosphate shunt, non-oxidative branch	cytosol	ribose-5-phosphate isomerase activity			ovary(1)	1		Acute lymphoblastic leukemia(2;0.000456)|all_hematologic(2;0.00287)				CGAAGAATCTCGGGGATCAGT	0.483													35	128	---	---	---	---	PASS
C2orf27B	408029	broad.mit.edu	37	2	132558558	132558558	+	5'UTR	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132558558G>A	uc002ttg.1	-	2						NM_214461	NP_999626	Q580R0	CB027_HUMAN	hypothetical protein LOC408029												0						TGTTGGGACCGCTGGCACAGA	0.552													4	131	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179481863	179481863	+	Silent	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179481863G>T	uc010zfg.1	-	204	40379	c.40155C>A	c.(40153-40155)ACC>ACA	p.T13385T	TTN_uc010zfh.1_Silent_p.T7080T|TTN_uc010zfi.1_Silent_p.T7013T|TTN_uc010zfj.1_Silent_p.T6888T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14312							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATCGTCAGCGGTGAGAGGAC	0.373													17	36	---	---	---	---	PASS
TFPI	7035	broad.mit.edu	37	2	188349545	188349545	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188349545T>G	uc002upx.2	-	5	561	c.528A>C	c.(526-528)GAA>GAC	p.E176D	TFPI_uc002upy.2_Missense_Mutation_p.E176D|TFPI_uc002upz.2_Missense_Mutation_p.E172D|TFPI_uc002uqa.2_Missense_Mutation_p.E176D|TFPI_uc002uqb.2_Missense_Mutation_p.E176D	NM_006287	NP_006278	P10646	TFPI1_HUMAN	tissue factor pathway inhibitor isoform a	176					blood coagulation, extrinsic pathway	extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0554)		Coagulation factor VIIa(DB00036)	TACGACCATCTTCACAAATGT	0.343													32	105	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196753118	196753118	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196753118A>T	uc002utj.3	-	33	5371	c.5270T>A	c.(5269-5271)TTA>TAA	p.L1757*		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1757	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TCTCCAGCCTAACATGTGAGG	0.393													19	65	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225661099	225661099	+	Silent	SNP	T	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225661099T>C	uc010fwz.1	-	44	5111	c.4872A>G	c.(4870-4872)GGA>GGG	p.G1624G	DOCK10_uc002vob.2_Silent_p.G1618G|DOCK10_uc002voa.2_Silent_p.G280G|DOCK10_uc002voc.2_Silent_p.G478G	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1624	DHR-2.						GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ACCGAGAGCCTCCAATCCCAG	0.378													2	8	---	---	---	---	PASS
SH3BP4	23677	broad.mit.edu	37	2	235951482	235951482	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235951482G>A	uc002vvp.2	+	4	2462	c.2069G>A	c.(2068-2070)CGG>CAG	p.R690Q	SH3BP4_uc010fym.2_Missense_Mutation_p.R690Q|SH3BP4_uc002vvq.2_Missense_Mutation_p.R690Q	NM_014521	NP_055336	Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	690					endocytosis	clathrin-coated vesicle|coated pit|nucleus	protein binding			skin(3)|ovary(1)	4		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		AGCGAGGAGCGGGTCAGGCTC	0.612													3	73	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238267874	238267874	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238267874C>G	uc002vwl.2	-	19	6614	c.6329G>C	c.(6328-6330)GGA>GCA	p.G2110A	COL6A3_uc002vwo.2_Missense_Mutation_p.G1904A|COL6A3_uc010znj.1_Missense_Mutation_p.G1503A	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2110	Triple-helical region.|Collagen-like 2.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		ACCATCCAGTCCAATTTCTCC	0.408													59	134	---	---	---	---	PASS
SNED1	25992	broad.mit.edu	37	2	241976725	241976725	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241976725C>T	uc002wah.1	+	6	1000	c.1000C>T	c.(1000-1002)CGC>TGC	p.R334C		NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor	334	EGF-like 2.				cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		CAACAGTTTCCGCTGCCAGTG	0.647													4	11	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77695237	77695237	+	3'UTR	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77695237G>A	uc003dpy.3	+	26					ROBO2_uc003dpz.2_3'UTR|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_3'UTR	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AAGCTGCTCTGAAGGACCATC	0.333													16	21	---	---	---	---	PASS
MCM2	4171	broad.mit.edu	37	3	127325478	127325478	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127325478C>A	uc003ejp.2	+	6	976	c.919C>A	c.(919-921)CGC>AGC	p.R307S	MCM2_uc011bkm.1_Missense_Mutation_p.R177S|MCM2_uc010hsl.2_RNA|MCM2_uc011bkn.1_Missense_Mutation_p.R191S	NM_004526	NP_004517	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	307					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding			ovary(3)|skin(1)	4						CCAGCTGATCCGCACCAGTGG	0.602													18	33	---	---	---	---	PASS
MECOM	2122	broad.mit.edu	37	3	168802758	168802758	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168802758C>T	uc003ffi.3	-	16	3364	c.3095G>A	c.(3094-3096)TGG>TAG	p.W1032*	MECOM_uc010hwk.1_3'UTR|MECOM_uc003ffj.3_Nonsense_Mutation_p.W1097*|MECOM_uc011bpi.1_Nonsense_Mutation_p.W1024*|MECOM_uc003ffn.3_Nonsense_Mutation_p.W1032*|MECOM_uc003ffk.2_Nonsense_Mutation_p.W1023*|MECOM_uc003ffl.2_Nonsense_Mutation_p.W1183*|MECOM_uc011bpj.1_Nonsense_Mutation_p.W1220*|MECOM_uc011bpk.1_Nonsense_Mutation_p.W1022*	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	1032					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						CATACTGTGCCACACGTTGGA	0.517													52	78	---	---	---	---	PASS
EIF4G1	1981	broad.mit.edu	37	3	184049133	184049133	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184049133G>C	uc003fnp.2	+	29	4439	c.4241G>C	c.(4240-4242)GGT>GCT	p.G1414A	EIF4G1_uc003fnt.2_Missense_Mutation_p.G1125A|EIF4G1_uc003fnq.2_Missense_Mutation_p.G1327A|EIF4G1_uc003fnr.2_Missense_Mutation_p.G1250A|EIF4G1_uc010hxx.2_Missense_Mutation_p.G1421A|EIF4G1_uc003fns.2_Missense_Mutation_p.G1374A|EIF4G1_uc010hxy.2_Missense_Mutation_p.G1421A|EIF4G1_uc003fnv.3_Missense_Mutation_p.G1415A|EIF4G1_uc003fnu.3_Missense_Mutation_p.G1414A|EIF4G1_uc003fnw.2_Missense_Mutation_p.G1421A|EIF4G1_uc003fnx.2_Missense_Mutation_p.G1219A|EIF4G1_uc003fny.3_Missense_Mutation_p.G1218A|EIF4G1_uc003foa.2_Missense_Mutation_p.G86A	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	1414					insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGGACATTGGTGCATTCGTC	0.517													117	137	---	---	---	---	PASS
C3orf59	151963	broad.mit.edu	37	3	192516184	192516184	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192516184T>A	uc011bsp.1	-	2	1788	c.1467A>T	c.(1465-1467)AAA>AAT	p.K489N		NM_178496	NP_848591	Q8IYB1	M21D2_HUMAN	hypothetical protein LOC151963	489											0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)		CTCAGAAAAATTTGTCATCAA	0.378													44	74	---	---	---	---	PASS
SDHAP2	727956	broad.mit.edu	37	3	195398271	195398271	+	Intron	SNP	A	G	G	rs142433257	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195398271A>G	uc003fuw.2	+						SDHAP2_uc003fuu.3_3'UTR|SDHAP2_uc011btb.1_Intron|SDHAP2_uc011btc.1_Intron|SDHAP2_uc003fuv.2_Intron					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						GTGTGCAGGCACATGTGCACA	0.542													3	14	---	---	---	---	PASS
CD38	952	broad.mit.edu	37	4	15818217	15818217	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15818217A>G	uc011bxc.1	+	2	424	c.317A>G	c.(316-318)TAT>TGT	p.Y106C	CD38_uc003goj.1_Missense_Mutation_p.Y106C|CD38_uc003gol.1_Missense_Mutation_p.Y106C	NM_001775	NP_001766	P28907	CD38_HUMAN	CD38 antigen	106	Extracellular (Potential).				B cell receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of apoptosis|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of transcription, DNA-dependent|response to drug	integral to membrane|plasma membrane	binding|NAD+ nucleosidase activity|receptor activity			ovary(2)	2						GAAGAAGACTATCAGCCACTA	0.408													53	122	---	---	---	---	PASS
CLRN2	645104	broad.mit.edu	37	4	17517125	17517125	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17517125G>A	uc003gpg.1	+	1	338	c.236G>A	c.(235-237)CGC>CAC	p.R79H		NM_001079827	NP_001073296	A0PK11	CLRN2_HUMAN	clarin 2	79						integral to membrane					0						CTTGGGGGCCGCCAATCCCAA	0.488													3	47	---	---	---	---	PASS
OCIAD2	132299	broad.mit.edu	37	4	48887464	48887464	+	3'UTR	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48887464G>A	uc003gyt.2	-	7					OCIAD2_uc003gyu.2_3'UTR	NM_001014446	NP_001014446	Q56VL3	OCAD2_HUMAN	OCIA domain containing 2 isoform 1							endosome					0						TACAAATTCAGAGGTTTAAAA	0.338													108	272	---	---	---	---	PASS
UGT2A1	10941	broad.mit.edu	37	4	70464995	70464995	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70464995A>C	uc003hem.3	-	2	896	c.833T>G	c.(832-834)TTG>TGG	p.L278W	UGT2A1_uc011caq.1_Missense_Mutation_p.L488W|UGT2A1_uc010ihu.2_Missense_Mutation_p.L322W|UGT2A1_uc010iht.2_Missense_Mutation_p.L278W|UGT2A1_uc010ihs.2_Missense_Mutation_p.L279W	NM_006798	NP_006789	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family,	278	Extracellular (Potential).				detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1						TTTGCAGTGCAATCCTCCAAC	0.348													25	66	---	---	---	---	PASS
ANKRD17	26057	broad.mit.edu	37	4	73941870	73941870	+	3'UTR	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73941870G>T	uc003hgp.2	-	34					ANKRD17_uc003hgo.2_3'UTR|ANKRD17_uc003hgq.2_3'UTR|ANKRD17_uc003hgr.2_3'UTR	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a						interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AATGATTTGGGAGCATAATTT	0.403													3	10	---	---	---	---	PASS
SHROOM3	57619	broad.mit.edu	37	4	77677855	77677855	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77677855G>A	uc011cbx.1	+	8	5916	c.4963G>A	c.(4963-4965)GTC>ATC	p.V1655I	SHROOM3_uc003hkg.2_Missense_Mutation_p.V1433I	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein	1655					apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			AGAAAAGAAAGTCAGTCCTGA	0.498													42	89	---	---	---	---	PASS
SCLT1	132320	broad.mit.edu	37	4	129812271	129812271	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129812271T>G	uc003igp.2	-	19	2357	c.1851A>C	c.(1849-1851)AAA>AAC	p.K617N	SCLT1_uc003ign.2_Missense_Mutation_p.K281N|SCLT1_uc003igo.2_Missense_Mutation_p.K227N|SCLT1_uc003igq.2_Missense_Mutation_p.K236N|SCLT1_uc010iob.1_Missense_Mutation_p.K104N	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1	617	Potential.					centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						GGGTATGAAGTTTCTGTCGAC	0.398													35	120	---	---	---	---	PASS
ELF2	1998	broad.mit.edu	37	4	139980658	139980658	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139980658T>C	uc003ihp.1	-	9	1431	c.1225A>G	c.(1225-1227)ACC>GCC	p.T409A	ELF2_uc003ihm.1_Missense_Mutation_p.T361A|ELF2_uc003ihn.1_Missense_Mutation_p.T349A|ELF2_uc003iho.1_Missense_Mutation_p.T332A|ELF2_uc011chc.1_Missense_Mutation_p.T224A	NM_201999	NP_973728	Q15723	ELF2_HUMAN	E74-like factor 2 (ets domain transcription	421					negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2	all_hematologic(180;0.162)					CTAGTGCTGGTTATTAATGGT	0.438													65	147	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160189366	160189366	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160189366C>A	uc003iqg.3	+	1	369	c.59C>A	c.(58-60)TCA>TAA	p.S20*		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	20					cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		GAGAAACACTCAGTAAGTATC	0.398													4	100	---	---	---	---	PASS
SLC12A7	10723	broad.mit.edu	37	5	1073766	1073766	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1073766C>T	uc003jbu.2	-	17	2289	c.2223G>A	c.(2221-2223)GAG>GAA	p.E741E		NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride	741					potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CCCGCTGAGCCTCCATGTGCT	0.687													78	84	---	---	---	---	PASS
C5orf22	55322	broad.mit.edu	37	5	31538683	31538683	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31538683G>T	uc003jhj.3	+	4	821	c.694G>T	c.(694-696)GCT>TCT	p.A232S	C5orf22_uc011cnw.1_RNA|C5orf22_uc003jhk.3_5'UTR	NM_018356	NP_060826	Q49AR2	CE022_HUMAN	hypothetical protein LOC55322	232										ovary(2)	2						ATGCCAGACTGCTGCCAGCAC	0.408													27	81	---	---	---	---	PASS
MCCC2	64087	broad.mit.edu	37	5	70928000	70928000	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70928000A>G	uc003kbs.3	+	8	929	c.791A>G	c.(790-792)GAT>GGT	p.D264G	MCCC2_uc010iyv.1_Missense_Mutation_p.D264G|MCCC2_uc003kbt.3_RNA|MCCC2_uc003kbu.1_Missense_Mutation_p.D133G	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)	264	Carboxyltransferase.				leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	GGAGGTGCTGATCTTCATTGC	0.393													113	169	---	---	---	---	PASS
AFF4	27125	broad.mit.edu	37	5	132228042	132228042	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132228042C>T	uc003kyd.2	-	13	2859	c.2451G>A	c.(2449-2451)GGG>GGA	p.G817G	AFF4_uc011cxk.1_Silent_p.G495G|AFF4_uc003kye.1_Silent_p.G817G	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31	817					transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAGGAACAGGCCCAGCGGGAG	0.448													71	242	---	---	---	---	PASS
GALNT10	55568	broad.mit.edu	37	5	153755895	153755895	+	Silent	SNP	T	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153755895T>G	uc003lvh.2	+	5	759	c.627T>G	c.(625-627)CTT>CTG	p.L209L	GALNT10_uc003lvg.1_Silent_p.L209L|GALNT10_uc010jic.2_RNA|GALNT10_uc010jid.2_Intron	NM_198321	NP_938080	Q86SR1	GLT10_HUMAN	GalNAc transferase 10 isoform a	209	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			TGAGGATTCTTCGAACCAAGA	0.502													139	183	---	---	---	---	PASS
MTCH1	23787	broad.mit.edu	37	6	36938212	36938212	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36938212A>G	uc003ond.1	-	10	992	c.992T>C	c.(991-993)GTT>GCT	p.V331A	MTCH1_uc003onc.1_Missense_Mutation_p.V314A|MTCH1_uc010jwo.1_RNA|MTCH1_uc003one.3_Missense_Mutation_p.V331A|MTCH1_uc011dtt.1_Missense_Mutation_p.V146A	NM_014341	NP_055156	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier homolog 1	331	Helical; (Potential).				activation of caspase activity|neuronal ion channel clustering|positive regulation of apoptosis|regulation of signal transduction|transport	integral to membrane|mitochondrial inner membrane	protein binding				0						GAGGTCGCCAACTAGCAGGAA	0.627													21	71	---	---	---	---	PASS
TRDN	10345	broad.mit.edu	37	6	123545248	123545248	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123545248C>T	uc003pzj.1	-	39	2026	c.2004G>A	c.(2002-2004)AAG>AAA	p.K668K	TRDN_uc010kem.1_Silent_p.K169K	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin	668	Lumenal.				muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		CTTTAGCTTTCTTTGAAGCTG	0.328													29	94	---	---	---	---	PASS
EPB41L2	2037	broad.mit.edu	37	6	131179363	131179363	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131179363C>T	uc003qch.2	-	19	3113	c.2931G>A	c.(2929-2931)AGG>AGA	p.R977R	EPB41L2_uc003qce.1_Silent_p.R355R|EPB41L2_uc003qcf.1_RNA|EPB41L2_uc003qcg.1_Silent_p.R719R|EPB41L2_uc011eby.1_Silent_p.R645R|EPB41L2_uc003qci.2_Silent_p.R824R|EPB41L2_uc010kfk.2_Silent_p.R645R|EPB41L2_uc003qcd.1_Silent_p.R138R	NM_001431	NP_001422	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	977	Carboxyl-terminal (CTD).				cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		CTCTGGCTTCCCTGATCGCCT	0.537													70	215	---	---	---	---	PASS
PPIL4	85313	broad.mit.edu	37	6	149838586	149838586	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149838586C>A	uc003qmo.1	-	11	1013	c.983G>T	c.(982-984)GGT>GTT	p.G328V	PPIL4_uc010kic.2_Intron|PPIL4_uc003qmp.1_Missense_Mutation_p.G328V	NM_139126	NP_624311	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase-like 4	328	Lys-rich.				protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		GTATTTCCCACCTATTTATTA	0.299													24	55	---	---	---	---	PASS
NUPL2	11097	broad.mit.edu	37	7	23240190	23240190	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23240190T>A	uc003svu.2	+	7	1357	c.1098T>A	c.(1096-1098)AAT>AAA	p.N366K	NUPL2_uc003svv.2_RNA|NUPL2_uc003svw.2_Missense_Mutation_p.N243K|NUPL2_uc011jyw.1_RNA|NUPL2_uc003svx.2_Missense_Mutation_p.N243K|NUPL2_uc011jyx.1_Missense_Mutation_p.N138K	NM_007342	NP_031368	O15504	NUPL2_HUMAN	nucleoporin like 2	366	Interaction with GLE1.|Ser-rich.				carbohydrate metabolic process|glucose transport|mRNA transport|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nuclear pore	nuclear export signal receptor activity|nucleic acid binding|zinc ion binding			skin(2)|ovary(1)	3						CTTTTGGAAATAGCAGCATAT	0.463													77	221	---	---	---	---	PASS
NOD1	10392	broad.mit.edu	37	7	30486629	30486629	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30486629A>T	uc003tav.2	-	8	2846	c.2323T>A	c.(2323-2325)TAC>AAC	p.Y775N		NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain	775	LRR 4.				activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						TTGGTGACGTACCTGGCTCCG	0.463													45	115	---	---	---	---	PASS
PSMA2	5683	broad.mit.edu	37	7	42964387	42964387	+	Silent	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42964387C>A	uc003thy.2	-	4	309	c.261G>T	c.(259-261)GTG>GTT	p.V87V	C7orf25_uc010kxr.2_5'UTR|PSMA2_uc010kxt.2_Silent_p.V9V|PSMA2_uc003thz.1_Silent_p.V9V	NM_002787	NP_002778	P25787	PSA2_HUMAN	proteasome subunit alpha type 2	87					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|response to virus|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	protein binding|threonine-type endopeptidase activity	p.V87V(1)		large_intestine(2)|ovary(1)	3						GAGCTCTGTGCACAAGCACTC	0.413													28	121	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	79082436	79082436	+	Silent	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79082436C>A	uc003ugx.2	-	1	455	c.201G>T	c.(199-201)CTG>CTT	p.L67L	MAGI2_uc003ugy.2_Silent_p.L67L|uc010lea.1_5'Flank	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	67	PDZ 1.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CGTTCACCTCCAGCAGCAGCT	0.637													34	66	---	---	---	---	PASS
C7orf63	79846	broad.mit.edu	37	7	89937153	89937153	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89937153C>T	uc010lep.2	+	21	2786	c.2535C>T	c.(2533-2535)AAC>AAT	p.N845N	C7orf63_uc011khj.1_Silent_p.N827N|C7orf63_uc011khk.1_Silent_p.N361N	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1	845							binding			ovary(1)	1						GAACATCAAACGCTAAAACGT	0.343													18	36	---	---	---	---	PASS
FAM71F1	84691	broad.mit.edu	37	7	128355467	128355467	+	5'UTR	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128355467G>T	uc003vno.1	+	1					FAM71F1_uc010llo.1_Intron|FAM71F1_uc011koq.1_Intron|FAM71F1_uc003vnm.1_Intron|FAM71F1_uc003vnn.1_Intron|FAM71F1_uc010llp.1_RNA|FAM71F1_uc003vnp.1_5'UTR	NM_032599	NP_115988	Q96KD3	F71F1_HUMAN	testes development-related NYD-SP18											skin(1)	1						CAGGACAAATGTGCAGCAGGC	0.483													3	51	---	---	---	---	PASS
ACCN3	9311	broad.mit.edu	37	7	150748965	150748965	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150748965C>T	uc003win.2	+	7	1651	c.1283C>T	c.(1282-1284)GCC>GTC	p.A428V	ACCN3_uc003wio.2_Missense_Mutation_p.A428V|ACCN3_uc003wip.2_Missense_Mutation_p.A428V|ACCN3_uc003wiq.2_RNA	NM_004769	NP_004760	Q9UHC3	ACCN3_HUMAN	amiloride-sensitive cation channel 3 isoform a	428	Extracellular (Potential).				sensory perception|signal transduction	cytoplasm|integral to plasma membrane	ligand-gated sodium channel activity			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGAAGAAGGCCTATGAGATG	0.592													32	88	---	---	---	---	PASS
INSIG1	3638	broad.mit.edu	37	7	155094505	155094505	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155094505A>G	uc003wly.2	+	5	964	c.753A>G	c.(751-753)ATA>ATG	p.I251M	INSIG1_uc011kvu.1_Missense_Mutation_p.I99M|INSIG1_uc003wlz.2_Missense_Mutation_p.Y154C	NM_005542	NP_005533	O15503	INSI1_HUMAN	insulin induced gene 1 isoform 1	251	Helical; (Potential).				cell proliferation|ER-nuclear sterol response pathway	endoplasmic reticulum membrane|integral to membrane	protein binding				0	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCCCTTGTATATTTTTCTCAG	0.418													73	202	---	---	---	---	PASS
CDCA2	157313	broad.mit.edu	37	8	25325823	25325823	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25325823C>A	uc003xep.1	+	6	1108	c.629C>A	c.(628-630)TCT>TAT	p.S210Y	PPP2R2A_uc003xek.2_Intron|CDCA2_uc011lae.1_Missense_Mutation_p.S210Y|CDCA2_uc003xeq.1_Missense_Mutation_p.S195Y|CDCA2_uc003xer.1_Translation_Start_Site	NM_152562	NP_689775	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	210					cell division|mitosis	cytoplasm|nucleus					0		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		CAGAGAGACTCTGATGAAAAT	0.443													61	152	---	---	---	---	PASS
IDO2	169355	broad.mit.edu	37	8	39836668	39836668	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39836668G>C	uc010lwy.1	+	4	559	c.317G>C	c.(316-318)GGT>GCT	p.G106A	IDO2_uc003xno.1_RNA|IDO2_uc010lwz.1_5'UTR	NM_194294	NP_919270	Q6ZQW0	I23O2_HUMAN	indoleamine-pyrrole 2,3 dioxygenase-like 1	93					tryptophan catabolic process to kynurenine	cytosol	heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			ovary(2)	2						CTCACCATGGGTTATGTCTGG	0.612													6	7	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41552240	41552240	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41552240A>C	uc003xok.2	-	28	3281	c.3197T>G	c.(3196-3198)ATG>AGG	p.M1066R	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.M382R|ANK1_uc003xoi.2_Missense_Mutation_p.M1066R|ANK1_uc003xoj.2_Missense_Mutation_p.M1066R|ANK1_uc003xol.2_Missense_Mutation_p.M1066R|ANK1_uc003xom.2_Missense_Mutation_p.M1107R	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	1066					axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GAGCCGTGACATGATCACGAA	0.597													18	53	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61761689	61761689	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61761689C>A	uc003xue.2	+	25	5857	c.5380C>A	c.(5380-5382)CTC>ATC	p.L1794I		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1794					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AGACAAATCCCTCTTAATTGG	0.393													55	182	---	---	---	---	PASS
NACAP1	83955	broad.mit.edu	37	8	102381717	102381717	+	3'UTR	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102381717C>T	uc003ykc.1	+	1					NACAP1_uc010mbs.1_RNA	NR_002182				SubName: Full=NACAP1 protein;												0						GGAGCAAAGGCAGTCCGAGCC	0.403													34	95	---	---	---	---	PASS
TSNARE1	203062	broad.mit.edu	37	8	143425602	143425602	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143425602G>T	uc003ywk.2	-	4	588	c.470C>A	c.(469-471)CCC>CAC	p.P157H	TSNARE1_uc011lju.1_Missense_Mutation_p.P157H|TSNARE1_uc003ywj.2_Missense_Mutation_p.P157H|TSNARE1_uc003ywl.3_Intron	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	157					vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CCTGCGAGTGGGCTCGGCCTT	0.652													21	42	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144940732	144940732	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144940732C>T	uc003zaa.1	-	2	14713	c.14700G>A	c.(14698-14700)CTG>CTA	p.L4900L		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	4900	Plectin 61.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGGCGGGCACCAGGACGCCCG	0.687													7	87	---	---	---	---	PASS
DGAT1	8694	broad.mit.edu	37	8	145540325	145540325	+	Silent	SNP	G	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145540325G>C	uc003zbv.3	-	17	1627	c.1359C>G	c.(1357-1359)GGC>GGG	p.G453G	DGAT1_uc010mfv.2_Missense_Mutation_p.Q288E	NM_012079	NP_036211	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	453	Lumenal (Potential).				triglyceride biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane	diacylglycerol O-acyltransferase activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			CAGCTGCGTTGCCATAGTTGC	0.612													4	20	---	---	---	---	PASS
RMI1	80010	broad.mit.edu	37	9	86616068	86616068	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86616068G>T	uc004anq.3	+	3	575	c.167G>T	c.(166-168)TGG>TTG	p.W56L	RMI1_uc004anr.3_Missense_Mutation_p.W56L|RMI1_uc004anp.3_Missense_Mutation_p.W56L|RMI1_uc004ans.3_Missense_Mutation_p.W56L	NM_024945	NP_079221	Q9H9A7	RMI1_HUMAN	RMI1, RecQ mediated genome instability 1,	56					DNA replication	nucleus					0						TTTGAGCAGTGGCTCCTTACT	0.388													54	154	---	---	---	---	PASS
RMI1	80010	broad.mit.edu	37	9	86616070	86616070	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86616070C>T	uc004anq.3	+	3	577	c.169C>T	c.(169-171)CTC>TTC	p.L57F	RMI1_uc004anr.3_Missense_Mutation_p.L57F|RMI1_uc004anp.3_Missense_Mutation_p.L57F|RMI1_uc004ans.3_Missense_Mutation_p.L57F	NM_024945	NP_079221	Q9H9A7	RMI1_HUMAN	RMI1, RecQ mediated genome instability 1,	57					DNA replication	nucleus					0						TGAGCAGTGGCTCCTTACTGA	0.378													55	153	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107651383	107651383	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107651383A>T	uc004bcl.2	-	3	473	c.160T>A	c.(160-162)TGC>AGC	p.C54S	ABCA1_uc004bcm.2_5'UTR	NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	54	Extracellular.				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AGTTACTTACATTCATGTTGT	0.478													18	71	---	---	---	---	PASS
C9orf86	55684	broad.mit.edu	37	9	139722995	139722995	+	Silent	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139722995G>A	uc004cji.1	+	4	631	c.363G>A	c.(361-363)CAG>CAA	p.Q121Q	C9orf86_uc004cjm.2_Silent_p.Q121Q|C9orf86_uc004cjh.2_Silent_p.Q121Q|C9orf86_uc004cjj.1_Silent_p.Q121Q|C9orf86_uc004cjk.1_RNA|C9orf86_uc010nbr.1_Silent_p.Q121Q|C9orf86_uc004cjl.1_RNA|C9orf86_uc010nbs.1_Silent_p.Q6Q|hsa-mir-4292|MI0015897_5'Flank	NM_024718	NP_078994	Q3YEC7	PARF_HUMAN	Rab-like GTP-binding protein 1 isoform 1	121	Small GTPase-like.				small GTPase mediated signal transduction	cytoplasm|nucleus	GTP binding|protein binding				0	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.61e-05)|Epithelial(140;0.000183)		ACGACCCCCAGGAGGTGAGTG	0.572													7	44	---	---	---	---	PASS
MAN1B1	11253	broad.mit.edu	37	9	140002045	140002045	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140002045C>T	uc004cld.2	+	12	1862	c.1827C>T	c.(1825-1827)CGC>CGT	p.R609R	MAN1B1_uc011mep.1_Silent_p.R609R|MAN1B1_uc010ncc.2_RNA|MAN1B1_uc004clf.1_Silent_p.R282R|MAN1B1_uc004clg.1_RNA	NM_016219	NP_057303	Q9UKM7	MA1B1_HUMAN	alpha 1,2-mannosidase	609	Lumenal (Potential).				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|endoplasmic reticulum quality control compartment|integral to membrane	alpha-mannosidase activity|calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(1)|central_nervous_system(1)	2	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		ACCTGTACCGCGTCACAGGGG	0.647													23	100	---	---	---	---	PASS
FBXO18	84893	broad.mit.edu	37	10	5948166	5948166	+	Silent	SNP	T	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5948166T>C	uc001iis.2	+	3	419	c.324T>C	c.(322-324)AGT>AGC	p.S108S	FBXO18_uc001iir.2_Silent_p.S34S|FBXO18_uc009xig.2_Silent_p.S34S|FBXO18_uc001iit.2_Silent_p.S159S	NM_178150	NP_835363	Q8NFZ0	FBX18_HUMAN	F-box only protein, helicase, 18 isoform 2	108					DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(2)|skin(1)	3						AGGAAGGCAGTGCAGGGCCGG	0.612													33	76	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26414398	26414398	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26414398G>A	uc001isn.2	+	19	2335	c.1975G>A	c.(1975-1977)GGA>AGA	p.G659R	MYO3A_uc009xko.1_Missense_Mutation_p.G659R|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	659	Myosin head-like.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						GGTCACTAGAGGAGAAACAAT	0.423													75	149	---	---	---	---	PASS
PARD3	56288	broad.mit.edu	37	10	34671810	34671810	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34671810T>G	uc010qej.1	-	9	1057	c.1057A>C	c.(1057-1059)ATT>CTT	p.I353L	PARD3_uc010qek.1_Missense_Mutation_p.I353L|PARD3_uc010qel.1_Missense_Mutation_p.I353L|PARD3_uc010qem.1_Missense_Mutation_p.I353L|PARD3_uc010qen.1_Missense_Mutation_p.I353L|PARD3_uc010qeo.1_Missense_Mutation_p.I353L|PARD3_uc010qep.1_Missense_Mutation_p.I309L|PARD3_uc010qeq.1_Missense_Mutation_p.I309L|PARD3_uc001ixo.1_Missense_Mutation_p.I83L|PARD3_uc001ixp.1_Missense_Mutation_p.I218L|PARD3_uc001ixq.1_Missense_Mutation_p.I353L|PARD3_uc001ixr.1_Missense_Mutation_p.I353L|PARD3_uc001ixt.1_Missense_Mutation_p.I174L|PARD3_uc001ixu.1_Missense_Mutation_p.I309L|PARD3_uc001ixs.1_Missense_Mutation_p.I6L	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog	353	PDZ 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				TGGAACCAAATGATGGGTGTA	0.398													4	252	---	---	---	---	PASS
GOT1	2805	broad.mit.edu	37	10	101157182	101157182	+	3'UTR	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101157182C>T	uc001kpr.2	-	9					GOT1_uc009xwh.2_RNA|GOT1_uc001kpq.1_3'UTR	NM_002079	NP_002070	P17174	AATC_HUMAN	aspartate aminotransferase 1						aspartate catabolic process|cellular response to insulin stimulus|gluconeogenesis|response to glucocorticoid stimulus	cytosol	L-aspartate:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding				0		Ovarian(717;0.028)|Colorectal(252;0.234)		Epithelial(162;4.76e-10)|all cancers(201;3.84e-08)	L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	GGctgcctcaccagagcagcc	0.318													28	74	---	---	---	---	PASS
PPRC1	23082	broad.mit.edu	37	10	103899302	103899302	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103899302T>A	uc001kum.2	+	5	1076	c.1037T>A	c.(1036-1038)CTG>CAG	p.L346Q	PPRC1_uc001kun.2_Missense_Mutation_p.L226Q|PPRC1_uc010qqj.1_Missense_Mutation_p.L346Q|PPRC1_uc009xxa.2_RNA	NM_015062	NP_055877	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor	346					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		TGCGTAGTGCTGGAGATTGTG	0.607													41	119	---	---	---	---	PASS
RRP8	23378	broad.mit.edu	37	11	6621253	6621253	+	3'UTR	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6621253C>T	uc001med.2	-	7						NM_015324	NP_056139	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase,						chromatin modification|chromatin silencing at rDNA|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	methylated histone residue binding|S-adenosylmethionine-dependent methyltransferase activity				0						GAGGTTTTATCACACTTTGTC	0.473													12	27	---	---	---	---	PASS
ST5	6764	broad.mit.edu	37	11	8728751	8728751	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8728751G>A	uc001mgt.2	-	13	2638	c.2452C>T	c.(2452-2454)CGG>TGG	p.R818W	ST5_uc009yfr.2_Missense_Mutation_p.R398W|ST5_uc001mgu.2_Missense_Mutation_p.R398W|ST5_uc001mgv.2_Missense_Mutation_p.R818W|ST5_uc010rbq.1_RNA|ST5_uc010rbp.1_Missense_Mutation_p.R331W|ST5_uc009yfs.2_RNA	NM_213618	NP_998783	P78524	ST5_HUMAN	suppression of tumorigenicity 5 isoform 1	818	DENN.				positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		ATCCCACGCCGGCGCTCCACC	0.602													4	62	---	---	---	---	PASS
SLC22A10	387775	broad.mit.edu	37	11	63059039	63059039	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63059039C>A	uc009yor.2	+	2	638	c.430C>A	c.(430-432)CTG>ATG	p.L144M	SLC22A10_uc010rmo.1_Intron|SLC22A10_uc001nwu.3_RNA|SLC22A10_uc010rmp.1_Missense_Mutation_p.L92M	NM_001039752	NP_001034841	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	144	Extracellular (Potential).					integral to membrane	transmembrane transporter activity			ovary(2)	2						TTATCAGTCACTGAAATCAGT	0.468													18	114	---	---	---	---	PASS
RCOR2	283248	broad.mit.edu	37	11	63682222	63682222	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63682222T>C	uc001nyc.2	-	5	773	c.385A>G	c.(385-387)ACC>GCC	p.T129A		NM_173587	NP_775858	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	129	ELM2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)|skin(1)	2						GGGAATGGGGTGAAGTTGGCC	0.587													88	259	---	---	---	---	PASS
PRDX5	25824	broad.mit.edu	37	11	64088367	64088367	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64088367T>G	uc001nzu.2	+	4	588	c.469T>G	c.(469-471)TTT>GTT	p.F157V	PRDX5_uc001nzv.2_Missense_Mutation_p.F113V|PRDX5_uc001nzw.2_Missense_Mutation_p.F68V|PRDX5_uc001nzx.2_RNA	NM_012094	NP_036226	P30044	PRDX5_HUMAN	peroxiredoxin 5 isoform a precursor	157	Thioredoxin.		F -> L (in a breast cancer sample; somatic mutation).		cell redox homeostasis|cellular response to reactive oxygen species|inflammatory response|negative regulation of apoptosis	cytosolic part|mitochondrion|peroxisome	caspase inhibitor activity|peroxidase activity|peroxiredoxin activity	p.F157L(1)		breast(1)	1					Auranofin(DB00995)	CACTGGGGCCTTTGGGAAGGT	0.577													71	205	---	---	---	---	PASS
CCDC88B	283234	broad.mit.edu	37	11	64111946	64111946	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64111946G>T	uc001nzy.2	+	14	1977	c.1933G>T	c.(1933-1935)GGC>TGC	p.G645C	CCDC88B_uc009ypo.1_Missense_Mutation_p.G642C|CCDC88B_uc001nzz.1_Missense_Mutation_p.G294C	NM_032251	NP_115627	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88	645					microtubule cytoskeleton organization	cytoplasm	microtubule binding			ovary(3)|skin(1)	4						GAGACAGGAGGGCCCTGAGCA	0.652													8	27	---	---	---	---	PASS
MMP12	4321	broad.mit.edu	37	11	102742668	102742668	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102742668G>C	uc001phk.2	-	3	410	c.365C>G	c.(364-366)ACA>AGA	p.T122R		NM_002426	NP_002417	P39900	MMP12_HUMAN	matrix metalloproteinase 12 preproprotein	122					positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)	CATGTCAGGTGTGTAATTATT	0.378													24	47	---	---	---	---	PASS
ZW10	9183	broad.mit.edu	37	11	113607443	113607443	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113607443G>T	uc001poe.2	-	15	2155	c.2118C>A	c.(2116-2118)AAC>AAA	p.N706K	ZW10_uc009yyv.2_RNA	NM_004724	NP_004715	O43264	ZW10_HUMAN	centromere/kinetochore protein zw10	706					cell division|ER to Golgi vesicle-mediated transport|establishment of mitotic spindle orientation|meiosis|mitotic cell cycle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|protein complex assembly|protein localization to kinetochore|protein transport|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|endoplasmic reticulum membrane|kinetochore microtubule|nucleus|spindle pole	centromeric DNA binding|protein binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		GATATTTCTTGTTCTTGCTTT	0.393													117	361	---	---	---	---	PASS
NINJ2	4815	broad.mit.edu	37	12	675059	675059	+	Intron	SNP	T	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:675059T>C	uc001qil.2	-						NINJ2_uc010sdr.1_Missense_Mutation_p.R71G|NINJ2_uc010sds.1_Missense_Mutation_p.R153G	NM_016533	NP_057617	Q9NZG7	NINJ2_HUMAN	ninjurin 2						nervous system development|neuron cell-cell adhesion|tissue regeneration	integral to plasma membrane				ovary(2)	2	all_cancers(10;0.0101)|all_epithelial(11;0.0174)|Ovarian(42;0.0512)|all_lung(10;0.103)|Lung NSC(10;0.185)		OV - Ovarian serous cystadenocarcinoma(31;3.26e-05)|BRCA - Breast invasive adenocarcinoma(9;0.0508)			ACGTGGGGCCTTTCTGCCAGC	0.637													17	12	---	---	---	---	PASS
SCNN1A	6337	broad.mit.edu	37	12	6471375	6471375	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6471375C>T	uc001qnx.2	-	4	1006	c.717G>A	c.(715-717)CAG>CAA	p.Q239Q	SCNN1A_uc001qnv.2_5'UTR|SCNN1A_uc001qnw.2_Silent_p.Q298Q|SCNN1A_uc010sfb.1_Silent_p.Q262Q	NM_001038	NP_001029	P37088	SCNNA_HUMAN	sodium channel, nonvoltage-gated 1 alpha isoform	239	Extracellular (By similarity).				excretion|response to stimulus|sensory perception of taste	apical plasma membrane	WW domain binding				0					Amiloride(DB00594)|Triamterene(DB00384)	ATGAGTATGTCTGGTAGAAGC	0.587													8	233	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	9000255	9000255	+	Silent	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9000255C>A	uc001quz.3	+	15	1892	c.1794C>A	c.(1792-1794)GTC>GTA	p.V598V	A2ML1_uc001qva.1_Silent_p.V178V|A2ML1_uc010sgm.1_Silent_p.V98V	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor	442						extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						ATGAGAGTGTCTTACTGCTTA	0.587													98	164	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9316306	9316306	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9316306C>G	uc001qvl.2	-	21	2723	c.2694G>C	c.(2692-2694)GAG>GAC	p.E898D	PZP_uc009zgl.2_Intron|PZP_uc010sgo.1_RNA|PZP_uc009zgm.1_Intron	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						TTCTTTTAATCTCAGGGACCT	0.433													74	126	---	---	---	---	PASS
PLBD1	79887	broad.mit.edu	37	12	14689601	14689601	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14689601T>A	uc001rcc.1	-	5	763	c.602A>T	c.(601-603)GAT>GTT	p.D201V		NM_024829	NP_079105	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	201					lipid catabolic process	extracellular region	hydrolase activity				0						ATCCAATAGATCTCCAACACT	0.438													53	206	---	---	---	---	PASS
ACVR1B	91	broad.mit.edu	37	12	52374824	52374824	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52374824T>A	uc001rzn.2	+	4	694	c.652T>A	c.(652-654)TTT>ATT	p.F218I	ACVR1B_uc001rzl.2_Missense_Mutation_p.F218I|ACVR1B_uc001rzm.2_Missense_Mutation_p.F218I|ACVR1B_uc010snn.1_Missense_Mutation_p.F218I	NM_004302	NP_004293	P36896	ACV1B_HUMAN	activin A receptor, type IB isoform a precursor	218	ATP (By similarity).|Protein kinase.|Cytoplasmic (Potential).				G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|peptidyl-threonine phosphorylation|positive regulation of activin receptor signaling pathway|positive regulation of erythrocyte differentiation|protein autophosphorylation|transmembrane receptor protein serine/threonine kinase signaling pathway	cell surface	activin receptor activity, type I|ATP binding|metal ion binding|SMAD binding|transforming growth factor beta receptor activity|ubiquitin protein ligase binding			pancreas(4)|breast(2)|ovary(1)|lung(1)|kidney(1)	9				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	CAAGGGTCGGTTTGGGGAAGT	0.507											OREG0021829	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	47	57	---	---	---	---	PASS
KRT74	121391	broad.mit.edu	37	12	52967395	52967395	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52967395T>A	uc001sap.1	-	1	215	c.167A>T	c.(166-168)AAT>ATT	p.N56I		NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN	keratin 6 irs4	56	Head.|Gly-rich.					keratin filament	structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.191)		AATACGCCGATTCCCTCCAAG	0.622													9	34	---	---	---	---	PASS
KRT74	121391	broad.mit.edu	37	12	52967397	52967397	+	Silent	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52967397C>A	uc001sap.1	-	1	213	c.165G>T	c.(163-165)GGG>GGT	p.G55G		NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN	keratin 6 irs4	55	Head.|Gly-rich.					keratin filament	structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.191)		TACGCCGATTCCCTCCAAGGC	0.627													9	37	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53453510	53453510	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53453510G>C	uc001sbp.2	+	18	2220	c.2085G>C	c.(2083-2085)GAG>GAC	p.E695D	TENC1_uc001sbl.2_Missense_Mutation_p.E571D|TENC1_uc001sbn.2_Missense_Mutation_p.E705D|TENC1_uc001sbq.2_Missense_Mutation_p.E190D|TENC1_uc001sbr.2_RNA|TENC1_uc009zmr.2_Missense_Mutation_p.E190D|TENC1_uc001sbs.2_5'Flank	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase	695					intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding			ovary(1)|pancreas(1)	2						CCTGCGAGGAGAAGCTGGCGC	0.662													21	33	---	---	---	---	PASS
PRR13	54458	broad.mit.edu	37	12	53837461	53837461	+	Silent	SNP	A	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53837461A>G	uc001scz.3	+	3	470	c.306A>G	c.(304-306)GCA>GCG	p.A102A	PRR13_uc001scy.3_Silent_p.A52A|PCBP2_uc010soh.1_5'UTR|PRR13_uc001sda.3_Silent_p.A102A	NM_018457	NP_060927	Q9NZ81	PRR13_HUMAN	proline rich 13 isoform 1	102					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						TTGGACCAGCAGTGATAGTAG	0.433													23	75	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78573446	78573446	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78573446C>T	uc001syp.2	+	29	5674	c.5501C>T	c.(5500-5502)GCC>GTC	p.A1834V	NAV3_uc001syo.2_Missense_Mutation_p.A1812V|NAV3_uc010sub.1_Missense_Mutation_p.A1291V|NAV3_uc009zsf.2_Missense_Mutation_p.A643V	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1834	Potential.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						ATCCGGGAAGCCATGAACCGG	0.433										HNSCC(70;0.22)			4	152	---	---	---	---	PASS
LTA4H	4048	broad.mit.edu	37	12	96421288	96421288	+	Silent	SNP	A	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96421288A>G	uc001ten.1	-	3	413	c.345T>C	c.(343-345)GCT>GCC	p.A115A	LTA4H_uc010suy.1_Silent_p.A77A|LTA4H_uc010suz.1_Silent_p.A77A|LTA4H_uc010sva.1_Intron	NM_000895	NP_000886	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase	115					hormone biosynthetic process|inflammatory response|leukotriene biosynthetic process|peptide catabolic process|prostanoid metabolic process|proteolysis	cytosol|nucleus	aminopeptidase activity|epoxide hydrolase activity|leukotriene-A4 hydrolase activity|metallopeptidase activity|protein binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(1)	1						GCCACTGGAGAGCAGAAGATT	0.373													40	152	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20567391	20567391	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20567391T>A	uc001umr.2	+	4	477	c.179T>A	c.(178-180)GTT>GAT	p.V60D	ZMYM2_uc001umq.2_Missense_Mutation_p.V60D|ZMYM2_uc001ums.2_Missense_Mutation_p.V60D|ZMYM2_uc001umt.2_Missense_Mutation_p.V60D|ZMYM2_uc009zzn.1_Missense_Mutation_p.V82D	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	60					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		GATGATGATGTTGTTTTTATC	0.383													30	106	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76431981	76431981	+	Intron	SNP	T	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76431981T>C	uc001vjv.2	+						LMO7_uc010thv.1_Intron|LMO7_uc010thw.1_Intron|LMO7_uc001vjx.1_RNA	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		GAGTGATGACTGCTATGTATC	0.463													9	34	---	---	---	---	PASS
GRTP1	79774	broad.mit.edu	37	13	114018185	114018185	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114018185C>A	uc001vtn.2	-	2	170	c.73G>T	c.(73-75)GAC>TAC	p.D25Y	GRTP1_uc010tkc.1_Missense_Mutation_p.D25Y|GRTP1_uc010agv.1_RNA	NM_024719	NP_078995	Q5TC63	GRTP1_HUMAN	growth hormone regulated TBC protein 1	25						intracellular	Rab GTPase activator activity				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0314)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0978)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			TAGGCGGCGTCGTCGAAGTCC	0.622													4	21	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23872974	23872974	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23872974C>T	uc001wjv.2	-	9	816	c.749G>A	c.(748-750)AGG>AAG	p.R250K	MYH6_uc010akp.1_Missense_Mutation_p.R250K	NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	250	Myosin head-like.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		AAAGTGGATCCTAATGAATTT	0.577													7	13	---	---	---	---	PASS
SIX6	4990	broad.mit.edu	37	14	60977812	60977812	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60977812C>G	uc001xfa.3	+	2	762	c.583C>G	c.(583-585)CAG>GAG	p.Q195E		NM_007374	NP_031400	O95475	SIX6_HUMAN	SIX homeobox 6	195					organ morphogenesis|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.088)		ACTCCAGCAGCAGGTCCTGTC	0.711													10	21	---	---	---	---	PASS
ZFP36L1	677	broad.mit.edu	37	14	69259632	69259632	+	Silent	SNP	G	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69259632G>C	uc001xkh.1	-	1	154	c.24C>G	c.(22-24)GCC>GCG	p.A8A	ZFP36L1_uc001xki.1_Silent_p.A8A	NM_004926	NP_004917	Q07352	TISB_HUMAN	butyrate response factor 1	8					regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CGAAGATGGTGGCAGACACGA	0.557													5	223	---	---	---	---	PASS
ENTPD5	957	broad.mit.edu	37	14	74454758	74454758	+	Silent	SNP	A	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74454758A>G	uc010tuo.1	-	4	359	c.48T>C	c.(46-48)TGT>TGC	p.C16C	ENTPD5_uc001xpi.2_Silent_p.C16C	NM_001249	NP_001240	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5	16					'de novo' posttranslational protein folding|ATP metabolic process|cell growth|cell proliferation|glycolysis|protein N-linked glycosylation|regulation of phosphatidylinositol 3-kinase cascade	endoplasmic reticulum lumen	guanosine-diphosphatase activity|uridine-diphosphatase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00394)		CGCTGCAAACACAGGATACCA	0.522													8	36	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105416511	105416511	+	Silent	SNP	G	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105416511G>C	uc010axc.1	-	7	5397	c.5277C>G	c.(5275-5277)CCC>CCG	p.P1759P	AHNAK2_uc001ypx.2_Silent_p.P1659P	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1759						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CGTCCATCTGGGGGCCCTTGA	0.667													92	75	---	---	---	---	PASS
MTA1	9112	broad.mit.edu	37	14	105930474	105930474	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105930474G>C	uc001yqx.2	+	13	1369	c.1182G>C	c.(1180-1182)GAG>GAC	p.E394D	MTA1_uc001yqy.2_RNA|MTA1_uc001yrb.2_Missense_Mutation_p.E155D	NM_004689	NP_004680	Q13330	MTA1_HUMAN	metastasis associated protein	394	GATA-type; atypical.				signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		GGGCCTGCGAGAGCTGTTACA	0.692													11	37	---	---	---	---	PASS
CORO2B	10391	broad.mit.edu	37	15	69006921	69006921	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69006921C>T	uc002arj.3	+	7	818	c.789C>T	c.(787-789)ATC>ATT	p.I263I	CORO2B_uc010bic.2_Silent_p.I258I|CORO2B_uc002ark.2_Silent_p.I30I	NM_006091	NP_006082	Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	263	WD 4.				actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding			ovary(3)|skin(2)|large_intestine(1)	6						TGCCCCTGATCGAAGAGGAAA	0.577													6	252	---	---	---	---	PASS
PSMA4	5685	broad.mit.edu	37	15	78838990	78838990	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78838990T>G	uc002bdu.3	+	8	739	c.581T>G	c.(580-582)ATC>AGC	p.I194S	PSMA4_uc010blf.2_Missense_Mutation_p.I194S|PSMA4_uc002bdv.3_Missense_Mutation_p.I123S|PSMA4_uc002bdw.3_Missense_Mutation_p.I170S|PSMA4_uc002bdx.3_Missense_Mutation_p.I123S	NM_002789	NP_002780	P25789	PSA4_HUMAN	proteasome alpha 4 subunit isoform 1	194					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	identical protein binding|threonine-type endopeptidase activity				0						GCTTTAGCTATCAAAGTACTA	0.348													24	150	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85360311	85360311	+	Silent	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85360311G>T	uc002ble.2	+	1	401	c.234G>T	c.(232-234)GGG>GGT	p.G78G		NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	78					heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CGGGTCCCGGGAGCTCCACGA	0.726													3	5	---	---	---	---	PASS
PRC1	9055	broad.mit.edu	37	15	91517903	91517903	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91517903A>T	uc002bqm.2	-	10	1419	c.1262T>A	c.(1261-1263)TTT>TAT	p.F421Y	PRC1_uc002bqn.2_Missense_Mutation_p.F421Y|PRC1_uc002bqo.2_Missense_Mutation_p.F421Y|PRC1_uc010uqs.1_Missense_Mutation_p.F380Y	NM_003981	NP_003972	O43663	PRC1_HUMAN	protein regulator of cytokinesis 1 isoform 1	421	Potential.|Spectrin-fold.				cytokinesis|mitotic spindle elongation	cytoplasm|nucleus|spindle microtubule|spindle pole	protein binding			ovary(1)|skin(1)	2	Lung NSC(78;0.0987)|all_lung(78;0.175)					ATTCACCATAAATGCCTTTGA	0.423													160	462	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102515335	102515335	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102515335C>G	uc002cdi.2	+	9	1979	c.559C>G	c.(559-561)CTG>GTG	p.L187V	WASH3P_uc002cdl.2_Missense_Mutation_p.L187V|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.L187V|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						GGAGCGAAAGCTGGAGAAGAA	0.652													4	7	---	---	---	---	PASS
TSC2	7249	broad.mit.edu	37	16	2115579	2115579	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2115579C>T	uc002con.2	+	16	1765	c.1659C>T	c.(1657-1659)TAC>TAT	p.Y553Y	TSC2_uc010bsd.2_Silent_p.Y553Y|TSC2_uc002coo.2_Silent_p.Y553Y|TSC2_uc010uvv.1_Silent_p.Y516Y|TSC2_uc010uvw.1_Silent_p.Y504Y|TSC2_uc002cop.2_Silent_p.Y353Y	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1	553					cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				TGGCCGCATACTCGGCCTCCT	0.622			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				78	190	---	---	---	---	PASS
CPPED1	55313	broad.mit.edu	37	16	12758696	12758696	+	3'UTR	SNP	A	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12758696A>C	uc002dca.3	-	4					CPPED1_uc002dcb.3_3'UTR|CPPED1_uc002dbz.3_RNA	NM_018340	NP_060810	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain								hydrolase activity|metal ion binding				0						TTCTGGCAAAATAAAAAAATA	0.398													25	57	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27659969	27659969	+	Silent	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27659969C>A	uc002dow.2	+	6	477	c.453C>A	c.(451-453)ATC>ATA	p.I151I	KIAA0556_uc002dox.1_Silent_p.I16I	NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	151										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						GGCTCCACATCGAACCTCCTG	0.498													3	105	---	---	---	---	PASS
ABCC11	85320	broad.mit.edu	37	16	48256589	48256589	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48256589T>A	uc002eff.1	-	5	1047	c.697A>T	c.(697-699)AGG>TGG	p.R233W	ABCC11_uc002efg.1_Missense_Mutation_p.R233W|ABCC11_uc002efh.1_Missense_Mutation_p.R233W|ABCC11_uc010vgl.1_Missense_Mutation_p.R233W	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	233	ABC transmembrane type-1 1.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				GCTCGGAACCTGATGGCTGTG	0.493									Cerumen_Type				38	69	---	---	---	---	PASS
NLRC5	84166	broad.mit.edu	37	16	57104485	57104485	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57104485C>G	uc002ekk.1	+	38	4847	c.4622C>G	c.(4621-4623)GCG>GGG	p.A1541G	NLRC5_uc010ccr.1_RNA|NLRC5_uc010ccs.1_RNA|NLRC5_uc002eko.1_RNA|NLRC5_uc002ekq.1_Missense_Mutation_p.A83G|NLRC5_uc002ekr.1_Missense_Mutation_p.A428G	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	1541	LRR 17.				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				GGCACCAAGGCGCTGATGAGG	0.453													48	160	---	---	---	---	PASS
PLA2G15	23659	broad.mit.edu	37	16	68283194	68283194	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68283194C>T	uc002evr.2	+	2	212	c.129C>T	c.(127-129)GTC>GTT	p.V43V	PLA2G15_uc010vld.1_Silent_p.V43V|PLA2G15_uc010vle.1_Intron|PLA2G15_uc010vlf.1_Intron	NM_012320	NP_036452	Q8NCC3	PAG15_HUMAN	lysophospholipase 3 (lysosomal phospholipase A2)	43					fatty acid catabolic process	extracellular region|lysosome	lysophospholipase activity|phosphatidylcholine-sterol O-acyltransferase activity|phospholipid binding			ovary(1)	1						CCCCTGCAGTCCCTGGTGATT	0.557													13	31	---	---	---	---	PASS
PRMT7	54496	broad.mit.edu	37	16	68391104	68391104	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68391104A>G	uc002evy.1	+	19	2332	c.2056A>G	c.(2056-2058)AGG>GGG	p.R686G	PRMT7_uc010vlg.1_Missense_Mutation_p.R636G|PRMT7_uc002evz.1_Missense_Mutation_p.R458G	NM_019023	NP_061896	Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	686					cell differentiation|DNA methylation involved in gamete generation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	[myelin basic protein]-arginine N-methyltransferase activity|histone methyltransferase activity (H4-R3 specific)|protein-arginine omega-N monomethyltransferase activity|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		CATGGAGTTCAGGCATGCAGA	0.587													3	139	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161926	90161926	+	3'UTR	SNP	T	C	C	rs8061283	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161926T>C	uc002fqp.2	+	3					uc002fqq.2_3'UTR					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		CCCACACCCATCTATGGTGAC	0.527													4	50	---	---	---	---	PASS
PIGL	9487	broad.mit.edu	37	17	16120578	16120578	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16120578T>C	uc002gpv.2	+	1	70	c.38T>C	c.(37-39)GTC>GCC	p.V13A	NCOR1_uc002gpo.2_5'Flank|PIGL_uc010vwd.1_Missense_Mutation_p.V13A|NCOR1_uc002gps.1_5'Flank|NCOR1_uc010coz.1_5'Flank|NCOR1_uc010cpb.1_5'Flank|NCOR1_uc010cpa.1_5'Flank|NCOR1_uc002gpu.2_5'Flank	NM_004278	NP_004269	Q9Y2B2	PIGL_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	13	Helical; (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	N-acetylglucosaminylphosphatidylinositol deacetylase activity				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0934)		GCGTTGGCGGTCTTGGCATGG	0.617													10	39	---	---	---	---	PASS
THRA	7067	broad.mit.edu	37	17	38243108	38243108	+	Splice_Site	SNP	T	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38243108T>A	uc002htw.2	+	7	1206	c.723_splice	c.e7+2	p.E241_splice	THRA_uc010cwp.1_Splice_Site_p.E241_splice|THRA_uc002htv.2_Splice_Site_p.E241_splice|THRA_uc002htx.2_Splice_Site_p.E241_splice	NM_003250	NP_003241	P10827	THA_HUMAN	thyroid hormone receptor, alpha isoform 2						negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|negative regulation of transcription initiation, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription from RNA polymerase II promoter	cytosol|nucleoplasm	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|TBP-class protein binding|thyroid hormone binding|thyroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding				0	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Levothyroxine(DB00451)|Liothyronine(DB00279)	TTCTCCGAGGTGAGTGGCAGA	0.567											OREG0024390	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	37	95	---	---	---	---	PASS
STAT3	6774	broad.mit.edu	37	17	40476790	40476790	+	Silent	SNP	G	A	A	rs1064115		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40476790G>A	uc002hzl.1	-	17	1779	c.1539C>T	c.(1537-1539)TCC>TCT	p.S513S	STAT3_uc002hzk.1_Silent_p.S513S|STAT3_uc002hzm.1_Silent_p.S513S|STAT3_uc010wgh.1_Silent_p.S415S|STAT3_uc002hzn.1_Silent_p.S513S	NM_139276	NP_644805	P40763	STAT3_HUMAN	signal transducer and activator of transcription	513					cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		TGGTGGTGGAGGAGAACTGCC	0.542									Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome				22	98	---	---	---	---	PASS
FMNL1	752	broad.mit.edu	37	17	43318890	43318890	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43318890C>A	uc002iin.2	+	14	1674	c.1474C>A	c.(1474-1476)CTG>ATG	p.L492M	FMNL1_uc002iiq.2_Missense_Mutation_p.L70M|FMNL1_uc010dag.2_5'Flank	NM_005892	NP_005883	O95466	FMNL_HUMAN	formin-like 1	492	Pro-rich.				actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1						AATCCGTATTCTGCGGGGGCC	0.692													5	7	---	---	---	---	PASS
SAMD14	201191	broad.mit.edu	37	17	48191795	48191795	+	Intron	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48191795G>T	uc002iqg.2	-						SAMD14_uc002iqd.2_Intron|SAMD14_uc002iqe.2_Intron|SAMD14_uc002iqf.2_Missense_Mutation_p.L278M	NM_174920	NP_777580	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14												0						GCATGAGCCAGGAGCTGGGCC	0.587													10	28	---	---	---	---	PASS
BPTF	2186	broad.mit.edu	37	17	65909128	65909128	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65909128A>T	uc002jgf.2	+	11	5189	c.5128A>T	c.(5128-5130)AAA>TAA	p.K1710*	BPTF_uc002jge.2_Nonsense_Mutation_p.K1836*	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1836					brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			ATCCTATAGAAAATTTGTTAC	0.403													70	125	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31311969	31311969	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31311969C>G	uc010dmg.1	+	9	972	c.917C>G	c.(916-918)GCT>GGT	p.A306G	ASXL3_uc002kxq.2_Missense_Mutation_p.A13G	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	306					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						AGTACTTCAGCTCTAAATAAT	0.373													47	129	---	---	---	---	PASS
CELF4	56853	broad.mit.edu	37	18	34833794	34833794	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34833794C>G	uc002lae.2	-	12	1837	c.1441G>C	c.(1441-1443)GAC>CAC	p.D481H	CELF4_uc010dnd.1_Missense_Mutation_p.D479H|CELF4_uc002lag.2_Missense_Mutation_p.D443H|CELF4_uc002laf.2_Missense_Mutation_p.D475H	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1	481					embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						CGATTGGCGTCTTTGGGCCGC	0.587													26	85	---	---	---	---	PASS
ZNF77	58492	broad.mit.edu	37	19	2934740	2934740	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2934740G>C	uc002lws.3	-	4	516	c.385C>G	c.(385-387)CTT>GTT	p.L129V		NM_021217	NP_067040	Q15935	ZNF77_HUMAN	zinc finger protein 77	129					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCACAAGAAGGTTCGCAGTC	0.493													73	220	---	---	---	---	PASS
SLC1A6	6511	broad.mit.edu	37	19	15072683	15072683	+	Intron	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15072683G>A	uc002naa.1	-						SLC1A6_uc010dzu.1_Intron|SLC1A6_uc010xod.1_Intron|SLC1A6_uc002nab.2_3'UTR|SLC1A6_uc002nac.2_3'UTR	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity						synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)	atgagttggtgagtgggtaag	0.199													5	12	---	---	---	---	PASS
CHERP	10523	broad.mit.edu	37	19	16634081	16634081	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16634081G>T	uc002nei.1	-	11	1836	c.1762C>A	c.(1762-1764)CAC>AAC	p.H588N	MED26_uc002nee.2_Intron|CHERP_uc010xpg.1_Missense_Mutation_p.H127N	NM_006387	NP_006378	Q8IWX8	CHERP_HUMAN	calcium homeostasis endoplasmic reticulum	588	Pro-rich.				cellular calcium ion homeostasis|negative regulation of cell proliferation|nervous system development|RNA processing	endoplasmic reticulum|perinuclear region of cytoplasm	RNA binding			ovary(2)	2						TGGCCAGGGTGGTGGTGAGGG	0.652													33	97	---	---	---	---	PASS
USHBP1	83878	broad.mit.edu	37	19	17373702	17373702	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17373702C>T	uc002nfs.1	-	4	414	c.301G>A	c.(301-303)GCA>ACA	p.A101T	USHBP1_uc002nft.1_RNA|USHBP1_uc010xpk.1_Missense_Mutation_p.A37T|USHBP1_uc010eam.1_Missense_Mutation_p.A29T	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1	101							PDZ domain binding			ovary(1)	1						TGTAGGGCTGCTTCTGGGGCT	0.632													6	220	---	---	---	---	PASS
ZNF780B	163131	broad.mit.edu	37	19	40540684	40540684	+	Silent	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40540684C>T	uc002omu.2	-	5	2147	c.2082G>A	c.(2080-2082)GCG>GCA	p.A694A	ZNF780B_uc002omv.2_Silent_p.A546A	NM_001005851	NP_001005851	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	694					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CAAAGGGTTTCGCACTGGAAT	0.388													5	248	---	---	---	---	PASS
NUP62	23636	broad.mit.edu	37	19	50413125	50413125	+	5'UTR	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50413125C>A	uc002pqx.2	-	2					IL4I1_uc002pqv.1_Intron|IL4I1_uc010eno.1_Intron|IL4I1_uc002pqw.1_Intron|IL4I1_uc002pqu.1_Intron|NUP62_uc002pqy.2_5'UTR|NUP62_uc002pqz.2_5'UTR|NUP62_uc002pra.2_5'UTR|NUP62_uc002prb.2_5'UTR|NUP62_uc002prc.2_5'UTR	NM_153719	NP_714941	P37198	NUP62_HUMAN	nucleoporin 62kDa						carbohydrate metabolic process|cell death|cell surface receptor linked signaling pathway|glucose transport|hormone-mediated signaling pathway|mRNA transport|negative regulation of apoptosis|negative regulation of cell proliferation|nucleocytoplasmic transport|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|protein transport|regulation of glucose transport|transcription, DNA-dependent|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleocytoplasmic shuttling complex|ribonucleoprotein complex|spindle pole	chromatin binding|protein serine/threonine kinase activity|receptor signaling complex scaffold activity|SH2 domain binding|structural constituent of nuclear pore|thyroid hormone receptor binding|ubiquitin binding				0		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TCGGTGTCTGCAGCCTTGGGA	0.552													5	20	---	---	---	---	PASS
ZNF160	90338	broad.mit.edu	37	19	53572495	53572495	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53572495C>T	uc010eqk.2	-	7	1708	c.1292G>A	c.(1291-1293)GGC>GAC	p.G431D	ZNF160_uc002qaq.3_Missense_Mutation_p.G431D|ZNF160_uc002qar.3_Missense_Mutation_p.G431D	NM_001102603	NP_001096073	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	431	C2H2-type 7.				hemopoiesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(134;0.02)		AAAGACTTTGCCACATTCATT	0.423													5	313	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3677901	3677901	+	Silent	SNP	G	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3677901G>C	uc002wja.2	-	9	2211	c.2211C>G	c.(2209-2211)GGC>GGG	p.G737G	SIGLEC1_uc002wiz.3_Silent_p.G737G	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	737	Ig-like C2-type 7.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						TAGCAGGGCTGCCAGCAGCTT	0.617													28	62	---	---	---	---	PASS
HCK	3055	broad.mit.edu	37	20	30671834	30671834	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30671834G>A	uc002wxh.2	+	7	841	c.670G>A	c.(670-672)GAC>AAC	p.D224N	HCK_uc010gdy.2_Missense_Mutation_p.D203N|HCK_uc002wxi.2_Missense_Mutation_p.D202N	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK	224	SH2.				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GGAGCTGGTGGACCACTACAA	0.597													27	69	---	---	---	---	PASS
MAP1LC3A	84557	broad.mit.edu	37	20	33147238	33147238	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33147238G>T	uc002xaq.1	+	3	338	c.184G>T	c.(184-186)GAG>TAG	p.E62*	MAP1LC3A_uc002xap.1_Nonsense_Mutation_p.E66*	NM_032514	NP_115903	Q9H492	MLP3A_HUMAN	microtubule-associated protein 1 light chain 3	62					autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|cytosol|endomembrane system|microtubule	phosphatidylethanolamine binding|protein binding				0						CAACATGAGCGAGTTGGTCAA	0.642													4	15	---	---	---	---	PASS
SLC32A1	140679	broad.mit.edu	37	20	37356752	37356752	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37356752C>T	uc002xjc.2	+	2	1311	c.1048C>T	c.(1048-1050)CTC>TTC	p.L350F		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	350	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	AGCCTGCGTGCTCAAGGGCCT	0.617													17	50	---	---	---	---	PASS
ARFRP1	10139	broad.mit.edu	37	20	62337758	62337758	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62337758A>T	uc002yga.2	-	3	782	c.215T>A	c.(214-216)ATG>AAG	p.M72K	ARFRP1_uc002ygc.2_Missense_Mutation_p.M72K|ARFRP1_uc002ygh.3_Missense_Mutation_p.M72K|ARFRP1_uc011abf.1_Missense_Mutation_p.M72K|ARFRP1_uc011abg.1_Missense_Mutation_p.M72K|ARFRP1_uc002yge.2_RNA|ARFRP1_uc002ygd.2_RNA|ARFRP1_uc002ygf.2_Missense_Mutation_p.M72K|ARFRP1_uc002ygg.2_RNA|ARFRP1_uc011abh.1_RNA|ZGPAT_uc002ygi.2_5'Flank|ZGPAT_uc002ygj.2_5'Flank|ZGPAT_uc002ygk.2_5'Flank|ZGPAT_uc010gkk.1_5'Flank|ZGPAT_uc010gkl.1_5'Flank|ZGPAT_uc002ygm.2_5'Flank|ZGPAT_uc002ygn.3_5'Flank	NM_003224	NP_003215	Q13795	ARFRP_HUMAN	ADP-ribosylation factor related protein 1	72					small GTPase mediated signal transduction	Golgi apparatus|membrane fraction	GTP binding|GTPase activity			breast(1)|skin(1)	2	all_cancers(38;9.53e-13)|all_epithelial(29;2.64e-14)|Lung NSC(23;7e-10)|all_lung(23;2.53e-09)		Epithelial(9;4.09e-08)|all cancers(9;1.7e-07)|OV - Ovarian serous cystadenocarcinoma(5;0.0102)			GTCCCAGAACATGAGCCGAGC	0.607													7	219	---	---	---	---	PASS
KRTAP10-4	386672	broad.mit.edu	37	21	45993662	45993662	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45993662C>G	uc002zfk.1	+	1	57	c.27C>G	c.(25-27)AGC>AGG	p.S9R	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198687	NP_941960	P60372	KR104_HUMAN	keratin associated protein 10-4	9						keratin filament					0						GCGACCTGAGCTACAGCAGCC	0.652													19	58	---	---	---	---	PASS
FBXO7	25793	broad.mit.edu	37	22	32875201	32875201	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32875201A>C	uc003amq.2	+	2	639	c.356A>C	c.(355-357)CAA>CCA	p.Q119P	FBXO7_uc003amp.1_Missense_Mutation_p.Q5P|FBXO7_uc003amr.2_Missense_Mutation_p.Q5P|FBXO7_uc003ams.2_Intron|FBXO7_uc003amt.2_Missense_Mutation_p.Q40P|FBXO7_uc003amu.2_Missense_Mutation_p.Q5P	NM_012179	NP_036311	Q9Y3I1	FBX7_HUMAN	F-box only protein 7 isoform 1	119					cell death|regulation of protein stability|ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(1)	1						CAGGATGAACAACCAAGTGAT	0.438													51	150	---	---	---	---	PASS
FIGF	2277	broad.mit.edu	37	X	15402054	15402054	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15402054C>A	uc004cwt.1	-	1	524	c.15G>T	c.(13-15)TGG>TGT	p.W5C		NM_004469	NP_004460	O43915	VEGFD_HUMAN	vascular endothelial growth factor D	5					angiogenesis|cell differentiation|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of mast cell chemotaxis|vascular endothelial growth factor receptor signaling pathway	extracellular space|membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity|platelet-derived growth factor receptor binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Hepatocellular(33;0.183)					TCACCACTACCCACTCTCTGT	0.413													43	32	---	---	---	---	PASS
HDAC6	10013	broad.mit.edu	37	X	48681371	48681371	+	Silent	SNP	G	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48681371G>A	uc011mmi.1	+	25	2657	c.2562G>A	c.(2560-2562)AAG>AAA	p.K854K	HDAC6_uc004dks.1_Silent_p.K854K|HDAC6_uc010nig.1_Silent_p.K702K|HDAC6_uc004dkt.1_Silent_p.K854K|HDAC6_uc011mmk.1_Silent_p.K835K|HDAC6_uc004dkv.1_Silent_p.K502K|HDAC6_uc004dkw.1_Silent_p.K502K|HDAC6_uc004dkx.1_Silent_p.K217K	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	854					aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	TCACCAAGAAGGCACCCCAAC	0.537													21	15	---	---	---	---	PASS
MSN	4478	broad.mit.edu	37	X	64959621	64959621	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64959621G>T	uc004dwf.2	+	13	1798	c.1600G>T	c.(1600-1602)GAT>TAT	p.D534Y		NM_002444	NP_002435	P26038	MOES_HUMAN	moesin	534					leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking	apical plasma membrane|cytoskeleton|extrinsic to membrane|microvillus membrane|nucleolus	cell adhesion molecule binding|receptor binding|structural constituent of cytoskeleton		MSN/ALK(6)	haematopoietic_and_lymphoid_tissue(6)|ovary(3)|lung(1)	10						CAATGCCAGAGATGAGTCCAA	0.522			T	ALK	ALCL								4	74	---	---	---	---	PASS
C1orf174	339448	broad.mit.edu	37	1	3806265	3806266	+	3'UTR	DEL	AA	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3806265_3806266delAA	uc001alf.2	-	4					C1orf174_uc009vls.2_RNA	NM_207356	NP_997239	Q8IYL3	CA174_HUMAN	hypothetical protein LOC339448												0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;5.09e-25)|all_epithelial(116;9.35e-17)|all_lung(118;1.09e-06)|Lung NSC(185;0.000139)|all_neural(13;0.00287)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0219)|all_hematologic(16;0.027)|Colorectal(325;0.0276)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;1.55e-39)|OV - Ovarian serous cystadenocarcinoma(86;5.99e-23)|GBM - Glioblastoma multiforme(42;2.22e-17)|Colorectal(212;1.08e-05)|COAD - Colon adenocarcinoma(227;5.49e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000365)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.19)		gtctccaaggaaaaaaaaaaaa	0.173													11	6	---	---	---	---	
CA6	765	broad.mit.edu	37	1	9018920	9018920	+	Intron	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9018920delT	uc001apm.2	+						CA6_uc009vmn.2_Intron	NM_001215	NP_001206	P23280	CAH6_HUMAN	carbonic anhydrase VI precursor						one-carbon metabolic process	extracellular region	carbonate dehydratase activity|zinc ion binding			ovary(2)	2	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)		ATCTTAAGCATTTGAATTTCT	0.438													309	140	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	24814065	24814066	+	IGR	INS	-	GGAGGGAA	GGAGGGAA	rs140464813	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24814065_24814066insGGAGGGAA								NIPAL3 (14593 upstream) : RCAN3 (15321 downstream)																							GGGggagggagggaaggaagga	0.040													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	31128558	31128559	+	IGR	INS	-	TGG	TGG	rs150361136	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128558_31128559insTGG								None (None upstream) : MATN1 (55567 downstream)																							ggtggtggtgatggtggtgatg	0.069													5	5	---	---	---	---	
EIF2B3	8891	broad.mit.edu	37	1	45453797	45453798	+	5'Flank	INS	-	AA	AA	rs149445248		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45453797_45453798insAA	uc001cmt.1	-						EIF2B3_uc001cmu.1_5'Flank|EIF2B3_uc001cmv.1_5'Flank|EIF2B3_uc001cmw.2_5'Flank	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					gacagcgtctcaaaaaaaaaaa	0.178													17	11	---	---	---	---	
MRPL37	51253	broad.mit.edu	37	1	54681675	54681675	+	Intron	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54681675delT	uc001cxa.3	+						MRPL37_uc009vzp.2_Intron|MRPL37_uc001cxb.1_Intron|MRPL37_uc001cxc.3_Intron|MRPL37_uc010oob.1_Intron	NM_016491	NP_057575	Q9BZE1	RM37_HUMAN	mitochondrial ribosomal protein L37 precursor						translation	mitochondrial ribosome	structural constituent of ribosome				0						CCTCATTCTATTTTAATTGTC	0.547													14	10	---	---	---	---	
S100A10	6281	broad.mit.edu	37	1	151955955	151955955	+	Intron	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151955955delT	uc001ezl.2	-							NM_002966	NP_002957	P60903	S10AA_HUMAN	S100 calcium binding protein A10						signal transduction		calcium ion binding|receptor binding				0	Melanoma(130;0.0648)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TCTAAATGTATTTTTTTTTTT	0.333													6	3	---	---	---	---	
FCRL2	79368	broad.mit.edu	37	1	157718231	157718232	+	Intron	INS	-	AAAT	AAAT	rs143605468	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157718231_157718232insAAAT	uc001fre.2	-						FCRL2_uc001frd.2_Intron|FCRL2_uc010phz.1_Intron|FCRL2_uc009wsp.2_Intron	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor						cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			gatagatagacaaataaataaa	0.124													3	3	---	---	---	---	
DHX9	1660	broad.mit.edu	37	1	182822929	182822929	+	Intron	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182822929delT	uc001gpr.2	+						DHX9_uc001gps.2_Intron	NM_001357	NP_001348	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 9						CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding			ovary(2)	2						GAAGTTGTCATTTTTTTTTTT	0.264													8	4	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	215800778	215800778	+	Intron	DEL	C	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215800778delC	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ttccttccttccttccttcct	0.010										HNSCC(13;0.011)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106219011	106219018	+	Intron	DEL	GAAGGAAG	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106219011_106219018delGAAGGAAG	uc002tdf.2	-											Homo sapiens hypothetical protein LOC285000, mRNA (cDNA clone IMAGE:3925223), partial cds.																		gagagagagagaaggaaggaaggaagga	0.000													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	110424633	110424635	+	IGR	DEL	AGA	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110424633_110424635delAGA								ANKRD57 (48070 upstream) : RGPD5 (125700 downstream)																							CAATCCAGTGAGAAGGTTTTGTG	0.369													11	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129098917	129098919	+	IGR	DEL	GTG	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129098917_129098919delGTG								HS6ST1 (22746 upstream) : None (None downstream)																							ggtattggtagtggtggtgatgg	0.103													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	147295054	147295061	+	IGR	DEL	AAGGAAGG	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147295054_147295061delAAGGAAGG								None (None upstream) : PABPC1P2 (49564 downstream)																							gaaagaaagaaaggaaggaaggaaggaa	0.000													4	2	---	---	---	---	
RBM45	129831	broad.mit.edu	37	2	178986131	178986136	+	Intron	DEL	ACACAC	-	-	rs11895951		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178986131_178986136delACACAC	uc002ulv.2	+							NM_152945	NP_694453	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45						cell differentiation|nervous system development	cytoplasm|nucleus	nucleotide binding|RNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			atgtatatatacacacacacacacac	0.228													4	3	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188204	10188205	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188204_10188205delTT	uc003bvc.2	+	2	560_561	c.347_348delTT	c.(346-348)CTTfs	p.L116fs	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	116	Involved in binding to CCT complex.		L -> V (in VHLD).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.?(2)|p.L116V(1)|p.W117fs*14(1)|p.W117fs*40(1)|p.W117fs*42(1)|p.L116fs*43(1)|p.H115fs*41(1)|p.H115fs*42(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		ATAGGTCACCTTTGGCTCTTCA	0.347		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				156	75	---	---	---	---	
KCNH8	131096	broad.mit.edu	37	3	19399694	19399699	+	Intron	DEL	TCTTTC	-	-	rs147021013		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19399694_19399699delTCTTTC	uc003cbk.1	+						KCNH8_uc011awe.1_Intron|KCNH8_uc010hex.1_Intron	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,							integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						ccttcttttttctttctctttctctt	0.000													4	3	---	---	---	---	
FRMD4B	23150	broad.mit.edu	37	3	69245689	69245690	+	Intron	INS	-	AAAAC	AAAAC	rs144990660	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69245689_69245690insAAAAC	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnu.2_Intron|FRMD4B_uc011bga.1_Intron	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CTTCAGACCAAAAAACAAAACA	0.287													6	4	---	---	---	---	
BBX	56987	broad.mit.edu	37	3	107492579	107492579	+	Intron	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107492579delT	uc010hpr.2	+						BBX_uc003dwk.3_Intron|BBX_uc003dwl.3_Intron|BBX_uc003dwm.3_Intron|BBX_uc003dwo.3_5'Flank	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			AACAATATGGTATCAAAATAA	0.284													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	168269864	168269865	+	IGR	INS	-	A	A	rs139746804		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168269864_168269865insA								MIR551B (127 upstream) : C3orf50 (257719 downstream)																							CCAATGGGATTAAAAAAAAAAA	0.277													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	14040827	14040827	+	IGR	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14040827delT								BOD1L (411499 upstream) : CPEB2 (964695 downstream)																							tctttctttgtttctctctcc	0.184													4	2	---	---	---	---	
ALB	213	broad.mit.edu	37	4	74274218	74274232	+	Intron	DEL	GCTTAACCAGTATAT	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74274218_74274232delGCTTAACCAGTATAT	uc003hgs.3	+						ALB_uc003hgw.3_Intron|ALB_uc011cbe.1_Intron|ALB_uc003hgt.3_Intron|ALB_uc010iii.2_Intron|ALB_uc003hgu.3_Intron|ALB_uc003hgv.3_Intron|ALB_uc011cbf.1_Intron|ALB_uc010iij.2_5'Flank|ALB_uc003hgx.3_5'Flank	NM_000477	NP_000468	P02768	ALBU_HUMAN	albumin preproprotein						bile acid and bile salt transport|bile acid metabolic process|cellular response to starvation|hemolysis by symbiont of host erythrocytes|lipoprotein metabolic process|maintenance of mitochondrion location|negative regulation of apoptosis|platelet activation|platelet degranulation|sodium-independent organic anion transport|transmembrane transport	extracellular space|platelet alpha granule lumen|protein complex	antioxidant activity|chaperone binding|copper ion binding|DNA binding|drug binding|fatty acid binding|pyridoxal phosphate binding|toxin binding			ovary(3)|skin(3)	6	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		Acenocoumarol(DB01418)|Acitretin(DB00459)|Alfentanil(DB00802)|Aluminium(DB01370)|Auranofin(DB00995)|Bismuth(DB01402)|Captopril(DB01197)|Carboplatin(DB00958)|Cefalotin(DB00456)|Cefazolin(DB01327)|Cefonicid(DB01328)|Cefoperazone(DB01329)|Chlorpheniramine(DB01114)|Chlorpromazine(DB00477)|Ciprofloxacin(DB00537)|Clonazepam(DB01068)|Cloxacillin(DB01147)|Cytarabine(DB00987)|Dantrolene(DB01219)|Diclofenac(DB00586)|Diflunisal(DB00861)|Digitoxin(DB01396)|Estrone(DB00655)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Flurbiprofen(DB00712)|Gadobenate Dimeglumine(DB00743)|Gatifloxacin(DB01044)|Gliclazide(DB01120)|Halothane(DB01159)|Human Serum Albumin(DB00062)|Hyaluronidase(DB00070)|Ibuprofen(DB01050)|Insulin-detemir(DB01307)|Insulin-glargine(DB01308)|Iodipamide(DB04711)|Ketoprofen(DB01009)|Levamisole(DB00848)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Mefenamic acid(DB00784)|Mephenytoin(DB00532)|Methotrexate(DB00563)|Nortriptyline(DB00540)|Oxazepam(DB00842)|Paclitaxel(DB01229)|Phenprocoumon(DB00946)|Probenecid(DB01032)|Propofol(DB00818)|Pyridoxine(DB00165)|Salicyclic acid(DB00936)|Saquinavir(DB01232)|Serum albumin(DB00096)|Serum albumin iodonated(DB00064)|Sodium lauryl sulfate(DB00815)|Sucralfate(DB00364)|Sulfamethizole(DB00576)|Sulindac(DB00605)|Suprofen(DB00870)|Testosterone(DB00624)|Xanthophyll(DB00137)	TCCTGACCAAGCTTAACCAGTATATTAAATCCTTT	0.344													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8287043	8287046	+	IGR	DEL	CTCC	-	-	rs139964067		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8287043_8287046delCTCC								MTRR (385810 upstream) : SEMA5A (748092 downstream)																							tccctctcctctccctcccttcct	0.103													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28780336	28780339	+	IGR	DEL	CCTT	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28780336_28780339delCCTT								None (None upstream) : None (None downstream)																							ttccttcctaccttccttccttct	0.000													4	3	---	---	---	---	
RICTOR	253260	broad.mit.edu	37	5	38943269	38943270	+	Intron	INS	-	A	A	rs5867438		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38943269_38943270insA	uc003jlp.2	-						RICTOR_uc003jlo.2_Intron|RICTOR_uc010ivf.2_Intron	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR						actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					GGTTTTTTTTTAAAAAAAATGA	0.287													5	3	---	---	---	---	
CHSY3	337876	broad.mit.edu	37	5	129407231	129407234	+	Intron	DEL	TGTG	-	-	rs35512470		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129407231_129407234delTGTG	uc003kvd.2	+							NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3							Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		AGTAGTTCATtgtgtgtgtgtgtg	0.152													4	3	---	---	---	---	
SLC22A4	6583	broad.mit.edu	37	5	131675169	131675170	+	Intron	DEL	AC	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131675169_131675170delAC	uc003kwq.2	+						uc003kwr.3_Intron	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	solute carrier family 22 member 4						body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity				0		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	GTacacacgtacacacacacac	0.342													5	3	---	---	---	---	
KIF13A	63971	broad.mit.edu	37	6	17940279	17940280	+	Intron	INS	-	A	A	rs9383333		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17940279_17940280insA	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			tctcataaattaaaaaaaaaaa	0.005													4	2	---	---	---	---	
C6orf10	10665	broad.mit.edu	37	6	32290694	32290695	+	Intron	INS	-	ATGAAA	ATGAAA	rs149901344	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32290694_32290695insATGAAA	uc011dpy.1	-							NM_006781	NP_006772	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10							integral to membrane				skin(1)	1						TTCCTCCTACTTGTTATTTCGT	0.342													4	2	---	---	---	---	
UBR2	23304	broad.mit.edu	37	6	42583490	42583491	+	Intron	INS	-	A	A	rs112022552		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42583490_42583491insA	uc011dur.1	+						UBR2_uc011dus.1_Intron|UBR2_uc010jxv.1_5'Flank|UBR2_uc003osh.2_5'Flank|UBR2_uc003osf.2_Intron	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			agcaagaccctaaaaaaaaaaa	0.000													4	2	---	---	---	---	
OOEP	441161	broad.mit.edu	37	6	74082632	74082633	+	Intron	DEL	TT	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74082632_74082633delTT	uc003pgv.3	-							NM_001080507	NP_001073976	A6NGQ2	OOEP_HUMAN	oocyte expressed protein homolog							cytoplasm					0						ttttctttcctttttttttttt	0.381													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	82972712	82972715	+	IGR	DEL	AAGG	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82972712_82972715delAAGG								IBTK (15264 upstream) : TPBG (100208 downstream)																							ggaaggaagaaaggaaggaaggaa	0.000													6	3	---	---	---	---	
MAP3K7	6885	broad.mit.edu	37	6	91261583	91261583	+	Intron	DEL	A	-	-	rs35787813		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91261583delA	uc003pnz.1	-						MAP3K7_uc003poa.1_Intron|MAP3K7_uc003pob.1_Intron|MAP3K7_uc003poc.1_Intron	NM_145331	NP_663304	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|histone H3 acetylation|I-kappaB phosphorylation|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytosol|endosome membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)	6		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		AGTGATAAAGAACTAGATTTT	0.274													3	6	---	---	---	---	
ECHDC1	55862	broad.mit.edu	37	6	127652111	127652111	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127652111delT	uc003qax.2	-	2	117	c.81delA	c.(79-81)ACAfs	p.T27fs	ECHDC1_uc003qaz.3_Frame_Shift_Del_p.T21fs|ECHDC1_uc010key.2_Intron|ECHDC1_uc003qay.3_Frame_Shift_Del_p.T21fs|ECHDC1_uc010kez.2_Intron|ECHDC1_uc010kex.2_RNA	NM_001139510	NP_001132982	Q9NTX5	ECHD1_HUMAN	enoyl Coenzyme A hydratase domain containing 1	27							catalytic activity				0				GBM - Glioblastoma multiforme(226;0.0423)|all cancers(137;0.156)		GTGACAATCCTGTTTGATGTA	0.393													118	59	---	---	---	---	
PDE7B	27115	broad.mit.edu	37	6	136468301	136468302	+	Intron	INS	-	A	A	rs149299885	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136468301_136468302insA	uc003qgp.2	+						uc003qgq.1_Intron|PDE7B_uc003qgr.2_Intron	NM_018945	NP_061818	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)	aagtaaaaattaaaaaaaaaaC	0.114													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64975025	64975025	+	IGR	DEL	C	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64975025delC								ZNF92 (109028 upstream) : INTS4L2 (137752 downstream)																							AGGTAGAAGGCTGGCACAGCT	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67816479	67816481	+	IGR	DEL	TCT	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67816479_67816481delTCT								None (None upstream) : None (None downstream)																							tccttccttctcttctttctttt	0.000													4	2	---	---	---	---	
SEMA3A	10371	broad.mit.edu	37	7	83824113	83824113	+	5'UTR	DEL	A	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83824113delA	uc003uhz.2	-	1						NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor						axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						CTCCaaaaagaaaaaaaaaaa	0.373													4	4	---	---	---	---	
AKAP9	10142	broad.mit.edu	37	7	91622509	91622509	+	Intron	DEL	T	-	-	rs75639681		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91622509delT	uc003ulg.2	+						AKAP9_uc003uld.3_Intron|AKAP9_uc003ule.2_Intron|AKAP9_uc003ulf.2_Intron	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2						G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			cttcttcttcttttttttttt	0.085			T	BRAF	papillary thyroid								4	2	---	---	---	---	
WNT2	7472	broad.mit.edu	37	7	116932348	116932349	+	Intron	DEL	CA	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116932348_116932349delCA	uc003viz.2	-						WNT2_uc003vja.2_Intron	NM_003391	NP_003382	P09544	WNT2_HUMAN	wingless-type MMTV integration site family						atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CAACcacactcacacacacaca	0.287													4	2	---	---	---	---	
ERI1	90459	broad.mit.edu	37	8	8874059	8874059	+	Intron	DEL	A	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8874059delA	uc011kwu.1	+						ERI1_uc003wsk.2_Intron	NM_153332	NP_699163	Q8IV48	ERI1_HUMAN	three prime histone mRNA exonuclease 1						gene silencing by RNA|rRNA 3'-end processing	cytoplasm|histone pre-mRNA 3'end processing complex|nucleolus	3'-5' exonuclease activity|histone pre-mRNA stem-loop binding|metal ion binding|ribosome binding|rRNA binding				0					Adenosine monophosphate(DB00131)	TGtaataattaaaaaaaaaaa	0.259													4	2	---	---	---	---	
ASAH1	427	broad.mit.edu	37	8	17920994	17920995	+	Intron	INS	-	G	G	rs66982576		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17920994_17920995insG	uc003wyl.2	-						ASAH1_uc010ltb.1_Intron|ASAH1_uc003wym.2_Intron|ASAH1_uc003wyn.2_Intron|ASAH1_uc003wyo.2_Intron	NM_177924	NP_808592	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase 1 isoform a						ceramide metabolic process	lysosome	ceramidase activity				0				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)		tttttttttttgtatttttctt	0.000													4	3	---	---	---	---	
CHCHD7	79145	broad.mit.edu	37	8	57129756	57129756	+	Intron	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57129756delT	uc003xsx.2	+						CHCHD7_uc003xss.2_Intron|CHCHD7_uc003xst.2_Intron|CHCHD7_uc003xsu.2_Intron|CHCHD7_uc003xsv.2_Intron|CHCHD7_uc003xsw.2_Intron	NM_001011671	NP_001011671	Q9BUK0	CHCH7_HUMAN	coiled-coil-helix-coiled-coil-helix domain										CHCHD7/PLAG1(12)	salivary_gland(12)	12		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00159)|all cancers(17;0.0112)			GGTTTTGGGATTTTTTTTTTA	0.289			T	PLAG1	salivary adenoma								5	4	---	---	---	---	
SPAG1	6674	broad.mit.edu	37	8	101206218	101206219	+	Intron	INS	-	A	A	rs138374520	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101206218_101206219insA	uc003yjh.1	+						SPAG1_uc003yjg.1_Intron|SPAG1_uc003yji.1_Intron	NM_172218	NP_757367	Q07617	SPAG1_HUMAN	sperm associated antigen 1						single fertilization	cytoplasm	GTP binding|hydrolase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		CAAAGGCCACCAAAAAAAAGCC	0.243													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	122304267	122304268	+	IGR	INS	-	TCCCTCCT	TCCCTCCT	rs144039194	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122304267_122304268insTCCCTCCT								SNTB1 (479958 upstream) : HAS2 (321003 downstream)																							ccctccctccctccttccttcc	0.000													11	5	---	---	---	---	
PVT1	5820	broad.mit.edu	37	8	129015195	129015196	+	Intron	INS	-	CCTC	CCTC	rs138039280	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129015195_129015196insCCTC	uc010mdq.2	+						PVT1_uc003ysl.2_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0						ctccctctctgcctccctccct	0.020													4	2	---	---	---	---	
FAM49B	51571	broad.mit.edu	37	8	130889909	130889913	+	Intron	DEL	GGTGT	-	-	rs56004410		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130889909_130889913delGGTGT	uc003yss.2	-						FAM49B_uc003yst.2_Intron|FAM49B_uc003ysu.2_Intron|FAM49B_uc003ysv.2_Intron|FAM49B_uc003ysw.2_Intron|FAM49B_uc003ysx.2_Intron|FAM49B_uc003ysy.1_Intron	NM_016623	NP_057707	Q9NUQ9	FA49B_HUMAN	hypothetical protein LOC51571												0	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			aaaaaaaaaaGgtgtgtgtgtgtgt	0.112													4	2	---	---	---	---	
TOP1MT	116447	broad.mit.edu	37	8	144403663	144403666	+	Intron	DEL	CACG	-	-	rs72210604		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144403663_144403666delCACG	uc003yxz.2	-						TOP1MT_uc011lkd.1_Intron|TOP1MT_uc011lke.1_Intron|TOP1MT_uc010mfb.2_Intron|TOP1MT_uc011lkf.1_Intron|TOP1MT_uc010mfd.1_Intron	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor						DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	gcacgccacacacgcacgccacac	0.137													4	2	---	---	---	---	
JAK2	3717	broad.mit.edu	37	9	5080892	5080892	+	Intron	DEL	C	-	-	rs33925764		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5080892delC	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		AAGACCttttctttttttttt	0.139		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				8	4	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33395300	33395300	+	Intron	DEL	C	-	-	rs77570582		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33395300delC	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_5'Flank|AQP7_uc010mjt.2_5'UTR|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_5'UTR|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		AGCAGCCTCGCCCACACACGC	0.602													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	45362789	45362791	+	IGR	DEL	TTC	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45362789_45362791delTTC								FAM27C (371298 upstream) : FAM27A (364238 downstream)																							CTTCAGCCTGTTCTTCTTCAGTC	0.468													6	3	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77427483	77427483	+	Intron	DEL	A	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77427483delA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GTGGGTACAGAAAAAAAAAAA	0.159													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	79183353	79183360	+	IGR	DEL	AAGGAAGA	-	-	rs71354664		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79183353_79183360delAAGGAAGA								GCNT1 (61023 upstream) : PRUNE2 (42933 downstream)																							ggaaggaaggaaggaagaaaggaaggaa	0.000													4	2	---	---	---	---	
CENPP	401541	broad.mit.edu	37	9	95099602	95099602	+	Intron	DEL	A	-	-	rs78317101		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95099602delA	uc004arz.2	+						CENPP_uc010mqx.2_Intron|CENPP_uc004ary.1_Intron	NM_001012267	NP_001012267	Q6IPU0	CENPP_HUMAN	centromere protein P						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	chromosome, centromeric region|cytosol|nucleoplasm				ovary(2)	2						ctccttctggaaaaaaaaaaa	0.109													4	2	---	---	---	---	
LRSAM1	90678	broad.mit.edu	37	9	130221497	130221497	+	Intron	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130221497delT	uc004brb.1	+						LRSAM1_uc010mxk.1_Intron|LRSAM1_uc004brc.1_Intron|LRSAM1_uc004brd.1_Intron	NM_001005373	NP_001005373	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif						negative regulation of endocytosis|non-lytic virus budding|protein autoubiquitination|protein catabolic process|protein polyubiquitination|protein transport|ubiquitin-dependent endocytosis	cytoplasm|extracellular region|membrane part	hormone activity|ubiquitin-protein ligase activity|zinc ion binding				0						CCCTTTGGGGttttttttttt	0.318													3	3	---	---	---	---	
ANKRD26	22852	broad.mit.edu	37	10	27301965	27301967	+	In_Frame_Del	DEL	GTG	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27301965_27301967delGTG	uc001ith.2	-	32	4966_4968	c.4794_4796delCAC	c.(4792-4797)ACCACT>ACT	p.1598_1599TT>T	ANKRD26_uc001itg.2_In_Frame_Del_p.1285_1286TT>T|ANKRD26_uc009xku.1_In_Frame_Del_p.1599_1600TT>T	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1598_1599						centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						GGTAGTGAGAGTGGTGAACAAAG	0.414													105	47	---	---	---	---	
WAC	51322	broad.mit.edu	37	10	28824816	28824817	+	Intron	INS	-	T	T	rs144095892	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28824816_28824817insT	uc001iuf.2	+						WAC_uc001iud.2_Intron|WAC_uc001iue.2_Intron|WAC_uc009xlb.2_Intron|WAC_uc001iug.2_Intron|WAC_uc001iuh.2_Intron	NM_016628	NP_057712	Q9BTA9	WAC_HUMAN	WW domain-containing adapter with a coiled-coil						cell cycle checkpoint|histone H2B conserved C-terminal lysine ubiquitination|histone monoubiquitination|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nuclear speck	chromatin binding|RNA polymerase II core binding			large_intestine(1)|ovary(1)	2						TAATCCTATCATTTTTTTTTTA	0.257													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	97725543	97725544	+	Intron	DEL	TG	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97725543_97725544delTG	uc001klg.1	-						uc001klj.1_Intron					Homo sapiens cDNA FLJ34077 fis, clone FCBBF3003481, weakly similar to ZINC FINGER PROTEIN 195.																		AGATTGGTTTtgtgtgtgtgtg	0.223													3	4	---	---	---	---	
HPSE2	60495	broad.mit.edu	37	10	100554766	100554768	+	Intron	DEL	AGA	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100554766_100554768delAGA	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		gggaggaaggagagagagagaga	0.099													4	2	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128836112	128836112	+	Intron	DEL	C	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128836112delC	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CTTTTTGGGTCtttttttttt	0.393													3	3	---	---	---	---	
SLC36A4	120103	broad.mit.edu	37	11	92899197	92899197	+	Intron	DEL	A	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92899197delA	uc001pdn.2	-						SLC36A4_uc001pdm.2_Intron	NM_152313	NP_689526	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid						L-alanine transport|proline transport|tryptophan transport	integral to membrane	symporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				AGAAAGGAAGAAAAAAAGAAG	0.318													53	24	---	---	---	---	
CCDC77	84318	broad.mit.edu	37	12	518533	518533	+	Splice_Site	DEL	G	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:518533delG	uc001qig.2	+	3	165	c.-15_splice	c.e3-1		CCDC77_uc009zdk.2_Intron|CCDC77_uc010sdp.1_Intron|CCDC77_uc010sdq.1_Intron	NM_032358	NP_115734	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77 isoform a							centrosome				ovary(1)	1	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			GTATTTGATAGGTGTGAAAAA	0.358													128	63	---	---	---	---	
KLRG1	10219	broad.mit.edu	37	12	9161834	9161838	+	Intron	DEL	AAAAA	-	-	rs112576720		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9161834_9161838delAAAAA	uc001qvh.2	+						KLRG1_uc001qvg.2_Intron	NM_005810	NP_005801	Q96E93	KLRG1_HUMAN	killer cell lectin-like receptor subfamily G,						cell surface receptor linked signaling pathway|cellular defense response|inflammatory response|regulation of immune response	integral to membrane	receptor activity|sugar binding			central_nervous_system(1)	1						gggtaagggcaaaaaaaaaaaaaaa	0.156													7	4	---	---	---	---	
CSDA	8531	broad.mit.edu	37	12	10870901	10870901	+	Intron	DEL	C	-	-	rs11309033		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10870901delC	uc001qyt.2	-						CSDA_uc001qyu.2_Intron	NM_003651	NP_003642	P16989	DBPA_HUMAN	cold shock domain protein A isoform a						negative regulation of transcription from RNA polymerase II promoter|response to cold	cytoplasm|nucleus	double-stranded DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|lung(1)|large_intestine(1)	4	Glioma(1;0.155)					CCACAGGCCACCCACCTTCCT	0.418													7	6	---	---	---	---	
SLCO1B3	28234	broad.mit.edu	37	12	21014281	21014282	+	Intron	INS	-	T	T	rs144976030	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21014281_21014282insT	uc001rek.2	+						SLCO1B3_uc001rel.2_Intron|SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_5'Flank	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					ttatatgcagcttttgtccaac	0.267													5	6	---	---	---	---	
ZC3H10	84872	broad.mit.edu	37	12	56510337	56510338	+	5'Flank	INS	-	G	G	rs146192315	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56510337_56510338insG	uc001sjp.1	+						RPL41_uc001sjn.2_5'Flank|RPL41_uc001sjo.2_5'Flank	NM_032786	NP_116175	Q96K80	ZC3HA_HUMAN	zinc finger CCCH-type containing 10								nucleic acid binding|zinc ion binding				0			OV - Ovarian serous cystadenocarcinoma(18;0.12)			GCCCCGCCCTTGGGGGGGGCAA	0.545													8	5	---	---	---	---	
CCT2	10576	broad.mit.edu	37	12	69986094	69986094	+	Intron	DEL	A	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69986094delA	uc001svb.1	+						CCT2_uc009zrm.1_Intron|CCT2_uc009zrn.1_Intron|CCT2_uc010stl.1_Intron	NM_006431	NP_006422	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2						'de novo' posttranslational protein folding	nucleus	ATP binding|unfolded protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			tgtctctactaaaaaaaaaaa	0.000													8	6	---	---	---	---	
C12orf26	84190	broad.mit.edu	37	12	82832291	82832292	+	Intron	INS	-	TT	TT			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82832291_82832292insTT	uc001szq.2	+							NM_032230	NP_115606	Q8N6Q8	CL026_HUMAN	hypothetical protein LOC84190												0						TTTATGGTTTCTTTTTTTTTTT	0.297													7	4	---	---	---	---	
CRY1	1407	broad.mit.edu	37	12	107394079	107394089	+	Intron	DEL	AAATTTCCTTC	-	-	rs11275319		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107394079_107394089delAAATTTCCTTC	uc001tmi.3	-							NM_004075	NP_004066	Q16526	CRY1_HUMAN	cryptochrome 1 (photolyase-like)						DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	blue light photoreceptor activity|DNA photolyase activity|double-stranded DNA binding|nucleotide binding|protein binding			ovary(3)	3						CATGTGAAATAAATTTCCTTCAAATTTCCAA	0.251													3	3	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117965130	117965131	+	Intron	DEL	AG	-	-	rs58270726		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965130_117965131delAG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					acacacacacagacacacacac	0.228													4	2	---	---	---	---	
CDK8	1024	broad.mit.edu	37	13	26928120	26928121	+	Intron	DEL	TA	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26928120_26928121delTA	uc001uqr.1	+						CDK8_uc001uqs.1_Intron|CDK8_uc001uqt.1_Intron	NM_001260	NP_001251	P49336	CDK8_HUMAN	cyclin-dependent kinase 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|large_intestine(1)|ovary(1)|skin(1)	5	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		CTGCAAACCTTATAGAAGTAGT	0.366													24	16	---	---	---	---	
SUGT1L1	283507	broad.mit.edu	37	13	41396419	41396419	+	Intron	DEL	A	-	-	rs113285533		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41396419delA	uc001uxp.1	-							NR_003365				Homo sapiens cDNA FLJ35913 fis, clone TESTI2010239.												0						CATTTCTAATAAAAAAAAAAT	0.363													4	2	---	---	---	---	
SYT16	83851	broad.mit.edu	37	14	62548098	62548099	+	Intron	INS	-	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62548098_62548099insA	uc001xfu.1	+						SYT16_uc010tse.1_Intron	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like											central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		GACTTTAATTTAATTTTCCATT	0.406													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95043934	95043935	+	IGR	INS	-	ATGG	ATGG	rs34159327		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95043934_95043935insATGG								SERPINA4 (7693 upstream) : SERPINA5 (3796 downstream)																							tggatggataaatggatggatg	0.153													6	3	---	---	---	---	
EML1	2009	broad.mit.edu	37	14	100380334	100380335	+	Intron	INS	-	TATC	TATC	rs149964074	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100380334_100380335insTATC	uc001ygs.2	+						EML1_uc010tww.1_Intron|EML1_uc001ygr.2_Intron	NM_004434	NP_004425	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1							cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)				gccAGCTGTGGTATCTATGTGA	0.094													4	3	---	---	---	---	
SPRED1	161742	broad.mit.edu	37	15	38591894	38591896	+	Intron	DEL	ACA	-	-	rs34384822		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38591894_38591896delACA	uc001zka.3	+							NM_152594	NP_689807	Q7Z699	SPRE1_HUMAN	sprouty-related protein 1 with EVH-1 domain						inactivation of MAPK activity|multicellular organismal development	caveola|nucleus	stem cell factor receptor binding			ovary(2)|lung(2)|skin(1)	5		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		GCAGTGAAATACAACATTTTTTT	0.340									Legius_syndrome				4	2	---	---	---	---	
FAM98B	283742	broad.mit.edu	37	15	38766375	38766375	+	Intron	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38766375delT	uc001zkb.1	+						FAM98B_uc001zkc.2_Intron	NM_001042429	NP_001035894	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B							tRNA-splicing ligase complex	protein binding			ovary(1)	1		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		TGTTTCCAAATTTTTTAGGAA	0.338													74	35	---	---	---	---	
HN1L	90861	broad.mit.edu	37	16	1749176	1749176	+	3'UTR	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1749176delT	uc002cmg.2	+	5					HN1L_uc010uvi.1_3'UTR|HN1L_uc010brt.2_RNA|HN1L_uc010bru.2_3'UTR|HN1L_uc010uvj.1_3'UTR|HN1L_uc010uvk.1_3'UTR	NM_144570	NP_653171	Q9H910	HN1L_HUMAN	hematological and neurological expressed 1-like							cytoplasm|nucleus				upper_aerodigestive_tract(1)	1						GCCTTCCAGATGGCTGGGAGA	0.597													5	4	---	---	---	---	
SLC9A3R2	9351	broad.mit.edu	37	16	2087452	2087453	+	Intron	INS	-	G	G			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2087452_2087453insG	uc002coi.2	+						SLC9A3R2_uc002coj.2_Intron|SLC9A3R2_uc002cok.2_Intron	NM_001130012	NP_001123484	Q15599	NHRF2_HUMAN	solute carrier family 9 isoform 3 regulator 2						protein complex assembly	apical plasma membrane|endomembrane system|nucleus	beta-catenin binding|phosphatase binding|protein C-terminus binding|receptor binding			central_nervous_system(1)	1						GAGCACACACTGGGGGGGGGTG	0.649													7	4	---	---	---	---	
FLYWCH1	84256	broad.mit.edu	37	16	2988609	2988609	+	Intron	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2988609delT	uc002csd.2	+						FLYWCH1_uc002csb.2_Intron|FLYWCH1_uc002csc.2_Intron|FLYWCH1_uc010bsv.2_Intron|FLYWCH1_uc002cse.2_Intron	NM_032296	NP_115672	Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1 isoform a							nucleus	DNA binding|metal ion binding				0						CCAGtctttgttttttttttt	0.224													3	4	---	---	---	---	
CREBBP	1387	broad.mit.edu	37	16	3842209	3842209	+	Intron	DEL	A	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3842209delA	uc002cvv.2	-						CREBBP_uc002cvw.2_Intron	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a						cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GTGTAACCATAACAcagtata	0.154			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9127640	9127655	+	IGR	DEL	TCGGTCCCTCCCTCCC	-	-	rs7198349	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9127640_9127655delTCGGTCCCTCCCTCCC								USP7 (70299 upstream) : C16orf72 (57882 downstream)																							cttccttccttcggtccctccctccctccttccttc	0.102													3	4	---	---	---	---	
GSG1L	146395	broad.mit.edu	37	16	27990984	27990985	+	Intron	INS	-	AA	AA	rs35672057		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27990984_27990985insAA	uc002doz.2	-						GSG1L_uc010bya.1_Intron	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1							integral to membrane				ovary(1)	1						aagaaagaaagagagagagaga	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	66059559	66059562	+	IGR	DEL	GAAA	-	-	rs28667374	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66059559_66059562delGAAA								LOC283867 (449356 upstream) : CDH5 (340963 downstream)																							aggaaggaaggaaagaaggaagga	0.039													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	81759343	81759344	+	IGR	INS	-	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81759343_81759344insT								CMIP (13978 upstream) : PLCG2 (53586 downstream)																							tccttccttccttttttttttt	0.005													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88226611	88226611	+	IGR	DEL	G	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88226611delG								BANP (115688 upstream) : ZNF469 (267268 downstream)																							tggtggtgatggtggtgatgg	0.000													5	3	---	---	---	---	
CCDC144C	348254	broad.mit.edu	37	17	20254234	20254235	+	Intron	INS	-	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20254234_20254235insT	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						AAGAGGAATTGTTTTTTTTTTT	0.248													3	3	---	---	---	---	
PSMD11	5717	broad.mit.edu	37	17	30800601	30800601	+	Intron	DEL	T	-	-	rs112811195		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30800601delT	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806	O00231	PSD11_HUMAN	proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			gtgcccagcattttttttttt	0.000													4	2	---	---	---	---	
C17orf50	146853	broad.mit.edu	37	17	34088119	34088125	+	Intron	DEL	TTTTTTT	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34088119_34088125delTTTTTTT	uc002hjx.2	+						MMP28_uc002hjw.1_Intron	NM_145272	NP_660315	Q8WW18	CQ050_HUMAN	hypothetical protein LOC146853												0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCTTCCTGAAttttttttttttttttt	0.246													4	2	---	---	---	---	
PSMB3	5691	broad.mit.edu	37	17	36909737	36909737	+	Intron	DEL	T	-	-	rs35484180		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36909737delT	uc002hqr.2	+							NM_002795	NP_002786	P49720	PSB3_HUMAN	proteasome beta 3 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity				0						CTTCCCtttcttttttttttt	0.264													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43686368	43686369	+	IGR	INS	-	G	G	rs74824446		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43686368_43686369insG								LOC644172 (6620 upstream) : CRHR1 (11343 downstream)																							AAAAAAAAAAAAgagacaagac	0.158													13	10	---	---	---	---	
SPOP	8405	broad.mit.edu	37	17	47700373	47700373	+	Intron	DEL	T	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47700373delT	uc010dbk.2	-						SPOP_uc002ipb.2_Intron|SPOP_uc002ipc.2_Intron|SPOP_uc002ipd.2_Intron|SPOP_uc002ipe.2_Intron|SPOP_uc002ipf.2_Intron|SPOP_uc002ipg.2_Intron|SPOP_uc010wlx.1_Intron	NM_003563	NP_003554	O43791	SPOP_HUMAN	speckle-type POZ protein						mRNA processing	nucleus	protein binding			prostate(2)|ovary(2)|lung(2)	6						GGTCCTAAAAttttttttttt	0.194										Prostate(2;0.17)			4	2	---	---	---	---	
RECQL5	9400	broad.mit.edu	37	17	73626922	73626923	+	Intron	INS	-	T	T	rs56158987		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73626922_73626923insT	uc010dgl.2	-						RECQL5_uc010dgk.2_Intron|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1						DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TCTCATCTGTGGGGGGGGGGGG	0.649								Other_identified_genes_with_known_or_suspected_DNA_repair_function					5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	9636642	9636642	+	IGR	DEL	A	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9636642delA								PPP4R1 (22042 upstream) : RAB31 (71586 downstream)																							actccatctcaaaaaaaaaat	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	41559194	41559200	+	IGR	DEL	TTTTTTT	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41559194_41559200delTTTTTTT								SYT4 (701579 upstream) : SETBP1 (700938 downstream)																							ttttgttctgttttttttttttttttt	0.300													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57863634	57863635	+	IGR	INS	-	G	G	rs144729393	by1000genomes	TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57863634_57863635insG								PMAIP1 (292096 upstream) : MC4R (174929 downstream)																							GTGAGACCCCCCCCAGTAACAG	0.485													9	5	---	---	---	---	
ATCAY	85300	broad.mit.edu	37	19	3924772	3924772	+	3'UTR	DEL	T	-	-	rs11306255		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3924772delT	uc002lyy.3	+	13					ATCAY_uc010xhz.1_3'UTR|ATCAY_uc010dts.2_3'UTR	NM_033064	NP_149053	Q86WG3	ATCAY_HUMAN	caytaxin						transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		AAACATTGTATTTTTTTTTTT	0.502													2	6	---	---	---	---	
FBN3	84467	broad.mit.edu	37	19	8153284	8153298	+	Intron	DEL	GAGTGAATGAGCAAG	-	-	rs147869949		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8153284_8153298delGAGTGAATGAGCAAG	uc002mjf.2	-						FBN3_uc002mje.2_Intron	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						gcaagggagtgagtgaatgagcaagaagtgaatga	0.102													3	5	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	8996060	8996060	+	Intron	DEL	C	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8996060delC	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGGGTCAGTGCTACCATGGTG	0.512													34	17	---	---	---	---	
CABP5	56344	broad.mit.edu	37	19	48537803	48537804	+	Intron	INS	-	TC	TC	rs71334256		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48537803_48537804insTC	uc002phu.1	-							NM_019855	NP_062829	Q9NP86	CABP5_HUMAN	calcium binding protein 5						signal transduction	cytoplasm	calcium ion binding			skin(1)	1		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		ttttctttcttttttttttttt	0.050													5	3	---	---	---	---	
KDELR1	10945	broad.mit.edu	37	19	48893549	48893549	+	Intron	DEL	C	-	-	rs36034010		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48893549delC	uc002pjb.1	-						KDELR1_uc002pja.1_Intron	NM_006801	NP_006792	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum						intracellular protein transport|protein retention in ER lumen|vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|integral to membrane|membrane fraction	KDEL sequence binding|protein binding|receptor activity				0		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		agagtccaggcccccggcccc	0.000													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	42043560	42043563	+	IGR	DEL	GAAG	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42043560_42043563delGAAG								PTPRT (225003 upstream) : SFRS6 (42941 downstream)																							aaaaaaaaaagaaggaaggaagga	0.005													2	6	---	---	---	---	
CSE1L	1434	broad.mit.edu	37	20	47686649	47686650	+	Intron	DEL	TA	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47686649_47686650delTA	uc002xty.2	+						CSE1L_uc010zyg.1_Intron|CSE1L_uc010ghx.2_Intron|CSE1L_uc010ghy.2_5'Flank|CSE1L_uc010zyh.1_5'Flank	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein						apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			GAAGCCTGTGTATAAAATGTTT	0.391													35	25	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55357295	55357295	+	IGR	DEL	A	-	-			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55357295delA								TFAP2C (142959 upstream) : BMP7 (386514 downstream)																							aaggagggagagaaggaagga	0.000													2	5	---	---	---	---	
PCK1	5105	broad.mit.edu	37	20	56136989	56136990	+	Intron	INS	-	A	A			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56136989_56136990insA	uc002xyn.3	+						PCK1_uc010zzm.1_Intron	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1						gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			GGCCATGTCTTAGATGGTCTGT	0.505													5	3	---	---	---	---	
CXADR	1525	broad.mit.edu	37	21	18931675	18931675	+	Intron	DEL	A	-	-	rs147134822		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18931675delA	uc002yki.2	+						CXADR_uc002ykh.1_Intron|CXADR_uc010gld.1_Intron|CXADR_uc010gle.1_Intron|CXADR_uc002ykj.1_Intron	NM_001338	NP_001329	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor						blood coagulation|cell adhesion|interspecies interaction between organisms|leukocyte migration|regulation of immune response	adherens junction|basolateral plasma membrane|extracellular region|integral to plasma membrane|nucleus|tight junction	receptor activity			ovary(1)	1				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		ttttttttttaaaaaatgtgt	0.000													6	4	---	---	---	---	
GCFC1	94104	broad.mit.edu	37	21	34133212	34133213	+	Intron	DEL	GC	-	-	rs8133271		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133212_34133213delGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						gtgcgtgcgtgcgtgtgtgtgt	0.277													16	9	---	---	---	---	
KIAA1644	85352	broad.mit.edu	37	22	44680766	44680767	+	Intron	INS	-	CTGCCTTCCTGCCTGCCTGC	CTGCCTTCCTGCCTGCCTGC	rs71786962		TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44680766_44680767insCTGCCTTCCTGCCTGCCTGC	uc003bet.2	-							NM_001099294	NP_001092764	Q3SXP7	K1644_HUMAN	hypothetical protein LOC85352 precursor							integral to membrane				ovary(1)	1		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				ATGCCACCTCTCTGccttcctg	0.406													4	2	---	---	---	---	
USP11	8237	broad.mit.edu	37	X	47104943	47104944	+	Intron	INS	-	T	T			TCGA-B0-4823-01A-02D-1421-08	TCGA-B0-4823-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47104943_47104944insT	uc004dhp.2	+						USP11_uc004dhq.2_Intron	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11						protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						CTATATTTAGCttttttttttt	0.277													4	2	---	---	---	---	
