Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NPHP4	261734	broad.mit.edu	37	1	5934998	5934998	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5934998C>G	uc001alq.1	-	21	3246	c.2980G>C	c.(2980-2982)GTG>CTG	p.V994L		NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin	994					actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		TTCTTAAGCACAAACTCAAAG	0.632													24	51	---	---	---	---	PASS
SLC2A5	6518	broad.mit.edu	37	1	9118229	9118229	+	Silent	SNP	A	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9118229A>T	uc001apo.2	-	2	406	c.114T>A	c.(112-114)GCT>GCA	p.A38A	SLC2A5_uc010nzz.1_Intron|SLC2A5_uc010oaa.1_Missense_Mutation_p.L7Q|SLC2A5_uc010oab.1_Silent_p.A38A|SLC2A5_uc010oac.1_Silent_p.A38A|SLC2A5_uc001app.3_Silent_p.A38A	NM_003039	NP_003030	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated	38	Extracellular (Potential).				carbohydrate metabolic process	integral to membrane|plasma membrane	fructose transmembrane transporter activity|glucose transmembrane transporter activity			pancreas(2)|ovary(1)	3	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GGGAGTTGACAGCAGCCACGT	0.592													22	36	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11190694	11190694	+	Silent	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11190694G>A	uc001asd.2	-	39	5626	c.5505C>T	c.(5503-5505)GCC>GCT	p.A1835A	MTOR_uc001asc.2_Silent_p.A40A	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1835	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						tggcagtggcggccgtggtgg	0.403													4	43	---	---	---	---	PASS
KIAA1522	57648	broad.mit.edu	37	1	33234371	33234371	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33234371G>A	uc001bvv.2	+	4	540	c.404G>A	c.(403-405)CGC>CAC	p.R135H	KIAA1522_uc001bvu.1_Missense_Mutation_p.R194H|KIAA1522_uc010ohm.1_Missense_Mutation_p.R146H|KIAA1522_uc010ohn.1_Missense_Mutation_p.R135H	NM_020888	NP_065939	Q9P206	K1522_HUMAN	hypothetical protein LOC57648	135											0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				ATGATCCAGCGCAAAGGTGGA	0.557													3	43	---	---	---	---	PASS
PHC2	1912	broad.mit.edu	37	1	33841143	33841143	+	5'UTR	SNP	C	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33841143C>A	uc001bxg.1	-	1					PHC2_uc001bxh.1_5'UTR|PHC2_uc009vuh.1_5'UTR|PHC2_uc001bxi.1_5'UTR	NM_198040	NP_932157	Q8IXK0	PHC2_HUMAN	polyhomeotic-like 2 isoform a						multicellular organismal development	PcG protein complex	DNA binding|identical protein binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TTCTCCATGGCCTGCAGTGTG	0.423													19	38	---	---	---	---	PASS
EFNA1	1942	broad.mit.edu	37	1	155104091	155104091	+	Silent	SNP	A	G	G			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155104091A>G	uc001fhh.2	+	2	474	c.369A>G	c.(367-369)GGA>GGG	p.G123G	EFNA1_uc001fhi.2_Silent_p.G123G|EFNA1_uc009wpd.1_5'Flank	NM_004428	NP_004419	P20827	EFNA1_HUMAN	ephrin A1 isoform a precursor	123					angiogenesis|aortic valve morphogenesis|cell migration|cell-cell signaling|endocardial cushion to mesenchymal transition involved in heart valve formation|ephrin receptor signaling pathway|mitral valve morphogenesis|negative regulation of epithelial to mesenchymal transition|negative regulation of transcription from RNA polymerase II promoter|positive regulation of peptidyl-tyrosine phosphorylation|regulation of cell adhesion mediated by integrin|substrate adhesion-dependent cell spreading	extracellular region|integral to plasma membrane	ephrin receptor binding				0	all_epithelial(22;4.71e-30)|all_lung(78;3.15e-27)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;2.28e-10)|all cancers(21;6.16e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000395)|LUSC - Lung squamous cell carcinoma(543;0.193)			TCAAAGAAGGACACAGCTACT	0.522													12	44	---	---	---	---	PASS
B3GALT2	8707	broad.mit.edu	37	1	193150003	193150003	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193150003T>G	uc001gtc.3	-	2	1405	c.690A>C	c.(688-690)AAA>AAC	p.K230N	CDC73_uc001gtb.2_Intron	NM_003783	NP_003774	O43825	B3GT2_HUMAN	UDP-Gal:betaGlcNAc beta	230	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)	1						CCATTAGTGTTTTAATGGTCA	0.338													50	123	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204971841	204971841	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204971841T>C	uc001hbj.2	+	27	3582	c.3254T>C	c.(3253-3255)ATC>ACC	p.I1085T	NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron|NFASC_uc010prb.1_Intron|NFASC_uc010prc.1_Intron|NFASC_uc001hbl.1_Intron|NFASC_uc001hbm.1_Missense_Mutation_p.I108T|NFASC_uc009xbh.1_Intron	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor	1192	Extracellular (Potential).|Fibronectin type-III 5.				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AACGAGGGCATCAGCAGTACC	0.552													19	36	---	---	---	---	PASS
MSH6	2956	broad.mit.edu	37	2	48026389	48026389	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48026389C>A	uc002rwd.3	+	4	1419	c.1267C>A	c.(1267-1269)CTT>ATT	p.L423I	MSH6_uc002rwc.2_Missense_Mutation_p.L423I|MSH6_uc010fbj.2_Missense_Mutation_p.L121I|MSH6_uc010yoi.1_Missense_Mutation_p.L293I|MSH6_uc010yoj.1_Missense_Mutation_p.L121I	NM_000179	NP_000170	P52701	MSH6_HUMAN	mutS homolog 6	423					determination of adult lifespan|DNA damage response, signal transduction resulting in induction of apoptosis|isotype switching|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|response to UV|somatic hypermutation of immunoglobulin genes	MutSalpha complex	ATP binding|DNA-dependent ATPase activity|protein binding			large_intestine(53)|central_nervous_system(28)|endometrium(28)|stomach(22)|haematopoietic_and_lymphoid_tissue(9)|lung(7)|skin(6)|urinary_tract(5)|breast(5)|ovary(3)|thyroid(1)|upper_aerodigestive_tract(1)	168		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GAACTTTGATCTTGTCATCTG	0.438			Mis|N|F|S		colorectal	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				38	82	---	---	---	---	PASS
KCNJ3	3760	broad.mit.edu	37	2	155555495	155555495	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155555495G>T	uc002tyv.1	+	1	403	c.208G>T	c.(208-210)GAC>TAC	p.D70Y	KCNJ3_uc010zce.1_Missense_Mutation_p.D70Y	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3	70	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	p.D70E(1)		upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)	CTACCTCTCGGACCTCTTCAC	0.592													20	47	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	190787980	190787980	+	5'UTR	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190787980G>A	uc002uro.2	+	1										SubName: Full=cDNA FLJ54127, highly similar to Heterogeneous nuclear ribonucleoproteins C;																		CGCAGAACCCGGGAGTAGGAG	0.498													9	20	---	---	---	---	PASS
ADAMTS9	56999	broad.mit.edu	37	3	64579996	64579996	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64579996C>T	uc003dmg.2	-	28	4326	c.4294G>A	c.(4294-4296)GAG>AAG	p.E1432K	ADAMTS9_uc011bfo.1_Missense_Mutation_p.E1404K|ADAMTS9_uc003dmh.1_Missense_Mutation_p.E1261K|ADAMTS9_uc011bfp.1_Missense_Mutation_p.E343K	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1432	TSP type-1 10.				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TTACACTGCTCACGATCGGGA	0.493													81	94	---	---	---	---	PASS
ZNF148	7707	broad.mit.edu	37	3	124952107	124952107	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124952107G>A	uc003ehx.3	-	9	1949	c.1463C>T	c.(1462-1464)GCG>GTG	p.A488V	SLC12A8_uc003ehw.3_Intron|ZNF148_uc003ehz.3_Missense_Mutation_p.A488V|ZNF148_uc010hsa.2_Missense_Mutation_p.A488V|ZNF148_uc003eia.3_Missense_Mutation_p.A488V|ZNF148_uc003ehy.2_Intron	NM_021964	NP_068799	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	488					cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4						CACATTCAGCGCATATTCCCT	0.433													5	209	---	---	---	---	PASS
UNC5C	8633	broad.mit.edu	37	4	96127874	96127874	+	Missense_Mutation	SNP	G	T	T	rs139568380	byFrequency	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96127874G>T	uc003htp.1	-	11	1961	c.1807C>A	c.(1807-1809)CGC>AGC	p.R603S	UNC5C_uc010ilc.1_Missense_Mutation_p.R622S	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor	603	Cytoplasmic (Potential).|ZU5.				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		ACGACTGGGCGGGTGAGCAGA	0.582													29	57	---	---	---	---	PASS
CFI	3426	broad.mit.edu	37	4	110667606	110667606	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110667606G>T	uc003hzr.3	-	11	1409	c.1201C>A	c.(1201-1203)CAC>AAC	p.H401N	CFI_uc003hzq.2_Missense_Mutation_p.H198N|CFI_uc011cft.1_Missense_Mutation_p.H409N|CFI_uc003hzs.3_Missense_Mutation_p.H394N	NM_000204	NP_000195	P05156	CFAI_HUMAN	complement factor I preproprotein	401	Peptidase S1.				complement activation, classical pathway|innate immune response|proteolysis	extracellular space|membrane	scavenger receptor activity|serine-type endopeptidase activity				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		AGGTCGGGGTGTATCCAGTCT	0.318													6	74	---	---	---	---	PASS
HPGD	3248	broad.mit.edu	37	4	175443219	175443219	+	Splice_Site	SNP	C	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175443219C>A	uc003itu.2	-	2	284	c.94_splice	c.e2-1	p.V32_splice	HPGD_uc003itv.2_Splice_Site_p.V32_splice|HPGD_uc011ckf.1_Splice_Site|HPGD_uc010irp.2_Intron|HPGD_uc010irq.2_Splice_Site_p.V32_splice|HPGD_uc011ckg.1_Splice_Site_p.V32_splice|HPGD_uc011ckh.1_Splice_Site|HPGD_uc003itw.2_Splice_Site_p.V32_splice|HPGD_uc003itx.2_Splice_Site_p.V32_splice	NM_000860	NP_000851	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)						female pregnancy|lipoxygenase pathway|negative regulation of cell cycle|parturition|prostaglandin metabolic process|transforming growth factor beta receptor signaling pathway	cytosol|nucleus	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|NAD+ binding|prostaglandin E receptor activity|protein homodimerization activity				0		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)	NADH(DB00157)	CCAGCGCTACCTATAGACAAG	0.507													75	106	---	---	---	---	PASS
TERT	7015	broad.mit.edu	37	5	1272327	1272327	+	Silent	SNP	C	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1272327C>A	uc003jcb.1	-	7	2413	c.2355G>T	c.(2353-2355)CCG>CCT	p.P785P	TERT_uc003jbz.1_Intron|TERT_uc003jca.1_Silent_p.P773P|TERT_uc003jcc.1_Silent_p.P785P|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1	785	Reverse transcriptase.		P -> L (in AA susceptibility).		anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CATCCCTCAGCGGGCTGGTCT	0.642									TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				7	22	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40959677	40959677	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40959677C>T	uc003jmh.2	+	12	1730	c.1616C>T	c.(1615-1617)ACG>ATG	p.T539M	C7_uc011cpn.1_RNA	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	539	TSP type-1 2.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				GTTGGAGAAACGACAGAAAGC	0.542													3	25	---	---	---	---	PASS
NLN	57486	broad.mit.edu	37	5	65088498	65088498	+	Intron	SNP	C	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65088498C>T	uc003juf.2	+						NLN_uc003jue.2_Missense_Mutation_p.P515S|NLN_uc003jug.2_Intron|NLN_uc010iww.2_Intron	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor						proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		TTTTTTTTTTCCCCCAGTAAA	0.428													4	82	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140209867	140209867	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140209867G>A	uc003lho.2	+	1	2218	c.2191G>A	c.(2191-2193)GCG>ACG	p.A731T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Missense_Mutation_p.A731T	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	731	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	p.A731A(1)		haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACCGAGGGCGCGTGCACGGC	0.692													33	61	---	---	---	---	PASS
C6orf114	85411	broad.mit.edu	37	6	13470345	13470345	+	Silent	SNP	T	C	C			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13470345T>C	uc003nav.2	-	2	691	c.168A>G	c.(166-168)GTA>GTG	p.V56V	GFOD1_uc003nas.1_Intron|GFOD1_uc003nat.1_Intron|C6orf114_uc003nau.2_RNA	NM_033069	NP_149060			hypothetical protein LOC85411												0	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0504)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.147)			AACCGATAAATACTGCAGTTG	0.343													23	51	---	---	---	---	PASS
PACSIN1	29993	broad.mit.edu	37	6	34499375	34499375	+	Splice_Site	SNP	A	C	C			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34499375A>C	uc003ojo.2	+	9	1244	c.1038_splice	c.e9-2	p.S346_splice	PACSIN1_uc003ojp.2_Splice_Site_p.S346_splice	NM_020804	NP_065855	Q9BY11	PACN1_HUMAN	protein kinase C and casein kinase substrate in						endocytosis		protein kinase activity				0						TCCGCGTCTCAGTGTTAGCAG	0.612													48	84	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43395697	43395697	+	Intron	SNP	T	G	G			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43395697T>G	uc003ouy.1	+							NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10							integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CCCTCAACTTTCCCTTCAGGT	0.687													4	17	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72974723	72974723	+	Silent	SNP	A	G	G			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72974723A>G	uc003pga.2	+	20	3239	c.3162A>G	c.(3160-3162)TTA>TTG	p.L1054L	RIMS1_uc011dyb.1_Intron|RIMS1_uc003pgc.2_Intron|RIMS1_uc010kaq.2_Intron|RIMS1_uc011dyc.1_Intron|RIMS1_uc010kar.2_Intron|RIMS1_uc011dyd.1_Intron|RIMS1_uc003pgf.2_Intron|RIMS1_uc003pgg.2_Intron|RIMS1_uc003pgi.2_Intron|RIMS1_uc003pgh.2_Intron|RIMS1_uc003pgd.2_Silent_p.L271L|RIMS1_uc003pge.2_Intron|RIMS1_uc011dye.1_Intron|RIMS1_uc011dyf.1_Intron|RIMS1_uc010kas.1_Intron	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1054					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				AGATGCCTTTATTACAGAGCA	0.378													6	9	---	---	---	---	PASS
HEATR2	54919	broad.mit.edu	37	7	794385	794385	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:794385C>T	uc010krz.1	+	5	1204	c.1184C>T	c.(1183-1185)ACG>ATG	p.T395M	HEATR2_uc003siz.2_Missense_Mutation_p.T263M	NM_017802	NP_060272	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	395	HEAT 6.						protein binding			skin(1)	1		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		GACCACGCCACGCAGCACCTG	0.657													4	58	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135261060	135261060	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135261060T>C	uc003vsw.2	+	4	417	c.386T>C	c.(385-387)TTA>TCA	p.L129S	NUP205_uc011kqa.1_RNA	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	129					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						ACCAGAGGATTAGTAGCTGTT	0.423													80	138	---	---	---	---	PASS
AMAC1L2	83650	broad.mit.edu	37	8	11189681	11189681	+	3'UTR	SNP	A	G	G			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11189681A>G	uc003wtp.1	+	1						NM_054028	NP_473369	Q96KT7	AMCL2_HUMAN	acyl-malonyl condensing enzyme							integral to membrane					0			STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)		ATAAATAAAGacaaagactga	0.279													5	20	---	---	---	---	PASS
USP17L2	377630	broad.mit.edu	37	8	11995803	11995803	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11995803C>T	uc003wvc.1	-	1	467	c.467G>A	c.(466-468)GGC>GAC	p.G156D	FAM66D_uc011kxp.1_Intron|FAM66D_uc011kxo.1_Intron	NM_201402	NP_958804	Q6R6M4	U17L2_HUMAN	deubiquitinating enzyme 3	156					apoptosis|cell cycle|G2/M transition checkpoint|mitotic cell cycle G1/S transition checkpoint|protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)	3						TTCCTGCTTGCCTCTATGGAA	0.522													14	33	---	---	---	---	PASS
DUSP26	78986	broad.mit.edu	37	8	33449489	33449489	+	3'UTR	SNP	G	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33449489G>T	uc003xjp.2	-	4					DUSP26_uc003xjq.2_3'UTR	NM_024025	NP_076930	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26							Golgi apparatus|nucleus	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		TGGGAGCCAGGGACCTACCCA	0.697													11	20	---	---	---	---	PASS
REXO1L1	254958	broad.mit.edu	37	8	86573410	86573410	+	3'UTR	SNP	G	A	A	rs79376271	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86573410G>A	uc011lfw.1	-	1						NM_172239	NP_758439	Q8IX06	GOR_HUMAN	exonuclease GOR							cytoplasm|nucleus	exonuclease activity|nucleic acid binding				0						TGGGCAGAGGGATGTGAACAG	0.667													3	17	---	---	---	---	PASS
BAALC	79870	broad.mit.edu	37	8	104240298	104240298	+	Nonsense_Mutation	SNP	C	T	T	rs144334771	byFrequency	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104240298C>T	uc003yld.2	+	3	614	c.409C>T	c.(409-411)CGA>TGA	p.R137*	BAALC_uc003yle.2_3'UTR|uc003ylf.2_Intron|BAALC_uc003ylg.2_Nonsense_Mutation_p.R83*|BAALC_uc010mcc.2_RNA	NM_024812	NP_079088	Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic isoform 1	172						centrosome|membrane|nucleus					0			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			GGACAGAAGTCGAAGAATCAC	0.433													3	52	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78790192	78790192	+	Intron	SNP	C	G	G			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790192C>G	uc004ajz.2	+						PCSK5_uc004ajy.2_Missense_Mutation_p.R683G|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						ggaatggaatcgaatcgaatc	0.129													4	6	---	---	---	---	PASS
TTC16	158248	broad.mit.edu	37	9	130486668	130486668	+	Intron	SNP	G	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130486668G>T	uc004brq.1	+						PTRH1_uc011mah.1_Intron|TTC16_uc011mai.1_Intron|TTC16_uc004brr.1_Intron|TTC16_uc010mxn.1_5'UTR	NM_144965	NP_659402	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16								binding				0						GGGCACTGGGGAGGGGGGGTG	0.547													5	25	---	---	---	---	PASS
CIZ1	25792	broad.mit.edu	37	9	130938657	130938657	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130938657G>A	uc004btt.2	-	11	2079	c.1916C>T	c.(1915-1917)CCC>CTC	p.P639L	CIZ1_uc004btr.2_Missense_Mutation_p.P611L|CIZ1_uc004bts.2_Missense_Mutation_p.P610L|CIZ1_uc011maq.1_Missense_Mutation_p.P578L|CIZ1_uc004btu.2_Missense_Mutation_p.P559L|CIZ1_uc011mar.1_Missense_Mutation_p.P538L|CIZ1_uc011mas.1_Missense_Mutation_p.P669L|CIZ1_uc004btw.2_Missense_Mutation_p.P583L|CIZ1_uc004btv.2_Missense_Mutation_p.P639L	NM_001131016	NP_001124488	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1 isoform	639						nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4						GACGTCCCGGGGCACGGGCAG	0.632													41	99	---	---	---	---	PASS
ASB6	140459	broad.mit.edu	37	9	132397747	132397747	+	3'UTR	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132397747G>A	uc004byf.1	-	6					METTL11A_uc004byd.1_3'UTR|METTL11A_uc010myw.1_RNA|METTL11A_uc011mbs.1_3'UTR|ASB6_uc004bye.1_3'UTR|ASB6_uc004byg.1_3'UTR|ASB6_uc011mbt.1_3'UTR|ASB6_uc010myx.1_3'UTR	NM_017873	NP_060343	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box-containing 6 isoform						intracellular signal transduction	cytoplasm					0		Ovarian(14;0.00556)				GAGATGAGCCGGGGCTGGCAG	0.622													48	123	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61830323	61830323	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61830323A>G	uc001jky.2	-	37	10508	c.10316T>C	c.(10315-10317)ATG>ACG	p.M3439T	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	3439					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						CTTAATTTCCATGGCTTGAAT	0.458													38	94	---	---	---	---	PASS
RRP12	23223	broad.mit.edu	37	10	99116876	99116876	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99116876T>C	uc001knf.2	-	34	4008	c.3869A>G	c.(3868-3870)AAC>AGC	p.N1290S	RRP12_uc001kne.2_Missense_Mutation_p.N305S|RRP12_uc009xvl.2_Missense_Mutation_p.N407S|RRP12_uc009xvm.2_Missense_Mutation_p.N1008S|RRP12_uc010qou.1_Missense_Mutation_p.N1229S|RRP12_uc009xvn.2_Missense_Mutation_p.N1190S	NM_015179	NP_055994	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog isoform 1	1290						integral to membrane|nuclear membrane|nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		CTTTCTGCGGTTTTTGTGTCC	0.637													16	61	---	---	---	---	PASS
TCERG1L	256536	broad.mit.edu	37	10	132965070	132965070	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132965070T>A	uc001lkp.2	-	5	1021	c.935A>T	c.(934-936)AAA>ATA	p.K312I	TCERG1L_uc009yax.1_RNA	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	312										large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		CTTGTCTTCTTTGTCTCCATC	0.592													12	41	---	---	---	---	PASS
PLEKHA7	144100	broad.mit.edu	37	11	16838611	16838611	+	Silent	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16838611G>A	uc001mmo.2	-	11	1617	c.1602C>T	c.(1600-1602)CAC>CAT	p.H534H	PLEKHA7_uc010rcu.1_Silent_p.H534H|PLEKHA7_uc010rcv.1_Silent_p.H108H|PLEKHA7_uc001mmn.2_Silent_p.H242H	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A	534					epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3						TGGGGCTGCCGTGCCGGAACT	0.677													25	38	---	---	---	---	PASS
SPRYD5	84767	broad.mit.edu	37	11	55653591	55653591	+	Intron	SNP	T	G	G			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55653591T>G	uc010rip.1	+						SPRYD5_uc010riq.1_5'UTR	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5							intracellular	zinc ion binding				0		all_epithelial(135;0.226)				TTCGTGGCTGTTTTGCAGGAG	0.398													15	44	---	---	---	---	PASS
CDK2AP2	10263	broad.mit.edu	37	11	67275231	67275231	+	Intron	SNP	G	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67275231G>T	uc001oma.2	-						PITPNM1_uc001oly.2_5'Flank|PITPNM1_uc001olz.2_5'Flank|CDK2AP2_uc009yry.2_Intron|CDK2AP2_uc001omb.2_Silent_p.S13S	NM_005851	NP_005842	O75956	CDKA2_HUMAN	cyclin-dependent kinase 2 associated protein 2												0						TCCAAGCCCAGGACCGGGTTC	0.627													4	3	---	---	---	---	PASS
PYROXD1	79912	broad.mit.edu	37	12	21623298	21623298	+	3'UTR	SNP	A	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21623298A>T	uc001rew.2	+	12					RECQL_uc001rex.2_Intron|RECQL_uc001rey.2_Intron|PYROXD1_uc009ziq.2_3'UTR|PYROXD1_uc009zir.2_3'UTR	NM_024854	NP_079130	Q8WU10	PYRD1_HUMAN	pyridine nucleotide-disulphide oxidoreductase								oxidoreductase activity			ovary(1)	1						AAAAAAAAAAAAACAAAGCAA	0.318													3	13	---	---	---	---	PASS
DYRK2	8445	broad.mit.edu	37	12	68052255	68052255	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68052255G>A	uc001str.3	+	3	1970	c.1568G>A	c.(1567-1569)CGC>CAC	p.R523H	DYRK2_uc001sts.3_Missense_Mutation_p.R450H	NM_006482	NP_006473	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	523	Protein kinase.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|positive regulation of glycogen biosynthetic process|smoothened signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|manganese ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(1)|central_nervous_system(1)	4			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		CCTGCAGTGCGCATGACCCCA	0.577													4	133	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70965011	70965011	+	Silent	SNP	C	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70965011C>T	uc001swb.3	-	11	2541	c.2511G>A	c.(2509-2511)GTG>GTA	p.V837V	PTPRB_uc010sto.1_Silent_p.V837V|PTPRB_uc010stp.1_Silent_p.V747V|PTPRB_uc001swc.3_Silent_p.V1055V|PTPRB_uc001swa.3_Silent_p.V967V|PTPRB_uc001swd.3_Silent_p.V1054V|PTPRB_uc009zrr.1_Silent_p.V934V	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	837	Fibronectin type-III 10.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTGACCAAGTCACATGCAAGT	0.438													13	41	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19415798	19415798	+	RNA	SNP	A	G	G			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19415798A>G	uc010tcj.1	-	1		c.30312T>C				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						ACTATGACATATATTTTCTGA	0.274													3	53	---	---	---	---	PASS
WASF3	10810	broad.mit.edu	37	13	27246116	27246116	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27246116G>T	uc001uqv.2	+	6	755	c.530G>T	c.(529-531)AGG>ATG	p.R177M	WASF3_uc001uqw.2_Missense_Mutation_p.R177M	NM_006646	NP_006637	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	177	Potential.				actin filament polymerization	cytoplasm|cytoskeleton	actin binding			pancreas(1)	1	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		AAAGAGAAAAGGCGTCAAAAG	0.338													11	53	---	---	---	---	PASS
SLITRK6	84189	broad.mit.edu	37	13	86370342	86370342	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86370342G>A	uc001vll.1	-	2	761	c.302C>T	c.(301-303)GCA>GTA	p.A101V	SLITRK6_uc010afe.1_5'Flank	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	101	Extracellular (Potential).|LRR 1.					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		CTCAATATCTGCAATATTGTT	0.353													61	141	---	---	---	---	PASS
ESR2	2100	broad.mit.edu	37	14	64749776	64749776	+	5'UTR	SNP	C	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64749776C>A	uc001xha.1	-	2					ESR2_uc001xgu.2_5'UTR|ESR2_uc001xgv.2_5'UTR|ESR2_uc001xgw.2_RNA|ESR2_uc001xgx.2_5'UTR|ESR2_uc001xgy.1_5'UTR|ESR2_uc001xgz.1_5'UTR|ESR2_uc010aqb.1_RNA|ESR2_uc010aqc.1_5'UTR	NM_001437	NP_001428	Q92731	ESR2_HUMAN	estrogen receptor beta isoform 1						cell-cell signaling|negative regulation of cell growth|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	mitochondrion|nucleoplasm	enzyme binding|estrogen receptor activity|receptor antagonist activity|sequence-specific DNA binding transcription factor activity|steroid binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Bicalutamide(DB01128)|Estradiol(DB00783)|Estramustine(DB01196)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	CTCAAAGATTCGTGGGCAAGT	0.328													3	62	---	---	---	---	PASS
C14orf159	80017	broad.mit.edu	37	14	91636352	91636352	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91636352G>T	uc001xzb.2	+	7	1031	c.263G>T	c.(262-264)GGC>GTC	p.G88V	C14orf159_uc010atv.1_Intron|C14orf159_uc001xyy.2_Missense_Mutation_p.G88V|C14orf159_uc001xyx.2_Missense_Mutation_p.G88V|C14orf159_uc001xyw.2_Missense_Mutation_p.G88V|C14orf159_uc001xzc.2_Missense_Mutation_p.G88V|C14orf159_uc001xza.2_Missense_Mutation_p.G88V|C14orf159_uc001xyv.2_Missense_Mutation_p.G88V|C14orf159_uc001xyz.2_Intron|C14orf159_uc010twj.1_Missense_Mutation_p.G88V|C14orf159_uc001xze.2_Missense_Mutation_p.G88V	NM_001102366	NP_001095836	Q7Z3D6	CN159_HUMAN	hypothetical protein LOC80017 isoform a	88						mitochondrion				central_nervous_system(2)|ovary(1)	3		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		CCCAGGATGGGCCATCCCCAG	0.572													43	102	---	---	---	---	PASS
TGM5	9333	broad.mit.edu	37	15	43552389	43552389	+	Silent	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43552389G>A	uc001zrd.1	-	3	305	c.297C>T	c.(295-297)TCC>TCT	p.S99S	TGM5_uc001zre.1_Intron	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1	99					epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	TCACCTCTGTGGAGGTGGCCC	0.647													21	50	---	---	---	---	PASS
LRRK1	79705	broad.mit.edu	37	15	101528945	101528945	+	Silent	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101528945G>A	uc002bwr.2	+	5	859	c.540G>A	c.(538-540)CCG>CCA	p.P180P	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bwq.1_Silent_p.P180P	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	180	ANK 3.				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGGCTGACCCGGAGAGCTACG	0.617													32	60	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102515299G>A	uc002cdi.2	+	9	1943	c.523G>A	c.(523-525)GGC>AGC	p.G175S	WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						TGGGGGCATCGGCAAGGCCAA	0.652													6	14	---	---	---	---	PASS
ZNF720	124411	broad.mit.edu	37	16	31734072	31734072	+	Silent	SNP	G	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31734072G>T	uc002ecn.3	+	2	333	c.129G>T	c.(127-129)CTG>CTT	p.L43L	ZNF720_uc010vfs.1_5'UTR|ZNF720_uc002eco.2_Intron|ZNF720_uc002ecp.1_Intron|ZNF720_uc002ecq.2_Silent_p.L45L	NM_001130913	NP_001124385	Q7Z2F6	ZN720_HUMAN	zinc finger protein 720	43	KRAB.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding				0						TGGTCTCTCTGGGTGAGGATA	0.403													11	139	---	---	---	---	PASS
CMTM2	146225	broad.mit.edu	37	16	66613526	66613526	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66613526G>A	uc002ept.2	+	1	176	c.16G>A	c.(16-18)GCA>ACA	p.A6T	CMTM2_uc010cdu.2_Missense_Mutation_p.A6T	NM_144673	NP_653274	Q8TAZ6	CKLF2_HUMAN	chemokine-like factor superfamily 2	6					chemotaxis	extracellular space|integral to membrane	cytokine activity			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.068)|Epithelial(162;0.212)		ACCTAAGGCGGCAAAGGGGGC	0.592													4	130	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76486631	76486631	+	Missense_Mutation	SNP	A	C	C	rs150449060		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76486631A>C	uc002feu.1	+	10	1683	c.1298A>C	c.(1297-1299)TAC>TCC	p.Y433S	CNTNAP4_uc002fev.1_Missense_Mutation_p.Y297S|CNTNAP4_uc010chb.1_Missense_Mutation_p.Y360S|CNTNAP4_uc002fex.1_Missense_Mutation_p.Y436S|CNTNAP4_uc002few.2_Missense_Mutation_p.Y408S	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	433	Extracellular (Potential).|Laminin G-like 2.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						TCGAATCTCTACCAGCCAGGA	0.433													12	51	---	---	---	---	PASS
CACNB1	782	broad.mit.edu	37	17	37341384	37341384	+	Silent	SNP	C	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37341384C>T	uc002hrm.1	-	7	801	c.648G>A	c.(646-648)TCG>TCA	p.S216S	CACNB1_uc002hrl.1_5'UTR|CACNB1_uc002hrn.2_Silent_p.S216S|CACNB1_uc002hro.2_Intron|CACNB1_uc002hrp.1_Intron	NM_000723	NP_000714	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1	216					axon guidance	voltage-gated calcium channel complex				large_intestine(1)|ovary(1)	2					Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Verapamil(DB00661)	TGATACTCACCGACTTCTGCT	0.388													25	67	---	---	---	---	PASS
HGS	9146	broad.mit.edu	37	17	79667601	79667601	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79667601T>C	uc002kbg.2	+	19	2064	c.1987T>C	c.(1987-1989)TAC>CAC	p.Y663H	MRPL12_uc002kbh.1_5'Flank|SLC25A10_uc010wut.1_5'Flank	NM_004712	NP_004703	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine	663	Interaction with NF2.|Gln-rich.				cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of JAK-STAT cascade|regulation of protein catabolic process	cytosol|early endosome membrane|multivesicular body membrane	metal ion binding|protein domain specific binding			ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			TTACTCATCCTACCAGCCTAC	0.572													10	14	---	---	---	---	PASS
ACP5	54	broad.mit.edu	37	19	11687390	11687390	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11687390G>A	uc002msg.3	-	4	549	c.403C>T	c.(403-405)CCT>TCT	p.P135S	ACP5_uc002msh.3_Missense_Mutation_p.P135S|ACP5_uc002msi.3_Missense_Mutation_p.P135S|ACP5_uc002msj.3_Missense_Mutation_p.P135S	NM_001611	NP_001602	P13686	PPA5_HUMAN	acid phosphatase 5, tartrate resistant	135					water-soluble vitamin metabolic process	cytosol|integral to membrane|lysosome	acid phosphatase activity|ferric iron binding|ferrous iron binding			central_nervous_system(1)	1						CGGTAGAAAGGGCTGGGGAAG	0.562													12	54	---	---	---	---	PASS
LILRA1	11024	broad.mit.edu	37	19	55110797	55110797	+	Intron	SNP	C	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55110797C>T	uc002qgh.1	+						LILRA1_uc010yfh.1_3'UTR	NM_006863	NP_006854	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity			skin(2)|ovary(1)	3				GBM - Glioblastoma multiforme(193;0.0348)		CACAGAGGGTCAGGTCCTGTC	0.463													15	33	---	---	---	---	PASS
RRBP1	6238	broad.mit.edu	37	20	17640771	17640771	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17640771G>A	uc010zrq.1	-	3	736	c.382C>T	c.(382-384)CCC>TCC	p.P128S	RRBP1_uc002wpu.2_5'Flank|RRBP1_uc002wpv.1_Missense_Mutation_p.P128S|RRBP1_uc002wpw.1_Missense_Mutation_p.P128S|RRBP1_uc010gcl.1_Intron|RRBP1_uc010zrr.1_Missense_Mutation_p.P128S			Q9P2E9	RRBP1_HUMAN	SubName: Full=RRBP1 protein; Flags: Fragment;	128	Cytoplasmic (Potential).				protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1						TTCTCCTGGGGCATGGCTGGA	0.567													3	43	---	---	---	---	PASS
WFDC9	259240	broad.mit.edu	37	20	44236581	44236581	+	3'UTR	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44236581G>A	uc002xoy.2	-	5						NM_147198	NP_671731	Q8NEX5	WFDC9_HUMAN	protease inhibitor WAP9 precursor							extracellular region					0		Myeloproliferative disorder(115;0.0122)				AGAGCCCTCAGGTTGATGTAG	0.428													17	20	---	---	---	---	PASS
HSF2BP	11077	broad.mit.edu	37	21	45050261	45050261	+	Silent	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45050261G>A	uc002zdi.2	-	6	848	c.516C>T	c.(514-516)GTC>GTT	p.V172V	HSF2BP_uc011aey.1_Silent_p.V97V	NM_007031	NP_008962	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding	172					spermatogenesis|transcription from RNA polymerase II promoter	cytosol	binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.18)		CCAGCTCCTGGACATCACCGT	0.348													4	72	---	---	---	---	PASS
C22orf9	23313	broad.mit.edu	37	22	45601765	45601765	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45601765A>C	uc003bfx.1	-	3	311	c.245T>G	c.(244-246)GTG>GGG	p.V82G	C22orf9_uc010gzw.1_5'UTR|C22orf9_uc003bfv.1_Missense_Mutation_p.V91G|C22orf9_uc003bfw.1_Missense_Mutation_p.V87G|C22orf9_uc010gzx.2_Missense_Mutation_p.V64G	NM_001009880	NP_001009880	Q6ICG6	K0930_HUMAN	hypothetical protein LOC23313 isoform b	82							protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|READ - Rectum adenocarcinoma(1;0.000617)|Colorectal(1;0.0024)		CCGCCGGTACACCTCCACCTC	0.612													31	52	---	---	---	---	PASS
GPRASP1	9737	broad.mit.edu	37	X	101910199	101910199	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101910199G>T	uc004ejj.3	+	5	2159	c.1358G>T	c.(1357-1359)AGT>ATT	p.S453I	GPRASP1_uc004eji.3_Missense_Mutation_p.S453I|GPRASP1_uc010nod.2_Missense_Mutation_p.S453I	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting	453						cytoplasm	protein binding			ovary(1)|lung(1)	2						GGGGCTAGCAGTAAATCCAGA	0.507													54	153	---	---	---	---	PASS
TEX13B	56156	broad.mit.edu	37	X	107224290	107224290	+	3'UTR	SNP	C	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107224290C>A	uc004enn.1	-	3						NM_031273	NP_112563	Q9BXU2	TX13B_HUMAN	testis expressed 13B											ovary(1)	1						TGGGCCTCCACATCTGACCAC	0.552													6	188	---	---	---	---	PASS
COL4A5	1287	broad.mit.edu	37	X	107868987	107868987	+	Silent	SNP	T	G	G			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107868987T>G	uc004enz.1	+	35	3271	c.3069T>G	c.(3067-3069)CCT>CCG	p.P1023P	COL4A5_uc011mso.1_Silent_p.P1023P|COL4A5_uc004eob.1_Silent_p.P631P	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	1023	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						TAGGACCTCCTGGACTTAAAG	0.413									Alport_syndrome_with_Diffuse_Leiomyomatosis				14	100	---	---	---	---	PASS
LRCH2	57631	broad.mit.edu	37	X	114398272	114398272	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114398272G>T	uc010nqe.2	-	11	1461	c.1430C>A	c.(1429-1431)GCT>GAT	p.A477D	LRCH2_uc004epz.2_Missense_Mutation_p.A477D	NM_020871	NP_065922	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH)	477										ovary(1)	1						TAACTGAGCAGCTATTTTCCT	0.333													10	19	---	---	---	---	PASS
AIFM1	9131	broad.mit.edu	37	X	129265759	129265759	+	Silent	SNP	G	A	A	rs146608893		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129265759G>A	uc004evg.2	-	14	1642	c.1464C>T	c.(1462-1464)CCC>CCT	p.P488P	AIFM1_uc011mur.1_Silent_p.P136P|AIFM1_uc011mus.1_3'UTR|AIFM1_uc004evh.2_Silent_p.P484P|AIFM1_uc004evi.2_Silent_p.P201P|AIFM1_uc004evk.2_RNA	NM_004208	NP_004199	O95831	AIFM1_HUMAN	programmed cell death 8 isoform 1	488					activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding	p.P488P(1)|p.P484P(1)		ovary(4)|central_nervous_system(1)	5						AGCCAACATCGGGGCCCAAAT	0.458													63	178	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3946	3946	+	RNA	SNP	G	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3946G>A	uc004cos.3	+	2		c.2239G>A			uc011mfh.1_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP47.																		GCTTCAACATCGAATACGCCG	0.473													9	3	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	19347283	19347283	+	IGR	DEL	A	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19347283delA								IFFO2 (64457 upstream) : UBR4 (51321 downstream)																							actctgtcagaaaaaaaaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	25301653	25301654	+	IGR	INS	-	GGAA	GGAA	rs7547501	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25301653_25301654insGGAA								RUNX3 (10041 upstream) : SYF2 (247113 downstream)																							tagaAGCAGATggaaggaagga	0.015													4	5	---	---	---	---	
TCTEX1D1	200132	broad.mit.edu	37	1	67242261	67242262	+	Intron	DEL	TA	-	-	rs60960124		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67242261_67242262delTA	uc001dcv.2	+						TCTEX1D1_uc009wau.2_Intron|TCTEX1D1_uc009wav.2_Intron	NM_152665	NP_689878	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1												0						tgtgtgtgtgtATATACATAAA	0.233													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121137791	121137796	+	IGR	DEL	CCACCG	-	-	rs28552466	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121137791_121137796delCCACCG								FCGR1B (201847 upstream) : LOC647121 (123114 downstream)																							ATTTCGCCCTCCACCGCCGCCGCCAC	0.631													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	151742420	151742420	+	IGR	DEL	C	-	-	rs35221320		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151742420delC								OAZ3 (-1385 upstream) : OAZ3 (-6975 downstream)																							tggcggcacgcgcctgcaatc	0.000													2	5	---	---	---	---	
CFHR4	10877	broad.mit.edu	37	1	196883940	196883941	+	Intron	INS	-	A	A	rs35868341		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196883940_196883941insA	uc001gto.2	+						CFHR4_uc009wyy.2_Intron|CFHR4_uc001gtp.2_Intron	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor							extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						TCTTGAGACTTAAAAAAAAAAA	0.208													12	7	---	---	---	---	
IGFN1	91156	broad.mit.edu	37	1	201195812	201195812	+	Intron	DEL	A	-	-	rs34207437		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201195812delA	uc001gwc.2	+						IGFN1_uc001gwb.2_Intron	NM_178275	NP_840059			RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;											ovary(2)|pancreas(1)	3						TATTAGCTACAAAAAAAAATC	0.363													4	2	---	---	---	---	
WDR64	128025	broad.mit.edu	37	1	241876710	241876718	+	Intron	DEL	AGGAAGGGA	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241876710_241876718delAGGAAGGGA	uc001hze.1	+						WDR64_uc001hzf.1_Intron			B1ANS9	WDR64_HUMAN	RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			ggagggagggaggaagggaaggaagggaa	0.014													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34041837	34041838	+	IGR	INS	-	CCTCC	CCTCC	rs141683394	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34041837_34041838insCCTCC								MYADML (88553 upstream) : None (None downstream)																							tcttctcttctcctcccctccc	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129393430	129393437	+	IGR	DEL	CCTTCCTT	-	-	rs72091728		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129393430_129393437delCCTTCCTT								HS6ST1 (317259 upstream) : None (None downstream)																							tccctccctcccttccttccttccttcc	0.192													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133034808	133034808	+	IGR	DEL	G	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133034808delG								NCRNA00164 (19266 upstream) : GPR39 (139339 downstream)																							aaggaaggaaggaaggaagga	0.209													10	8	---	---	---	---	
SLC25A12	8604	broad.mit.edu	37	2	172693471	172693472	+	Intron	DEL	CA	-	-	rs3836020		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172693471_172693472delCA	uc002uhh.2	-						SLC25A12_uc010fqh.2_Intron|SLC25A12_uc010zdv.1_Intron	NM_003705	NP_003696	O75746	CMC1_HUMAN	solute carrier family 25, member 12						gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	cacacacatgcacacacacaca	0.282													4	5	---	---	---	---	
DIRC3	729582	broad.mit.edu	37	2	218206959	218206962	+	Intron	DEL	GGAA	-	-	rs10604373		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218206959_218206962delGGAA	uc002vgn.1	-						DIRC3_uc002vgo.2_Intron					Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0						gagggaggacggaaggaaggaagg	0.142													5	3	---	---	---	---	
DNAH1	25981	broad.mit.edu	37	3	52360871	52360871	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52360871delC	uc011bef.1	+	5	963	c.702delC	c.(700-702)GGCfs	p.G234fs	DNAH1_uc003ddt.1_Frame_Shift_Del_p.G234fs	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	234	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TCGAACAGGGCCATGACCCAA	0.597													19	9	---	---	---	---	
SMC4	10051	broad.mit.edu	37	3	160131533	160131534	+	Intron	INS	-	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160131533_160131534insA	uc003fdh.2	+						IFT80_uc003fda.2_Intron|SMC4_uc003fdf.1_Intron|SMC4_uc003fdg.1_Intron|SMC4_uc010hwc.1_Intron|SMC4_uc003fdi.2_Intron|SMC4_uc003fdj.2_Intron|SMC4_uc010hwd.2_Intron|SMC4_uc003fdl.2_5'Flank	NM_001002800	NP_001002800	Q9NTJ3	SMC4_HUMAN	SMC4 structural maintenance of chromosomes						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	ATP binding|protein heterodimerization activity			ovary(1)|breast(1)	2			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CCCCCTTAGTGAAAAAAAAAAA	0.396													4	2	---	---	---	---	
PPM1L	151742	broad.mit.edu	37	3	160672742	160672744	+	Intron	DEL	TCC	-	-	rs72365532	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160672742_160672744delTCC	uc003fdr.2	+						PPM1L_uc003fds.2_Intron|PPM1L_uc003fdt.2_Intron|PPM1L_uc010hwf.2_Intron	NM_139245	NP_640338	Q5SGD2	PPM1L_HUMAN	protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			cttccttccttccttcctttcct	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	191759442	191759443	+	IGR	INS	-	AAA	AAA	rs60225141		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191759442_191759443insAAA								PYDC2 (580199 upstream) : FGF12 (100241 downstream)																							aaggaaggaaggaaggaaggaa	0.054													4	4	---	---	---	---	
RGS12	6002	broad.mit.edu	37	4	3416752	3416764	+	Intron	DEL	CGTGTGAGAGGGA	-	-	rs145348636	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3416752_3416764delCGTGTGAGAGGGA	uc003ggw.2	+						RGS12_uc003ggu.2_Intron|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_Intron|RGS12_uc003ggv.2_Intron|RGS12_uc003ggy.1_Intron|RGS12_uc010ict.1_Intron|RGS12_uc003ggz.2_Intron|RGS12_uc010icu.1_Intron|RGS12_uc011bvs.1_Intron|RGS12_uc003gha.2_Intron|RGS12_uc010icv.2_Intron|RGS12_uc003ghb.2_Intron	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1							condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		gtgagaggggcgtgtgagagggacgtgtgagag	0.070													4	2	---	---	---	---	
CC2D2A	57545	broad.mit.edu	37	4	15524738	15524738	+	Intron	DEL	A	-	-	rs142926881		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15524738delA	uc010idv.2	+						CC2D2A_uc003gnx.2_Intron|CC2D2A_uc003gnv.2_Intron	NM_001080522	NP_001073991	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A isoform						cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3						actccatctcaaaaaaaaaaa	0.109													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49141738	49141738	+	IGR	DEL	A	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49141738delA								CWH43 (77645 upstream) : None (None downstream)																							attccattctattccattcca	0.000													4	2	---	---	---	---	
EXOC1	55763	broad.mit.edu	37	4	56770418	56770419	+	Intron	INS	-	AT	AT			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56770418_56770419insAT	uc003hbe.1	+						EXOC1_uc003hbf.1_Intron|EXOC1_uc003hbg.1_Intron	NM_018261	NP_060731	Q9NV70	EXOC1_HUMAN	exocyst complex component 1 isoform 1						exocytosis|protein transport	exocyst	protein binding			ovary(2)|skin(2)|lung(1)|central_nervous_system(1)	6	Glioma(25;0.08)|all_neural(26;0.101)					atactaCCCAAATTCTTAGAAT	0.163													47	22	---	---	---	---	
TMPRSS11D	9407	broad.mit.edu	37	4	68725580	68725581	+	Intron	INS	-	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68725580_68725581insT	uc003hdq.2	-						LOC550112_uc003hdl.3_Intron|TMPRSS11D_uc011caj.1_Intron	NM_004262	NP_004253	O60235	TM11D_HUMAN	transmembrane protease, serine 11D						proteolysis|respiratory gaseous exchange	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						TTTCTTTCAAGTTTTTTTTTTC	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	111323431	111323447	+	IGR	DEL	TTCCTTCCTTCCTCCCT	-	-	rs6817024		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111323431_111323447delTTCCTTCCTTCCTCCCT								ELOVL6 (203611 upstream) : ENPEP (73782 downstream)																							ccttccttccttccttccttcctcccttcccttccct	0.097													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	154050791	154050793	+	IGR	DEL	ACT	-	-	rs148451405	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154050791_154050793delACT								FHDC1 (149943 upstream) : TRIM2 (23477 downstream)																							caccatcaccactaccaccacca	0.000													4	2	---	---	---	---	
HCN1	348980	broad.mit.edu	37	5	45402915	45402916	+	Intron	INS	-	TCCT	TCCT			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45402915_45402916insTCCT	uc003jok.2	-							NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic							integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						cctttctttcctccttccttcc	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	77963737	77963739	+	IGR	DEL	TCC	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77963737_77963739delTCC								LHFPL2 (19089 upstream) : ARSB (109300 downstream)																							ctcatctgtatcctcctcctcct	0.148													4	2	---	---	---	---	
HSD17B4	3295	broad.mit.edu	37	5	118861408	118861409	+	Intron	INS	-	T	T	rs12659452		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118861408_118861409insT	uc003ksj.2	+						HSD17B4_uc011cwg.1_Intron|HSD17B4_uc011cwh.1_Intron|HSD17B4_uc011cwi.1_Intron|HSD17B4_uc003ksk.3_Intron|HSD17B4_uc011cwj.1_Intron|HSD17B4_uc010jcn.1_Intron|HSD17B4_uc010jco.1_Intron	NM_000414	NP_000405	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4						bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)	ttcctgttttgttttttttttt	0.213													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	133759104	133759104	+	IGR	DEL	A	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133759104delA								CDKN2AIPNL (11515 upstream) : PHF15 (100962 downstream)																							aaaacaaaacaaaaaaaaaAA	0.134													4	2	---	---	---	---	
ARHGAP26	23092	broad.mit.edu	37	5	142421287	142421288	+	Intron	INS	-	A	A	rs66720832		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142421287_142421288insA	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGAGAAAATGAAAAAAAAAAA	0.406													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	165019311	165019314	+	IGR	DEL	GAAG	-	-	rs112356683		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165019311_165019314delGAAG								None (None upstream) : None (None downstream)																							aggaaggaaagaaggaaggaagga	0.235													3	4	---	---	---	---	
TMEM14B	81853	broad.mit.edu	37	6	10756864	10756864	+	3'UTR	DEL	A	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10756864delA	uc003mzk.3	+	6					SYCP2L_uc011dim.1_Intron|TMEM14B_uc010jor.2_3'UTR|TMEM14B_uc010jos.1_Intron	NM_030969	NP_112231	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B isoform a							integral to membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				CATTTTACCTAAAAAAAAAAA	0.368													14	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	12628850	12628865	+	IGR	DEL	CCTCCCTCCCTCCCTT	-	-	rs146594740		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12628850_12628865delCCTCCCTCCCTCCCTT								EDN1 (331424 upstream) : PHACTR1 (88023 downstream)																							ttccttcctccctccctccctcccttccttccttcc	0.102													5	3	---	---	---	---	
KCTD20	222658	broad.mit.edu	37	6	36437782	36437783	+	Intron	INS	-	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36437782_36437783insA	uc003ome.2	+						KCTD20_uc011dtm.1_Intron|KCTD20_uc011dtn.1_Intron|KCTD20_uc010jwk.2_Intron|KCTD20_uc011dto.1_Intron	NM_173562	NP_775833	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)	2						GAATTCCTTAGAAATCTGTTTT	0.356													13	7	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152456150	152456151	+	Intron	DEL	AC	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152456150_152456151delAC	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc003qop.3_Intron|SYNE1_uc011eez.1_Intron|SYNE1_uc003qoq.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AAAAAAAGAAACAACACTTACC	0.337										HNSCC(10;0.0054)			33	19	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	162656983	162656986	+	Intron	DEL	AAGA	-	-	rs76198933		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162656983_162656986delAAGA	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		ggaaggaaggaagaaaggaagaaa	0.069													4	2	---	---	---	---	
C7orf16	10842	broad.mit.edu	37	7	31735444	31735444	+	Intron	DEL	T	-	-	rs68028809		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31735444delT	uc003tcl.2	+						C7orf16_uc011kaf.1_Intron	NM_006658	NP_006649	O96001	GSUB_HUMAN	G-substrate isoform 1						behavior|central nervous system development|intracellular protein kinase cascade|protein phosphorylation	soluble fraction				ovary(2)|central_nervous_system(1)	3			GBM - Glioblastoma multiforme(11;0.216)			taaaagtttattttttttacc	0.065													3	3	---	---	---	---	
STAG3L4	64940	broad.mit.edu	37	7	66772494	66772495	+	Intron	INS	-	T	T	rs113583073		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66772494_66772495insT	uc003tvt.3	+						STAG3L4_uc010laj.2_Intron	NM_022906	NP_075057	Q8TBR4	STG34_HUMAN	stromal antigen 3-like 4												0		Lung NSC(55;0.0839)|all_lung(88;0.181)				TGCTTGATTCCTTTTTTTTTTT	0.272													3	3	---	---	---	---	
SEMA3A	10371	broad.mit.edu	37	7	83720640	83720641	+	Intron	INS	-	GA	GA			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83720640_83720641insGA	uc003uhz.2	-							NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor						axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						aaggaaggaagagagagagaga	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98821028	98821029	+	IGR	INS	-	T	T	rs56802756		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98821028_98821029insT								KPNA7 (15939 upstream) : MYH16 (49895 downstream)																							gaaggaaggGcgggcacggtgg	0.005													4	2	---	---	---	---	
THAP1	55145	broad.mit.edu	37	8	42694692	42694693	+	Intron	INS	-	T	T	rs144111248	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42694692_42694693insT	uc003xpk.2	-						THAP1_uc003xpl.2_Intron	NM_018105	NP_060575	Q9NVV9	THAP1_HUMAN	THAP domain containing, apoptosis associated						cell cycle|endothelial cell proliferation|regulation of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	sequence-specific DNA binding|zinc ion binding				0	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Acute lymphoblastic leukemia(644;0.000299)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0377)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TCATTTATTAATTTTTTAAAAA	0.124													4	2	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131199667	131199667	+	Intron	DEL	T	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131199667delT	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						CGTTACACCAttttttttttt	0.159													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	99649621	99649632	+	IGR	DEL	AAGAAAGAAAGA	-	-	rs10979441		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99649621_99649632delAAGAAAGAAAGA								ZNF782 (11765 upstream) : LOC441454 (21725 downstream)																							ggaaggaaggaagaaagaaagaaagatacgaa	0.005													3	3	---	---	---	---	
C9orf114	51490	broad.mit.edu	37	9	131586559	131586560	+	Intron	DEL	GT	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131586559_131586560delGT	uc004bwd.2	-						C9orf114_uc004bwe.2_Intron|C9orf114_uc010mym.2_Intron	NM_016390	NP_057474	Q5T280	CI114_HUMAN	hypothetical protein LOC51490												0						GAGCtgtgtggtgtgtgtgtgt	0.500													3	3	---	---	---	---	
TSC1	7248	broad.mit.edu	37	9	135780007	135780013	+	Intron	DEL	ACACTGG	-	-	rs142817620		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135780007_135780013delACACTGG	uc004cca.2	-						TSC1_uc004ccb.3_Intron|TSC1_uc011mcq.1_Intron|TSC1_uc011mcr.1_Intron	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1						activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.?(1)		lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		GGAGAAGCCTACACTGGACACAATGGG	0.478			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				6	3	---	---	---	---	
GATA3	2625	broad.mit.edu	37	10	8106275	8106275	+	Intron	DEL	T	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8106275delT	uc001ika.2	+						GATA3_uc001ijz.2_Intron	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2						aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						cttcttcttcttttttttttt	0.313			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34220055	34220056	+	IGR	INS	-	TTCCTTCCTTCC	TTCCTTCCTTCC			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34220055_34220056insTTCCTTCCTTCC								NRP1 (596049 upstream) : PARD3 (180042 downstream)																							AGATAAGTGGAttccttccttc	0.188													4	3	---	---	---	---	
PRKG1	5592	broad.mit.edu	37	10	53387639	53387639	+	Intron	DEL	C	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53387639delC	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		tccttcccttcccttcccttc	0.040													4	2	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	57298607	57298610	+	Intron	DEL	TTCC	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57298607_57298610delTTCC	uc001jjv.1	-							NM_001142770	NP_001136242	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-2 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				ccttcctcctttccttccttcctt	0.000										HNSCC(58;0.16)			4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	78887325	78887328	+	Intron	DEL	AGGA	-	-	rs72447373		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78887325_78887328delAGGA	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	TAGAGAAAATaggaaggaaggaag	0.230													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	81788176	81788176	+	IGR	DEL	A	-	-	rs35380147		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81788176delA								MBL1P (77393 upstream) : LOC219347 (17815 downstream)																							AGCTGTGCATATCTGGACTCC	0.443													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113498052	113498053	+	IGR	INS	-	AAAGG	AAAGG			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113498052_113498053insAAAGG								DRD2 (151639 upstream) : TMPRSS5 (60216 downstream)																							ggaaggaaggaaggaaggaagg	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115497786	115497786	+	IGR	DEL	T	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115497786delT								CADM1 (122545 upstream) : None (None downstream)																							ttccccctccttttttttttt	0.000													5	4	---	---	---	---	
IPO8	10526	broad.mit.edu	37	12	30827141	30827142	+	Intron	INS	-	A	A			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30827141_30827142insA	uc001rjd.2	-						IPO8_uc010sjt.1_Intron	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8						intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CTTTTTTTCCCACAAGCCACAA	0.361													4	3	---	---	---	---	
TMPO	7112	broad.mit.edu	37	12	98914051	98914062	+	Intron	DEL	CCTTCCTTCCTT	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98914051_98914062delCCTTCCTTCCTT	uc001tfj.2	+						TMPO_uc001tfi.1_Intron|TMPO_uc001tfk.2_Intron|TMPO_uc001tfl.2_Intron|TMPO_uc001tfh.1_Intron	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta							integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						CATATTTTTCccttccttccttccttccttcc	0.038													3	3	---	---	---	---	
XPO4	64328	broad.mit.edu	37	13	21360040	21360041	+	Intron	INS	-	GAAG	GAAG	rs57419802		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21360040_21360041insGAAG	uc001unq.3	-							NM_022459	NP_071904	Q9C0E2	XPO4_HUMAN	exportin 4						protein transport	cytoplasm|nucleus	protein binding			large_intestine(1)|ovary(1)|kidney(1)	3		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		agaaagaaagaggagggaggaa	0.069													4	5	---	---	---	---	
PRKD1	5587	broad.mit.edu	37	14	30389222	30389225	+	Intron	DEL	GGAA	-	-	rs71443338		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30389222_30389225delGGAA	uc001wqh.2	-							NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1						cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		aaggaaggagggaaggaaggaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	71326184	71326184	+	IGR	DEL	T	-	-	rs35480879		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71326184delT								MAP3K9 (50296 upstream) : PCNX (47938 downstream)																							aacaattcccttcttttgctc	0.154													3	4	---	---	---	---	
YLPM1	56252	broad.mit.edu	37	14	75287731	75287731	+	Intron	DEL	T	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75287731delT	uc001xqj.3	+						YLPM1_uc001xql.3_Intron|YLPM1_uc001xqm.1_Intron	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TAACTCAGTCTTTTTTTTTTT	0.353													4	2	---	---	---	---	
SNRPA1	6627	broad.mit.edu	37	15	101833200	101833200	+	Intron	DEL	A	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101833200delA	uc002bww.2	-						SNRPA1_uc002bwx.2_Intron|SNRPA1_uc010bpc.2_Intron	NM_003090	NP_003081	P09661	RU2A_HUMAN	small nuclear ribonucleoprotein polypeptide A'							catalytic step 2 spliceosome|nucleoplasm|U2 snRNP	protein binding|RNA binding			kidney(1)	1	Lung NSC(78;0.00156)|all_lung(78;0.00195)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00113)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ACTCTAGGGGAAAAAATTACT	0.328													63	28	---	---	---	---	
EMP2	2013	broad.mit.edu	37	16	10631618	10631619	+	Intron	DEL	CA	-	-	rs34790340		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10631618_10631619delCA	uc002czx.2	-							NM_001424	NP_001415	P54851	EMP2_HUMAN	epithelial membrane protein 2						cell proliferation	integral to membrane					0						TGCATGCGCCcacacacacaca	0.342													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33371342	33371342	+	IGR	DEL	G	-	-	rs28624695		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33371342delG								SLC6A10P (474879 upstream) : MIR1826 (594166 downstream)																							acttgaacccggggggcagag	0.020													5	5	---	---	---	---	
VPS35	55737	broad.mit.edu	37	16	46694732	46694733	+	Intron	INS	-	AA	AA	rs33973421		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46694732_46694733insAA	uc002eef.3	-						VPS35_uc002eed.2_3'UTR|VPS35_uc002eee.2_Intron	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35						protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TACTGACTATCAAAAAAAAAAA	0.203													4	3	---	---	---	---	
PHKB	5257	broad.mit.edu	37	16	47598870	47598870	+	Intron	DEL	T	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47598870delT	uc002eev.3	+						PHKB_uc002eeu.3_Intron	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				tctgtgtgtctttttttTTTT	0.194													4	2	---	---	---	---	
CCDC135	84229	broad.mit.edu	37	16	57764612	57764613	+	Intron	INS	-	CT	CT	rs140947586	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57764612_57764613insCT	uc002emi.2	+						CCDC135_uc002emj.2_Intron|CCDC135_uc002emk.2_Intron	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135							cytoplasm				central_nervous_system(1)	1						AGTCTTGCCCCGTTCTGATCTC	0.307													0	6	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81253526	81253527	+	Intron	INS	-	TTATT	TTATT	rs141224532	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81253526_81253527insTTATT	uc002fgh.1	-						PKD1L2_uc002fgj.2_Intron	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						ttagacatgaattatttaatcc	0.282													8	6	---	---	---	---	
TUBB3	10381	broad.mit.edu	37	16	89996502	89996505	+	Intron	DEL	TTCC	-	-	rs113176575		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89996502_89996505delTTCC	uc002fph.1	+						TUBB3_uc002fpf.2_Intron|TUBB3_uc010ciz.1_Intron|TUBB3_uc010cja.1_Intron|TUBB3_uc002fpg.1_Intron|TUBB3_uc002fpi.1_Intron|TUBB3_uc002fpj.1_5'Flank|TUBB3_uc010cjb.1_5'Flank	NM_006086	NP_006077	Q13509	TBB3_HUMAN	tubulin, beta, 4						'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(2)|pancreas(1)	3		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		tcttccttcattccttccttcctt	0.044													4	2	---	---	---	---	
MPDU1	9526	broad.mit.edu	37	17	7488855	7488856	+	Intron	DEL	CA	-	-	rs140696498		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7488855_7488856delCA	uc002ghw.2	+						MPDU1_uc010vub.1_Intron|MPDU1_uc002ghx.2_Intron|MPDU1_uc010vuc.1_Intron	NM_004870	NP_004861	O75352	MPU1_HUMAN	mannose-P-dolichol utilization defect 1						dolichol-linked oligosaccharide biosynthetic process|protein folding	endoplasmic reticulum membrane|integral to membrane|mitochondrion	protein binding			central_nervous_system(1)	1						actctgtctccaaaaaaaaaaa	0.257													1	5	---	---	---	---	
DCAKD	79877	broad.mit.edu	37	17	43101655	43101664	+	3'UTR	DEL	GTGTGTGTGT	-	-	rs10578787	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43101655_43101664delGTGTGTGTGT	uc002ihx.2	-	4					DCAKD_uc010daa.1_3'UTR|DCAKD_uc010dab.1_3'UTR	NM_024819	NP_079095	Q8WVC6	DCAKD_HUMAN	dephospho-CoA kinase domain containing						coenzyme A biosynthetic process		ATP binding|dephospho-CoA kinase activity				0		Prostate(33;0.155)				CGGAGAGTCCgtgtgtgtgtgtgtgtgtgt	0.410													5	3	---	---	---	---	
HOXB3	3213	broad.mit.edu	37	17	46655142	46655143	+	Intron	INS	-	C	C	rs151227265	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46655142_46655143insC	uc010dbf.2	-						HOXB3_uc010wlm.1_Intron|HOXB3_uc010dbg.2_Intron|HOXB3_uc010wlk.1_5'Flank|HOXB3_uc010wll.1_Intron|HOXB4_uc002inp.2_Intron	NM_002146	NP_002137	P14651	HXB3_HUMAN	homeobox B3						angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CCCCAGCTCAACCCCCCCCCAA	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	9636778	9636785	+	IGR	DEL	AAAGAAAG	-	-	rs72008380		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9636778_9636785delAAAGAAAG								PPP4R1 (22178 upstream) : RAB31 (71443 downstream)																							agaaagaaaaaaagaaagaaagaaagaa	0.000													4	2	---	---	---	---	
CEP192	55125	broad.mit.edu	37	18	13087800	13087800	+	Intron	DEL	C	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13087800delC	uc010xac.1	+						CEP192_uc010dlf.1_Intron|CEP192_uc010xad.1_Intron|CEP192_uc002kru.2_Intron|CEP192_uc002krv.2_Intron|CEP192_uc002krw.2_Intron|CEP192_uc002krx.2_Intron|CEP192_uc002kry.2_5'Flank	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa											ovary(4)|pancreas(1)	5						TGATGAGCTACCACAATGTGA	0.368													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	21249349	21249352	+	IGR	DEL	TTCT	-	-	rs71163630		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21249349_21249352delTTCT								ANKRD29 (6500 upstream) : LAMA3 (20210 downstream)																							ccttccttccttctttccttcttt	0.005													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	63778799	63778800	+	IGR	INS	-	GAA	GAA	rs148360663	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63778799_63778800insGAA								CDH7 (230625 upstream) : CDH19 (392521 downstream)																							aaggaaggaaggaaggaaggag	0.000													6	3	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153066	7153066	+	Intron	DEL	A	-	-	rs113402674		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153066delA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	acacccccccacacacacaca	0.050													4	4	---	---	---	---	
TASP1	55617	broad.mit.edu	37	20	13514975	13514976	+	Intron	INS	-	T	T	rs144596064	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13514975_13514976insT	uc002woi.2	-						TASP1_uc010zri.1_Intron|TASP1_uc002woh.2_Intron|TASP1_uc010zrj.1_Intron	NM_017714	NP_060184	Q9H6P5	TASP1_HUMAN	taspase 1 precursor						asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0						AAGTCAAAATGTATTTTCCACC	0.307													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	32479566	32479566	+	IGR	DEL	T	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32479566delT								CHMP4B (37397 upstream) : RALY (102166 downstream)																							tctatctttcttttttctttc	0.000													5	4	---	---	---	---	
RBM11	54033	broad.mit.edu	37	21	15585613	15585616	+	5'Flank	DEL	TTCC	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15585613_15585616delTTCC	uc002yjo.3	+						RBM11_uc002yjn.3_5'Flank|RBM11_uc002yjp.3_5'Flank	NM_144770	NP_658983	P57052	RBM11_HUMAN	RNA binding motif protein 11								nucleotide binding|RNA binding				0				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		CCAAcctcctttccttccttcctt	0.137													8	4	---	---	---	---	
MEI1	150365	broad.mit.edu	37	22	42101712	42101713	+	Intron	INS	-	T	T	rs71946635		TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42101712_42101713insT	uc003baz.1	+						MEI1_uc003bay.3_Intron|MEI1_uc011apd.1_Intron	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2						ttgttttttacttttttttttt	0.158													6	3	---	---	---	---	
DHRSX	207063	broad.mit.edu	37	X	2403830	2403830	+	Intron	DEL	A	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2403830delA	uc004cqf.3	-							NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				gaaaagggagagaagggagag	0.000													4	2	---	---	---	---	
USP9X	8239	broad.mit.edu	37	X	41046083	41046084	+	Intron	INS	-	T	T			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41046083_41046084insT	uc004dfb.2	+						USP9X_uc004dfc.2_Intron	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform						BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						AGATGGGGTGAttttttttttt	0.129													5	3	---	---	---	---	
SHROOM4	57477	broad.mit.edu	37	X	50378792	50378792	+	Intron	DEL	G	-	-	rs5915290	by1000genomes	TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50378792delG	uc004dpe.2	-						SHROOM4_uc004dpd.3_Intron|SHROOM4_uc004dpf.1_Intron	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4						actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					AAAAAAAAAAGGGGGAAGAAA	0.483													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	78221260	78221266	+	IGR	DEL	TTTCTTT	-	-			TCGA-BP-4972-01A-01D-1462-08	TCGA-BP-4972-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78221260_78221266delTTTCTTT								P2RY10 (3823 upstream) : GPR174 (205203 downstream)																							tctttctttctttctttctttctttct	0.000													4	2	---	---	---	---	
