Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
COL8A2	1296	broad.mit.edu	37	1	36564618	36564618	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36564618C>A	uc001bzv.1	-	2	671	c.664G>T	c.(664-666)GGG>TGG	p.G222W	COL8A2_uc001bzw.1_Missense_Mutation_p.G157W	NM_005202	NP_005193	P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2 precursor	222	Triple-helical region.				angiogenesis|cell-cell adhesion|extracellular matrix organization	basement membrane|collagen	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGGGCACCCCCCTGCCCTGGG	0.721													11	12	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	154042867	154042867	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154042867A>C	uc001fdw.2	-	17	2508	c.2436T>G	c.(2434-2436)AAT>AAG	p.N812K	NUP210L_uc009woq.2_5'UTR|NUP210L_uc010peh.1_Missense_Mutation_p.N812K	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	812						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GTGAACTGAAATTATCAAACT	0.358													50	88	---	---	---	---	PASS
URB2	9816	broad.mit.edu	37	1	229773797	229773797	+	Missense_Mutation	SNP	C	T	T	rs141779194		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229773797C>T	uc001hts.1	+	4	3573	c.3437C>T	c.(3436-3438)ACG>ATG	p.T1146M	URB2_uc009xfd.1_Missense_Mutation_p.T1146M	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	1146						nucleolus				central_nervous_system(2)|ovary(1)	3						AGCGACAGGACGCTGCTCTCC	0.582													27	69	---	---	---	---	PASS
CNNM3	26505	broad.mit.edu	37	2	97493923	97493923	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97493923C>T	uc002swy.2	+	5	1801	c.1777C>T	c.(1777-1779)CCA>TCA	p.P593S	CNNM3_uc002swz.2_Missense_Mutation_p.P545S	NM_017623	NP_060093	Q8NE01	CNNM3_HUMAN	cyclin M3 isoform 1	593					ion transport	integral to membrane|plasma membrane	protein binding			ovary(1)	1						CCTAACTGTGCCATCCTCGGG	0.607													3	34	---	---	---	---	PASS
BHLHE40	8553	broad.mit.edu	37	3	5025495	5025495	+	3'UTR	SNP	G	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5025495G>A	uc003bqf.2	+	5					BHLHE40_uc011asw.1_3'UTR	NM_003670	NP_003661	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40							Golgi apparatus|nucleolus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						ATAATCTGAGGCATGGAGAGC	0.284													4	6	---	---	---	---	PASS
CTNNB1	1499	broad.mit.edu	37	3	41275110	41275110	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41275110A>G	uc010hia.1	+	10	1432	c.1276A>G	c.(1276-1278)AAC>GAC	p.N426D	CTNNB1_uc003ckp.2_Missense_Mutation_p.N426D|CTNNB1_uc003ckq.2_Missense_Mutation_p.N426D|CTNNB1_uc003ckr.2_Missense_Mutation_p.N426D|CTNNB1_uc011azf.1_Missense_Mutation_p.N419D|CTNNB1_uc011azg.1_Missense_Mutation_p.N354D|CTNNB1_uc003cks.2_Missense_Mutation_p.N29D|CTNNB1_uc003ckt.1_5'Flank	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	426	ARM 7.			N->A: Abolishes TCF7L2 and LEF1 binding.	adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding		CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	AATTCTTTCTAACCTCACTTG	0.468		15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				84	98	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52643770	52643770	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52643770A>G	uc003des.2	-	16	2138	c.2126T>C	c.(2125-2127)ATT>ACT	p.I709T	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.I709T|PBRM1_uc003der.2_Missense_Mutation_p.I677T|PBRM1_uc003det.2_Missense_Mutation_p.I724T|PBRM1_uc003deu.2_Missense_Mutation_p.I724T|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.I709T|PBRM1_uc010hmk.1_Missense_Mutation_p.I709T|PBRM1_uc003dey.2_Missense_Mutation_p.I709T|PBRM1_uc003dez.1_Missense_Mutation_p.I709T|PBRM1_uc003dfb.1_Missense_Mutation_p.I622T|PBRM1_uc003dfa.1_Missense_Mutation_p.I55T|PBRM1_uc003dfc.2_Missense_Mutation_p.I76T	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	709	Bromo 5.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GTGACTTCGAATTTTTTCCAT	0.438			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								75	69	---	---	---	---	PASS
NPHP3	27031	broad.mit.edu	37	3	132418875	132418875	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132418875G>T	uc003epe.1	-	12	1851	c.1774C>A	c.(1774-1776)CTG>ATG	p.L592M	NPHP3_uc003epd.1_Translation_Start_Site|NPHP3_uc003epf.1_Missense_Mutation_p.L347M	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3	592					maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						TCCAGTGTCAGAGCAGAGACT	0.443													25	47	---	---	---	---	PASS
RBPJ	3516	broad.mit.edu	37	4	26426100	26426100	+	Silent	SNP	C	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26426100C>T	uc003grx.1	+	7	908	c.672C>T	c.(670-672)CTC>CTT	p.L224L	RBPJ_uc003gry.1_Silent_p.L209L|RBPJ_uc003grz.1_Silent_p.L224L|RBPJ_uc011bxt.1_Silent_p.L224L|RBPJ_uc003gsa.1_Silent_p.L210L|RBPJ_uc003gsb.1_Silent_p.L211L|RBPJ_uc003gsc.1_Silent_p.L210L	NM_005349	NP_005340	Q06330	SUH_HUMAN	recombining binding protein suppressor of	224					DNA recombination|negative regulation of transcription, DNA-dependent|positive regulation of transcription of Notch receptor target	cytoplasm|nucleolus|nucleoplasm	DNA binding|protein binding|recombinase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)	3		Breast(46;0.0503)				TTATTCATCTCTGTGAGTATA	0.348													60	107	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89979836	89979836	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89979836G>C	uc003kju.2	+	28	6194	c.6098G>C	c.(6097-6099)AGA>ACA	p.R2033T	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2033	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AATTTAGCGAGAGCAACTCAA	0.378													30	83	---	---	---	---	PASS
PCDHB15	56121	broad.mit.edu	37	5	140625223	140625223	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140625223C>T	uc003lje.2	+	1	77	c.77C>T	c.(76-78)GCA>GTA	p.A26V		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	26					homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTGACTCTGGCAGGCTGGGAA	0.537													28	93	---	---	---	---	PASS
ATP10B	23120	broad.mit.edu	37	5	160061395	160061395	+	Silent	SNP	G	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160061395G>A	uc003lym.1	-	12	2194	c.1347C>T	c.(1345-1347)ACC>ACT	p.T449T	ATP10B_uc003lyp.2_Silent_p.T449T|ATP10B_uc011deg.1_Silent_p.T493T|ATP10B_uc003lyn.2_Silent_p.T7T|ATP10B_uc003lyo.2_Silent_p.T421T	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	449	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGCCCATGATGGTGCAACGTC	0.507													25	291	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168098202	168098202	+	Splice_Site	SNP	C	G	G			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168098202C>G	uc003mab.2	-	34	4547	c.4127_splice	c.e34+1	p.R1376_splice	SLIT3_uc010jjg.2_Splice_Site_p.R1383_splice	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGGACACTGACCTGTGGCCGA	0.667													21	21	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169477270	169477270	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169477270T>A	uc003maf.2	+	41	4162	c.4082T>A	c.(4081-4083)TTC>TAC	p.F1361Y	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.F853Y	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1361	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AACAAAGTGTTCATCTACCGC	0.507													97	304	---	---	---	---	PASS
GTF2IRD2P1	401375	broad.mit.edu	37	7	72664015	72664015	+	5'UTR	SNP	C	G	G			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72664015C>G	uc003txs.1	-	11					FKBP6_uc003twz.2_Intron	NR_002164				RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;												0						ATACCACCCCCGGGGCATGCC	0.507													3	23	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128484237	128484237	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128484237A>G	uc003vnz.3	+	20	3318	c.3109A>G	c.(3109-3111)AAG>GAG	p.K1037E	FLNC_uc003voa.3_Missense_Mutation_p.K1037E	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1037	Filamin 8.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GGGGCCCTACAAGGTGGATAT	0.662													11	28	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52732871	52732871	+	3'UTR	SNP	T	C	C	rs77261625	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732871T>C	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TTTTCAAGACTAAAGGAATTA	0.313													4	35	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117825304	117825304	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117825304G>A	uc004bjj.3	-	13	4287	c.3925C>T	c.(3925-3927)CGT>TGT	p.R1309C	TNC_uc010mvf.2_Missense_Mutation_p.R1309C	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1309	Fibronectin type-III 8.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						TCCATGGAACGCAGGCTGCCA	0.592													12	24	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141070935	141070935	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141070935C>T	uc004com.2	+	4	599	c.338C>T	c.(337-339)GCC>GTC	p.A113V	TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						CCCTACAACGCCACCCTCTCA	0.517													4	54	---	---	---	---	PASS
PNLIP	5406	broad.mit.edu	37	10	118321017	118321017	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118321017T>A	uc001lcm.2	+	12	1246	c.1203T>A	c.(1201-1203)AAT>AAA	p.N401K		NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor	401	PLAT.				lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	CTCATTCCAATGAATTTGACT	0.328													36	91	---	---	---	---	PASS
ART5	116969	broad.mit.edu	37	11	3659828	3659828	+	3'UTR	SNP	C	G	G			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3659828C>G	uc001lyb.1	-	4					ART5_uc001lyc.1_3'UTR|ART5_uc001lyd.2_3'UTR	NM_053017	NP_443750	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5 precursor							extracellular region	NAD(P)+-protein-arginine ADP-ribosyltransferase activity			ovary(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAAGTGGCTGCCTCAGTACTT	0.498													7	28	---	---	---	---	PASS
RRP8	23378	broad.mit.edu	37	11	6621304	6621304	+	3'UTR	SNP	G	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6621304G>A	uc001med.2	-	7						NM_015324	NP_056139	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase,						chromatin modification|chromatin silencing at rDNA|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	methylated histone residue binding|S-adenosylmethionine-dependent methyltransferase activity				0						TCACAGCCAGGCTGGAAACAG	0.507													15	46	---	---	---	---	PASS
PTPRJ	5795	broad.mit.edu	37	11	48166268	48166268	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48166268G>T	uc001ngp.3	+	13	2972	c.2617G>T	c.(2617-2619)GAT>TAT	p.D873Y		NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	873	Extracellular (Potential).|Fibronectin type-III 9.				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						CACGTATGAGGATTTCAAAAA	0.398													35	94	---	---	---	---	PASS
OR4C12	283093	broad.mit.edu	37	11	50003287	50003287	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50003287G>C	uc010ria.1	-	1	751	c.751C>G	c.(751-753)CCC>GCC	p.P251A		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	251	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						AATATACAGGGCACAAAGAAT	0.418													5	84	---	---	---	---	PASS
HNRNPUL2	221092	broad.mit.edu	37	11	62489317	62489317	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62489317G>T	uc001nuw.2	-	8	1650	c.1457C>A	c.(1456-1458)GCT>GAT	p.A486D	HNRNPUL2_uc001nuu.1_RNA	NM_001079559	NP_001073027	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like	486					cell killing	nucleus	ATP binding|nucleic acid binding				0						CACAGTCTCAGCTCCCAGGAC	0.438													102	251	---	---	---	---	PASS
LOC341056	341056	broad.mit.edu	37	11	122888720	122888720	+	RNA	SNP	C	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122888720C>T	uc010rzt.1	+	1		c.447C>T				NR_027288				full-length cDNA clone CS0DC021YJ17 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).												0						ATTTTTCACTCAATTTGATGC	0.443													54	132	---	---	---	---	PASS
NBEA	26960	broad.mit.edu	37	13	36220480	36220480	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36220480C>T	uc001uvb.2	+	50	7908	c.7702C>T	c.(7702-7704)CAC>TAC	p.H2568Y	NBEA_uc010abi.2_Missense_Mutation_p.H1224Y|NBEA_uc010tee.1_Missense_Mutation_p.H361Y|NBEA_uc010tef.1_Missense_Mutation_p.H361Y|NBEA_uc001uvd.2_Missense_Mutation_p.H146Y	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	2568						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CTCTGCCATGCACCTGGTAAG	0.433													10	30	---	---	---	---	PASS
SEMA6D	80031	broad.mit.edu	37	15	48053615	48053615	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48053615G>T	uc010bek.2	+	6	794	c.434G>T	c.(433-435)TGT>TTT	p.C145F	SEMA6D_uc001zvw.2_Missense_Mutation_p.C145F|SEMA6D_uc001zvx.1_Missense_Mutation_p.C145F|SEMA6D_uc001zvy.2_Missense_Mutation_p.C145F|SEMA6D_uc001zvz.2_Missense_Mutation_p.C145F|SEMA6D_uc001zwa.2_Missense_Mutation_p.C145F|SEMA6D_uc001zwb.2_Missense_Mutation_p.C145F|SEMA6D_uc001zwc.2_Missense_Mutation_p.C145F	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	145	Sema.|Extracellular (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AATCCCATGTGTAGATACTAC	0.343													32	71	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27715251	27715251	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27715251G>T	uc002dow.2	+	12	1345	c.1321G>T	c.(1321-1323)GTC>TTC	p.V441F	KIAA0556_uc002dox.1_Missense_Mutation_p.V349F	NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	441										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						CCTCCAGGCCGTCGAAAGTGA	0.448													42	100	---	---	---	---	PASS
GOT2	2806	broad.mit.edu	37	16	58750636	58750636	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58750636G>A	uc002eof.1	-	7	898	c.784C>T	c.(784-786)CGC>TGC	p.R262C	GOT2_uc010vim.1_Missense_Mutation_p.R219C	NM_002080	NP_002071	P00505	AATM_HUMAN	aspartate aminotransferase 2 precursor	262					aspartate catabolic process|fatty acid transport|gluconeogenesis|response to ethanol	mitochondrial matrix|plasma membrane	L-aspartate:2-oxoglutarate aminotransferase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	ATGAAGTGGCGCACAGCCCAG	0.473													4	94	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10610395	10610395	+	Silent	SNP	A	G	G			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10610395A>G	uc002moq.1	-	2	471	c.315T>C	c.(313-315)CCT>CCC	p.P105P	KEAP1_uc002mor.1_Silent_p.P105P	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	105	BTB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			CCTTGAAGACAGGGCTGGATG	0.602													14	41	---	---	---	---	PASS
ZNF223	7766	broad.mit.edu	37	19	44570596	44570596	+	Silent	SNP	G	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44570596G>A	uc002oyf.1	+	5	868	c.615G>A	c.(613-615)AAG>AAA	p.K205K	ZNF284_uc010ejd.2_RNA	NM_013361	NP_037493	Q9UK11	ZN223_HUMAN	zinc finger protein 223	205	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(69;0.0352)				AACTCTTTAAGTGTGACGTGT	0.428													123	172	---	---	---	---	PASS
HAS1	3036	broad.mit.edu	37	19	52216712	52216712	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52216712G>A	uc002pxo.1	-	5	1740	c.1705C>T	c.(1705-1707)CGG>TGG	p.R569W	HAS1_uc010epc.1_Missense_Mutation_p.R169W|HAS1_uc010epd.1_3'UTR|HAS1_uc002pxn.1_Missense_Mutation_p.R576W|HAS1_uc002pxp.1_Missense_Mutation_p.R568W	NM_001523	NP_001514	Q92839	HAS1_HUMAN	hyaluronan synthase 1	569	Extracellular (Potential).				cell adhesion	integral to plasma membrane	hyaluronan synthase activity|protein binding			ovary(1)|pancreas(1)	2		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CCGGTCCGCCGCCGGCAAAGC	0.716													3	8	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50717397	50717397	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50717397G>A	uc003bkv.3	-	28	4539	c.4433C>T	c.(4432-4434)CCG>CTG	p.P1478L	PLXNB2_uc003bkt.1_Missense_Mutation_p.P270L|PLXNB2_uc003bku.1_Missense_Mutation_p.P463L	NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	1478	Cytoplasmic (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GACCTTCACCGGGATGGCGTC	0.622													24	34	---	---	---	---	PASS
SBF1	6305	broad.mit.edu	37	22	50885210	50885210	+	3'UTR	SNP	A	G	G			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50885210A>G	uc003blh.2	-	41					SBF1_uc003ble.2_3'UTR|SBF1_uc003blf.2_3'UTR|SBF1_uc011arx.1_3'UTR	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1						protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		GCAGCCGGGGAGTGGGGAAGG	0.617													2	7	---	---	---	---	PASS
MFN2	9927	broad.mit.edu	37	1	12058607	12058611	+	Intron	DEL	AAAAC	-	-	rs113209787		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12058607_12058611delAAAAC	uc001atn.3	+						MFN2_uc009vni.2_Intron	NM_014874	NP_055689	O95140	MFN2_HUMAN	mitofusin 2						blood coagulation|mitochondrial fusion|mitochondrial membrane organization|mitochondrion localization|negative regulation of Ras protein signal transduction|negative regulation of smooth muscle cell proliferation|protein targeting to mitochondrion	cytosol|integral to membrane|intrinsic to mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		tcTATATCCAaaaacaaaacaaaac	0.195													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	32830052	32830052	+	5'Flank	DEL	T	-	-	rs111465260		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32830052delT	uc001bve.1	-											Homo sapiens cDNA FLJ36415 fis, clone THYMU2010917.																		TCAGACttccttttttttttt	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37568487	37568496	+	IGR	DEL	GGAAGAGGAG	-	-	rs12747649		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37568487_37568496delGGAAGAGGAG								GRIK3 (68643 upstream) : ZC3H12A (371623 downstream)																							aggaggaagaggaagaggagggaggaggag	0.000													6	5	---	---	---	---	
PLK3	1263	broad.mit.edu	37	1	45270777	45270778	+	Intron	INS	-	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45270777_45270778insA	uc001cmn.2	+						PLK3_uc001cmo.2_Intron	NM_004073	NP_004064	Q9H4B4	PLK3_HUMAN	polo-like kinase 3							membrane	ATP binding|protein binding|protein serine/threonine kinase activity				0	Acute lymphoblastic leukemia(166;0.155)					gactccatctcaaaaaaaaaaa	0.193													4	2	---	---	---	---	
ARHGAP29	9411	broad.mit.edu	37	1	94649704	94649707	+	Splice_Site	DEL	TACC	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94649704_94649707delTACC	uc001dqj.3	-	19	2616	c.2247_splice	c.e19+1	p.Q749_splice	ARHGAP29_uc009wdq.1_Splice_Site|ARHGAP29_uc001dqk.2_Splice_Site_p.Q315_splice	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1						Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TAAAAATTTTTACCTGCCGAAGGT	0.309													144	67	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	99657331	99657334	+	IGR	DEL	AAAC	-	-	rs819707	byFrequency	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99657331_99657334delAAAC								LPPR5 (186882 upstream) : LPPR4 (72566 downstream)																							ggaaggaaagaaACAAACAAACAA	0.157													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161716375	161716376	+	IGR	DEL	CT	-	-	rs151003373		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161716375_161716376delCT								FCRLB (18443 upstream) : DUSP12 (3205 downstream)																							tccttccttccttcTCTCTCTC	0.035													4	2	---	---	---	---	
GLT25D2	23127	broad.mit.edu	37	1	184006888	184006889	+	5'Flank	INS	-	GT	GT			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184006888_184006889insGT	uc001gqr.2	-						GLT25D2_uc010poj.1_5'Flank|GLT25D2_uc001gqs.2_5'Flank	NM_015101	NP_055916	Q8IYK4	GT252_HUMAN	glycosyltransferase 25 domain containing 2						lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity			ovary(1)|breast(1)	2						TGAGCCtgtgagtgtgtgtgtg	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	184320782	184320783	+	IGR	INS	-	AAGG	AAGG	rs141740434	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184320782_184320783insAAGG								TSEN15 (277441 upstream) : C1orf21 (35367 downstream)																							CAATTTAGCGAaaggaaggaag	0.218													4	2	---	---	---	---	
FMOD	2331	broad.mit.edu	37	1	203198890	203198890	+	Intron	DEL	A	-	-	rs11809805	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203198890delA	uc010pqi.1	-						CHIT1_uc001gzm.1_Intron|CHIT1_uc001gzn.2_5'Flank|CHIT1_uc009xam.1_5'Flank|CHIT1_uc009xan.1_5'Flank|CHIT1_uc001gzo.2_5'Flank	NM_002023		Q06828	FMOD_HUMAN	fibromodulin precursor						transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)			GGTGGGGGGGATGGGAGCAGG	0.542													2	5	---	---	---	---	
B3GALNT2	148789	broad.mit.edu	37	1	235611535	235611536	+	3'UTR	INS	-	AAA	AAA	rs71576473		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235611535_235611536insAAA	uc001hxc.2	-	12					TBCE_uc001hwz.1_Intron|TBCE_uc001hxa.1_Intron|TBCE_uc010pxr.1_Intron|TBCE_uc001hxb.1_Intron	NM_152490	NP_689703	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2						protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			breast(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			aagtcagtctcaaaaaaaaaaa	0.158													10	10	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28210682	28210682	+	Intron	DEL	A	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28210682delA	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron|uc002rlw.2_5'Flank	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					accctgtctcaaaaaaaaaaa	0.100													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34041837	34041838	+	IGR	INS	-	CCTCC	CCTCC	rs141683394	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34041837_34041838insCCTCC								MYADML (88553 upstream) : None (None downstream)																							tcttctcttctcctcccctccc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42208561	42208562	+	IGR	INS	-	A	A	rs75336936		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42208561_42208562insA								None (None upstream) : PKDCC (66599 downstream)																							actctgtctccaaaaaaaaaaa	0.000													2	4	---	---	---	---	
PUS10	150962	broad.mit.edu	37	2	61174986	61174986	+	Intron	DEL	G	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61174986delG	uc010fci.2	-						PUS10_uc002sao.2_Intron|PUS10_uc010ypk.1_Intron	NM_144709	NP_653310	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(2)|large_intestine(1)|kidney(1)	4			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			aaaaaaaaaagaaaagaaaag	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134405321	134405322	+	IGR	INS	-	AGG	AGG	rs56187134		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134405321_134405322insAGG								NCKAP5 (79290 upstream) : MGAT5 (606508 downstream)																							ggaaggaaggaaagaaaagaaa	0.000													4	4	---	---	---	---	
ALS2CR11	151254	broad.mit.edu	37	2	202439773	202439774	+	Intron	INS	-	G	G	rs13394004		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202439773_202439774insG	uc002uye.2	-						ALS2CR11_uc002uyf.2_Intron|ALS2CR11_uc010fti.2_Intron	NM_152525	NP_689738	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)											large_intestine(1)|ovary(1)|skin(1)	3						aaaaaaaaaaaaagaagaagaa	0.228													5	3	---	---	---	---	
C2orf80	389073	broad.mit.edu	37	2	209030330	209030331	+	3'UTR	INS	-	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209030330_209030331insT	uc002vcr.2	-	9					CRYGA_uc002vcq.3_5'Flank	NM_001099334	NP_001092804	Q0P641	CB080_HUMAN	hypothetical protein LOC389073											skin(1)	1						TAAGGTCACAGTTTTTTTTTTT	0.347													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	218879582	218879601	+	IGR	DEL	GGAAGGAAGGACGGAAGGAA	-	-	rs11276357		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218879582_218879601delGGAAGGAAGGACGGAAGGAA								TNS1 (11864 upstream) : RUFY4 (20110 downstream)																							ATTGCaggagggaaggaaggacggaaggaaggaaggaagg	0.077													2	5	---	---	---	---	
HDAC4	9759	broad.mit.edu	37	2	240111871	240111871	+	Intron	DEL	G	-	-	rs74761897		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240111871delG	uc002vyk.3	-						HDAC4_uc010fyz.1_Intron|HDAC4_uc010zoa.1_Intron|HDAC4_uc010fza.2_Intron|HDAC4_uc002vyl.1_Intron|HDAC4_uc010fyy.2_5'Flank	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		TTCACGGGGCGGGGGGGGGGT	0.627													9	4	---	---	---	---	
CNOT10	25904	broad.mit.edu	37	3	32769472	32769483	+	Intron	DEL	TTTATTTATTTA	-	-	rs71695725		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32769472_32769483delTTTATTTATTTA	uc003cfc.1	+						CNOT10_uc011axi.1_Intron|CNOT10_uc003cfd.1_Intron|CNOT10_uc003cfe.1_Intron|CNOT10_uc010hfv.1_Intron|CNOT10_uc011axj.1_Intron|CNOT10_uc010hfw.1_Intron	NM_015442	NP_056257	Q9H9A5	CNOTA_HUMAN	CCR4-NOT transcription complex, subunit 10						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	protein binding			central_nervous_system(1)|skin(1)	2						CATTTCTCTTtttatttatttatttatttatt	0.151													3	3	---	---	---	---	
PRICKLE2	166336	broad.mit.edu	37	3	64184698	64184699	+	Intron	INS	-	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64184698_64184699insA	uc003dmf.2	-							NM_198859	NP_942559	Q7Z3G6	PRIC2_HUMAN	prickle-like 2							cytoplasm|nuclear membrane	zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		TTTTTTTTTCCAAGAGCCTGCC	0.505													4	3	---	---	---	---	
GBE1	2632	broad.mit.edu	37	3	81541828	81541829	+	Intron	INS	-	TTCTCCCT	TTCTCCCT	rs149554537	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81541828_81541829insTTCTCCCT	uc003dqg.2	-							NM_000158	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		cccttctcccattctccctttc	0.045									Glycogen_Storage_Disease_type_IV				6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	83790732	83790733	+	IGR	INS	-	GGAG	GGAG	rs13089076		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83790732_83790733insGGAG								None (None upstream) : None (None downstream)																							aaggaaggaaaggagggaggga	0.089													5	5	---	---	---	---	
EPHB1	2047	broad.mit.edu	37	3	134902089	134902090	+	Intron	INS	-	CTTC	CTTC	rs144173551	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134902089_134902090insCTTC	uc003eqt.2	+						EPHB1_uc003equ.2_Intron	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						tccctccctttcttccttcctt	0.050													8	8	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149340290	149340305	+	Intron	DEL	AAGAAAGAAAGAAAGA	-	-	rs72335546	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149340290_149340305delAAGAAAGAAAGAAAGA	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ggaaggaaggaagaaagaaagaaagaaagaaagaaa	0.083													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	155829897	155829897	+	IGR	DEL	T	-	-	rs28406457		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155829897delT								GMPS (174379 upstream) : KCNAB1 (8440 downstream)																							AAATGCTGtgttttttttttt	0.159													6	3	---	---	---	---	
TMEM207	131920	broad.mit.edu	37	3	190147704	190147704	+	Intron	DEL	A	-	-	rs67899321		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190147704delA	uc003fsj.2	-							NM_207316	NP_997199	Q6UWW9	TM207_HUMAN	transmembrane protein 207 precursor							integral to membrane					0	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		CACAGGGGGGAAAAAAAAAAT	0.353													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	25938202	25938205	+	IGR	DEL	AGGG	-	-	rs59380402		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25938202_25938205delAGGG								C4orf52 (6702 upstream) : RBPJ (383127 downstream)																							gaaggaaggaagggaggaaggaaa	0.147													5	3	---	---	---	---	
SLC4A4	8671	broad.mit.edu	37	4	72214031	72214034	+	Intron	DEL	CACA	-	-	rs144310007		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72214031_72214034delCACA	uc003hfy.2	+						SLC4A4_uc010iic.2_Intron|SLC4A4_uc010iib.2_Intron|SLC4A4_uc003hfz.2_Intron|SLC4A4_uc003hgc.3_Intron|SLC4A4_uc003hga.2_Intron|SLC4A4_uc003hgb.3_Intron	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate							basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			CTAATTTAGTcacacacacacaca	0.250													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10317214	10317217	+	IGR	DEL	CCTT	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10317214_10317217delCCTT								CMBL (9046 upstream) : MARCH6 (36611 downstream)																							ATGCTTTTTCccttccttccttcc	0.127													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	130306978	130306985	+	IGR	DEL	GGAAGGAA	-	-	rs71982858	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130306978_130306985delGGAAGGAA								CHSY3 (784652 upstream) : HINT1 (187890 downstream)																							aaggaaggacggaaggaaggaaggaagg	0.000													14	8	---	---	---	---	
MYOZ3	91977	broad.mit.edu	37	5	150052109	150052110	+	Intron	INS	-	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150052109_150052110insA	uc003lss.2	+						MYOZ3_uc003lsr.2_Intron	NM_001122853	NP_001116325	Q8TDC0	MYOZ3_HUMAN	myozenin 3							sarcomere	protein binding			skin(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGAGGGGCGGGAAGCCAGTCAC	0.411													8	5	---	---	---	---	
CDKAL1	54901	broad.mit.edu	37	6	20757082	20757085	+	Intron	DEL	CTCC	-	-	rs10652206		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20757082_20757085delCTCC	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			ttccttccttctccccttccttcc	0.078													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	25261990	25261990	+	5'Flank	DEL	A	-	-	rs150117437		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25261990delA	uc003nex.3	-											Homo sapiens cDNA clone IMAGE:5297808.																		TGGACtatttaaaaaaaaaaa	0.179													4	2	---	---	---	---	
FTSJD2	23070	broad.mit.edu	37	6	37420622	37420622	+	Intron	DEL	T	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37420622delT	uc003ons.2	+						FTSJD2_uc010jwu.2_Intron	NM_015050	NP_055865	Q8N1G2	MTR1_HUMAN	FtsJ methyltransferase domain containing 2						mRNA capping	cytoplasm|nucleus	mRNA (nucleoside-2'-O-)-methyltransferase activity|nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CCTGTTTACATTTTTTTTTTT	0.244													6	3	---	---	---	---	
MRPL2	51069	broad.mit.edu	37	6	43023097	43023098	+	Intron	INS	-	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43023097_43023098insA	uc003ots.1	-						CUL7_uc011dvb.1_5'Flank|CUL7_uc003otq.2_5'Flank|CUL7_uc010jyh.2_5'Flank|KLC4_uc003otr.1_Intron	NM_015950	NP_057034	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2 precursor						translation	mitochondrion|ribosome	structural constituent of ribosome				0		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		actctgtctcgaaaaaaaaaaa	0.203													6	3	---	---	---	---	
ORC3L	23595	broad.mit.edu	37	6	88311389	88311390	+	Intron	INS	-	A	A			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88311389_88311390insA	uc003pmh.2	+						ORC3L_uc011dzl.1_Intron|ORC3L_uc011dzm.1_Intron|ORC3L_uc011dzn.1_Intron|ORC3L_uc003pmg.2_Intron|ORC3L_uc003pmi.2_Intron|ORC3L_uc011dzo.1_Intron|ORC3L_uc011dzp.1_Intron	NM_012381	NP_036513	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3 isoform 2						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)		gactccatatcaaaaaaaaaaa	0.119													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56403871	56403890	+	IGR	DEL	AGGAAGGAAGGAAAGAAGGG	-	-	rs71563819	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56403871_56403890delAGGAAGGAAGGAAAGAAGGG								PSPH (219781 upstream) : DKFZp434L192 (160026 downstream)																							gaaagaaggaaggaaggaaggaaagaagggaggaaggaag	0.095													3	3	---	---	---	---	
DMTF1	9988	broad.mit.edu	37	7	86796133	86796133	+	Intron	DEL	T	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86796133delT	uc003uih.2	+						DMTF1_uc003uii.2_Intron|DMTF1_uc003uij.2_Intron|DMTF1_uc011khb.1_Intron|DMTF1_uc003uik.2_Intron|DMTF1_uc003uil.2_Intron|DMTF1_uc003uim.1_Intron|DMTF1_uc003uin.2_Intron	NM_001142327	NP_001135799	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1						cell cycle	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(14;0.0058)					cttcccaaccttttttttttc	0.050													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	150302509	150302510	+	IGR	INS	-	T	T			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150302509_150302510insT								GIMAP4 (31469 upstream) : GIMAP6 (19956 downstream)																							cttctttcttGTTTTTTTTTTT	0.059													3	3	---	---	---	---	
LOC100128542	100128542	broad.mit.edu	37	7	150451251	150451252	+	Intron	INS	-	GAAA	GAAA	rs72059403		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150451251_150451252insGAAA	uc011kuw.1	+							NM_001162367	NP_001155839			hypothetical protein LOC100128542												0						aaggagggaaggaaaggaagga	0.094													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152140121	152140121	+	IGR	DEL	T	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152140121delT								FABP5L3 (23 upstream) : LOC100128822 (21088 downstream)																							TGTTTCTTTCTTTTTTTTTTC	0.328													4	2	---	---	---	---	
RCL1	10171	broad.mit.edu	37	9	4803727	4803727	+	Intron	DEL	A	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4803727delA	uc003zis.2	+						RCL1_uc003zit.2_Intron|RCL1_uc010mhk.1_Intron	NM_005772	NP_005763	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1						ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		TGTGAAAGGTAAAAAAAAAAA	0.458													4	3	---	---	---	---	
C9orf25	203259	broad.mit.edu	37	9	34416271	34416272	+	Intron	INS	-	GGAAGGAAGGAAGGAA	GGAAGGAAGGAAGGAA	rs144617392	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34416271_34416272insGGAAGGAAGGAAGGAA	uc011lok.1	-						C9orf25_uc003zuj.2_Intron|C9orf25_uc003zuk.2_Intron|C9orf25_uc011lol.1_Intron|C9orf25_uc003zul.2_Intron	NM_147202	NP_671735	Q8IW50	CI025_HUMAN	hypothetical protein LOC203259												0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.0858)		gagggagggagggaaggaagga	0.084													4	5	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113192388	113192388	+	Intron	DEL	T	-	-	rs11331398		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113192388delT	uc010mtz.2	-						SVEP1_uc010mty.2_5'Flank	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						gtttgttttcttttttttttt	0.303													11	5	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	34550622	34550629	+	Intron	DEL	AAGAAAGG	-	-	rs7083805		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34550622_34550629delAAGAAAGG	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				gtctcaaagaaagaaaggaagaaaggaa	0.000													4	3	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	61893881	61893882	+	Intron	INS	-	T	T	rs141972925	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61893881_61893882insT	uc001jky.2	-						ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jla.1_Intron|ANK3_uc001jlb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						AGTACAACTTATTTTTTTTTAA	0.337													7	5	---	---	---	---	
OAT	4942	broad.mit.edu	37	10	126100385	126100386	+	Intron	DEL	AA	-	-	rs72254317		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126100385_126100386delAA	uc001lhp.2	-						OAT_uc001lhq.2_Intron|OAT_uc001lhr.2_Intron	NM_000274	NP_000265	P04181	OAT_HUMAN	ornithine aminotransferase precursor						cellular amino acid biosynthetic process|visual perception	mitochondrial matrix	ornithine-oxo-acid transaminase activity|protein binding|pyridoxal phosphate binding				0		all_lung(145;0.0271)|Lung NSC(174;0.0436)|Colorectal(57;0.102)|all_neural(114;0.116)			L-Ornithine(DB00129)|Pyridoxal Phosphate(DB00114)	actccgtctcaaaaaaaaaaaa	0.099													4	3	---	---	---	---	
BEST1	7439	broad.mit.edu	37	11	61725444	61725445	+	Intron	INS	-	CAAACAAA	CAAACAAA	rs149120080	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61725444_61725445insCAAACAAA	uc001nss.2	+						BEST1_uc010rlp.1_Intron|BEST1_uc001nsq.2_Intron|BEST1_uc010rlq.1_Intron|BEST1_uc010rlr.1_Intron|BEST1_uc010rls.1_Intron|BEST1_uc001nsr.2_Intron|BEST1_uc009ynt.2_Intron|BEST1_uc010rlt.1_Intron|BEST1_uc001nst.2_Intron|BEST1_uc010rlu.1_Intron|BEST1_uc010rlv.1_Intron	NM_004183	NP_004174	O76090	BEST1_HUMAN	bestrophin 1 isoform 1						response to stimulus|transepithelial chloride transport|visual perception	basolateral plasma membrane|chloride channel complex|cytosol|membrane fraction	chloride channel activity			central_nervous_system(1)	1						agactctgtctcaaacaaacaa	0.188													6	3	---	---	---	---	
CSDA	8531	broad.mit.edu	37	12	10870901	10870901	+	Intron	DEL	C	-	-	rs11309033		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10870901delC	uc001qyt.2	-						CSDA_uc001qyu.2_Intron	NM_003651	NP_003642	P16989	DBPA_HUMAN	cold shock domain protein A isoform a						negative regulation of transcription from RNA polymerase II promoter|response to cold	cytoplasm|nucleus	double-stranded DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|lung(1)|large_intestine(1)	4	Glioma(1;0.155)					CCACAGGCCACCCACCTTCCT	0.418													3	4	---	---	---	---	
DENND5B	160518	broad.mit.edu	37	12	31562360	31562360	+	Intron	DEL	A	-	-	rs111670680		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31562360delA	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc009zjq.1_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2						AGTATCAAAGAAAAAAAAAAA	0.254													2	4	---	---	---	---	
BAZ2A	11176	broad.mit.edu	37	12	56999208	56999208	+	Intron	DEL	T	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56999208delT	uc001slq.1	-						BAZ2A_uc001slp.1_Intron|BAZ2A_uc009zov.1_5'Flank|BAZ2A_uc009zow.1_Intron	NM_013449	NP_038477	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A						chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding				0						TTTTATGTAAttttttttttt	0.174													4	2	---	---	---	---	
TBC1D15	64786	broad.mit.edu	37	12	72242944	72242944	+	Intron	DEL	A	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72242944delA	uc001swu.2	+						TBC1D15_uc009zrv.2_Intron|TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron|MRS2P2_uc010stu.1_RNA	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0						CTGTGATTATaaaaaaaaaaa	0.299													4	2	---	---	---	---	
TBC1D15	64786	broad.mit.edu	37	12	72271279	72271280	+	Intron	DEL	CC	-	-	rs11178976	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72271279_72271280delCC	uc001swu.2	+						TBC1D15_uc009zrv.2_Intron|TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0						tcctgtttttccttccttcctt	0.000													4	2	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117965094	117965107	+	Intron	DEL	ACACACACACACAG	-	-	rs59836858		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965094_117965107delACACACACACACAG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGacacacacacacacacacacagacacacacac	0.234													3	3	---	---	---	---	
PEBP1	5037	broad.mit.edu	37	12	118577117	118577118	+	Intron	DEL	AA	-	-	rs35893505		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118577117_118577118delAA	uc001twu.1	+						PEBP1_uc010szc.1_Intron	NM_002567	NP_002558	P30086	PEBP1_HUMAN	prostatic binding protein								ATP binding|phosphatidylethanolamine binding|serine-type endopeptidase inhibitor activity			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					actctgtctcaaaaaaaaaaaa	0.213								Direct_reversal_of_damage					5	5	---	---	---	---	
PRKAB1	5564	broad.mit.edu	37	12	120110460	120110461	+	Intron	DEL	AG	-	-	rs150497180		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120110460_120110461delAG	uc009zwu.2	+						PRKAB1_uc001txg.2_Intron	NM_006253	NP_006244	Q9Y478	AAKB1_HUMAN	AMP-activated protein kinase beta 1						cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol					0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.166)	Adenosine monophosphate(DB00131)|Metformin(DB00331)	TACAGAAGAAAGAGAATATTTC	0.342													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	129497863	129497864	+	IGR	INS	-	TT	TT	rs10655206		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129497863_129497864insTT								GLT1D1 (28354 upstream) : TMEM132D (58407 downstream)																							TGGCAGAATCCTTTTTTTTTTT	0.371													5	3	---	---	---	---	
DACH1	1602	broad.mit.edu	37	13	72079203	72079204	+	Intron	INS	-	TCCT	TCCT	rs140006860	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72079203_72079204insTCCT	uc010thn.1	-						DACH1_uc010tho.1_Intron|DACH1_uc010thp.1_Intron	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN	dachshund homolog 1 isoform a						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		AATTAGATATCtccttccttcc	0.129													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	28609873	28609874	+	IGR	INS	-	TC	TC			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28609873_28609874insTC								None (None upstream) : FOXG1 (626413 downstream)																							tttccttccctccttccttcct	0.015													4	2	---	---	---	---	
NPAS3	64067	broad.mit.edu	37	14	34063472	34063472	+	Intron	DEL	T	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34063472delT	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron|NPAS3_uc001wrw.2_Intron	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		gtaattgctattattgtttgt	0.000													4	2	---	---	---	---	
AP4E1	23431	broad.mit.edu	37	15	51240537	51240538	+	Intron	DEL	TT	-	-	rs71729261		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51240537_51240538delTT	uc001zyx.1	+							NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1						intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		AGGAGATGGCTTTTTTTTTTTT	0.366													4	2	---	---	---	---	
ANKDD1A	348094	broad.mit.edu	37	15	65213951	65213951	+	Intron	DEL	A	-	-	rs112295552		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65213951delA	uc002aoa.2	+						ANKDD1A_uc002anx.1_Intron|ANKDD1A_uc002any.2_Intron|ANKDD1A_uc002anz.2_Intron|ANKDD1A_uc002aob.2_Intron|ANKDD1A_uc002aoc.2_5'Flank|ANKDD1A_uc010bha.2_5'Flank	NM_182703	NP_874362	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A						signal transduction					ovary(1)	1						GCCTCTATTTAAAAAAAAAAA	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	95552960	95552960	+	IGR	DEL	A	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95552960delA								MCTP2 (525780 upstream) : LOC145820 (423362 downstream)																							ggaaggaaggaaAAAAAAAAG	0.313													4	2	---	---	---	---	
RAB11FIP3	9727	broad.mit.edu	37	16	538711	538712	+	Intron	INS	-	TT	TT	rs3079539		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:538711_538712insTT	uc002chf.2	+						RAB11FIP3_uc010uuf.1_Intron|RAB11FIP3_uc010uug.1_Intron	NM_014700	NP_055515	O75154	RFIP3_HUMAN	rab11-family interacting protein 3 isoform 1						cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding				0		Hepatocellular(16;0.0218)				atccagccCACTTTTTTTTTTT	0.272													4	4	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15083569	15083570	+	Intron	INS	-	GCA	GCA	rs66497434		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15083569_15083570insGCA	uc010uzl.1	+						PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002dda.3_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron|uc010bvd.1_5'UTR	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	ACGCACGCGGCGCAGCAGCCCC	0.634													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	23180452	23180453	+	IGR	INS	-	AGAAAGAA	AGAAAGAA			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23180452_23180453insAGAAAGAA								USP31 (19861 upstream) : SCNN1G (13587 downstream)																							aggaaggaaagagaaagaaaga	0.000													3	3	---	---	---	---	
NDRG4	65009	broad.mit.edu	37	16	58540057	58540062	+	Intron	DEL	TGTGTC	-	-	rs145437540	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58540057_58540062delTGTGTC	uc002eno.2	+						NDRG4_uc002enk.2_Intron|NDRG4_uc002enm.2_Intron|NDRG4_uc010vif.1_Intron|NDRG4_uc010cdk.2_Intron|NDRG4_uc010vig.1_Intron|NDRG4_uc010vih.1_Intron|NDRG4_uc010vii.1_Intron|NDRG4_uc002enp.2_Intron|NDRG4_uc002enq.1_5'UTR	NM_022910	NP_075061	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 1						cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1						tgtgtgtgtgtgtgtctgtgtgtgtg	0.306													6	4	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7680447	7680447	+	Intron	DEL	A	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7680447delA	uc002giu.1	+							NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				actctgtctcaaaaaaaaaaa	0.174													5	3	---	---	---	---	
FN3K	64122	broad.mit.edu	37	17	80693502	80693502	+	5'UTR	DEL	C	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80693502delC	uc010wvs.1	+	1					FN3K_uc002kfw.1_5'Flank	NM_022158	NP_071441	Q9H479	FN3K_HUMAN	fructosamine 3 kinase						fructoselysine metabolic process		fructosamine-3-kinase activity				0	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GAGTCCCGCGCCCCGCACTCC	0.716													4	2	---	---	---	---	
DTNA	1837	broad.mit.edu	37	18	32408818	32408819	+	Intron	INS	-	T	T	rs71962398		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32408818_32408819insT	uc010dmn.1	+						DTNA_uc002kxu.2_Intron|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Intron|DTNA_uc002kxw.2_Intron|DTNA_uc002kxx.2_Intron|DTNA_uc010dmj.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010dmk.1_Intron|DTNA_uc010dml.2_Intron|DTNA_uc002kyb.3_Intron|DTNA_uc010dmm.2_Intron|DTNA_uc010xby.1_Intron|DTNA_uc010dmo.2_Intron|DTNA_uc002kyd.3_Intron|DTNA_uc010xbz.1_Intron|DTNA_uc010xca.1_Intron|DTNA_uc002kye.2_Intron	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						AAATGCAACCATTTTTTTTTTC	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45293754	45293754	+	IGR	DEL	A	-	-	rs12457164		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45293754delA								IER3IP1 (591009 upstream) : SMAD2 (65713 downstream)																							agaaagaaagaaaggaaggaa	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8801639	8801640	+	IGR	INS	-	TC	TC	rs149614434	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8801639_8801640insTC								ADAMTS10 (126051 upstream) : ACTL9 (6111 downstream)																							cttctttcctttctctctcttt	0.000													3	4	---	---	---	---	
ZNF317	57693	broad.mit.edu	37	19	9269694	9269699	+	Intron	DEL	GAGACT	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9269694_9269699delGAGACT	uc002mku.2	+						ZNF317_uc002mkv.2_Intron|ZNF317_uc002mkw.2_Intron|ZNF317_uc002mkx.2_Intron|ZNF317_uc002mky.2_Intron	NM_020933	NP_065984	Q96PQ6	ZN317_HUMAN	zinc finger protein 317						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCCCTCAGAGGAGACTGTGTTTCAGA	0.476													9	4	---	---	---	---	
RAVER1	125950	broad.mit.edu	37	19	10431300	10431301	+	Intron	INS	-	G	G	rs138008327	by1000genomes	TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10431300_10431301insG	uc002moa.2	-						RAVER1_uc002mnz.2_5'Flank	NM_133452	NP_597709	Q8IY67	RAVR1_HUMAN	RAVER1							cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			aTTTGGCCTTAGGGGACAGAGA	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31495750	31495756	+	IGR	DEL	TCTCTTA	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31495750_31495756delTCTCTTA								ZNF536 (446785 upstream) : DKFZp566F0947 (145027 downstream)																							TTAGCCTCCCTCTCTTATCTCTTATtc	0.063													6	3	---	---	---	---	
ZIM3	114026	broad.mit.edu	37	19	57649405	57649407	+	Intron	DEL	AGG	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57649405_57649407delAGG	uc002qnz.1	-							NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		gaaggaaagaaggaaggaaggaa	0.000													4	2	---	---	---	---	
C21orf99	149992	broad.mit.edu	37	21	14437700	14437700	+	RNA	DEL	A	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14437700delA	uc002yja.3	+	9		c.2370delA				NR_026916				Homo sapiens C21orf99 protein (C21orf99) mRNA, complete cds.												0						ctaaaaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ITSN1	6453	broad.mit.edu	37	21	35260248	35260248	+	Intron	DEL	T	-	-	rs11343877		TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35260248delT	uc002yta.1	+						DONSON_uc002ysn.1_Intron|ITSN1_uc002ytb.1_Intron|ITSN1_uc002ytj.2_Intron|ITSN1_uc010gmm.1_Intron	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						TGGGGTTGGGTTTTTTTTTTT	0.279													4	2	---	---	---	---	
AIRE	326	broad.mit.edu	37	21	45710555	45710556	+	Intron	INS	-	C	C			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45710555_45710556insC	uc002zei.2	+						AIRE_uc010gpq.2_Intron|AIRE_uc002zej.2_Intron|AIRE_uc010gpr.2_5'UTR	NM_000383	NP_000374	O43918	AIRE_HUMAN	autoimmune regulator isoform 1						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|histone binding|transcription regulatory region DNA binding|translation regulator activity|zinc ion binding			skin(1)	1				Colorectal(79;0.0806)		tacctgggagacccctgaaggc	0.168									Autoimmune_PolyEndocrinopathy_Candidiasis_Ectodermal_Dystrophy				2	5	---	---	---	---	
XG	7499	broad.mit.edu	37	X	2683418	2683425	+	Intron	DEL	GGAAGGAA	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2683418_2683425delGGAAGGAA	uc011mhg.1	+						XG_uc010ndb.2_Intron|XG_uc004cqp.2_Intron	NM_175569	NP_780778	P55808	XG_HUMAN	XG glycoprotein isoform 1 precursor							integral to membrane|plasma membrane				ovary(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				agggagggagggaaggaaggaaggaagg	0.135													8	7	---	---	---	---	
USP11	8237	broad.mit.edu	37	X	47104944	47104944	+	Intron	DEL	T	-	-			TCGA-BP-4973-01A-01D-1462-08	TCGA-BP-4973-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47104944delT	uc004dhp.2	+						USP11_uc004dhq.2_Intron	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11						protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						TATATTTAGCttttttttttt	0.274													4	2	---	---	---	---	
