Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CDK11A	728642	broad.mit.edu	37	1	1636274	1636274	+	Nonsense_Mutation	SNP	C	T	T	rs2179381	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1636274C>T	uc010nyt.1	-	13	1635	c.1527G>A	c.(1525-1527)TGG>TGA	p.W509*	CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agv.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|CDK11A_uc001ahj.3_5'UTR|CDK11A_uc009vkp.2_Intron|CDK11A_uc009vkq.2_Intron|CDK11A_uc009vkr.2_Intron|CDK11A_uc009vks.2_Intron|CDK11A_uc010nys.1_Intron			Q9UQ88	CD11A_HUMAN	SubName: Full=cDNA FLJ56415, highly similar to PITSLRE serine/threonine-protein kinase CDC2L1 (EC 2.7.11.22);	Error:Variant_position_missing_in_Q9UQ88_after_alignment					apoptosis|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			stomach(1)	1						GCACCCGGCCCCAGGACAGCA	0.622													6	79	---	---	---	---	PASS
DNASE2B	58511	broad.mit.edu	37	1	84864297	84864297	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84864297T>C	uc001djt.1	+	1	83	c.50T>C	c.(49-51)CTC>CCC	p.L17P	UOX_uc009wcg.2_5'Flank	NM_021233	NP_067056	Q8WZ79	DNS2B_HUMAN	deoxyribonuclease II beta isoform 1 precursor	17					DNA metabolic process	lysosome	deoxyribonuclease II activity				0				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)		TTTGCTTTGCTCTTCCTTGGC	0.453								Direct_reversal_of_damage					99	132	---	---	---	---	PASS
HIPK1	204851	broad.mit.edu	37	1	114483183	114483183	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114483183C>A	uc001eem.2	+	2	339	c.178C>A	c.(178-180)CAC>AAC	p.H60N	HIPK1_uc001eel.2_Missense_Mutation_p.H60N|HIPK1_uc001een.2_Missense_Mutation_p.H60N	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	60					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAACTCCTCTCACCAGGTAGC	0.537													71	108	---	---	---	---	PASS
SNX27	81609	broad.mit.edu	37	1	151665946	151665946	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151665946A>G	uc001eyn.1	+	11	1581	c.1565A>G	c.(1564-1566)AAG>AGG	p.K522R	SNX27_uc001eyo.2_Missense_Mutation_p.K429R|SNX27_uc001eyp.2_Missense_Mutation_p.K336R	NM_030918	NP_112180	Q96L92	SNX27_HUMAN	sorting nexin family member 27	522					cell communication|protein transport|signal transduction	cytosol|early endosome	phosphatidylinositol binding|protein binding			ovary(2)|central_nervous_system(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGCGAGCTCAAGTGGAGAAAA	0.423													68	150	---	---	---	---	PASS
DDR2	4921	broad.mit.edu	37	1	162749936	162749936	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162749936C>T	uc001gcf.2	+	19	2933	c.2468C>T	c.(2467-2469)TCT>TTT	p.S823F	DDR2_uc001gcg.2_Missense_Mutation_p.S823F|uc001gch.1_5'Flank	NM_001014796	NP_001014796	Q16832	DDR2_HUMAN	discoidin domain receptor family, member 2	823	Cytoplasmic (Potential).|Protein kinase.				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)			TGTCCTGACTCTGTGTATAAG	0.453													64	388	---	---	---	---	PASS
C1orf112	55732	broad.mit.edu	37	1	169811586	169811586	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169811586T>A	uc001ggp.2	+	19	2064	c.1754T>A	c.(1753-1755)GTA>GAA	p.V585E	C1orf112_uc001ggj.2_RNA|C1orf112_uc001ggq.2_Missense_Mutation_p.V585E|C1orf112_uc009wvt.2_Missense_Mutation_p.V262E|C1orf112_uc009wvu.1_Missense_Mutation_p.V461E|C1orf112_uc001ggr.2_Missense_Mutation_p.V450E|C1orf112_uc010plv.1_Missense_Mutation_p.V527E	NM_018186	NP_060656	Q9NSG2	CA112_HUMAN	hypothetical protein LOC55732	585											0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTGCTTGCAGTATGTAATTCT	0.408													79	216	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186147782	186147782	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186147782A>T	uc001grq.1	+	104	16407	c.16178A>T	c.(16177-16179)CAT>CTT	p.H5393L	HMCN1_uc001grs.1_Intron	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	5393					response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CAGTACTCACATCTCTACAGC	0.453													60	313	---	---	---	---	PASS
DUSP10	11221	broad.mit.edu	37	1	221912420	221912420	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221912420C>T	uc001hmy.1	-	2	849	c.667G>A	c.(667-669)GAC>AAC	p.D223N	DUSP10_uc001hmx.1_5'Flank|DUSP10_uc001hmz.1_Intron	NM_007207	NP_009138	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10 isoform a	223	Rhodanese.				inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|negative regulation of stress-activated MAPK cascade	Golgi apparatus|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|lung(1)	2				GBM - Glioblastoma multiforme(131;0.0103)		TTGAAAGAGTCCTTGCCTTCC	0.473													40	90	---	---	---	---	PASS
TARBP1	6894	broad.mit.edu	37	1	234565028	234565028	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234565028T>A	uc001hwd.2	-	17	2914	c.2914A>T	c.(2914-2916)ATG>TTG	p.M972L		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	972					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TTCCACGCCATGTCAAAAGAC	0.338													49	115	---	---	---	---	PASS
TTC32	130502	broad.mit.edu	37	2	20101521	20101521	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20101521G>A	uc002rdg.2	-	1	227	c.95C>T	c.(94-96)TCC>TTC	p.S32F		NM_001008237	NP_001008238	Q5I0X7	TTC32_HUMAN	tetratricopeptide repeat domain 32	32	TPR 1.						identical protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATGTAAGCGGAGTACAGTGC	0.647													18	104	---	---	---	---	PASS
EXOC6B	23233	broad.mit.edu	37	2	72406461	72406461	+	3'UTR	SNP	C	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72406461C>G	uc010fep.2	-	22						NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						CCGGGGTCACCCTTCATGAGT	0.557													4	16	---	---	---	---	PASS
C2orf77	129881	broad.mit.edu	37	2	170506866	170506866	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170506866T>G	uc002ufe.2	-	7	1219	c.1125A>C	c.(1123-1125)AAA>AAC	p.K375N		NM_001085447	NP_001078916	Q0VFZ6	CB077_HUMAN	hypothetical protein LOC129881	375	Potential.										0						CTGCAATTGTTTTTAATTCTG	0.318													10	63	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179485254	179485254	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179485254G>T	uc010zfg.1	-	197	38514	c.38290C>A	c.(38290-38292)CTG>ATG	p.L12764M	TTN_uc010zfh.1_Missense_Mutation_p.L6459M|TTN_uc010zfi.1_Missense_Mutation_p.L6392M|TTN_uc010zfj.1_Missense_Mutation_p.L6267M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13691							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCCACTTCAGTGTTACATTG	0.398													26	176	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185801482	185801482	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185801482T>G	uc002uph.2	+	4	1953	c.1359T>G	c.(1357-1359)ATT>ATG	p.I453M		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	453						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						AACCATCAATTTCCTATAGCT	0.348													122	153	---	---	---	---	PASS
OBFC2A	64859	broad.mit.edu	37	2	192550402	192550402	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192550402A>C	uc002usx.2	+	6	1003	c.523A>C	c.(523-525)ATA>CTA	p.I175L	OBFC2A_uc002usw.2_Missense_Mutation_p.I95L|OBFC2A_uc002usy.2_RNA|OBFC2A_uc002usz.2_RNA|OBFC2A_uc002uta.2_Missense_Mutation_p.I89L	NM_001031716	NP_001026886	Q96AH0	SOSB2_HUMAN	oligonucleotide/oligosaccharide-binding fold	175					double-strand break repair via homologous recombination|G2/M transition checkpoint|response to ionizing radiation	SOSS complex	single-stranded DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.061)|Epithelial(96;0.244)			CCGGGGACTTATAAATCCACA	0.428													14	72	---	---	---	---	PASS
NBEAL1	65065	broad.mit.edu	37	2	204002984	204002984	+	Silent	SNP	A	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204002984A>T	uc002uzt.3	+	29	4911	c.4578A>T	c.(4576-4578)ATA>ATT	p.I1526I	NBEAL1_uc002uzs.3_Silent_p.I236I	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	1526							binding			ovary(1)|skin(1)	2						TGCTGATCATACAGGACTTTC	0.378													35	146	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228886626	228886626	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228886626G>T	uc002vpq.2	-	6	545	c.498C>A	c.(496-498)AAC>AAA	p.N166K	SPHKAP_uc002vpp.2_Missense_Mutation_p.N166K|SPHKAP_uc010zlx.1_Missense_Mutation_p.N166K	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	166						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		AGTTGGTACTGTTTGGTCTGT	0.438													30	94	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230650536	230650536	+	Silent	SNP	C	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230650536C>A	uc002vpw.1	-	33	4915	c.4806G>T	c.(4804-4806)GCG>GCT	p.A1602A	TRIP12_uc002vpx.1_Silent_p.A1650A|TRIP12_uc002vpy.1_Silent_p.A1332A	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1602					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TCACAGACTCCGCCTGTTTCA	0.463													95	114	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183739	10183739	+	Nonsense_Mutation	SNP	G	T	T	rs5030802		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183739G>T	uc003bvc.2	+	1	421	c.208G>T	c.(208-210)GAG>TAG	p.E70*	VHL_uc003bvd.2_Nonsense_Mutation_p.E70*	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	70			Missing (in VHLD; type I).|E -> K (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.E70*(6)|p.E70fs*61(2)|p.R69_E70>Q(2)|p.E70fs*85(1)|p.N67fs*59(1)|p.R60fs*35(1)|p.N67_V74del(1)|p.E70_S72>A(1)|p.E70fs*89(1)|p.P61fs*61(1)|p.R69fs*89(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GAACTCGCGCGAGCCCTCCCA	0.721		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				4	2	---	---	---	---	PASS
C3orf58	205428	broad.mit.edu	37	3	143691724	143691724	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143691724G>T	uc003evo.2	+	1	1085	c.550G>T	c.(550-552)GCG>TCG	p.A184S	C3orf58_uc011bnl.1_5'Flank	NM_173552	NP_775823	Q8NDZ4	CC058_HUMAN	hypothetical protein LOC205428 isoform a	184						COPI vesicle coat|extracellular region				ovary(1)	1						GCGCCGCTACGCGGAGACCAA	0.697													4	9	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47527622	47527622	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47527622A>T	uc003gxk.1	+	5	903	c.739A>T	c.(739-741)AGC>TGC	p.S247C	ATP10D_uc003gxj.3_Missense_Mutation_p.S247C	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	247	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						AGAATGTGAAAGCCCAAACAA	0.363													22	61	---	---	---	---	PASS
CXCL11	6373	broad.mit.edu	37	4	76956490	76956490	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76956490G>T	uc003hjm.2	-	2	160	c.67C>A	c.(67-69)CCC>ACC	p.P23T	ART3_uc003hji.2_Intron|ART3_uc003hjj.2_Intron|ART3_uc003hjk.2_Intron	NM_005409	NP_005400	O14625	CXL11_HUMAN	small inducible cytokine B11 precursor	23					cell-cell signaling|chemotaxis|inflammatory response|signal transduction	extracellular space	chemokine activity				0			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTGAACATGGGGAAGCCTAGA	0.423													8	67	---	---	---	---	PASS
SEPT11	55752	broad.mit.edu	37	4	77955767	77955767	+	3'UTR	SNP	T	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77955767T>A	uc003hkj.2	+	10					SEPT11_uc011cca.1_3'UTR	NM_018243	NP_060713	Q9NVA2	SEP11_HUMAN	septin 11						cell cycle|cell division|protein heterooligomerization	axon|cell junction|dendritic spine|septin complex|stress fiber|synapse	GTP binding|protein binding				0						tattttattttTTTACCCTTC	0.378													3	13	---	---	---	---	PASS
SYNPO2	171024	broad.mit.edu	37	4	119947951	119947951	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119947951G>C	uc003icm.3	+	3	623	c.427G>C	c.(427-429)GCT>CCT	p.A143P	SYNPO2_uc010ina.2_Missense_Mutation_p.A143P|SYNPO2_uc010inb.2_Missense_Mutation_p.A143P|SYNPO2_uc011cgh.1_Intron|SYNPO2_uc010inc.2_Missense_Mutation_p.A71P	NM_001128933	NP_001122405	Q9UMS6	SYNP2_HUMAN	synaptopodin 2 isoform b	143						nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2						AGTTCCCCTAGCTGAGAACCA	0.547													14	47	---	---	---	---	PASS
SYNPO2	171024	broad.mit.edu	37	4	119947953	119947953	+	Silent	SNP	T	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119947953T>A	uc003icm.3	+	3	625	c.429T>A	c.(427-429)GCT>GCA	p.A143A	SYNPO2_uc010ina.2_Silent_p.A143A|SYNPO2_uc010inb.2_Silent_p.A143A|SYNPO2_uc011cgh.1_Intron|SYNPO2_uc010inc.2_Silent_p.A71A	NM_001128933	NP_001122405	Q9UMS6	SYNP2_HUMAN	synaptopodin 2 isoform b	143						nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2						TTCCCCTAGCTGAGAACCAAA	0.547													14	47	---	---	---	---	PASS
USP53	54532	broad.mit.edu	37	4	120182905	120182905	+	Silent	SNP	T	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120182905T>C	uc003ics.3	+	11	1924	c.858T>C	c.(856-858)AAT>AAC	p.N286N	USP53_uc003icr.3_Silent_p.N286N|USP53_uc003icu.3_5'UTR	NM_019050	NP_061923	Q70EK8	UBP53_HUMAN	ubiquitin specific protease 53	286					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			ovary(1)|breast(1)|kidney(1)|skin(1)	4						ATGCCAAAAATAGTGAACTTA	0.313													41	106	---	---	---	---	PASS
IL15	3600	broad.mit.edu	37	4	142654084	142654084	+	3'UTR	SNP	C	A	A	rs10519613	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142654084C>A	uc003iis.2	+	8					IL15_uc003iit.2_3'UTR|IL15_uc010iol.2_RNA|IL15_uc003iiu.2_RNA	NM_000585	NP_000576	P40933	IL15_HUMAN	interleukin 15 preproprotein						cell-cell signaling|immune response|positive regulation of interleukin-17 production	endosome|extracellular space|Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	cytokine activity|cytokine receptor binding|signal transducer activity				0	all_hematologic(180;0.158)					CTCGGCATTTCAAATGTGCTG	0.333													6	25	---	---	---	---	PASS
TMEM184C	55751	broad.mit.edu	37	4	148555356	148555356	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148555356T>G	uc003ila.3	+	10	1657	c.1088T>G	c.(1087-1089)TTT>TGT	p.F363C		NM_018241	NP_060711	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	363						integral to membrane					0						AAAAAATTGTTTCCCGAGGAT	0.348													20	62	---	---	---	---	PASS
GALNT7	51809	broad.mit.edu	37	4	174219381	174219381	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174219381C>A	uc003isz.3	+	6	1164	c.1081C>A	c.(1081-1083)CTC>ATC	p.L361I	GALNT7_uc011ckb.1_Intron	NM_017423	NP_059119	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	361	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			central_nervous_system(1)	1		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		TTGGAGTATGCTCTGGAAACG	0.438													16	47	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89971958	89971958	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89971958T>A	uc003kju.2	+	25	5471	c.5375T>A	c.(5374-5376)ATC>AAC	p.I1792N	GPR98_uc003kjt.2_5'UTR|GPR98_uc010jba.1_RNA	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	1792	Extracellular (Potential).|Calx-beta 12.				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTCATAAACATCACTGATAAT	0.299													31	34	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127782277	127782277	+	Silent	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127782277G>A	uc003kuu.2	-	7	1288	c.849C>T	c.(847-849)ATC>ATT	p.I283I	FBN2_uc003kuv.2_Silent_p.I250I|FBN2_uc003kuw.3_Silent_p.I283I|FBN2_uc003kux.1_Silent_p.I283I	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	283	EGF-like 4; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ATATCCCTGGGATAGCCTGGC	0.383													81	221	---	---	---	---	PASS
CHSY3	337876	broad.mit.edu	37	5	129520380	129520380	+	Silent	SNP	G	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129520380G>T	uc003kvd.2	+	3	1545	c.1545G>T	c.(1543-1545)CGG>CGT	p.R515R		NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	515	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		GCAGAGGACGGCTCATTGACT	0.463													14	109	---	---	---	---	PASS
BRD8	10902	broad.mit.edu	37	5	137503709	137503709	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137503709A>T	uc003lcf.1	-	9	756	c.701T>A	c.(700-702)CTG>CAG	p.L234Q	BRD8_uc003lcc.1_RNA|BRD8_uc011cyl.1_5'Flank|BRD8_uc003lcg.2_Missense_Mutation_p.L307Q|BRD8_uc003lci.2_Missense_Mutation_p.L307Q|BRD8_uc003lch.2_Missense_Mutation_p.L167Q|BRD8_uc011cym.1_Missense_Mutation_p.L218Q|BRD8_uc010jer.1_Missense_Mutation_p.L273Q|BRD8_uc011cyn.1_Missense_Mutation_p.L193Q|BRD8_uc010jes.1_Missense_Mutation_p.L101Q	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2	234					cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GCCTACCTCCAGGAGGACACC	0.522													51	195	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140559268	140559268	+	Silent	SNP	G	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140559268G>T	uc011dai.1	+	1	1839	c.1653G>T	c.(1651-1653)CTG>CTT	p.L551L	PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	551	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCGCGTGCTGGTGCTGGACG	0.716													41	154	---	---	---	---	PASS
LOC134466	134466	broad.mit.edu	37	5	150310852	150310852	+	3'UTR	SNP	C	T	T	rs6861480	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150310852C>T	uc003lsz.1	-	4					LOC134466_uc003ltb.2_RNA|LOC134466_uc003lta.2_RNA					RecName: Full=Putative KRAB domain-containing protein LOC134466;												0						CCAGTGTGAACTCTTTAATGT	0.413													6	76	---	---	---	---	PASS
F13A1	2162	broad.mit.edu	37	6	6145726	6145726	+	3'UTR	SNP	A	G	G	rs1050782	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6145726A>G	uc003mwv.2	-	15						NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor						peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	TCCACTCTGGAGCCCTCTGCA	0.448													4	15	---	---	---	---	PASS
PIP5K1P1	206426	broad.mit.edu	37	6	7986847	7986847	+	Silent	SNP	G	A	A	rs197129	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7986847G>A	uc003mxx.3	+	1	513	c.78G>A	c.(76-78)GCG>GCA	p.A26A	TXNDC5_uc003mxw.2_Intron	NR_027712				RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;												0						CCTGTACCGCGTCCTCAGCAT	0.607													4	29	---	---	---	---	PASS
LEMD2	221496	broad.mit.edu	37	6	33754592	33754592	+	Intron	SNP	G	A	A	rs4711351	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33754592G>A	uc011drm.1	-						LEMD2_uc011drl.1_5'UTR|LEMD2_uc003ofe.2_Intron	NM_181336	NP_851853	Q8NC56	LEMD2_HUMAN	LEM domain containing 2 isoform 1							integral to nuclear inner membrane				central_nervous_system(1)	1						TTAAGTGTGGGTTGAGAAAGG	0.413													5	52	---	---	---	---	PASS
POLH	5429	broad.mit.edu	37	6	43571729	43571729	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43571729C>A	uc003ovq.3	+	7	1169	c.865C>A	c.(865-867)CAT>AAT	p.H289N	POLH_uc010jyu.2_Missense_Mutation_p.H165N|POLH_uc011dvl.1_RNA|POLH_uc003ovr.3_Missense_Mutation_p.H190N	NM_006502	NP_006493	Q9Y253	POLH_HUMAN	DNA-directed DNA polymerase eta	289					DNA replication|DNA synthesis involved in DNA repair|regulation of DNA repair|response to UV-C	cytoplasm|nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding			breast(2)	2	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			GCTCCAGAGTCATTTTGGGGA	0.398								DNA_polymerases_(catalytic_subunits)	Xeroderma_Pigmentosum				57	84	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51586771	51586771	+	Intron	SNP	G	A	A	rs9349593	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51586771G>A	uc003pah.1	-						PKHD1_uc010jzn.1_Intron|PKHD1_uc003pai.2_3'UTR	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TCAGCTTCCTGCAGGCTCCTC	0.428													8	120	---	---	---	---	PASS
USP45	85015	broad.mit.edu	37	6	99883515	99883515	+	3'UTR	SNP	G	C	C	rs13208607	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99883515G>C	uc003ppx.2	-	18					USP45_uc003ppv.2_RNA|USP45_uc003ppw.2_3'UTR	NM_001080481	NP_001073950	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|breast(1)	2		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		GGGAAGACTAGAAAGGCACAT	0.308													6	80	---	---	---	---	PASS
MCHR2	84539	broad.mit.edu	37	6	100368762	100368762	+	3'UTR	SNP	A	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100368762A>T	uc003pqh.1	-	6					MCHR2_uc003pqi.1_3'UTR	NM_001040179	NP_001035269	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2							integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CCTTTCTGATAATACCAGTAA	0.383													22	92	---	---	---	---	PASS
PLG	5340	broad.mit.edu	37	6	161152841	161152841	+	Silent	SNP	A	G	G	rs150227219		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161152841A>G	uc003qtm.3	+	12	1566	c.1503A>G	c.(1501-1503)CCA>CCG	p.P501P		NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen	501	Kringle 5.				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CTGGGACGCCATGCCAGGACT	0.502													81	125	---	---	---	---	PASS
CDC14C	168448	broad.mit.edu	37	7	48964801	48964801	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48964801A>G	uc010kyv.1	+	1	645	c.533A>G	c.(532-534)TAT>TGT	p.Y178C		NR_003595				SubName: Full=Putative uncharacterized protein MGC26484;												0						TATGAACACTATGAAAAAGCA	0.368													19	121	---	---	---	---	PASS
COBL	23242	broad.mit.edu	37	7	51094361	51094361	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51094361G>A	uc003tpr.3	-	11	3571	c.3386C>T	c.(3385-3387)ACG>ATG	p.T1129M	COBL_uc003tps.2_Missense_Mutation_p.T1186M|COBL_uc011kcl.1_Missense_Mutation_p.T1129M|COBL_uc003tpp.3_Missense_Mutation_p.T915M|COBL_uc003tpq.3_Missense_Mutation_p.T1070M|COBL_uc003tpo.3_Missense_Mutation_p.T671M	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	1129	WH2 1.									skin(3)|ovary(2)	5	Glioma(55;0.08)					GTGTTCTGCCGTCTAGAATAT	0.507													67	215	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100680818	100680818	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100680818G>A	uc003uxp.1	+	3	6174	c.6121G>A	c.(6121-6123)GAA>AAA	p.E2041K	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2041	Extracellular (Potential).|32.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AACTCCTAGTGAACGGACCAC	0.498													53	259	---	---	---	---	PASS
HIPK2	28996	broad.mit.edu	37	7	139415959	139415959	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139415959T>C	uc003vvf.3	-	2	1049	c.875A>G	c.(874-876)AAG>AGG	p.K292R	HIPK2_uc003vvd.3_Missense_Mutation_p.K292R	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform	292	Protein kinase.|Interaction with DAXX.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					GGGGCTAAACTTGTTTTGCTT	0.507													20	148	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146829477	146829477	+	Silent	SNP	T	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146829477T>C	uc003weu.1	+	8	1740	c.1224T>C	c.(1222-1224)GGT>GGC	p.G408G		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	408	Extracellular (Potential).|Laminin G-like 2.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACCCCAATGGTCTCCTGGTCT	0.483										HNSCC(39;0.1)			62	126	---	---	---	---	PASS
PBK	55872	broad.mit.edu	37	8	27667793	27667793	+	3'UTR	SNP	C	T	T	rs1052873	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27667793C>T	uc003xgi.2	-	8					ESCO2_uc010luy.1_Intron|PBK_uc011lap.1_3'UTR	NM_018492	NP_060962	Q96KB5	TOPK_HUMAN	PDZ binding kinase						mitosis		ATP binding|protein binding|protein serine/threonine kinase activity				0		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|KIRC - Kidney renal clear cell carcinoma(542;0.101)|Kidney(114;0.121)|Colorectal(74;0.141)		CAGTTATTTACGCAAGCCACA	0.358													6	62	---	---	---	---	PASS
MTFR1	9650	broad.mit.edu	37	8	66620359	66620359	+	Intron	SNP	G	A	A	rs13274205	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66620359G>A	uc003xvm.2	+						MTFR1_uc011lep.1_Silent_p.*349*|MTFR1_uc003xvn.2_Intron|MTFR1_uc003xvo.1_Intron	NM_014637	NP_055452	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1 isoform 1							mitochondrion|plasma membrane				pancreas(1)	1			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			AAAGGGAGGTGATACAGGATT	0.398													5	48	---	---	---	---	PASS
FBXO43	286151	broad.mit.edu	37	8	101153010	101153010	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101153010C>T	uc003yjd.2	-	2	2185	c.1472G>A	c.(1471-1473)GGT>GAT	p.G491D	FBXO43_uc003yje.2_Missense_Mutation_p.G457D|FBXO43_uc010mbp.1_Missense_Mutation_p.G491D	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b	491	F-box.				meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			TTTTTCTATACCCATTTTCTT	0.388													31	443	---	---	---	---	PASS
FAM75A6	389730	broad.mit.edu	37	9	43627428	43627428	+	Missense_Mutation	SNP	G	A	A	rs11261835	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43627428G>A	uc011lrb.1	-	4	1288	c.1259C>T	c.(1258-1260)CCC>CTC	p.P420L		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	420						integral to membrane					0						GTGCAGAGAGGGGAGGCCCCA	0.498													12	194	---	---	---	---	PASS
PGM5P2	595135	broad.mit.edu	37	9	69113733	69113733	+	RNA	SNP	G	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69113733G>T	uc004aff.3	-	5		c.921C>A				NR_002836				Homo sapiens phosphoglucomutase 5 pseudogene 2, mRNA (cDNA clone IMAGE:4121651), with apparent retained intron.												0						AATTGGCTGGGGCCCCCAGCT	0.443													23	111	---	---	---	---	PASS
DAPK1	1612	broad.mit.edu	37	9	90321652	90321652	+	Silent	SNP	C	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90321652C>T	uc004apc.2	+	26	3804	c.3666C>T	c.(3664-3666)GTC>GTT	p.V1222V	DAPK1_uc004apd.2_Silent_p.V1222V|DAPK1_uc011ltg.1_Silent_p.V1156V|DAPK1_uc011lth.1_Silent_p.V959V|DAPK1_uc004apg.2_Silent_p.V199V	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	1222					apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						TTGAGAACGTCATGGCCACCA	0.637									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				8	32	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113276281	113276281	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113276281G>A	uc010mtz.2	-	4	1407	c.1070C>T	c.(1069-1071)CCT>CTT	p.P357L	SVEP1_uc010mua.1_Missense_Mutation_p.P357L|SVEP1_uc004beu.2_Missense_Mutation_p.P357L|SVEP1_uc004bev.2_Missense_Mutation_p.P101L	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	357					cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						ACAGTCTTCAGGGGATGTGCT	0.428													5	33	---	---	---	---	PASS
DBH	1621	broad.mit.edu	37	9	136522203	136522203	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136522203A>G	uc004cel.2	+	11	1583	c.1574A>G	c.(1573-1575)GAG>GGG	p.E525G	uc010nao.1_Intron	NM_000787	NP_000778	P09172	DOPO_HUMAN	dopamine beta hydroxylase precursor	525	Intragranular (Potential).				hormone biosynthetic process	chromaffin granule lumen|chromaffin granule membrane|extracellular region|integral to membrane|membrane fraction|soluble fraction|transport vesicle membrane	dopamine beta-monooxygenase activity|L-ascorbic acid binding			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Dopamine(DB00988)|Vitamin C(DB00126)	TTCAACAACGAGGATGTCTGC	0.612													19	100	---	---	---	---	PASS
SEC16A	9919	broad.mit.edu	37	9	139370322	139370322	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139370322C>A	uc004chx.2	-	3	2055	c.1746G>T	c.(1744-1746)CAG>CAT	p.Q582H	SEC16A_uc004chv.3_Missense_Mutation_p.Q209H|SEC16A_uc004chw.2_Missense_Mutation_p.Q582H|SEC16A_uc010nbn.2_Missense_Mutation_p.Q582H|SEC16A_uc010nbo.1_Missense_Mutation_p.Q582H	NM_014866	NP_055681	O15027	SC16A_HUMAN	SEC16 homolog A	404					protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane					0		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CACGGTAATTCTGGCTCACAG	0.478													11	16	---	---	---	---	PASS
DIP2C	22982	broad.mit.edu	37	10	445051	445051	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:445051T>A	uc001ifp.2	-	10	1348	c.1258A>T	c.(1258-1260)AAG>TAG	p.K420*	DIP2C_uc009xhj.1_Nonsense_Mutation_p.K116*	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	420						nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TTCCTTACCTTCCTGGTGAGC	0.622													13	40	---	---	---	---	PASS
IL2RA	3559	broad.mit.edu	37	10	6067802	6067802	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6067802C>T	uc001iiz.1	-	2	410	c.251G>A	c.(250-252)AGC>AAC	p.S84N	IL2RA_uc009xih.1_Missense_Mutation_p.S84N|IL2RA_uc001ija.1_Missense_Mutation_p.S46N	NM_000417	NP_000408	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha chain precursor	84	Sushi 1.|Extracellular (Potential).				cell proliferation	integral to membrane	interleukin-2 receptor activity			ovary(1)|skin(1)	2					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CTTACCAGAGCTTGTGCATTG	0.468													18	64	---	---	---	---	PASS
LOC387646	387646	broad.mit.edu	37	10	27535600	27535600	+	3'UTR	SNP	T	C	C	rs640284	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27535600T>C	uc001its.2	-	1						NR_003525				SubName: Full=cDNA FLJ44924 fis, clone BRAMY3014555;												0						CACAGGTCAATTGCACATGGG	0.517													13	194	---	---	---	---	PASS
LOC387646	387646	broad.mit.edu	37	10	27539928	27539928	+	5'UTR	SNP	A	G	G	rs604705	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27539928A>G	uc001its.2	-	1						NR_003525				SubName: Full=cDNA FLJ44924 fis, clone BRAMY3014555;												0						TACTCAGGGGACCCTGGAGGC	0.478													11	105	---	---	---	---	PASS
HNRNPA3P1	10151	broad.mit.edu	37	10	44285777	44285777	+	Missense_Mutation	SNP	T	C	C	rs3750724	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44285777T>C	uc010qfe.1	-	1	89	c.59A>G	c.(58-60)CAC>CGC	p.H20R		NR_002726				SubName: Full=cDNA FLJ52659, highly similar to Heterogeneous nuclear ribonucleoprotein A3; SubName: Full=cDNA, FLJ79333, highly similar to Heterogeneous nuclear ribonucleoprotein A3; SubName: Full=Heterogeneous nuclear ribonucleoprotein A3, isoform CRA_a;												0						CTCCCCCCAGTGGCGACGGCG	0.527													4	32	---	---	---	---	PASS
LOC100133308	100133308	broad.mit.edu	37	10	45652504	45652504	+	5'Flank	SNP	T	G	G	rs3842995	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45652504T>G	uc009xmq.1	-						uc001jca.3_RNA|uc001jcb.1_RNA|uc009xmr.1_RNA	NR_024472				Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.												0						GGAGGAAAAATAAACATCTGT	0.368													3	18	---	---	---	---	PASS
OGDHL	55753	broad.mit.edu	37	10	50947858	50947858	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50947858C>T	uc001jie.2	-	17	2310	c.2168G>A	c.(2167-2169)AGC>AAC	p.S723N	OGDHL_uc009xog.2_Missense_Mutation_p.S750N|OGDHL_uc010qgt.1_Missense_Mutation_p.S666N|OGDHL_uc010qgu.1_Missense_Mutation_p.S514N	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	723					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						GGCATTGGGGCTGGCCATGGC	0.567													13	40	---	---	---	---	PASS
CC2D2B	387707	broad.mit.edu	37	10	97779281	97779281	+	Intron	SNP	G	A	A	rs4918984	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97779281G>A	uc001kll.2	+						uc001klg.1_Intron|uc001klj.1_Intron|CC2D2B_uc001klk.2_Intron|CC2D2B_uc010qop.1_Intron|uc009xvb.1_RNA	NM_001001732	NP_001001732	Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B isoform											ovary(1)	1		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		gatgagaaccgttgAGGTAGT	0.209													7	81	---	---	---	---	PASS
LCOR	84458	broad.mit.edu	37	10	98715214	98715214	+	Silent	SNP	A	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98715214A>G	uc001kms.1	+	8	1358	c.837A>G	c.(835-837)GTA>GTG	p.V279V	LCOR_uc001kmr.2_Silent_p.V279V|C10orf12_uc009xvg.1_Intron|LCOR_uc001kmt.1_Silent_p.V279V|LCOR_uc001kmu.1_Silent_p.V279V	NM_032440	NP_115816	Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	279						nucleus	DNA binding			ovary(3)	3		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		GCTCTTTGGTAATGGGTTCAC	0.428													26	100	---	---	---	---	PASS
FAM178A	55719	broad.mit.edu	37	10	102719193	102719193	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102719193C>A	uc001krt.3	+	19	3968	c.3426C>A	c.(3424-3426)GAC>GAA	p.D1142E	FAM178A_uc001krs.2_Missense_Mutation_p.D1142E	NM_018121	NP_060591	Q8IX21	F178A_HUMAN	hypothetical protein LOC55719 isoform 1	1142											0						AGGTGAAAGACTTGGTCGCCA	0.358													44	244	---	---	---	---	PASS
EBF3	253738	broad.mit.edu	37	10	131761928	131761928	+	Silent	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131761928G>A	uc001lki.1	-	1	164	c.105C>T	c.(103-105)GGC>GGT	p.G35G	EBF3_uc010qur.1_Silent_p.G21G	NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3	35					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		CGTCCACCACGCCCGCCGTGT	0.453													5	34	---	---	---	---	PASS
TRIM48	79097	broad.mit.edu	37	11	55038375	55038375	+	3'UTR	SNP	T	C	C	rs3213870	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55038375T>C	uc010rid.1	+	6						NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48							intracellular	zinc ion binding				0						TCCTTCTCACTTCCTCTCAGA	0.433													7	45	---	---	---	---	PASS
CREBZF	58487	broad.mit.edu	37	11	85374911	85374911	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85374911A>C	uc001pas.2	-	1	1272	c.1009T>G	c.(1009-1011)TCG>GCG	p.S337A	CREBZF_uc010rtc.1_RNA|CREBZF_uc010rtd.1_RNA	NM_001039618	NP_001034707	Q9NS37	ZHANG_HUMAN	HCF-binding transcription factor Zhangfei	337					negative regulation of gene expression, epigenetic|negative regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|response to virus	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				AACTCCACCGACACCTTATCC	0.562											OREG0021274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	39	112	---	---	---	---	PASS
FOLH1B	219595	broad.mit.edu	37	11	89429850	89429850	+	Missense_Mutation	SNP	G	C	C	rs141697840		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89429850G>C	uc001pda.2	+	13	1622	c.1096G>C	c.(1096-1098)GCA>CCA	p.A366P		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	366					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						TCTGGAAAGAGCATTTATTGA	0.308													23	95	---	---	---	---	PASS
SDHD	6392	broad.mit.edu	37	11	111959648	111959648	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111959648T>A	uc001pmz.2	+	3	288	c.227T>A	c.(226-228)CTC>CAC	p.L76H	TIMM8B_uc001pmx.2_5'Flank|TIMM8B_uc001pmy.2_5'Flank	NM_003002	NP_002993	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D	76	Helical; (By similarity).				respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II	electron carrier activity|heme binding|succinate dehydrogenase activity|ubiquinone binding				0		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Succinic acid(DB00139)	AGTGTTTTGCTCCTGGGTCTG	0.498			Mis|N|F|S			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome				54	46	---	---	---	---	PASS
OR10G9	219870	broad.mit.edu	37	11	123894277	123894277	+	Silent	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123894277G>A	uc010sad.1	+	1	558	c.558G>A	c.(556-558)CTG>CTA	p.L186L		NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G,	186	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TCCTGAAACTGGCCTGTGCAG	0.522													46	175	---	---	---	---	PASS
VWA5A	4013	broad.mit.edu	37	11	123988558	123988558	+	Silent	SNP	A	G	G	rs150034934	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123988558A>G	uc001pzu.2	+	4	431	c.222A>G	c.(220-222)GTA>GTG	p.V74V	VWA5A_uc001pzr.2_Silent_p.V74V|VWA5A_uc001pzs.2_Silent_p.V74V|VWA5A_uc010sae.1_Silent_p.V90V|VWA5A_uc001pzt.2_Silent_p.V74V	NM_001130142	NP_001123614	O00534	VMA5A_HUMAN	BCSC-1 isoform 1	74	VIT.									upper_aerodigestive_tract(1)|ovary(1)	2						AGAAAATTGTAGCAGAATTAC	0.413													22	73	---	---	---	---	PASS
STT3A	3703	broad.mit.edu	37	11	125490850	125490850	+	3'UTR	SNP	C	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125490850C>A	uc001qcd.2	+	18					STT3A_uc001qce.2_3'UTR|STT3A_uc010sbg.1_3'UTR|STT3A_uc009zbn.2_3'UTR	NM_152713	NP_689926	P46977	STT3A_HUMAN	integral membrane protein 1						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity				0	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		TTGTCTTGGGCAGTATGGGCT	0.323													3	6	---	---	---	---	PASS
HOXC13	3229	broad.mit.edu	37	12	54332658	54332658	+	5'UTR	SNP	T	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54332658T>G	uc001sei.2	+	1					HOXC13_uc010sop.1_RNA	NM_017410	NP_059106	P31276	HXC13_HUMAN	homeobox C13							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						CTCTGGCAAGTGGAGTTTTTA	0.343			T	NUP98	AML								6	12	---	---	---	---	PASS
GLIPR1L1	256710	broad.mit.edu	37	12	75737689	75737689	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75737689T>G	uc001sxo.2	+	2	437	c.391T>G	c.(391-393)TGC>GGC	p.C131G	CAPS2_uc001sxm.3_Intron|CAPS2_uc009zsa.2_Intron|GLIPR1L1_uc001sxn.2_Missense_Mutation_p.C131G	NM_152779	NP_689992	Q6UWM5	GPRL1_HUMAN	GLI pathogenesis-related 1 like 1	131						extracellular region					0						TAGTCTATCATGCTCCAGAGT	0.313													47	137	---	---	---	---	PASS
MGAT4C	25834	broad.mit.edu	37	12	86373140	86373140	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86373140C>T	uc001tai.3	-	8	2614	c.1364G>A	c.(1363-1365)TGT>TAT	p.C455Y	MGAT4C_uc001tal.3_Missense_Mutation_p.C455Y|MGAT4C_uc001taj.3_Missense_Mutation_p.C455Y|MGAT4C_uc001tak.3_Missense_Mutation_p.C455Y|MGAT4C_uc010sum.1_Missense_Mutation_p.C479Y|MGAT4C_uc001tah.3_Missense_Mutation_p.C455Y	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	455	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						TATCCTCATACAATGTATATC	0.308													44	74	---	---	---	---	PASS
UBE3B	89910	broad.mit.edu	37	12	109967774	109967774	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109967774T>A	uc001top.2	+	25	3310	c.2707T>A	c.(2707-2709)TTC>ATC	p.F903I	UBE3B_uc001toq.2_Missense_Mutation_p.F903I|UBE3B_uc001tos.2_Missense_Mutation_p.F330I|UBE3B_uc001tot.2_Missense_Mutation_p.F21I|UBE3B_uc010sxp.1_Missense_Mutation_p.F21I	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	903	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			ovary(2)|lung(2)	4						CATTAGCGGATTCCGTTCCAT	0.443													85	160	---	---	---	---	PASS
OR4K13	390433	broad.mit.edu	37	14	20502565	20502565	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20502565A>G	uc010tkz.1	-	1	353	c.353T>C	c.(352-354)ATG>ACG	p.M118T		NM_001004714	NP_001004714	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K,	118	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		GTCTATTGCCATGGCTACAAG	0.493													60	71	---	---	---	---	PASS
RPS29	6235	broad.mit.edu	37	14	50044392	50044392	+	3'UTR	SNP	T	C	C	rs2883438	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50044392T>C	uc001wwl.2	-	3					SDCCAG1_uc010anj.1_Intron	NM_001030001	NP_001025172	P62273	RS29_HUMAN	ribosomal protein S29 isoform 2						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|structural constituent of ribosome|zinc ion binding				0	all_epithelial(31;0.00214)|Breast(41;0.0124)					ACCCTGTTGTTAATACCTCTG	0.448													7	86	---	---	---	---	PASS
PDIA3	2923	broad.mit.edu	37	15	44060741	44060741	+	Silent	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44060741G>A	uc001zsu.2	+	9	1231	c.1083G>A	c.(1081-1083)CTG>CTA	p.L361L	PDIA3_uc010bdp.2_Silent_p.L341L|PDIA3_uc010ued.1_Silent_p.L135L	NM_005313	NP_005304	P30101	PDIA3_HUMAN	protein disulfide-isomerase A3 precursor	361	Thioredoxin 2.				cell redox homeostasis|glycerol ether metabolic process|post-translational protein modification|protein folding|protein import into nucleus|protein N-linked glycosylation via asparagine|protein retention in ER lumen|signal transduction	endoplasmic reticulum lumen|melanosome	cysteine-type endopeptidase activity|electron carrier activity|phospholipase C activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)|skin(1)	2		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.48e-07)		ATGGCAATCTGAAGAGATACC	0.488													25	67	---	---	---	---	PASS
SPATA5L1	79029	broad.mit.edu	37	15	45706846	45706846	+	Silent	SNP	T	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45706846T>C	uc001zve.2	+	4	1621	c.1512T>C	c.(1510-1512)TAT>TAC	p.Y504Y	SPATA5L1_uc001zvf.2_RNA	NM_024063	NP_076968	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	504						cytoplasm	ATP binding|nucleoside-triphosphatase activity			ovary(3)|skin(1)	4		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		TTCTCCTCTATGGGCCCCCTG	0.498													30	102	---	---	---	---	PASS
PRTG	283659	broad.mit.edu	37	15	56032778	56032778	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56032778G>A	uc002adg.2	-	2	247	c.199C>T	c.(199-201)CCT>TCT	p.P67S		NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor	67	Ig-like 1.				multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		ACCTTAATAGGAACTTCTCCG	0.423													46	319	---	---	---	---	PASS
GLCE	26035	broad.mit.edu	37	15	69561171	69561171	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69561171C>G	uc002ary.1	+	5	1670	c.1442C>G	c.(1441-1443)TCT>TGT	p.S481C		NM_015554	NP_056369	O94923	GLCE_HUMAN	D-glucuronyl C5-epimerase	481	Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process|heparin biosynthetic process	Golgi membrane|integral to membrane	UDP-glucuronate 5'-epimerase activity			ovary(2)	2						AAGTTTCTATCTGAGCAGCAT	0.378													37	197	---	---	---	---	PASS
LASS3	204219	broad.mit.edu	37	15	100943022	100943022	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100943022C>G	uc002bvz.2	-	13	1550	c.1048G>C	c.(1048-1050)GAA>CAA	p.E350Q	LASS3_uc002bwa.2_Missense_Mutation_p.E361Q|LASS3_uc002bwb.2_Missense_Mutation_p.E350Q	NM_178842	NP_849164	Q8IU89	CERS3_HUMAN	LAG1 longevity assurance homolog 3	350	Poly-Glu.					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(2)|pancreas(1)|skin(1)	4	Lung NSC(78;0.0018)|all_lung(78;0.00278)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000867)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)			tcttcctcttcctcttcctct	0.408													5	43	---	---	---	---	PASS
CHST4	10164	broad.mit.edu	37	16	71570904	71570904	+	Silent	SNP	C	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71570904C>A	uc002fan.2	+	2	505	c.324C>A	c.(322-324)GTC>GTA	p.V108V	CHST4_uc002fao.2_Silent_p.V108V	NM_005769	NP_005760	Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	108	Lumenal (Potential).				cell-cell signaling|immune response|inflammatory response|N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity				0						ACATGAGCGTCTTTGATGCCT	0.592													17	125	---	---	---	---	PASS
MAF	4094	broad.mit.edu	37	16	79633710	79633710	+	Silent	SNP	A	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79633710A>G	uc002ffn.2	-	1	913	c.90T>C	c.(88-90)TTT>TTC	p.F30F	MAF_uc002ffm.2_Silent_p.F30F	NM_001031804	NP_001026974	O75444	MAF_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene	30					transcription from RNA polymerase II promoter	chromatin|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1		all_epithelial(2;0.139)|Lung NSC(2;0.186)|Melanoma(2;0.211)		UCEC - Uterine corpus endometrioid carcinoma (2;0.0178)		TTTTCACTTCAAACTTCATCA	0.557			T	IGH@	MM								22	65	---	---	---	---	PASS
OR1D2	4991	broad.mit.edu	37	17	2996190	2996190	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2996190A>G	uc010vrb.1	-	1	101	c.101T>C	c.(100-102)ATG>ACG	p.M34T		NM_002548	NP_002539	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D,	34	Helical; Name=1; (Potential).				cellular component movement|chemotaxis|protein import into nucleus, translocation|sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity			ovary(1)	1						GACCAGGTACATGGACAGGAA	0.557													46	230	---	---	---	---	PASS
C17orf98	388381	broad.mit.edu	37	17	36997521	36997521	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36997521G>A	uc002hqv.2	-	1	122	c.122C>T	c.(121-123)CCG>CTG	p.P41L		NM_001080465	NP_001073934	A8MV24	CQ098_HUMAN	hypothetical protein LOC388381	41											0						GTTGTAGGGCGGAATCGCCGA	0.617													34	79	---	---	---	---	PASS
C17orf53	78995	broad.mit.edu	37	17	42232723	42232723	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42232723T>A	uc002ifi.1	+	8	1902	c.1717T>A	c.(1717-1719)TAC>AAC	p.Y573N	C17orf53_uc010czq.1_Missense_Mutation_p.Y572N|C17orf53_uc002ifj.1_Missense_Mutation_p.Y497N|C17orf53_uc002ifk.1_RNA	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN	hypothetical protein LOC78995	573											0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GGTCCATATTTACAGCCCGGA	0.522													28	164	---	---	---	---	PASS
ZNF652	22834	broad.mit.edu	37	17	47388778	47388778	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47388778G>T	uc002iov.3	-	5	1669	c.1205C>A	c.(1204-1206)TCC>TAC	p.S402Y	ZNF652_uc002iow.2_Missense_Mutation_p.S402Y|ZNF652_uc002iou.3_RNA	NM_001145365	NP_001138837	Q9Y2D9	ZN652_HUMAN	zinc finger protein 652	402	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)			GCTCATGTGGGAGCGTAGCTG	0.453													136	266	---	---	---	---	PASS
BZRAP1	9256	broad.mit.edu	37	17	56395795	56395795	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56395795C>T	uc002ivx.3	-	14	2589	c.1718G>A	c.(1717-1719)GGC>GAC	p.G573D	BZRAP1_uc010dcs.2_Missense_Mutation_p.G513D|BZRAP1_uc010wnt.1_Missense_Mutation_p.G573D	NM_004758	NP_004749	O95153	RIMB1_HUMAN	peripheral benzodiazepine receptor-associated	573						mitochondrion	benzodiazepine receptor binding			upper_aerodigestive_tract(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCCAGGGGAGCCCGGCGGGAG	0.622													15	39	---	---	---	---	PASS
BZRAP1	9256	broad.mit.edu	37	17	56395796	56395796	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56395796C>T	uc002ivx.3	-	14	2588	c.1717G>A	c.(1717-1719)GGC>AGC	p.G573S	BZRAP1_uc010dcs.2_Missense_Mutation_p.G513S|BZRAP1_uc010wnt.1_Missense_Mutation_p.G573S	NM_004758	NP_004749	O95153	RIMB1_HUMAN	peripheral benzodiazepine receptor-associated	573						mitochondrion	benzodiazepine receptor binding			upper_aerodigestive_tract(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCAGGGGAGCCCGGCGGGAGG	0.622													16	38	---	---	---	---	PASS
COG1	9382	broad.mit.edu	37	17	71197742	71197742	+	Silent	SNP	T	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71197742T>C	uc002jjg.2	+	7	1812	c.1776T>C	c.(1774-1776)ATT>ATC	p.I592I	COG1_uc002jjh.2_Silent_p.I592I|COG1_uc002jjf.1_Silent_p.I592I	NM_018714	NP_061184	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	592					Golgi organization|intra-Golgi vesicle-mediated transport|protein transport	Golgi membrane|Golgi transport complex	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.197)			TACAGAGCATTGAAGAGGGTG	0.587													30	60	---	---	---	---	PASS
THOC1	9984	broad.mit.edu	37	18	214641	214641	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:214641A>C	uc002kkj.3	-	21	1999	c.1959T>G	c.(1957-1959)AAT>AAG	p.N653K	THOC1_uc002kkk.3_RNA|THOC1_uc002kkh.3_Missense_Mutation_p.N277K	NM_005131	NP_005122	Q96FV9	THOC1_HUMAN	THO complex 1	653	Death.				apoptosis|intronless viral mRNA export from host nucleus|mRNA processing|regulation of transcription elongation, DNA-dependent|RNA splicing|signal transduction|transcription, DNA-dependent	cytoplasm|nuclear matrix|nuclear speck|THO complex part of transcription export complex	DNA binding|protein binding|RNA binding			ovary(1)	1		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				TATTTGTCTCATTGTCATTAG	0.348													48	89	---	---	---	---	PASS
MYO5B	4645	broad.mit.edu	37	18	47463681	47463681	+	Silent	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47463681G>A	uc002leb.2	-	15	2127	c.1839C>T	c.(1837-1839)AGC>AGT	p.S613S	MYO5B_uc002lec.1_Silent_p.S612S	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB	613	Myosin head-like.				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		CAGAACGGACGCTGATCTTCG	0.547													22	143	---	---	---	---	PASS
SERPINB5	5268	broad.mit.edu	37	18	61154236	61154236	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61154236G>A	uc002liz.3	+	3	368	c.226G>A	c.(226-228)GAT>AAT	p.D76N	SERPINB5_uc002liy.2_Missense_Mutation_p.D76N	NM_002639	NP_002630	P36952	SPB5_HUMAN	serine (or cysteine) proteinase inhibitor, clade	76					cellular component movement|regulation of proteolysis	cytoplasm|extracellular space	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1						AGTAACATCGGATGTAAACAA	0.353													63	138	---	---	---	---	PASS
ZNF560	147741	broad.mit.edu	37	19	9578114	9578114	+	Silent	SNP	A	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9578114A>C	uc002mlp.1	-	10	1719	c.1509T>G	c.(1507-1509)CTT>CTG	p.L503L	ZNF560_uc010dwr.1_Silent_p.L397L	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560	503	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						AATGAGCAAAAAGAGATGAGA	0.408													99	156	---	---	---	---	PASS
PLVAP	83483	broad.mit.edu	37	19	17487791	17487791	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17487791G>T	uc002ngk.1	-	1	357	c.307C>A	c.(307-309)CTG>ATG	p.L103M		NM_031310	NP_112600	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	103	Extracellular (Potential).					caveola|integral to membrane|perinuclear region of cytoplasm					0						CGAGCATTCAGCCACATCTGC	0.557													19	62	---	---	---	---	PASS
MAP1S	55201	broad.mit.edu	37	19	17836823	17836823	+	Silent	SNP	C	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17836823C>T	uc002nhe.1	+	5	639	c.630C>T	c.(628-630)TTC>TTT	p.F210F	MAP1S_uc010eaz.1_RNA|MAP1S_uc010eba.1_Silent_p.F210F|MAP1S_uc002nhf.1_Intron|MAP1S_uc010xpv.1_Silent_p.F184F	NM_018174	NP_060644	Q66K74	MAP1S_HUMAN	BPY2 interacting protein 1	210	Necessary for the microtubule-organizing center localization.				apoptosis|brain development|microtubule bundle formation|mitochondrion transport along microtubule|neuron projection morphogenesis	cytosol|dendrite|microtubule|neuronal cell body|nucleus|perinuclear region of cytoplasm|spindle|synapse	actin filament binding|beta-tubulin binding|DNA binding|microtubule binding			central_nervous_system(1)	1						TGTGCGAATTCCTGGAGTACG	0.711													5	27	---	---	---	---	PASS
KIAA1683	80726	broad.mit.edu	37	19	18376414	18376414	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18376414G>C	uc002nin.2	-	3	2152	c.1936C>G	c.(1936-1938)CAC>GAC	p.H646D	KIAA1683_uc010ebn.2_Missense_Mutation_p.H646D|KIAA1683_uc010xqe.1_Missense_Mutation_p.H600D	NM_025249	NP_079525	Q9H0B3	K1683_HUMAN	KIAA1683 isoform b	646						mitochondrion				ovary(2)	2						ACATACACGTGAGGTGGCTTG	0.577													21	74	---	---	---	---	PASS
DPY19L3	147991	broad.mit.edu	37	19	32968514	32968514	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32968514A>G	uc002ntg.2	+	17	1960	c.1784A>G	c.(1783-1785)AAC>AGC	p.N595S	DPY19L3_uc002nth.1_Missense_Mutation_p.N595S|DPY19L3_uc002nti.1_RNA|DPY19L3_uc002ntj.1_Missense_Mutation_p.N17S	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3	595						integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)					ACCCTAACCAACCACCCGCAC	0.582													14	80	---	---	---	---	PASS
ZNF534	147658	broad.mit.edu	37	19	52942411	52942411	+	Silent	SNP	G	A	A	rs113700997		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52942411G>A	uc002pzk.2	+	4	1798	c.1737G>A	c.(1735-1737)GCG>GCA	p.A579A	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Silent_p.A566A	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	579	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACACCTTGCGCGACATAGGA	0.443													4	21	---	---	---	---	PASS
ZNF761	388561	broad.mit.edu	37	19	53958116	53958116	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53958116T>A	uc010eqp.2	+	7	813	c.355T>A	c.(355-357)TTG>ATG	p.L119M	ZNF761_uc010ydy.1_Missense_Mutation_p.L65M|ZNF761_uc002qbt.1_Missense_Mutation_p.L65M	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761	119					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)		AATCAAAAAGTTGACAGGTAT	0.368													67	119	---	---	---	---	PASS
HMOX1	3162	broad.mit.edu	37	22	35783139	35783139	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35783139G>T	uc003ant.1	+	3	686	c.606G>T	c.(604-606)GAG>GAT	p.E202D		NM_002133	NP_002124	P09601	HMOX1_HUMAN	heme oxygenase (decyclizing) 1	202					angiogenesis|anti-apoptosis|cell death|cellular iron ion homeostasis|endothelial cell proliferation|erythrocyte homeostasis|heme catabolic process|heme oxidation|intracellular protein kinase cascade|low-density lipoprotein particle clearance|negative regulation of leukocyte migration|negative regulation of smooth muscle cell proliferation|positive regulation of chemokine biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of smooth muscle cell proliferation|protein homooligomerization|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hydrogen peroxide|response to nicotine|smooth muscle hyperplasia|transmembrane transport|wound healing involved in inflammatory response	endoplasmic reticulum membrane|extracellular space|microsome	enzyme binding|heme binding|heme oxygenase (decyclizing) activity|protein homodimerization activity|signal transducer activity			ovary(1)	1					NADH(DB00157)	TGATAGAAGAGGCCAAGACTG	0.602													25	103	---	---	---	---	PASS
FBLN1	2192	broad.mit.edu	37	22	45938163	45938163	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45938163G>A	uc003bgj.1	+	10	1342	c.1195G>A	c.(1195-1197)GAT>AAT	p.D399N	FBLN1_uc003bgg.1_Missense_Mutation_p.D399N|FBLN1_uc003bgh.2_Missense_Mutation_p.D399N|FBLN1_uc010gzz.2_Missense_Mutation_p.D437N|FBLN1_uc003bgi.1_Missense_Mutation_p.D399N	NM_006486	NP_006477	P23142	FBLN1_HUMAN	fibulin 1 isoform D	399	EGF-like 6; calcium-binding.|Self-association and FN1-binding; calcium is necessary for homotypic binding, but not for heterotypic binding.				interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GATGTGTGTCGGTGCGTGGGG	0.612													58	97	---	---	---	---	PASS
SAT1	6303	broad.mit.edu	37	X	23803813	23803813	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23803813G>A	uc004dau.2	+	6	550	c.356G>A	c.(355-357)AGG>AAG	p.R119K	SAT1_uc004dav.2_RNA	NM_002970	NP_002961	P21673	SAT1_HUMAN	diamine N-acetyltransferase 1	119	N-acetyltransferase.				angiogenesis|polyamine biosynthetic process	cytosol	diamine N-acetyltransferase activity|protein binding				0					Spermine(DB00127)	GTTGCAATGAGGTGTCGCTGC	0.408													37	46	---	---	---	---	PASS
SAT1	6303	broad.mit.edu	37	X	23803814	23803814	+	Silent	SNP	G	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23803814G>A	uc004dau.2	+	6	551	c.357G>A	c.(355-357)AGG>AGA	p.R119R	SAT1_uc004dav.2_RNA	NM_002970	NP_002961	P21673	SAT1_HUMAN	diamine N-acetyltransferase 1	119	N-acetyltransferase.				angiogenesis|polyamine biosynthetic process	cytosol	diamine N-acetyltransferase activity|protein binding				0					Spermine(DB00127)	TTGCAATGAGGTGTCGCTGCA	0.413													37	44	---	---	---	---	PASS
HDAC6	10013	broad.mit.edu	37	X	48674583	48674583	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48674583T>C	uc011mmi.1	+	18	1624	c.1529T>C	c.(1528-1530)ATC>ACC	p.I510T	HDAC6_uc004dks.1_Missense_Mutation_p.I510T|HDAC6_uc010nig.1_Missense_Mutation_p.I358T|HDAC6_uc004dkt.1_Missense_Mutation_p.I510T|HDAC6_uc011mmk.1_Missense_Mutation_p.I491T|HDAC6_uc004dkv.1_Missense_Mutation_p.I158T|HDAC6_uc004dkw.1_Missense_Mutation_p.I158T	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	510	Histone deacetylase 2.				aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	ATCTTGCGGATCATGTGCCGT	0.647													28	25	---	---	---	---	PASS
OGT	8473	broad.mit.edu	37	X	70756094	70756094	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70756094G>T	uc004eaa.1	+	2	321	c.104G>T	c.(103-105)GGA>GTA	p.G35V	BCYRN1_uc011mpt.1_Intron|OGT_uc004eab.1_Missense_Mutation_p.G25V|OGT_uc011mpw.1_Missense_Mutation_p.G35V	NM_181672	NP_858058	O15294	OGT1_HUMAN	O-linked GlcNAc transferase isoform 1	35	TPR 1.				cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity			ovary(3)|kidney(1)|pancreas(1)	5	Renal(35;0.156)					TATCAGGCAGGAGATTTTGAG	0.453													17	33	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117677504	117677504	+	Missense_Mutation	SNP	G	A	A	rs145683125	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117677504G>A	uc004eqp.2	+	4	403	c.340G>A	c.(340-342)GTG>ATG	p.V114M		NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	114	Interaction with activated CDC42 (By similarity).				blood coagulation	cytosol	GTP binding			ovary(3)	3						AGATTGGCACGTGGTAAACTA	0.348													8	114	---	---	---	---	PASS
MAGEA12	4111	broad.mit.edu	37	X	151896334	151896334	+	RNA	SNP	G	A	A	rs2515828	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151896334G>A	uc004fgb.2	-	4		c.433C>T						P43365	MAGAC_HUMAN	Homo sapiens melanoma antigen family A, 12, mRNA (cDNA clone MGC:4914 IMAGE:3450217), complete cds.											skin(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GTTCCCTTCCGGGTTGTCTTG	0.527													5	40	---	---	---	---	PASS
F8	2157	broad.mit.edu	37	X	154157680	154157680	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154157680A>T	uc004fmt.2	-	14	4556	c.4385T>A	c.(4384-4386)CTT>CAT	p.L1462H		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	1462	B.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GGCTAAAGAAAGGTTATTTTT	0.418													38	58	---	---	---	---	PASS
ITGB3BP	23421	broad.mit.edu	37	1	63920427	63920427	+	Intron	DEL	A	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63920427delA	uc001dba.1	-						ITGB3BP_uc001dbb.1_Intron|ITGB3BP_uc001dbc.1_Intron|ITGB3BP_uc001dbd.1_Intron|ITGB3BP_uc009wak.1_Intron|ITGB3BP_uc001dbe.1_Intron	NM_014288	NP_055103	Q13352	CENPR_HUMAN	integrin beta 3 binding protein						apoptosis|cell adhesion|CenH3-containing nucleosome assembly at centromere|induction of apoptosis by extracellular signals|mitotic prometaphase|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome, centromeric region|cytosol|membrane fraction|nucleoplasm	protein C-terminus binding|signal transducer activity				0						TTCTCCTATTAAAAAAAAAAT	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	80400182	80400189	+	IGR	DEL	TCCTTCCT	-	-	rs71753353	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80400182_80400189delTCCTTCCT								ELTD1 (927687 upstream) : None (None downstream)																							cttccttccgtccttccttccttccttc	0.000													5	4	---	---	---	---	
ANP32E	81611	broad.mit.edu	37	1	150193908	150193911	+	Intron	DEL	GGAA	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150193908_150193911delGGAA	uc001etw.2	-						ANP32E_uc010pbt.1_Intron|ANP32E_uc010pbu.1_Intron|ANP32E_uc010pbv.1_Intron|ANP32E_uc001etv.3_Intron	NM_030920	NP_112182	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32							cytoplasmic membrane-bounded vesicle|nucleus	phosphatase inhibitor activity				0	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			agggagggagggaaggaaggaagg	0.078													4	2	---	---	---	---	
SLC26A9	115019	broad.mit.edu	37	1	205893754	205893754	+	Intron	DEL	T	-	-	rs67742034		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205893754delT	uc001hdq.2	-						SLC26A9_uc001hdo.2_Intron|SLC26A9_uc001hdp.2_Intron	NM_052934	NP_443166	Q7LBE3	S26A9_HUMAN	solute carrier family 26, member 9 isoform a							integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			TTAAATAGCATTTTTTGCAAT	0.373													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224262251	224262254	+	IGR	DEL	TTCT	-	-	rs71822807		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224262251_224262254delTTCT								TP53BP2 (228577 upstream) : FBXO28 (39537 downstream)																							ccttccttccttctttctttcttt	0.088													3	4	---	---	---	---	
ITPKB	3707	broad.mit.edu	37	1	226830027	226830027	+	Intron	DEL	T	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226830027delT	uc010pvo.1	-							NM_002221	NP_002212	P27987	IP3KB_HUMAN	1D-myo-inositol-trisphosphate 3-kinase B								ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity			ovary(4)|central_nervous_system(1)	5		Prostate(94;0.0773)				TTTTCTTTTCTTTTTttttta	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	231442133	231442134	+	IGR	DEL	TG	-	-	rs138733794		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231442133_231442134delTG								GNPAT (28415 upstream) : EXOC8 (26349 downstream)																							CTACTCTCTTtgtgtgtgtgtg	0.248													2	4	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237678972	237678973	+	Intron	INS	-	TTCC	TTCC			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237678972_237678973insTTCC	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			cctcccTTTTTttccttccttc	0.064													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	243251423	243251423	+	RNA	DEL	A	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243251423delA	uc001hzq.1	-	8		c.1209delT								Homo sapiens cDNA FLJ52610 complete cds.																		actccatctcaaaaaaaaaaa	0.179													4	2	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245408059	245408060	+	Intron	DEL	CA	-	-	rs111373951		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245408059_245408060delCA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			cacgcacactcacacacacaca	0.302													3	4	---	---	---	---	
RANBP2	5903	broad.mit.edu	37	2	109371230	109371231	+	Intron	INS	-	TAT	TAT	rs144795306	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109371230_109371231insTAT	uc002tem.3	+							NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						ACTTTCACGTGTATTATTTAAA	0.158													13	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113104393	113104394	+	IGR	INS	-	A	A	rs149346840	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113104393_113104394insA								ZC3H6 (6753 upstream) : RGPD8 (21572 downstream)																							ccatcaccatcgcaccaccatc	0.000													3	3	---	---	---	---	
KCNJ3	3760	broad.mit.edu	37	2	155591581	155591582	+	Intron	INS	-	TG	TG	rs139771822	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155591581_155591582insTG	uc002tyv.1	+						KCNJ3_uc010zce.1_Intron	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3						synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)	CCTTGTAGGCCtgtgtgtgtgt	0.149													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	168222095	168222096	+	IGR	INS	-	AC	AC	rs67975295		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168222095_168222096insAC								XIRP2 (105836 upstream) : B3GALT1 (453086 downstream)																							GAGATACAAATacacacacaca	0.282													2	5	---	---	---	---	
LRP2	4036	broad.mit.edu	37	2	170038236	170038260	+	Intron	DEL	AGACTGCATTCTGAATTCTTTTCTG	-	-	rs61106961		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170038236_170038260delAGACTGCATTCTGAATTCTTTTCTG	uc002ues.2	-							NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TCTGTAGAGCAGACTGCATTCTGAATTCTTTTCTGCATTCAGAAA	0.378													6	5	---	---	---	---	
OLA1	29789	broad.mit.edu	37	2	174984685	174984686	+	Intron	DEL	AC	-	-	rs67473742		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174984685_174984686delAC	uc002uih.2	-						OLA1_uc002uii.2_Intron|OLA1_uc010fqq.2_Intron|OLA1_uc002uij.2_Intron|OLA1_uc002uik.2_Intron|OLA1_uc010fqr.2_Intron	NM_013341	NP_037473	Q9NTK5	OLA1_HUMAN	Obg-like ATPase 1 isoform 1						ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2						acacacacaaacacacacacac	0.208													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235325003	235325004	+	IGR	DEL	AC	-	-	rs10561770		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235325003_235325004delAC								SPP2 (339227 upstream) : ARL4C (76684 downstream)																							TATAATTAAAacacacacacac	0.228													4	2	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236986681	236986682	+	Intron	INS	-	TG	TG	rs141039110	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236986681_236986682insTG	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						aacaaccaatttgtgtgtgtgt	0.183													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	44742568	44742568	+	IGR	DEL	G	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44742568delG								ZNF35 (40286 upstream) : ZNF502 (11567 downstream)																							aaggaaggaaggaaggaagga	0.025													5	3	---	---	---	---	
CCDC66	285331	broad.mit.edu	37	3	56598292	56598292	+	Intron	DEL	A	-	-	rs11285260		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56598292delA	uc003dhz.2	+						CCDC66_uc003dhy.2_Intron|CCDC66_uc003dhu.2_Intron|CCDC66_uc003dhx.2_Intron|CCDC66_uc003dhv.2_Intron|CCDC66_uc003dhw.2_Intron	NM_001141947	NP_001135419	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66 isoform 1											breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		TTGTTCTTTTAGAGGACTTTC	0.264													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	28522588	28522607	+	IGR	DEL	TTCCTTCCTTCCTTCCTTCC	-	-	rs142513400		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28522588_28522607delTTCCTTCCTTCCTTCCTTCC								None (None upstream) : None (None downstream)																							AAATTTAtctttccttccttccttccttccttccttcctt	0.127													6	3	---	---	---	---	
CCDC111	201973	broad.mit.edu	37	4	185613052	185613052	+	Intron	DEL	T	-	-	rs10567357		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185613052delT	uc003iwk.2	+						CCDC111_uc003iwj.2_Intron|CCDC111_uc003iwl.2_Intron|CCDC111_uc003iwm.2_Intron|CCDC111_uc003iwn.2_Intron	NM_152683	NP_689896	Q96LW4	CC111_HUMAN	coiled-coil domain containing 111						DNA replication, synthesis of RNA primer		DNA primase activity			central_nervous_system(1)	1		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.00531)|Hepatocellular(41;0.00932)|Renal(120;0.0246)|Prostate(90;0.0283)|all_hematologic(60;0.0749)|all_neural(102;0.131)		all cancers(43;5.84e-27)|Epithelial(43;2.2e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.28e-11)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.03e-05)|Colorectal(24;7.57e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000249)|COAD - Colon adenocarcinoma(29;0.000502)|LUSC - Lung squamous cell carcinoma(40;0.00995)|READ - Rectum adenocarcinoma(43;0.173)		aatacaaaccttttttttttt	0.025													3	5	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1052736	1052740	+	Intron	DEL	GAGCA	-	-	rs142533833		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1052736_1052740delGAGCA	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	AGGCGGGGAGGAGCAGGGCAGGGGA	0.605													5	6	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5192109	5192109	+	Intron	DEL	T	-	-	rs113899904		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5192109delT	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron|ADAMTS16_uc003jdj.1_Intron	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						atttatttactttattttgag	0.154													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8287043	8287046	+	IGR	DEL	CTCC	-	-	rs139964067		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8287043_8287046delCTCC								MTRR (385810 upstream) : SEMA5A (748092 downstream)																							tccctctcctctccctcccttcct	0.103													5	3	---	---	---	---	
TRIO	7204	broad.mit.edu	37	5	14481080	14481080	+	Intron	DEL	A	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14481080delA	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc003jfh.1_Intron	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					ttgtctatttaaaaaaaaaaa	0.154													4	2	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	59183548	59183549	+	Intron	DEL	GT	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59183548_59183549delGT	uc003jsa.2	-						PDE4D_uc003jsb.2_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	CAAGCCATCAgtgtgtgtgtgt	0.267													4	3	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	59284181	59284181	+	3'UTR	DEL	T	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59284181delT	uc003jse.1	-	5					PDE4D_uc003jsb.2_Intron|PDE4D_uc010iwj.1_3'UTR			Q08499	PDE4D_HUMAN	Homo sapiens cAMP-specific phosphodiesterase PDE4D7 (PDE4D) mRNA, complete cds; alternatively spliced.						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	AAATTCATCCTTTTTTTTTTG	0.348													5	3	---	---	---	---	
C5orf48	389320	broad.mit.edu	37	5	125971528	125971528	+	Intron	DEL	A	-	-	rs71573967		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125971528delA	uc003kub.1	+							NM_207408	NP_997291	Q6ZNM6	CE048_HUMAN	hypothetical protein LOC389320											ovary(1)	1						ctaattttttattttttgtat	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	178071796	178071809	+	IGR	DEL	GTGTGTGTGTGTGT	-	-	rs71587673		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178071796_178071809delGTGTGTGTGTGTGT								CLK4 (14180 upstream) : ZNF354A (66722 downstream)																							GCCCCTCCCAgtgtgtgtgtgtgtgtgtgtgtgt	0.425													4	2	---	---	---	---	
DSP	1832	broad.mit.edu	37	6	7562606	7562607	+	Intron	INS	-	TT	TT	rs77312649	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7562606_7562607insTT	uc003mxp.1	+						DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GGTAGATTTGGTTTTTTTTTTT	0.356													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	120119454	120119455	+	IGR	INS	-	TC	TC	rs60968307		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120119454_120119455insTC								MAN1A1 (448528 upstream) : None (None downstream)																							ctttctttctttctctctctct	0.000													4	2	---	---	---	---	
PTPRK	5796	broad.mit.edu	37	6	128312259	128312259	+	Intron	DEL	C	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128312259delC	uc003qbk.2	-						PTPRK_uc003qbj.2_Intron|PTPRK_uc010kfc.2_Intron|PTPRK_uc011ebu.1_Intron	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TATTTTATTACTCAATGAGAA	0.264													5	4	---	---	---	---	
PDE10A	10846	broad.mit.edu	37	6	165845028	165845041	+	Intron	DEL	ATATACTATATATC	-	-	rs56194933		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165845028_165845041delATATACTATATATC	uc003qun.2	-						PDE10A_uc011egj.1_Intron|PDE10A_uc011egk.1_Intron|PDE10A_uc003quo.2_Intron	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	actatatataatatactatatatcatatgtataa	0.159													2	4	---	---	---	---	
SLC29A4	222962	broad.mit.edu	37	7	5331003	5331007	+	Intron	DEL	GGTCT	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5331003_5331007delGGTCT	uc003sod.2	+						SLC29A4_uc011jwg.1_Intron|SLC29A4_uc003soc.2_Intron|SLC29A4_uc003soe.2_Intron	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN	solute carrier family 29 (nucleoside						nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity			liver(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)		gctgccctgaggTCTGGTGTAAGAC	0.117													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	20042913	20042916	+	IGR	DEL	AAAT	-	-	rs148399376		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20042913_20042916delAAAT								TMEM196 (229697 upstream) : MACC1 (131372 downstream)																							GGGCTACAAAaaataaataaataa	0.299													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57659470	57659471	+	IGR	DEL	TA	-	-	rs79867563	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659470_57659471delTA								ZNF716 (126205 upstream) : None (None downstream)																							GCGTTGATCTTACAGTCTGGTG	0.371													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62665042	62665045	+	IGR	DEL	ACAC	-	-	rs79271344		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62665042_62665045delACAC								None (None upstream) : LOC643955 (86627 downstream)																							TTAGGATTATacacacacacacac	0.225													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	113220105	113220106	+	IGR	INS	-	AC	AC	rs138327349	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113220105_113220106insAC								LOC401397 (461468 upstream) : PPP1R3A (296776 downstream)																							ATGATCTGGGTacacacacaca	0.163													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	62726248	62726251	+	IGR	DEL	TCTT	-	-	rs67610362	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62726248_62726251delTCTT								ASPH (99049 upstream) : NKAIN3 (435250 downstream)																							tctttctttctcttccttccttcc	0.000													4	2	---	---	---	---	
TMEM74	157753	broad.mit.edu	37	8	109769028	109769031	+	Intron	DEL	AGGA	-	-	rs112425656		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109769028_109769031delAGGA	uc003ymx.2	-									Q96NL1	TMM74_HUMAN	Homo sapiens cDNA FLJ30668 fis, clone FCBBF1000675.						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane|lysosomal membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			agggaaggggaggaaggaaggaag	0.123													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	137426207	137426208	+	IGR	DEL	TC	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137426207_137426208delTC								KHDRBS3 (766361 upstream) : None (None downstream)																							ccttcctGTTtctctctctctc	0.045													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90460009	90460010	+	IGR	INS	-	TGTG	TGTG	rs148675813	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90460009_90460010insTGTG								CTSL3 (58210 upstream) : C9orf79 (37731 downstream)																							AAGTCTTGCTCtgtgtgtgtgt	0.297													3	3	---	---	---	---	
CAMSAP1	157922	broad.mit.edu	37	9	138715799	138715800	+	Frame_Shift_Ins	INS	-	T	T	rs148250832	byFrequency	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138715799_138715800insT	uc004cgr.3	-	10	1396_1397	c.1396_1397insA	c.(1396-1398)ACCfs	p.T466fs	CAMSAP1_uc004cgq.3_Frame_Shift_Ins_p.T356fs|CAMSAP1_uc010nbg.2_Frame_Shift_Ins_p.T188fs	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein	466						cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		GACTCACCTGGTTTTTTTTTCT	0.337													4	3	---	---	---	---	
GATA3	2625	broad.mit.edu	37	10	8106272	8106276	+	Intron	DEL	TTCTT	-	-	rs71385693	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8106272_8106276delTTCTT	uc001ika.2	+						GATA3_uc001ijz.2_Intron	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2						aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						tttcttcttcttctttttttttttt	0.312			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						4	3	---	---	---	---	
FAM107B	83641	broad.mit.edu	37	10	14709868	14709872	+	Intron	DEL	AGTAG	-	-	rs113901025		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14709868_14709872delAGTAG	uc001ina.1	-						FAM107B_uc010qbu.1_Intron	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641											breast(4)	4						ATAAATGCCAAGTAGAGTAGAGTAA	0.434													4	2	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	34964520	34964520	+	Intron	DEL	T	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34964520delT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				ATACCCCAACTTTTTTTTTTT	0.333													4	2	---	---	---	---	
ASAH2	56624	broad.mit.edu	37	10	52004763	52004763	+	Intron	DEL	A	-	-	rs144809559		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52004763delA	uc001jjd.2	-						ASAH2_uc009xos.2_Intron	NM_019893	NP_063946	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase 2 isoform a						apoptosis|ceramide metabolic process|signal transduction	integral to membrane|mitochondrion|plasma membrane	ceramidase activity				0						TCTGCTCATGAAAAAAAAAGG	0.224													3	4	---	---	---	---	
KIF11	3832	broad.mit.edu	37	10	94388745	94388745	+	Intron	DEL	T	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94388745delT	uc001kic.2	+						KIF11_uc010qnq.1_Intron	NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11						blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1						TCCTTCAAGAttttttttttt	0.119													6	3	---	---	---	---	
TRPM5	29850	broad.mit.edu	37	11	2443237	2443238	+	Intron	INS	-	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2443237_2443238insA	uc001lwm.3	-						TRPM5_uc010qxl.1_Intron|TRPM5_uc009ydn.2_Intron	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,							integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		TTGCCTGTGCCGGGTGGGGGGA	0.673													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113662516	113662516	+	IGR	DEL	T	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113662516delT								CLDN25 (11309 upstream) : USP28 (6082 downstream)																							ATGTAAAATCTTTTTTTTTTT	0.239													4	2	---	---	---	---	
WBP11	51729	broad.mit.edu	37	12	14954063	14954064	+	Intron	INS	-	A	A	rs150029016	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14954063_14954064insA	uc001rci.2	-						C12orf60_uc001rcj.3_5'Flank	NM_016312	NP_057396	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11						mRNA processing|RNA splicing|rRNA processing	cytoplasm	single-stranded DNA binding|WW domain binding			ovary(1)|lung(1)	2						AATCAAATTTGAAAAATAAAAT	0.312													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	43137740	43137745	+	IGR	DEL	GTGTGT	-	-	rs141140901		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43137740_43137745delGTGTGT								PRICKLE1 (154168 upstream) : ADAMTS20 (610268 downstream)																							AGGTTGTCTCgtgtgtgtgtgtgtgt	0.359													4	4	---	---	---	---	
COL2A1	1280	broad.mit.edu	37	12	48380331	48380332	+	Intron	INS	-	G	G	rs144941834	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48380331_48380332insG	uc001rqu.2	-						COL2A1_uc009zkw.2_Intron|COL2A1_uc001rqv.2_Intron	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor						axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GTTTCAGGGCTGGGGGGGGGCT	0.550													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	73639228	73639229	+	IGR	DEL	AC	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73639228_73639229delAC								TRHDE (579807 upstream) : None (None downstream)																							gattgaaaatacacacacacac	0.000													3	3	---	---	---	---	
TXNRD1	7296	broad.mit.edu	37	12	104661477	104661478	+	Intron	INS	-	TCTC	TCTC	rs145068892	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104661477_104661478insTCTC	uc010swk.1	+							NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3						cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						ctttctttctttctctctttct	0.089													4	2	---	---	---	---	
DYNLL1	8655	broad.mit.edu	37	12	120934545	120934545	+	Intron	DEL	T	-	-	rs35017041		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120934545delT	uc001tyj.2	+						uc001tyk.1_5'Flank|DYNLL1_uc001tyl.2_Intron|DYNLL1_uc001tym.2_Intron	NM_001037494	NP_001032583	P63167	DYL1_HUMAN	dynein light chain 1						actin cytoskeleton organization|activation of pro-apoptotic gene products|anatomical structure morphogenesis|female gamete generation|G2/M transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|microtubule-based process|negative regulation of phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transport	centrosome|cytoplasmic dynein complex|cytosol|microtubule|mitochondrion|nucleus|plasma membrane	motor activity|protein binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCGTCCGAAGttttttttttt	0.547													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	45168862	45168862	+	IGR	DEL	T	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45168862delT								TSC22D1 (18161 upstream) : NUFIP1 (344522 downstream)																							TTGTATTACCTTTTTTTTTTT	0.348													4	3	---	---	---	---	
NEK5	341676	broad.mit.edu	37	13	52663229	52663230	+	Intron	INS	-	AACAACAACAAC	AACAACAACAAC	rs147701822	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52663229_52663230insAACAACAACAAC	uc001vge.2	-							NM_199289	NP_954983	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5								ATP binding|metal ion binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)	1		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		ctgtctcagaaaacaacaacaa	0.149													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23265335	23265336	+	IGR	INS	-	G	G			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23265335_23265336insG								GOLGA9P (2592 upstream) : HERC2P2 (16929 downstream)																							AGGCAGGAAGAGGGGGCTCCCA	0.639													6	3	---	---	---	---	
PDIA3	2923	broad.mit.edu	37	15	44060895	44060896	+	Intron	INS	-	T	T			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44060895_44060896insT	uc001zsu.2	+						PDIA3_uc010bdp.2_Intron|PDIA3_uc010ued.1_Intron	NM_005313	NP_005304	P30101	PDIA3_HUMAN	protein disulfide-isomerase A3 precursor						cell redox homeostasis|glycerol ether metabolic process|post-translational protein modification|protein folding|protein import into nucleus|protein N-linked glycosylation via asparagine|protein retention in ER lumen|signal transduction	endoplasmic reticulum lumen|melanosome	cysteine-type endopeptidase activity|electron carrier activity|phospholipase C activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)|skin(1)	2		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.48e-07)		TTGGCCATCTCTTTTTTTTTTT	0.332													4	2	---	---	---	---	
MYEF2	50804	broad.mit.edu	37	15	48451631	48451632	+	Intron	DEL	GT	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48451631_48451632delGT	uc001zwi.3	-						MYEF2_uc001zwj.3_Intron|MYEF2_uc001zwl.2_Intron	NM_016132	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2						transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding			lung(2)|ovary(1)	3		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		AACCTtgtgcgtgtgtgtgtgt	0.203													4	2	---	---	---	---	
NRG4	145957	broad.mit.edu	37	15	76248134	76248134	+	Intron	DEL	A	-	-	rs146303179		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76248134delA	uc002bbo.2	-						NRG4_uc010bkm.1_Intron|NRG4_uc002bbn.2_Intron|NRG4_uc010bkn.2_Intron|NRG4_uc010bko.2_Intron	NM_138573	NP_612640	Q8WWG1	NRG4_HUMAN	neuregulin 4							extracellular region|integral to membrane|plasma membrane	growth factor activity				0						GTACCTGGCCAAAAAAAAAAA	0.284													5	6	---	---	---	---	
SCAPER	49855	broad.mit.edu	37	15	76907820	76907821	+	Intron	DEL	AC	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76907820_76907821delAC	uc002bby.2	-						SCAPER_uc010bkr.2_Intron|SCAPER_uc002bbx.2_Intron|SCAPER_uc002bbz.1_Intron	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER							endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						ATATATacatacacacacacac	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	86535842	86535845	+	IGR	DEL	TTCC	-	-	rs138835398	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86535842_86535845delTTCC								KLHL25 (197653 upstream) : AGBL1 (149397 downstream)																							ccttctttctttccttccttcctt	0.000													4	2	---	---	---	---	
NOMO2	283820	broad.mit.edu	37	16	18549711	18549712	+	Intron	INS	-	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18549711_18549712insA	uc002dfe.2	-						NOMO2_uc002dff.2_Intron|NOMO2_uc010bvx.2_Intron	NM_001004060	NP_001004060	Q5JPE7	NOMO2_HUMAN	nodal modulator 2 isoform 1							endoplasmic reticulum membrane|integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding			skin(1)	1						ctctgtctctcaaaaaaaaaaa	0.173													6	4	---	---	---	---	
BOLA2	552900	broad.mit.edu	37	16	29770487	29770487	+	Intron	DEL	A	-	-	rs62054910		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29770487delA	uc010bzb.1	-						uc002dtf.2_Intron			Q9H3K6	BOLA2_HUMAN	SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0						aggaaggaagaaaagaaagaa	0.055													2	4	---	---	---	---	
NFAT5	10725	broad.mit.edu	37	16	69602280	69602291	+	Intron	DEL	TATATATATATA	-	-	rs62052822		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69602280_69602291delTATATATATATA	uc002exm.1	+						NFAT5_uc002exh.1_Intron|NFAT5_uc002exi.2_Intron|NFAT5_uc002exj.1_Intron|NFAT5_uc002exk.1_Intron|NFAT5_uc002exl.1_Intron|NFAT5_uc002exn.1_Intron|MIR1538_hsa-mir-1538|MI0007259_5'Flank	NM_006599	NP_006590	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform c						excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						tgtgtgtgtgtATATATATATATATATACACA	0.151													6	4	---	---	---	---	
WDR59	79726	broad.mit.edu	37	16	74920463	74920463	+	Intron	DEL	T	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74920463delT	uc002fdh.1	-						WDR59_uc002fdf.1_Intron|WDR59_uc002fdg.1_Intron	NM_030581	NP_085058	Q6PJI9	WDR59_HUMAN	WD repeat domain 59											ovary(1)|breast(1)	2						TACCCTTGCCTTTTTGCGCAG	0.333													3	6	---	---	---	---	
NECAB2	54550	broad.mit.edu	37	16	84035269	84035288	+	Intron	DEL	CCTGGGCACCCCCTCACCTT	-	-	rs3215187		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84035269_84035288delCCTGGGCACCCCCTCACCTT	uc002fhd.2	+						NECAB2_uc002fhe.2_Intron	NM_019065	NP_061938	Q7Z6G3	NECA2_HUMAN	neuronal calcium-binding protein 2						antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity|protein binding			ovary(2)	2						AGTCAGCCTCCCTGGGCACCCCCTCACCTTCCCACAAAGG	0.582													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	3895175	3895176	+	IGR	INS	-	CTTC	CTTC	rs72199089		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3895175_3895176insCTTC								ATP2A3 (27439 upstream) : ZZEF1 (12564 downstream)																							ctctctctcttcttccttcctt	0.109													4	2	---	---	---	---	
CHRNE	1145	broad.mit.edu	37	17	4802256	4802275	+	Intron	DEL	GCCTCTGCCTCGCTCCACCC	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4802256_4802275delGCCTCTGCCTCGCTCCACCC	uc002fzk.1	-						C17orf107_uc010ckr.2_5'Flank|C17orf107_uc002fzl.3_5'Flank	NM_000080	NP_000071	Q04844	ACHE_HUMAN	nicotinic acetylcholine receptor epsilon						muscle contraction|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0						ACAGTGGTGGGCCTCTGCCTCGCTCCACCCGCCTCTGGCT	0.668													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	12462611	12462614	+	Intron	DEL	TTCC	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12462611_12462614delTTCC	uc002gnl.1	+						uc002gnm.1_Intron					Homo sapiens cDNA FLJ34690 fis, clone MESAN2000894.																		cccacccgcattccttccttcctt	0.010													4	2	---	---	---	---	
KIAA0100	9703	broad.mit.edu	37	17	26950601	26950601	+	Intron	DEL	A	-	-	rs35696171		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26950601delA	uc002hbu.2	-						KIAA0100_uc002hbt.2_5'Flank	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor							extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					CACCATGAGGAAAAAAAAAAA	0.368													4	2	---	---	---	---	
TBC1D29	26083	broad.mit.edu	37	17	28888194	28888194	+	Intron	DEL	C	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28888194delC	uc002hfh.2	+						TBC1D29_uc002hfi.2_Intron|uc002hfj.1_5'Flank	NM_015594	NP_056409	Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29							intracellular	Rab GTPase activator activity				0		Myeloproliferative disorder(56;0.0255)				TGACACTGTTCTTTTtttttt	0.269													4	3	---	---	---	---	
SUZ12	23512	broad.mit.edu	37	17	30322875	30322875	+	Intron	DEL	T	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30322875delT	uc002hgs.2	+						SUZ12_uc002hgt.2_Intron	NM_015355	NP_056170	Q15022	SUZ12_HUMAN	joined to JAZF1						negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				GTAAAGGAACTTTTTTTAAAA	0.199			T	JAZF1	endometrial stromal tumours								4	3	---	---	---	---	
KRT222	125113	broad.mit.edu	37	17	38813462	38813463	+	Intron	INS	-	A	A	rs34128971		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38813462_38813463insA	uc002hvc.2	-						KRT222_uc010wfk.1_Intron|KRT222_uc002hvb.2_Intron|KRT222_uc010cxc.2_3'UTR	NM_152349	NP_689562	Q8N1A0	KT222_HUMAN	truncated type I keratin KA21							intermediate filament	structural molecule activity			central_nervous_system(1)|skin(1)	2						gactcaatctcaaaaaaaaaaa	0.114													4	2	---	---	---	---	
NFE2L1	4779	broad.mit.edu	37	17	46137399	46137399	+	3'UTR	DEL	C	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46137399delC	uc002imz.3	+	6					NFE2L1_uc002ina.3_3'UTR|NFE2L1_uc002inb.3_3'UTR|NFE2L1_uc010wle.1_3'UTR|NFE2L1_uc010wlf.1_3'UTR	NM_003204	NP_003195	Q14494	NF2L1_HUMAN	nuclear factor erythroid 2-like 1						anatomical structure morphogenesis|heme biosynthetic process|inflammatory response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			skin(1)	1						aaggaaggaaCCCCCCCCCCC	0.458													9	4	---	---	---	---	
TAC4	255061	broad.mit.edu	37	17	47925054	47925055	+	Intron	INS	-	AC	AC	rs150685532	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47925054_47925055insAC	uc002ipo.1	-						TAC4_uc002ipp.1_Intron|TAC4_uc002ipq.1_Intron|TAC4_uc002ipr.1_Intron|TAC4_uc002ips.1_Intron|TAC4_uc002ipt.2_Intron|TAC4_uc002ipu.2_Intron	NM_170685	NP_733786	Q86UU9	TKN4_HUMAN	tachykinin 4 isoform alpha						regulation of blood pressure	extracellular region				breast(1)	1						cacacacacagacacacacaca	0.183													6	5	---	---	---	---	
TUBD1	51174	broad.mit.edu	37	17	57963684	57963684	+	Intron	DEL	A	-	-	rs113094238		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57963684delA	uc002ixw.1	-						TUBD1_uc010ddf.1_Intron|TUBD1_uc010ddg.1_Intron|TUBD1_uc010ddh.1_Intron|TUBD1_uc010wok.1_Intron|TUBD1_uc002ixx.1_Intron|TUBD1_uc010wol.1_Intron|TUBD1_uc010ddi.1_Intron	NM_016261	NP_057345	Q9UJT1	TBD_HUMAN	delta-tubulin						cell differentiation|microtubule-based movement|multicellular organismal development|protein polymerization|spermatogenesis	centriole|microtubule|nucleus	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)			GTCCAAATCCAAAAAAAAAAA	0.373													8	5	---	---	---	---	
PRPSAP1	5635	broad.mit.edu	37	17	74352353	74352354	+	5'Flank	DEL	AC	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74352353_74352354delAC	uc010wta.1	-						PRPSAP1_uc010wtb.1_5'Flank	NM_002766	NP_002757	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate						nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1						tcTCTCTcatacacacacacac	0.010													4	2	---	---	---	---	
GAA	2548	broad.mit.edu	37	17	78084941	78084941	+	Intron	DEL	C	-	-	rs12945868	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78084941delC	uc002jxo.2	+						GAA_uc002jxp.2_Intron|GAA_uc002jxq.2_Intron	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	acid alpha-glucosidase preproprotein						cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)	GGGAAAGGGGCGGGGGGGGGA	0.632													3	3	---	---	---	---	
CPLX4	339302	broad.mit.edu	37	18	56979806	56979807	+	Intron	DEL	AT	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56979806_56979807delAT	uc002lhy.2	-							NM_181654	NP_857637	Q7Z7G2	CPLX4_HUMAN	complexin 4 precursor						exocytosis|neurotransmitter transport	cell junction|synapse	syntaxin binding			ovary(1)	1		Colorectal(73;0.175)				tatatcttgaatatatatatat	0.134													4	2	---	---	---	---	
MAN2B1	4125	broad.mit.edu	37	19	12767170	12767171	+	Intron	INS	-	A	A			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12767170_12767171insA	uc002mub.2	-						MAN2B1_uc010dyv.1_Intron	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1						protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6						gactccgtctcaaaaaaaaaaa	0.292													4	2	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17757078	17757079	+	Intron	INS	-	TGTT	TGTT	rs142508123	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17757078_17757079insTGTT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						Ggttttttgtgtgtttgtttgt	0.272													4	3	---	---	---	---	
ATP5SL	55101	broad.mit.edu	37	19	41938473	41938474	+	Intron	INS	-	GTGT	GTGT	rs149102482	by1000genomes	TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41938473_41938474insGTGT	uc002oqw.1	-						CYP2F1_uc010xvw.1_Intron|ATP5SL_uc002oqu.1_Intron|ATP5SL_uc002oqv.2_Intron|ATP5SL_uc010xwa.1_Intron|ATP5SL_uc002oqx.1_Intron|ATP5SL_uc002oqy.1_Intron|ATP5SL_uc002oqz.1_Intron|ATP5SL_uc002ora.1_3'UTR|ATP5SL_uc010xwb.1_3'UTR	NM_018035	NP_060505	Q9NW81	AT5SL_HUMAN	ATP5S-like											large_intestine(1)|breast(1)	2						ACAgtgtgtgcgtgtgtgtgtg	0.416													4	2	---	---	---	---	
CABP5	56344	broad.mit.edu	37	19	48537803	48537804	+	Intron	INS	-	TC	TC	rs71334256		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48537803_48537804insTC	uc002phu.1	-							NM_019855	NP_062829	Q9NP86	CABP5_HUMAN	calcium binding protein 5						signal transduction	cytoplasm	calcium ion binding			skin(1)	1		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		ttttctttcttttttttttttt	0.050													4	3	---	---	---	---	
NTN5	126147	broad.mit.edu	37	19	49173202	49173203	+	Intron	INS	-	CA	CA			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49173202_49173203insCA	uc002pkb.2	-						SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|NTN5_uc002pkc.2_Intron	NM_145807	NP_665806	Q8WTR8	NET5_HUMAN	netrin 5 precursor							extracellular region				large_intestine(1)|pancreas(1)	2						accatcaccatcaccaccacca	0.000													5	3	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8731631	8731632	+	Intron	INS	-	GAGTGCA	GAGTGCA			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8731631_8731632insGAGTGCA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						tgcccaggctggagtgcagagg	0.114													5	3	---	---	---	---	
C20orf72	92667	broad.mit.edu	37	20	17970349	17970349	+	Intron	DEL	T	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17970349delT	uc002wqh.2	+						C20orf72_uc010gco.2_Intron|C20orf72_uc010gcp.2_Intron	NM_052865	NP_443097	Q9BQP7	CT072_HUMAN	hypothetical protein LOC92667												0						TTCTTGGGCCTTTTTTTTTTT	0.269													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10547387	10547388	+	Intron	DEL	AC	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10547387_10547388delAC	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		cagaataggtacacacacacac	0.000													4	2	---	---	---	---	
RUNX1	861	broad.mit.edu	37	21	37072038	37072041	+	Intron	DEL	ACAC	-	-	rs111879146		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37072038_37072041delACAC	uc002yut.1	-									Q01196	RUNX1_HUMAN	Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387						ATTAAATTAAacacacacacacac	0.377			T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				4	3	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33176966	33176969	+	Intron	DEL	TCCT	-	-	rs68188956		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33176966_33176969delTCCT	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						cttccttccctccttccttcctct	0.064													4	2	---	---	---	---	
CACNG2	10369	broad.mit.edu	37	22	37075182	37075189	+	Intron	DEL	CCTTCCTT	-	-	rs67750605		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37075182_37075189delCCTTCCTT	uc003aps.1	-							NM_006078	NP_006069	Q9Y698	CCG2_HUMAN	voltage-dependent calcium channel gamma-2						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0						GGATtttctcccttccttccttccttcc	0.168													4	2	---	---	---	---	
CYTH4	27128	broad.mit.edu	37	22	37707901	37707902	+	Intron	DEL	AG	-	-	rs3842718		TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37707901_37707902delAG	uc003arf.2	+						CYTH4_uc011amw.1_Intron|CYTH4_uc010gxe.2_Intron	NM_013385	NP_037517	Q9UIA0	CYH4_HUMAN	cytohesin 4						regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						AGCCTGCCACAGAGAGAGTGCT	0.599													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48644813	48644814	+	IGR	INS	-	CTT	CTT			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48644813_48644814insCTT								None (None upstream) : FAM19A5 (240474 downstream)																							ttccttccttccttccttcctt	0.173													4	4	---	---	---	---	
FLNA	2316	broad.mit.edu	37	X	153599613	153599613	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153599613delT	uc004fkk.2	-	2	250	c.1delA	c.(1-3)ATGfs	p.M1fs	FLNA_uc010nuu.1_Frame_Shift_Del_p.M1fs	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1					actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GAGCTACTCATTTTGAGGCGC	0.716											OREG0003594	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10028735	10028737	+	IGR	DEL	TTC	-	-			TCGA-BP-5173-01A-01D-1429-08	TCGA-BP-5173-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10028735_10028737delTTC								TTTY22 (377881 upstream) : None (None downstream)																							TTTCTTCCTATTCTTCTTGGTTG	0.360													5	3	---	---	---	---	
