Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TMEM53	79639	broad.mit.edu	37	1	45101527	45101527	+	3'UTR	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45101527A>G	uc001cmb.1	-	4					RNF220_uc001clv.1_Intron|RNF220_uc001clw.1_Intron|RNF220_uc010okx.1_Intron|RNF220_uc010oky.1_Intron|RNF220_uc010okz.1_Intron|RNF220_uc001clx.1_Intron|RNF220_uc001cly.1_Intron|RNF220_uc001clz.1_Intron|RNF220_uc001cma.1_Intron			Q6P2H8	TMM53_HUMAN	SubName: Full=Transmembrane protein 53;							integral to membrane				ovary(2)	2	Acute lymphoblastic leukemia(166;0.155)					GCGGAAAACTATTGGGAAGAG	0.542													9	32	---	---	---	---	PASS
ROR1	4919	broad.mit.edu	37	1	64643611	64643611	+	Silent	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64643611A>G	uc001dbj.2	+	9	2286	c.1887A>G	c.(1885-1887)GTA>GTG	p.V629V	uc001dbm.2_5'Flank	NM_005012	NP_005003	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	629	Cytoplasmic (Potential).|Protein kinase.				transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|central_nervous_system(1)|skin(1)|kidney(1)	19						AACTTCATGTAAAGATTTCAG	0.468													39	140	---	---	---	---	PASS
SORT1	6272	broad.mit.edu	37	1	109888450	109888450	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109888450A>G	uc001dxm.1	-	8	935	c.886T>C	c.(886-888)TTC>CTC	p.F296L	SORT1_uc010ovi.1_Missense_Mutation_p.F159L|SORT1_uc009wfb.2_Missense_Mutation_p.F160L	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein	296	BNR 4.|Extracellular (Potential).				endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		ATAGTTTTGAAGCTTTTTCCC	0.408													67	177	---	---	---	---	PASS
OTUD7B	56957	broad.mit.edu	37	1	149920957	149920957	+	Silent	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149920957A>G	uc001etn.2	-	10	1508	c.1152T>C	c.(1150-1152)TAT>TAC	p.Y384Y		NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne	384	Catalytic.|TRAF-binding.				negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			GCAGCAGCTTATACTCTGAAT	0.473													27	85	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157497673	157497673	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157497673C>G	uc001fqu.2	-	9	1852	c.1694G>C	c.(1693-1695)CGC>CCC	p.R565P	FCRL5_uc009wsm.2_Missense_Mutation_p.R565P|FCRL5_uc010phv.1_Missense_Mutation_p.R565P|FCRL5_uc010phw.1_Missense_Mutation_p.R480P	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	565	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity	p.R565H(1)		ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GAGGATGGGGCGAGACACTGG	0.458													4	98	---	---	---	---	PASS
ATP1A2	477	broad.mit.edu	37	1	160098797	160098797	+	Missense_Mutation	SNP	C	T	T	rs121918618		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160098797C>T	uc001fvc.2	+	10	1376	c.1244C>T	c.(1243-1245)ACG>ATG	p.T415M	ATP1A2_uc001fvb.2_Missense_Mutation_p.T415M|ATP1A2_uc001fvd.2_Missense_Mutation_p.T151M|ATP1A2_uc009wtg.1_Missense_Mutation_p.T103M	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein	415	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CGATCCCCTACGTGGACGGCC	0.577													7	35	---	---	---	---	PASS
DENND1B	163486	broad.mit.edu	37	1	197480874	197480874	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197480874A>G	uc010ppe.1	-	21	2077	c.1739T>C	c.(1738-1740)ATT>ACT	p.I580T	DENND1B_uc010ppf.1_RNA	NM_001142795	NP_001136267	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 1	Error:Variant_position_missing_in_Q6P3S1_after_alignment						clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						TTTGTAATCAATGTCATCCAT	0.363													5	149	---	---	---	---	PASS
LAD1	3898	broad.mit.edu	37	1	201353894	201353894	+	Intron	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201353894A>G	uc001gwm.2	-						LAD1_uc009wzu.1_Missense_Mutation_p.F423L	NM_005558	NP_005549	O00515	LAD1_HUMAN	ladinin 1							basement membrane	structural molecule activity				0						CCAAATAGAAAGAACCAGAGC	0.527													66	164	---	---	---	---	PASS
TMEM206	55248	broad.mit.edu	37	1	212538406	212538406	+	3'UTR	SNP	G	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212538406G>C	uc001hjc.3	-	8					TMEM206_uc010pte.1_3'UTR	NM_018252	NP_060722	Q9H813	TM206_HUMAN	transmembrane protein 206							integral to membrane				breast(1)	1				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		TTTTGGGACGGGGTTAGAAGT	0.373													9	25	---	---	---	---	PASS
COLEC11	78989	broad.mit.edu	37	2	3691463	3691463	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3691463G>A	uc002qya.2	+	7	719	c.571G>A	c.(571-573)GCA>ACA	p.A191T	COLEC11_uc002qxz.2_Missense_Mutation_p.A188T|COLEC11_uc002qyb.2_Missense_Mutation_p.A167T|COLEC11_uc002qyc.2_Missense_Mutation_p.A167T|COLEC11_uc010ewo.2_Missense_Mutation_p.A143T|COLEC11_uc010ewp.2_Missense_Mutation_p.A165T|COLEC11_uc010ewq.2_Missense_Mutation_p.A141T|COLEC11_uc010ewr.2_Missense_Mutation_p.A141T|COLEC11_uc010ews.2_Missense_Mutation_p.A117T	NM_024027	NP_076932	Q9BWP8	COL11_HUMAN	collectin sub-family member 11 isoform a	191	C-type lectin.					collagen	mannose binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		CCTGATGGCCGCATACCTGGC	0.672													4	43	---	---	---	---	PASS
NAT8	9027	broad.mit.edu	37	2	73868095	73868095	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73868095A>G	uc002sji.1	-	2	828	c.661T>C	c.(661-663)TCT>CCT	p.S221P		NM_003960	NP_003951	Q9UHE5	NAT8_HUMAN	N-acetyltransferase 8	221					gastrulation with mouth forming second|response to drug	integral to membrane	N-acetyltransferase activity			ovary(1)	1						ACCTTAGAAGAAGGGAGGTGG	0.343													14	65	---	---	---	---	PASS
FAHD2B	151313	broad.mit.edu	37	2	97749407	97749407	+	3'UTR	SNP	C	T	T	rs79549240		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97749407C>T	uc002sxm.2	-	8						NM_199336	NP_955368	Q6P2I3	FAH2B_HUMAN	fumarylacetoacetate hydrolase domain containing								hydrolase activity|metal ion binding				0						CTGGCACCTGCCCACACCTGC	0.597													4	35	---	---	---	---	PASS
STAT4	6775	broad.mit.edu	37	2	191900934	191900934	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191900934C>A	uc002usm.1	-	17	1780	c.1526G>T	c.(1525-1527)GGT>GTT	p.G509V	STAT4_uc002usn.1_Missense_Mutation_p.G509V|STAT4_uc010zgk.1_Missense_Mutation_p.G354V|STAT4_uc002uso.2_Missense_Mutation_p.G509V	NM_003151	NP_003142	Q14765	STAT4_HUMAN	signal transducer and activator of transcription	509					JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			TGAGTTAAGACCACGACCAAC	0.448													32	88	---	---	---	---	PASS
CLK1	1195	broad.mit.edu	37	2	201719363	201719363	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201719363G>C	uc002uwe.2	-	11	1377	c.1196C>G	c.(1195-1197)CCA>CGA	p.P399R	CLK1_uc002uwd.2_Missense_Mutation_p.P222R|CLK1_uc010zhi.1_Missense_Mutation_p.P441R|CLK1_uc002uwf.2_Missense_Mutation_p.P173R|CLK1_uc002uwg.2_Missense_Mutation_p.P248R|CLK1_uc010fsv.2_RNA	NM_004071	NP_004062	P49759	CLK1_HUMAN	CDC-like kinase 1 isoform 1	399	Protein kinase.				cell proliferation	nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			pancreas(2)	2						CATATGTTTTGGTAGAGGTCC	0.333													61	244	---	---	---	---	PASS
LOC728323	728323	broad.mit.edu	37	2	243056808	243056808	+	RNA	SNP	T	A	A	rs144220014	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:243056808T>A	uc010zpd.1	+	3		c.269T>A			LOC728323_uc010zpe.1_RNA|LOC728323_uc010zpf.1_RNA|LOC728323_uc010zpg.1_Intron	NR_024437				Homo sapiens cDNA FLJ60027 complete cds, moderately similar to F-box only protein 25.												0						ATAGCGAAGATGGAGAAATAC	0.279													3	61	---	---	---	---	PASS
PFKFB4	5210	broad.mit.edu	37	3	48573722	48573722	+	Silent	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48573722G>A	uc003ctv.2	-	8	824	c.807C>T	c.(805-807)GGC>GGT	p.G269G	PFKFB4_uc003ctw.2_Silent_p.G78G|PFKFB4_uc010hkc.2_Silent_p.G269G|PFKFB4_uc003ctx.2_Silent_p.G226G|PFKFB4_uc010hkb.2_Silent_p.G269G|PFKFB4_uc011bbm.1_Silent_p.G258G|PFKFB4_uc011bbn.1_RNA	NM_004567	NP_004558	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,	269	Fructose-2,6-bisphosphatase.				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		CTGGGTCCCCGCCAATCCGGC	0.637													5	117	---	---	---	---	PASS
TRAIP	10293	broad.mit.edu	37	3	49881187	49881187	+	Intron	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49881187G>A	uc003cxs.1	-						TRAIP_uc010hla.1_Intron|TRAIP_uc011bcx.1_3'UTR	NM_005879	NP_005870	Q9BWF2	TRAIP_HUMAN	TRAF interacting protein						cell proliferation|induction of apoptosis	perinuclear region of cytoplasm	protein binding|zinc ion binding			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CAGTTCTGGGGCAATACCTCC	0.502													4	184	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52595822	52595822	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52595822A>C	uc003des.2	-	25	4261	c.4249T>G	c.(4249-4251)TGG>GGG	p.W1417G	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.W1417G|PBRM1_uc003der.2_Missense_Mutation_p.W1385G|PBRM1_uc003det.2_Missense_Mutation_p.W1432G|PBRM1_uc003deu.2_Missense_Mutation_p.W1432G|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.W1417G|PBRM1_uc010hmk.1_Missense_Mutation_p.W1392G|PBRM1_uc003dey.2_Missense_Mutation_p.W1365G|PBRM1_uc003dez.1_Missense_Mutation_p.W1416G	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1417	HMG box.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGATTTCTCCATTCTGTCCCC	0.517			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								113	311	---	---	---	---	PASS
C3orf63	23272	broad.mit.edu	37	3	56658897	56658897	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56658897T>C	uc003did.3	-	21	4195	c.4094A>G	c.(4093-4095)CAG>CGG	p.Q1365R	C3orf63_uc003dib.3_Missense_Mutation_p.Q484R|C3orf63_uc003dic.3_Missense_Mutation_p.Q989R|C3orf63_uc003die.3_Missense_Mutation_p.Q1426R	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b	1426										ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		GTTCTGAGCCTGAAGTCTGAT	0.363													3	146	---	---	---	---	PASS
DPPA4	55211	broad.mit.edu	37	3	109056371	109056371	+	5'UTR	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109056371A>G	uc003dxq.3	-	1					DPPA4_uc011bho.1_5'UTR|DPPA4_uc011bhp.1_5'UTR	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4							nucleus	protein binding			upper_aerodigestive_tract(1)	1						ACATGCTTCCAAAATGGCCCC	0.483													3	123	---	---	---	---	PASS
GTPBP8	29083	broad.mit.edu	37	3	112718328	112718328	+	Silent	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112718328A>G	uc003dzn.2	+	5	749	c.702A>G	c.(700-702)GGA>GGG	p.G234G	GTPBP8_uc011bhy.1_RNA|GTPBP8_uc003dzp.2_RNA|GTPBP8_uc003dzo.2_Silent_p.G201G	NM_014170	NP_054889	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 isoform 1	234					barrier septum formation		GTP binding				0						CTTCCAAGGGACATCTTTTAA	0.279													6	165	---	---	---	---	PASS
TOPBP1	11073	broad.mit.edu	37	3	133374242	133374242	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133374242C>A	uc003eps.2	-	6	766	c.634G>T	c.(634-636)GGC>TGC	p.G212C		NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	212	BRCT 2.				DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						CTGTCTAAGCCACATAAGCCA	0.368								Other_conserved_DNA_damage_response_genes					5	177	---	---	---	---	PASS
GBA3	57733	broad.mit.edu	37	4	22749618	22749618	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22749618A>G	uc003gqp.3	+	3	1077	c.986A>G	c.(985-987)GAT>GGT	p.D329G	GBA3_uc010iep.2_Intron|GBA3_uc011bxo.1_Missense_Mutation_p.D330G	NM_020973	NP_066024	Q9H227	GBA3_HUMAN	cytosolic beta-glucosidase isoform a	329					glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity				0						ATTCTCCAGGATGCGGAAATT	0.373													11	27	---	---	---	---	PASS
ANKRD34B	340120	broad.mit.edu	37	5	79854670	79854670	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79854670A>T	uc010jam.2	-	4	1519	c.1169T>A	c.(1168-1170)CTT>CAT	p.L390H	ANKRD34B_uc003kgw.2_Missense_Mutation_p.L390H|ANKRD34B_uc010jan.2_Missense_Mutation_p.L390H	NM_001004441	NP_001004441	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	390						cytoplasm|nucleus				pancreas(1)	1		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		CTTTCCTATAAGTGCTTTGCC	0.463													35	104	---	---	---	---	PASS
RIOK2	55781	broad.mit.edu	37	5	96518962	96518962	+	5'UTR	SNP	T	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96518962T>C	uc003kmz.2	-	1					RIOK2_uc003kna.3_5'UTR	NM_018343	NP_060813	Q9BVS4	RIOK2_HUMAN	RIO kinase 2 isoform 1								ATP binding|protein serine/threonine kinase activity			kidney(1)	1		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		AGGTCGTTATTCCAGCCTCTA	0.532													9	21	---	---	---	---	PASS
PPP2R2B	5521	broad.mit.edu	37	5	145980011	145980011	+	Missense_Mutation	SNP	G	A	A	rs148423117		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145980011G>A	uc003loe.2	-	7	1328	c.803C>T	c.(802-804)CCG>CTG	p.P268L	PPP2R2B_uc010jgm.2_Missense_Mutation_p.P257L|PPP2R2B_uc003log.3_Missense_Mutation_p.P268L|PPP2R2B_uc003lof.3_Missense_Mutation_p.P268L|PPP2R2B_uc003loi.3_Missense_Mutation_p.P271L|PPP2R2B_uc003loh.3_Missense_Mutation_p.P268L|PPP2R2B_uc003loj.3_Missense_Mutation_p.P248L|PPP2R2B_uc003lok.3_Missense_Mutation_p.P257L|PPP2R2B_uc011dbu.1_Missense_Mutation_p.P274L|PPP2R2B_uc011dbv.1_Missense_Mutation_p.P326L	NM_004576	NP_004567	Q00005	2ABB_HUMAN	beta isoform of regulatory subunit B55, protein	268					apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGATCTTCCGGCTCTTCAAA	0.413													11	129	---	---	---	---	PASS
UBLCP1	134510	broad.mit.edu	37	5	158696067	158696067	+	Silent	SNP	C	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158696067C>G	uc003lxq.2	+	2	470	c.144C>G	c.(142-144)CTC>CTG	p.L48L		NM_145049	NP_659486	Q8WVY7	UBCP1_HUMAN	ubiquitin-like domain containing CTD phosphatase	48	Ubiquitin-like.					nucleus	phosphoprotein phosphatase activity			ovary(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TACTTGGACTCAAAGTTAAAG	0.299													39	191	---	---	---	---	PASS
SLC29A1	2030	broad.mit.edu	37	6	44200593	44200593	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44200593T>G	uc003owu.1	+	12	1438	c.1109T>G	c.(1108-1110)GTG>GGG	p.V370G	SLC29A1_uc003owv.1_Missense_Mutation_p.V370G|SLC29A1_uc003oww.1_Missense_Mutation_p.V449G|SLC29A1_uc003owx.1_Missense_Mutation_p.V370G|SLC29A1_uc003owy.1_Missense_Mutation_p.V370G|SLC29A1_uc003owz.1_Missense_Mutation_p.V370G	NM_004955	NP_004946	Q99808	S29A1_HUMAN	equilibrative nucleoside transporter 1	370	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|basolateral plasma membrane|integral to plasma membrane|membrane fraction	nucleoside transmembrane transporter activity|protein binding			large_intestine(2)|skin(1)	3	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		Troglitazone(DB00197)	GCCCGGCTGGTGTTTGTGCCA	0.647													10	53	---	---	---	---	PASS
C6orf138	442213	broad.mit.edu	37	6	47847043	47847043	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47847043T>C	uc011dwm.1	-	3	1571	c.1486A>G	c.(1486-1488)AGC>GGC	p.S496G	C6orf138_uc011dwn.1_Missense_Mutation_p.S260G	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213	513						integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1						CTATAGTTGCTGAAATATTTC	0.473													3	38	---	---	---	---	PASS
CNR1	1268	broad.mit.edu	37	6	88853987	88853987	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88853987C>T	uc011dzq.1	-	2	4570	c.1007G>A	c.(1006-1008)CGC>CAC	p.R336H	CNR1_uc010kbz.2_Missense_Mutation_p.R336H|CNR1_uc011dzr.1_Missense_Mutation_p.R336H|CNR1_uc011dzs.1_Missense_Mutation_p.R336H|CNR1_uc003pmq.3_Missense_Mutation_p.R336H|CNR1_uc011dzt.1_Missense_Mutation_p.R336H|CNR1_uc010kca.2_Missense_Mutation_p.R303H	NM_001160260	NP_001153732	P21554	CNR1_HUMAN	cannabinoid receptor 1 isoform a	336	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	cannabinoid receptor activity|protein binding			skin(2)	2		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Marinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	AATGTCCATGCGGGCTTGGTC	0.567													5	275	---	---	---	---	PASS
SASH1	23328	broad.mit.edu	37	6	148853944	148853944	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148853944G>C	uc003qme.1	+	14	2051	c.1576G>C	c.(1576-1578)GTG>CTG	p.V526L	SASH1_uc011eeb.1_Missense_Mutation_p.V287L|SASH1_uc003qmf.1_5'UTR	NM_015278	NP_056093	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	526							protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		CGGTCAAACAGTGAGCACCAC	0.537													41	131	---	---	---	---	PASS
LIMK1	3984	broad.mit.edu	37	7	73530181	73530181	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73530181A>G	uc003uaa.1	+	13	1625	c.1460A>G	c.(1459-1461)GAC>GGC	p.D487G	RFC2_uc011kfa.1_Intron|LIMK1_uc010lbl.1_RNA|LIMK1_uc003uab.2_Missense_Mutation_p.D453G	NM_002314	NP_002305	P53667	LIMK1_HUMAN	LIM domain kinase 1	487	Protein kinase.				actin cytoskeleton organization|axon guidance|negative regulation of ubiquitin-protein ligase activity|positive regulation of actin filament bundle assembly|positive regulation of axon extension|Rho protein signal transduction	cytosol|growth cone|nucleus	ATP binding|heat shock protein binding|protein serine/threonine kinase activity|zinc ion binding			stomach(2)|ovary(1)	3		Lung NSC(55;0.137)				CTCATGGTGGACGAGAAGACT	0.617													3	70	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91736718	91736718	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91736718C>T	uc003ulg.2	+	48	11753	c.11528C>T	c.(11527-11529)CCT>CTT	p.P3843L	AKAP9_uc003ulf.2_Missense_Mutation_p.P3835L|AKAP9_uc003uli.2_Missense_Mutation_p.P3466L|AKAP9_uc003ulj.2_Missense_Mutation_p.P1613L|AKAP9_uc003ull.2_Missense_Mutation_p.P739L	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	3847					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATTAGGTCCCCTTTACCATTT	0.358			T	BRAF	papillary thyroid								36	145	---	---	---	---	PASS
FBXO24	26261	broad.mit.edu	37	7	100189341	100189341	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100189341G>A	uc003uvm.1	+	4	667	c.374G>A	c.(373-375)AGC>AAC	p.S125N	FBXO24_uc010lha.1_RNA|FBXO24_uc003uvl.1_Missense_Mutation_p.S111N|FBXO24_uc003uvn.1_5'UTR|uc011kjy.1_Intron|FBXO24_uc011kjz.1_Missense_Mutation_p.S163N|FBXO24_uc011kka.1_Missense_Mutation_p.S113N	NM_033506	NP_277041	O75426	FBX24_HUMAN	F-box only protein 24 isoform 1	125						ubiquitin ligase complex	ubiquitin-protein ligase activity			ovary(3)|skin(1)	4	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CGATGTCTCAGCAAGAGCGTG	0.582													4	102	---	---	---	---	PASS
AASS	10157	broad.mit.edu	37	7	121753263	121753263	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121753263A>G	uc003vka.2	-	10	1283	c.1187T>C	c.(1186-1188)CTG>CCG	p.L396P	AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Missense_Mutation_p.L396P|AASS_uc011knw.1_Intron	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor	396	Lysine-ketoglutarate reductase.				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	GGAACACATCAGGATCCCCGA	0.413													3	117	---	---	---	---	PASS
CHRM2	1129	broad.mit.edu	37	7	136700464	136700464	+	Silent	SNP	T	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136700464T>C	uc003vtf.1	+	4	1475	c.852T>C	c.(850-852)AAT>AAC	p.N284N	CHRM2_uc003vtg.1_Silent_p.N284N|CHRM2_uc003vtj.1_Silent_p.N284N|CHRM2_uc003vtk.1_Silent_p.N284N|CHRM2_uc003vtl.1_Silent_p.N284N|CHRM2_uc003vtm.1_Silent_p.N284N|CHRM2_uc003vti.1_Silent_p.N284N|CHRM2_uc003vto.1_Silent_p.N284N|CHRM2_uc003vtn.1_Silent_p.N284N|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	284	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)	AGAGCTCCAATGACTCCACCT	0.493													3	104	---	---	---	---	PASS
ZNF212	7988	broad.mit.edu	37	7	148947875	148947875	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148947875A>G	uc003wfp.2	+	3	614	c.518A>G	c.(517-519)AAC>AGC	p.N173S		NM_012256	NP_036388	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	173	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			ATGGAGAGTAACTATGAGACA	0.483													46	134	---	---	---	---	PASS
CTSB	1508	broad.mit.edu	37	8	11703216	11703216	+	Silent	SNP	G	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11703216G>T	uc003wum.2	-	11	1200	c.876C>A	c.(874-876)CCC>CCA	p.P292P	CTSB_uc003wul.2_Silent_p.P229P|CTSB_uc011kxl.1_Silent_p.P213P|CTSB_uc003wun.2_Silent_p.P292P|CTSB_uc003wuo.2_Silent_p.P292P|CTSB_uc003wup.2_Silent_p.P292P|CTSB_uc003wuq.2_Silent_p.P292P|CTSB_uc010lsc.2_Silent_p.P168P|CTSB_uc003wur.2_Silent_p.P292P|CTSB_uc003wus.1_Silent_p.P292P|CTSB_uc003wut.1_Silent_p.P292P|CTSB_uc003wuu.2_3'UTR	NM_147780	NP_680090	P07858	CATB_HUMAN	cathepsin B preproprotein	292					proteolysis|regulation of apoptosis|regulation of catalytic activity	lysosome|melanosome	cysteine-type endopeptidase activity				0	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		CCAGCCAGTAGGGTGTGCCAT	0.577													13	51	---	---	---	---	PASS
COLEC10	10584	broad.mit.edu	37	8	120118232	120118232	+	Silent	SNP	T	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120118232T>C	uc003yoo.2	+	6	733	c.636T>C	c.(634-636)AAT>AAC	p.N212N		NM_006438	NP_006429	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 precursor	212	C-type lectin.					collagen|cytoplasm	mannose binding			ovary(2)|skin(1)	3	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			TTGGCGTGAATGACCTTGAAA	0.522													29	71	---	---	---	---	PASS
CYP11B2	1585	broad.mit.edu	37	8	143994277	143994277	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143994277C>A	uc003yxk.1	-	7	1149	c.1146G>T	c.(1144-1146)TTG>TTT	p.L382F		NM_000498	NP_000489	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B,	382					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity				0	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Candesartan(DB00796)|Metyrapone(DB01011)	CCACTCGCTCCAAAAACAGAC	0.597									Familial_Hyperaldosteronism_type_I				4	30	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385452	33385452	+	Intron	SNP	C	G	G	rs75281638	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385452C>G	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_3'UTR|AQP7_uc010mjt.2_3'UTR|AQP7_uc011lnx.1_3'UTR|AQP7_uc011lny.1_3'UTR|AQP7_uc003zss.3_3'UTR|AQP7_uc011lnz.1_3'UTR|AQP7_uc011loa.1_3'UTR	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TCAGGGACAGCGTTGACACTC	0.612													3	14	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385458	33385458	+	Intron	SNP	C	T	T	rs78260530	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385458C>T	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_3'UTR|AQP7_uc010mjt.2_3'UTR|AQP7_uc011lnx.1_3'UTR|AQP7_uc011lny.1_3'UTR|AQP7_uc003zss.3_3'UTR|AQP7_uc011lnz.1_3'UTR|AQP7_uc011loa.1_3'UTR	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		ACAGCGTTGACACTCAGTGCA	0.607													3	13	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117848654	117848654	+	Silent	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117848654G>A	uc004bjj.3	-	3	1718	c.1356C>T	c.(1354-1356)GGC>GGT	p.G452G	TNC_uc010mvf.2_Silent_p.G452G	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	452	EGF-like 10.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						ATACACATTTGCCCTCGACAC	0.567													32	133	---	---	---	---	PASS
GTPBP4	23560	broad.mit.edu	37	10	1042996	1042996	+	Intron	SNP	T	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1042996T>G	uc001ift.2	+						GTPBP4_uc010qac.1_5'UTR|GTPBP4_uc001ifu.2_Intron|GTPBP4_uc010qad.1_Intron|GTPBP4_uc010qae.1_Intron	NM_012341	NP_036473	Q9BZE4	NOG1_HUMAN	G protein-binding protein CRFG						negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		ACTATTACTTTCTGCAACTAT	0.229													9	23	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26432519	26432519	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26432519A>G	uc001isn.2	+	21	2765	c.2405A>G	c.(2404-2406)CAG>CGG	p.Q802R	MYO3A_uc009xko.1_Missense_Mutation_p.Q802R|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	802	Myosin head-like.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						GCCACTGACCAGACTCTTGTA	0.388													4	148	---	---	---	---	PASS
C10orf71	118461	broad.mit.edu	37	10	50532616	50532616	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50532616G>A	uc010qgp.1	+	3	2365	c.2026G>A	c.(2026-2028)GTG>ATG	p.V676M		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	676											0						CTCCAGATCTGTGTCCCAAGA	0.522													20	68	---	---	---	---	PASS
ADAMTS14	140766	broad.mit.edu	37	10	72496510	72496510	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72496510G>T	uc001jrh.2	+	10	1560	c.1560G>T	c.(1558-1560)AAG>AAT	p.K520N	ADAMTS14_uc001jrg.2_Missense_Mutation_p.K523N|ADAMTS14_uc001jri.1_Missense_Mutation_p.K43N	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	520	Disintegrin.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						AGACCAAGAAGGGGCCCCCGC	0.617													8	87	---	---	---	---	PASS
MGEA5	10724	broad.mit.edu	37	10	103553717	103553717	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103553717C>A	uc001ktv.2	-	11	2466	c.2023G>T	c.(2023-2025)GAC>TAC	p.D675Y	MGEA5_uc001ktu.2_Intron|MGEA5_uc010qqe.1_Missense_Mutation_p.D622Y|MGEA5_uc009xws.2_Missense_Mutation_p.D622Y	NM_012215	NP_036347	O60502	NCOAT_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	675	Histone acetyltransferase activity (By similarity).				glycoprotein catabolic process	cytoplasm|nucleus	histone acetyltransferase activity|hyalurononglucosaminidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		GGTTCTTGGTCTCCAATTAAG	0.428													10	381	---	---	---	---	PASS
CCDC147	159686	broad.mit.edu	37	10	106209950	106209950	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106209950A>T	uc001kyh.2	+	17	2632	c.2498A>T	c.(2497-2499)GAA>GTA	p.E833V		NM_001008723	NP_001008723	Q5T655	CC147_HUMAN	coiled-coil domain containing 147	833	Potential.									ovary(2)|central_nervous_system(2)|skin(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		AAACGTAAAGAACAACTTCAA	0.333													63	185	---	---	---	---	PASS
OR52E6	390078	broad.mit.edu	37	11	5862729	5862729	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5862729C>A	uc010qzq.1	-	1	399	c.399G>T	c.(397-399)TGG>TGT	p.W133C	TRIM5_uc001mbq.1_Intron	NM_001005167	NP_001005167	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E,	133	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCATGGTGTACCAAAGAGGTT	0.463													6	339	---	---	---	---	PASS
PLEKHA7	144100	broad.mit.edu	37	11	16838838	16838838	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16838838C>T	uc001mmo.2	-	11	1390	c.1375G>A	c.(1375-1377)GGT>AGT	p.G459S	PLEKHA7_uc010rcu.1_Missense_Mutation_p.G459S|PLEKHA7_uc010rcv.1_Missense_Mutation_p.G33S|PLEKHA7_uc001mmn.2_Missense_Mutation_p.G167S	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A	459					epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3						TGGCCAGGACCCTGGCGAGGA	0.602													36	130	---	---	---	---	PASS
PLEKHA7	144100	broad.mit.edu	37	11	16847952	16847952	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16847952T>G	uc001mmo.2	-	10	1073	c.1058A>C	c.(1057-1059)GAG>GCG	p.E353A	PLEKHA7_uc010rcu.1_Missense_Mutation_p.E353A|PLEKHA7_uc001mmn.2_Missense_Mutation_p.E61A	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A	353					epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3						CCGCTTGCCCTCCAGTGGGTC	0.592													25	123	---	---	---	---	PASS
OR4C3	256144	broad.mit.edu	37	11	48346849	48346849	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48346849T>A	uc010rhv.1	+	1	357	c.357T>A	c.(355-357)TAT>TAA	p.Y119*		NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C,	92	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CCATCTCTTATGAGTGCTGCA	0.443													40	674	---	---	---	---	PASS
P4HA3	283208	broad.mit.edu	37	11	74009370	74009370	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74009370G>C	uc001ouz.2	-	4	647	c.604C>G	c.(604-606)CCA>GCA	p.P202A	P4HA3_uc001ouy.3_RNA|P4HA3_uc010rrj.1_Missense_Mutation_p.P202A	NM_182904	NP_878907	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha III subunit	202						endoplasmic reticulum lumen	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity			skin(1)	1	Breast(11;2.31e-05)					TCCAGCCATGGAATGGCATGG	0.478													4	274	---	---	---	---	PASS
ZCCHC8	55596	broad.mit.edu	37	12	122957982	122957982	+	3'UTR	SNP	C	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122957982C>T	uc001ucn.2	-	14					ZCCHC8_uc001ucl.2_3'UTR|ZCCHC8_uc001ucm.2_3'UTR|ZCCHC8_uc009zxp.2_3'UTR|ZCCHC8_uc009zxq.2_3'UTR	NM_017612	NP_060082	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8							catalytic step 2 spliceosome	nucleic acid binding|protein binding|zinc ion binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		TATCTATCCACTTAATTAGTA	0.368													5	24	---	---	---	---	PASS
ULK1	8408	broad.mit.edu	37	12	132400471	132400471	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132400471G>A	uc001uje.2	+	19	1913	c.1645G>A	c.(1645-1647)GGG>AGG	p.G549R		NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1	549					autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		CCGCACTTCCGGGCTGGGCTG	0.692													19	78	---	---	---	---	PASS
LOC374491	374491	broad.mit.edu	37	13	25168489	25168489	+	RNA	SNP	G	A	A	rs142860004	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25168489G>A	uc001upm.2	+	10		c.1161G>A			LOC374491_uc001upn.2_RNA|LOC374491_uc001upo.2_RNA					Homo sapiens mRNA; cDNA DKFZp434J0717 (from clone DKFZp434J0717).												0						TGAAAGTGCAGTTTTTCTCTT	0.363													4	67	---	---	---	---	PASS
RALGAPA1	253959	broad.mit.edu	37	14	36125081	36125081	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36125081C>T	uc001wti.2	-	28	4301	c.3910G>A	c.(3910-3912)GAA>AAA	p.E1304K	RALGAPA1_uc010amp.2_RNA|RALGAPA1_uc001wtj.2_Missense_Mutation_p.E1304K|RALGAPA1_uc010tpv.1_Missense_Mutation_p.E1317K|RALGAPA1_uc010tpw.1_Missense_Mutation_p.E1351K	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	1304					activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						TGGACTAGTTCTTCACAAATC	0.348													109	151	---	---	---	---	PASS
PPIL5	122769	broad.mit.edu	37	14	50081325	50081325	+	3'UTR	SNP	G	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50081325G>C	uc001wwn.2	+	4					SDCCAG1_uc010anj.1_Intron|PPIL5_uc001wwo.2_3'UTR|PPIL5_uc010ank.2_3'UTR|PPIL5_uc001wwp.2_RNA	NM_152329	NP_689542	Q96L50	LLR1_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 5												0	all_epithelial(31;0.0021)|Breast(41;0.0124)					TGCTGGAGAGGAGGAATGTGT	0.313													4	41	---	---	---	---	PASS
KIAA0586	9786	broad.mit.edu	37	14	58937442	58937442	+	Splice_Site	SNP	G	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58937442G>T	uc001xdv.3	+	16	2598	c.2325_splice	c.e16+1	p.K775_splice	KIAA0586_uc010trr.1_Splice_Site_p.K892_splice|KIAA0586_uc001xdt.3_Splice_Site_p.K807_splice|KIAA0586_uc001xdu.3_Splice_Site_p.K836_splice|KIAA0586_uc010trs.1_Splice_Site_p.K766_splice|KIAA0586_uc010trt.1_Splice_Site_p.K711_splice|KIAA0586_uc010tru.1_Splice_Site_p.K711_splice	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein											ovary(1)	1						TTGGATAAAGGTATATTTCAG	0.318													8	30	---	---	---	---	PASS
EIF2B2	8892	broad.mit.edu	37	14	75475794	75475794	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75475794T>C	uc001xrc.1	+	8	1041	c.959T>C	c.(958-960)CTC>CCC	p.L320P		NM_014239	NP_055054	P49770	EI2BB_HUMAN	eukaryotic translation initiation factor 2B,	320					cellular response to stimulus|myelination|oligodendrocyte development|ovarian follicle development|regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	ATP binding|GTP binding|protein binding|translation initiation factor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00661)		CCCCCAGAGCTCATTACCCTC	0.483													96	260	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33822793	33822793	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33822793G>A	uc001zhi.2	+	4	350	c.280G>A	c.(280-282)GCA>ACA	p.A94T	RYR3_uc010bar.2_Missense_Mutation_p.A94T	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	94	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ATTCCCACAGGCAGCACAAGG	0.532													18	46	---	---	---	---	PASS
PARP16	54956	broad.mit.edu	37	15	65551800	65551800	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65551800A>C	uc002aoo.2	-	6	1168	c.914T>G	c.(913-915)GTG>GGG	p.V305G	PARP16_uc002aop.2_Missense_Mutation_p.V190G|PARP16_uc002aoq.2_Missense_Mutation_p.V306G	NM_017851	NP_060321	Q8N5Y8	PAR16_HUMAN	poly (ADP-ribose) polymerase family, member 16	305	Helical; (Potential).					integral to membrane	NAD+ ADP-ribosyltransferase activity			lung(2)	2						GATGACACTCACTATGAGCAG	0.483													61	184	---	---	---	---	PASS
LOXL1	4016	broad.mit.edu	37	15	74239564	74239564	+	Silent	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74239564G>A	uc002awc.1	+	4	1842	c.1506G>A	c.(1504-1506)CAG>CAA	p.Q502Q	LOXL1_uc002awd.1_5'Flank	NM_005576	NP_005567	Q08397	LOXL1_HUMAN	lysyl oxidase-like 1 preproprotein	502	Lysyl-oxidase like.				protein deamination	extracellular space	copper ion binding				0						CTCATACCCAGGTTGGGCTGG	0.617													28	105	---	---	---	---	PASS
SCAMP2	10066	broad.mit.edu	37	15	75142952	75142952	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75142952A>C	uc002azb.1	-	6	609	c.535T>G	c.(535-537)TCC>GCC	p.S179A	SCAMP2_uc002aza.1_Missense_Mutation_p.S29A|SCAMP2_uc010bkg.1_Intron	NM_005697	NP_005688	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2	179	Lumenal (Potential).				post-Golgi vesicle-mediated transport|protein transport	integral to membrane|nucleus|recycling endosome membrane|trans-Golgi network membrane	protein binding			ovary(1)	1						ACTCCCTTGGAGCTGTTGCCC	0.537													48	157	---	---	---	---	PASS
TNRC6A	27327	broad.mit.edu	37	16	24815624	24815624	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24815624A>G	uc002dmm.2	+	12	3935	c.3821A>G	c.(3820-3822)AAT>AGT	p.N1274S	TNRC6A_uc010bxs.2_Missense_Mutation_p.N1021S|TNRC6A_uc002dmn.2_Missense_Mutation_p.N1021S|TNRC6A_uc002dmo.2_Missense_Mutation_p.N962S|TNRC6A_uc002dmp.2_5'UTR|TNRC6A_uc002dmq.2_5'Flank	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1274	Sufficient for interaction with EIF2C1 and EIF2C4.				negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		ATGGAGCGCAATCCTTATTTT	0.363													3	168	---	---	---	---	PASS
FHOD1	29109	broad.mit.edu	37	16	67265179	67265179	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67265179A>C	uc002esl.2	-	17	2691	c.2579T>G	c.(2578-2580)CTA>CGA	p.L860R	FHOD1_uc002esk.2_5'Flank|FHOD1_uc010ced.2_Missense_Mutation_p.L667R	NM_013241	NP_037373	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	860	FH2.				actin cytoskeleton organization	cytoplasm|cytoskeleton|nucleus	actin binding			breast(2)|ovary(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		GAGATGGTGTAGCAGTGACTG	0.587													11	78	---	---	---	---	PASS
FAM65A	79567	broad.mit.edu	37	16	67579292	67579292	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67579292C>G	uc010vjp.1	+	18	3201	c.3105C>G	c.(3103-3105)TTC>TTG	p.F1035L	FAM65A_uc002eth.2_Missense_Mutation_p.F1015L|FAM65A_uc010cej.2_Missense_Mutation_p.F1018L|FAM65A_uc010vjq.1_Missense_Mutation_p.F1029L|FAM65A_uc002etk.2_Missense_Mutation_p.F1013L	NM_024519	NP_078795	Q6ZS17	FA65A_HUMAN	hypothetical protein LOC79567	1019						cytoplasm	binding			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		GTGTGAAGTTCCTGGAGGATG	0.577													26	74	---	---	---	---	PASS
TMCO7	79613	broad.mit.edu	37	16	68934403	68934403	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68934403C>G	uc002ewi.3	+	8	1456	c.1444C>G	c.(1444-1446)CTT>GTT	p.L482V		NM_024562	NP_078838	Q9C0B7	TMCO7_HUMAN	transmembrane and coiled-coil domains 7	482	Helical; (Potential).					integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)		CCTGGGAGTGCTTTTTCTTCT	0.383													6	357	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268158	70268158	+	RNA	SNP	A	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268158A>C	uc010cfp.1	-	3		c.257T>G								Homo sapiens cDNA, FLJ98908.																		TTCTTCATTAAAACAGCTACT	0.333													2	17	---	---	---	---	PASS
MLYCD	23417	broad.mit.edu	37	16	83940609	83940609	+	Silent	SNP	G	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83940609G>T	uc002fgz.2	+	2	566	c.546G>T	c.(544-546)CTG>CTT	p.L182L		NM_012213	NP_036345	O95822	DCMC_HUMAN	malonyl-CoA decarboxylase precursor	182					acyl-CoA metabolic process|fatty acid biosynthetic process	mitochondrion|peroxisome	malonyl-CoA decarboxylase activity|methylmalonyl-CoA decarboxylase activity				0						ATGGGGTGCTGAAAGGAATGC	0.478													53	204	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10351442	10351442	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10351442G>A	uc002gmn.2	-	34	4769	c.4658C>T	c.(4657-4659)GCA>GTA	p.A1553V	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1553	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						CTCAAGAGATGCCTTAATAAA	0.323													20	72	---	---	---	---	PASS
POLDIP2	26073	broad.mit.edu	37	17	26675106	26675106	+	3'UTR	SNP	C	G	G	rs3093715	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26675106C>G	uc002haz.2	-	14					POLDIP2_uc010wag.1_RNA	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2							mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		TTGTTCTTCCCGGTGACCAAG	0.532													8	21	---	---	---	---	PASS
SFRS1	6426	broad.mit.edu	37	17	56084456	56084456	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56084456C>A	uc002ivi.2	-	1	252	c.43G>T	c.(43-45)GAT>TAT	p.D15Y	SFRS1_uc002ivj.2_Missense_Mutation_p.D15Y	NM_006924	NP_008855	Q07955	SRSF1_HUMAN	splicing factor, arginine/serine-rich 1 isoform	15					mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding				0		Colorectal(1115;0.0691)		LUAD - Lung adenocarcinoma(1115;0.247)		ATGCGGCAATCGTTGTTCCCT	0.577													3	128	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75209495	75209495	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75209495G>A	uc002jto.2	+	16	2230	c.1963G>A	c.(1963-1965)GTG>ATG	p.V655M	SEC14L1_uc010dhc.2_Missense_Mutation_p.V655M|SEC14L1_uc010wth.1_Missense_Mutation_p.V655M|SEC14L1_uc002jtm.2_Missense_Mutation_p.V655M|SEC14L1_uc010wti.1_Missense_Mutation_p.V621M|SEC14L1_uc010wtj.1_Missense_Mutation_p.R143H|SEC14L1_uc002jtr.2_Missense_Mutation_p.V49M	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a	655	GOLD.				transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						GGTGGACGACGTGCTTGCGTC	0.617													20	45	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78362598	78362598	+	Intron	SNP	A	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78362598A>C	uc002jyh.1	+						uc002jyi.1_Intron|RNF213_uc010dhx.1_5'UTR	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213											ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CTGTGAGCCCACAGTTTCTGC	0.502													12	61	---	---	---	---	PASS
ICAM5	7087	broad.mit.edu	37	19	10404871	10404871	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10404871G>C	uc002mnu.3	+	8	1932	c.1867G>C	c.(1867-1869)GCA>CCA	p.A623P	ICAM5_uc002mnv.3_Missense_Mutation_p.A498P	NM_003259	NP_003250	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5 precursor	623	Extracellular (Potential).|Ig-like C2-type 7.				cell-cell adhesion	integral to plasma membrane				breast(3)	3			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			GCTGCCGCTGGCACCCCCAGA	0.657													5	248	---	---	---	---	PASS
HSH2D	84941	broad.mit.edu	37	19	16263872	16263872	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16263872C>G	uc002ndp.3	+	6	766	c.235C>G	c.(235-237)CAT>GAT	p.H79D	HSH2D_uc002ndr.2_Missense_Mutation_p.H22D|HSH2D_uc010ead.2_RNA	NM_032855	NP_116244	Q96JZ2	HSH2D_HUMAN	hematopoietic SH2 domain containing	79	SH2.					cytoplasm|nucleus					0						CAGCTGCTGCCATTTCATGGT	0.632													4	20	---	---	---	---	PASS
ZNF93	81931	broad.mit.edu	37	19	20044531	20044531	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20044531C>A	uc002non.2	+	4	878	c.767C>A	c.(766-768)CCC>CAC	p.P256H		NM_031218	NP_112495	P35789	ZNF93_HUMAN	zinc finger protein 93	256						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1						GGAAAGAAACCCTACAAGTGT	0.368													26	111	---	---	---	---	PASS
FTL	2512	broad.mit.edu	37	19	49469167	49469167	+	Silent	SNP	C	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49469167C>T	uc002plo.2	+	2	442	c.243C>T	c.(241-243)GAC>GAT	p.D81D	FTL_uc002pln.1_Silent_p.D81D	NM_000146	NP_000137	P02792	FRIL_HUMAN	ferritin, light polypeptide	81	Ferritin-like diiron.				cell death|cellular iron ion homeostasis|cellular membrane organization|iron ion transport|post-Golgi vesicle-mediated transport	cytosol|intracellular ferritin complex	ferric iron binding|identical protein binding|oxidoreductase activity				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	Iron Dextran(DB00893)	TCTTCCAGGACATCAAGGTAA	0.602													20	45	---	---	---	---	PASS
CCDC155	147872	broad.mit.edu	37	19	49900949	49900949	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49900949G>A	uc002pnm.1	+	6	616	c.442G>A	c.(442-444)GGA>AGA	p.G148R	CCDC155_uc002pnl.1_Missense_Mutation_p.G148R|CCDC155_uc010emx.1_Missense_Mutation_p.G121R	NM_144688	NP_653289	Q8N6L0	CC155_HUMAN	coiled-coil domain containing 155	148						integral to membrane	calcium ion binding			ovary(1)|central_nervous_system(1)	2						GGAGAGCTTCGGAGGCGAAGA	0.557													6	215	---	---	---	---	PASS
PTPRH	5794	broad.mit.edu	37	19	55710122	55710122	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55710122C>T	uc002qjq.2	-	8	1652	c.1579G>A	c.(1579-1581)GGT>AGT	p.G527S	PTPRH_uc010esv.2_Missense_Mutation_p.G349S|PTPRH_uc002qjs.2_Missense_Mutation_p.G534S	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	527	Extracellular (Potential).|Fibronectin type-III 6.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		ATGTCAGTACCTGAGGTGCTT	0.597													27	84	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29633945	29633945	+	Intron	SNP	G	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633945G>A	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TGGAATTTTTGTTTCTGCCTT	0.279													7	88	---	---	---	---	PASS
SLITRK4	139065	broad.mit.edu	37	X	142716848	142716848	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142716848G>C	uc004fbx.2	-	2	2453	c.2077C>G	c.(2077-2079)CAG>GAG	p.Q693E	SLITRK4_uc004fby.2_Missense_Mutation_p.Q693E	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	693	Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TTGCTCATCTGTTCTATAGTT	0.443													7	188	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	1837	1837	+	5'Flank	SNP	C	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:1837C>T	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		AGCAAGGACTAACCCCTATAC	0.383													4	2	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	39424113	39424113	+	IGR	DEL	C	-	-	rs67460849		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39424113delC								RHBDL2 (16657 upstream) : AKIRIN1 (32803 downstream)																							TCACTAGtttctttttttttt	0.204													5	4	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766820	206766823	+	Intron	DEL	GAGC	-	-	rs141098886		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766820_206766823delGAGC	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			gagagagagagagcgcgagagaga	0.211													9	6	---	---	---	---	
EPRS	2058	broad.mit.edu	37	1	220152281	220152282	+	Intron	DEL	TG	-	-	rs7548301		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220152281_220152282delTG	uc001hly.1	-							NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase						glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	ATTTTTCatatgtgtgtgtata	0.158													3	3	---	---	---	---	
C1orf31	388753	broad.mit.edu	37	1	234519319	234519320	+	Intron	INS	-	ACACACACACAC	ACACACACACAC	rs141657444	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234519319_234519320insACACACACACAC	uc001hwc.2	+						C1orf31_uc001hwb.2_Intron	NM_001012985	NP_001013003	Q5JTJ3	CA031_HUMAN	hypothetical protein LOC388753							mitochondrion	cytochrome-c oxidase activity				0	Ovarian(103;0.0339)	all_cancers(173;0.241)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AGTTACAGCTGacacacacaca	0.124													4	2	---	---	---	---	
LRP2	4036	broad.mit.edu	37	2	170031530	170031530	+	Intron	DEL	A	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170031530delA	uc002ues.2	-							NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TAAGATTTCTAAAAAAAAAAA	0.343													4	2	---	---	---	---	
HJURP	55355	broad.mit.edu	37	2	234754664	234754665	+	Intron	INS	-	AC	AC	rs147320613	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234754664_234754665insAC	uc002vvg.2	-						HJURP_uc010znd.1_Intron|HJURP_uc010zne.1_Intron	NM_018410	NP_060880	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein						cell cycle|CenH3-containing nucleosome assembly at centromere|centromeric core chromatin assembly|chromosome segregation|regulation of DNA binding|regulation of protein complex assembly	condensed chromosome kinetochore|cytoplasm|nucleolus|nucleoplasm	DNA binding|histone binding			ovary(1)	1		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		AATGTAAAAAGACACACACACA	0.342													7	4	---	---	---	---	
TDGF1	6997	broad.mit.edu	37	3	46623001	46623001	+	3'UTR	DEL	T	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46623001delT	uc003cpv.2	+	6					LRRC2_uc003cpu.3_5'Flank	NM_003212	NP_003203	P13385	TDGF1_HUMAN	teratocarcinoma-derived growth factor 1						activation of MAPK activity|anterior/posterior axis specification, embryo|mammary gland development|morphogenesis of a branching structure|negative regulation of apoptosis|peptidyl-serine phosphorylation|positive regulation of cell migration|positive regulation of peptidyl-tyrosine phosphorylation	anchored to membrane|cell surface|extrinsic to plasma membrane	growth factor activity				0				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		CCAGTGtttcttttttttttt	0.194													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75703977	75703978	+	IGR	INS	-	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75703977_75703978insT								MIR1324 (23968 upstream) : ZNF717 (54816 downstream)																							TCTTTTCTGAATTTTTTATTTT	0.322													3	3	---	---	---	---	
KCNMB3	27094	broad.mit.edu	37	3	178969357	178969357	+	5'UTR	DEL	C	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178969357delC	uc003fjm.2	-	1					KCNMB3_uc003fjl.3_Intron|KCNMB3_uc011bqc.1_Intron|KCNMB3_uc003fjn.2_5'UTR|KCNMB3_uc003fjo.2_Intron|KCNMB3_uc003fjp.1_Intron	NM_014407	NP_055222	Q9NPA1	KCMB3_HUMAN	calcium-activated potassium channel beta 3						detection of calcium ion|platelet activation|regulation of action potential in neuron	voltage-gated potassium channel complex	calcium-activated potassium channel activity|potassium channel regulator activity				0	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)			CTCCACTGTGCCTGCAAACCT	0.458													0	7	---	---	---	---	
PRKG2	5593	broad.mit.edu	37	4	82031881	82031882	+	Intron	INS	-	CA	CA	rs145649671	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82031881_82031882insCA	uc003hmh.2	-						PRKG2_uc011ccf.1_Intron|PRKG2_uc011ccg.1_Intron|PRKG2_uc011cch.1_Intron	NM_006259	NP_006250	Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II						platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						TTTATACCATGCACacacacac	0.277													3	6	---	---	---	---	
REEP5	7905	broad.mit.edu	37	5	112237915	112237915	+	Intron	DEL	G	-	-	rs141436136		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112237915delG	uc003kqe.1	-						REEP5_uc011cvw.1_Intron|REEP5_uc011cvx.1_Intron|REEP5_uc011cvy.1_Intron|REEP5_uc011cvz.1_Intron	NM_005669	NP_005660	Q00765	REEP5_HUMAN	receptor accessory protein 5							integral to membrane	protein binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		gcATTtttttgtttttgtttt	0.104													6	4	---	---	---	---	
ATG12	9140	broad.mit.edu	37	5	115173167	115173167	+	Intron	DEL	A	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115173167delA	uc003krh.2	-						ATG12_uc003kri.2_Intron|ATG12_uc003krj.2_Intron	NM_004707	NP_004698	O94817	ATG12_HUMAN	APG12 autophagy 12-like						autophagic vacuole assembly|negative regulation of type I interferon production	pre-autophagosomal structure membrane	protein binding				0		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;7.59e-08)|Epithelial(69;7.05e-07)|all cancers(49;3.11e-05)		agactgtctcaaaaaaaaaaa	0.129													9	5	---	---	---	---	
ZKSCAN3	80317	broad.mit.edu	37	6	28327932	28327932	+	Intron	DEL	T	-	-	rs113424723		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28327932delT	uc003nle.3	+						ZKSCAN3_uc010jrc.2_Intron|ZKSCAN3_uc003nlf.3_Intron	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3						positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						ctcagaataatttttttttta	0.050													1	5	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	145167776	145167776	+	Intron	DEL	A	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145167776delA	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTAAGCCAGGAAAAAAAAAAT	0.368													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64532452	64532452	+	Intron	DEL	T	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64532452delT	uc003ttt.1	+						uc010kzt.1_Intron					Homo sapiens cDNA clone IMAGE:4215179, partial cds.																		atgcccagccttttttttttt	0.119													6	3	---	---	---	---	
LOC100132832	100132832	broad.mit.edu	37	7	76669648	76669649	+	Intron	INS	-	ATCTC	ATCTC			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76669648_76669649insATCTC	uc003ufy.2	+						PMS2L11_uc011kgn.1_Intron	NR_028058				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						TGCACAGAAATATTTAATTTGC	0.208													9	4	---	---	---	---	
ABCB1	5243	broad.mit.edu	37	7	87174479	87174480	+	Intron	DEL	TG	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87174479_87174480delTG	uc003uiz.1	-						ABCB1_uc011khc.1_Intron	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1						G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	tgtgtgtgtctgtgtgtgtgtg	0.282													4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	148112872	148112873	+	3'UTR	INS	-	A	A	rs145619519		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148112872_148112873insA	uc003weu.1	+	24					CNTNAP2_uc003wev.1_3'UTR	NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			AGACTGATCACAAAAAAAAAAA	0.332										HNSCC(39;0.1)			3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	7679341	7679342	+	IGR	INS	-	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7679341_7679342insA								FAM90A7 (262107 upstream) : SPAG11A (26060 downstream)																							gactccttctcaaaaaaaaaaa	0.074													4	2	---	---	---	---	
MYST3	7994	broad.mit.edu	37	8	41801617	41801617	+	Intron	DEL	A	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41801617delA	uc010lxb.2	-						MYST3_uc010lxc.2_Intron|MYST3_uc003xon.3_Intron|MYST3_uc010lxd.2_Intron	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic						histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			AATTCCTTCCAAAAAAAAAAA	0.294													9	4	---	---	---	---	
C9orf93	203238	broad.mit.edu	37	9	15657002	15657002	+	Intron	DEL	A	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15657002delA	uc003zmd.2	+						C9orf93_uc010mih.1_Intron|C9orf93_uc003zme.2_Intron|C9orf93_uc011lmu.1_Intron|C9orf93_uc003zmc.2_Intron	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238												0				GBM - Glioblastoma multiforme(50;4.84e-07)		TCTTGCAAAGAAAAAAAAAAA	0.274													4	2	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113192403	113192404	+	Intron	INS	-	GT	GT	rs35386381	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113192403_113192404insGT	uc010mtz.2	-						SVEP1_uc010mty.2_5'Flank	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						ttttttttttGGTGTGTGTGTG	0.322													8	5	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	114994275	114994277	+	Intron	DEL	AGA	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114994275_114994277delAGA	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						agaagagaagagaagagaagaga	0.079													5	3	---	---	---	---	
C10orf71	118461	broad.mit.edu	37	10	50530449	50530449	+	5'UTR	DEL	A	-	-	rs141182587		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50530449delA	uc010qgp.1	+	3						NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2												0						TTTTGCAGAGAAAAAAAAAAA	0.403													4	3	---	---	---	---	
AGAP6	414189	broad.mit.edu	37	10	51748895	51748916	+	Intron	DEL	CTTTTCGCCTCCCCTCCCAATC	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51748895_51748916delCTTTTCGCCTCCCCTCCCAATC	uc001jix.3	+							NM_001077665	NP_001071133	Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			skin(1)	1						CAGTCAGTTTCTTTTCGCCTCCCCTCCCAATCGCCCAGTTCT	0.509													7	4	---	---	---	---	
SLIT1	6585	broad.mit.edu	37	10	98761352	98761353	+	Intron	INS	-	G	G	rs140122364	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98761352_98761353insG	uc001kmw.2	-							NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor						axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		tgctggagggagggggggtccc	0.188													4	2	---	---	---	---	
PIK3C2A	5286	broad.mit.edu	37	11	17123155	17123155	+	Intron	DEL	T	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17123155delT	uc001mmq.3	-						PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Intron|PIK3C2A_uc001mmr.3_Intron	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha						cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	tttttttttcttttttttttt	0.129													4	2	---	---	---	---	
SLC5A12	159963	broad.mit.edu	37	11	26707847	26707848	+	Intron	INS	-	TTC	TTC	rs149603915	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26707847_26707848insTTC	uc001mra.2	-						SLC5A12_uc001mrb.2_Intron	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose						sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						GAAAAGATAAGTTCTTTTTTTG	0.317													4	6	---	---	---	---	
OR5AS1	219447	broad.mit.edu	37	11	55797730	55797733	+	5'Flank	DEL	AATC	-	-	rs141606802		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55797730_55797733delAATC	uc010riw.1	+							NM_001001921	NP_001001921	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|liver(1)|skin(1)	5	Esophageal squamous(21;0.00693)					CAAATGACAAAATCAAAATCAAAA	0.265													7	6	---	---	---	---	
HYOU1	10525	broad.mit.edu	37	11	118916978	118916978	+	Intron	DEL	T	-	-	rs144229837		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118916978delT	uc001puu.2	-						HYOU1_uc001put.2_Intron|HYOU1_uc010ryu.1_Intron|HYOU1_uc010ryv.1_Intron|HYOU1_uc001pux.3_Intron	NM_006389	NP_006380	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1 precursor							endoplasmic reticulum lumen	ATP binding|protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		gtgcctggccttttttttttt	0.000													6	3	---	---	---	---	
EI24	9538	broad.mit.edu	37	11	125447653	125447655	+	Intron	DEL	TGT	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125447653_125447655delTGT	uc001qca.2	+						EI24_uc001qcb.2_Intron|EI24_uc010sbd.1_RNA|EI24_uc009zbl.2_Intron|EI24_uc001qcc.2_Intron|EI24_uc010sbe.1_Intron|EI24_uc010sbf.1_Intron	NM_004879	NP_004870	O14681	EI24_HUMAN	etoposide induced 2.4 isoform 1						apoptosis|autophagy|induction of apoptosis|negative regulation of cell growth	endoplasmic reticulum membrane|integral to membrane|nuclear membrane				ovary(1)	1	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.64e-07)|OV - Ovarian serous cystadenocarcinoma(99;0.0975)		gaatgggtactgttgttctatcc	0.079													6	4	---	---	---	---	
EI24	9538	broad.mit.edu	37	11	125452222	125452222	+	Intron	DEL	T	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125452222delT	uc001qca.2	+						EI24_uc001qcb.2_Intron|EI24_uc010sbd.1_Intron|EI24_uc009zbl.2_Intron|EI24_uc001qcc.2_Intron|EI24_uc010sbe.1_Intron|EI24_uc010sbf.1_Intron	NM_004879	NP_004870	O14681	EI24_HUMAN	etoposide induced 2.4 isoform 1						apoptosis|autophagy|induction of apoptosis|negative regulation of cell growth	endoplasmic reticulum membrane|integral to membrane|nuclear membrane				ovary(1)	1	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.64e-07)|OV - Ovarian serous cystadenocarcinoma(99;0.0975)		TAATTATTTCTTTTTTTTTTT	0.348													11	5	---	---	---	---	
KLRC3	3823	broad.mit.edu	37	12	10571536	10571537	+	Intron	INS	-	T	T	rs5796393		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10571536_10571537insT	uc001qyf.2	-						KLRC3_uc001qyh.2_Intron|KLRC3_uc001qyi.1_Intron|KLRC3_uc010shc.1_Intron|KLRC3_uc010shd.1_Intron	NM_002261	NP_002252	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C,						cellular defense response	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|skin(1)	3						TTATGGCTGAATTTATGGCTTA	0.292													3	3	---	---	---	---	
KRT83	3889	broad.mit.edu	37	12	52710046	52710049	+	Intron	DEL	ACAC	-	-	rs140413807		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52710046_52710049delACAC	uc001saf.2	-							NM_002282	NP_002273	P78385	KRT83_HUMAN	keratin 83						epidermis development	keratin filament	structural molecule activity			skin(1)	1	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CACTTacactacacacacacacac	0.299													4	3	---	---	---	---	
ACACB	32	broad.mit.edu	37	12	109661379	109661380	+	Intron	DEL	TG	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109661379_109661380delTG	uc001tob.2	+						ACACB_uc001toc.2_Intron	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	ctgggcaacatgtgagaccctg	0.005													8	5	---	---	---	---	
FLT1	2321	broad.mit.edu	37	13	28932004	28932005	+	Intron	DEL	CC	-	-	rs71190777		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28932004_28932005delCC	uc001usb.3	-							NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1						cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	tcttttctttcctttttttttt	0.411													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20138376	20138376	+	IGR	DEL	G	-	-	rs57620493		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20138376delG								P704P (118104 upstream) : OR4Q3 (77211 downstream)																							ACAaaagaaagaaagaaagaa	0.219													6	3	---	---	---	---	
SCFD1	23256	broad.mit.edu	37	14	31175237	31175238	+	Intron	INS	-	T	T	rs150091343	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31175237_31175238insT	uc001wqm.1	+						SCFD1_uc001wqn.1_Intron|SCFD1_uc010tpg.1_Intron|SCFD1_uc010tph.1_Intron|SCFD1_uc010amf.1_Intron|SCFD1_uc010tpi.1_Intron|SCFD1_uc010amd.1_Intron|SCFD1_uc010ame.1_Intron	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a						post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		AGTTCTCCTGGTTTTTTTTTTC	0.208													7	4	---	---	---	---	
AK7	122481	broad.mit.edu	37	14	96953556	96953557	+	Intron	INS	-	A	A			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96953556_96953557insA	uc001yfn.2	+							NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7						cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		actaaaaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	44028129	44028129	+	IGR	DEL	T	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44028129delT								CKMT1A (36710 upstream) : CATSPER2P1 (19 downstream)																							agcccggcaattttttttttt	0.000													5	3	---	---	---	---	
SQRDL	58472	broad.mit.edu	37	15	45951410	45951411	+	Intron	DEL	GT	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45951410_45951411delGT	uc001zvt.2	+						SQRDL_uc001zvu.2_Intron|SQRDL_uc001zvv.2_Intron	NM_021199	NP_067022	Q9Y6N5	SQRD_HUMAN	sulfide dehydrogenase like precursor								oxidoreductase activity			ovary(1)	1		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)		gtgtgtgtgagtgtgtgtgtgt	0.406													6	3	---	---	---	---	
SLC24A1	9187	broad.mit.edu	37	15	65931908	65931909	+	Intron	INS	-	CTGAGGC	CTGAGGC	rs148083690	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65931908_65931909insCTGAGGC	uc010ujf.1	+						SLC24A1_uc010ujd.1_Intron|SLC24A1_uc010uje.1_Intron|SLC24A1_uc010ujg.1_Intron|SLC24A1_uc010ujh.1_Intron	NM_004727	NP_004718	O60721	NCKX1_HUMAN	solute carrier family 24						response to light intensity|visual perception	integral to plasma membrane|membrane fraction|outer membrane	calcium, potassium:sodium antiporter activity|protein binding|symporter activity				0						ACAGGGGCCCACTGTGCGGCTC	0.584													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33371342	33371342	+	IGR	DEL	G	-	-	rs28624695		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33371342delG								SLC6A10P (474879 upstream) : MIR1826 (594166 downstream)																							acttgaacccggggggcagag	0.020													2	6	---	---	---	---	
EZH1	2145	broad.mit.edu	37	17	40865055	40865056	+	Intron	INS	-	AA	AA	rs71839900		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40865055_40865056insAA	uc002iaz.2	-						EZH1_uc002iba.2_Intron|EZH1_uc010wgt.1_Intron|EZH1_uc010wgu.1_Intron|EZH1_uc010wgv.1_Intron|EZH1_uc010wgw.1_Intron|EZH1_uc010cyp.2_Intron|EZH1_uc010cyq.2_Intron|EZH1_uc010cyo.1_Intron|EZH1_uc010cyr.1_Intron	NM_001991	NP_001982	Q92800	EZH1_HUMAN	enhancer of zeste homolog 1						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	chromatin binding|DNA binding			ovary(3)	3		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		gagactgtttcaaaaaaaaaaa	0.099													3	5	---	---	---	---	
TOM1L1	10040	broad.mit.edu	37	17	53016156	53016157	+	Intron	DEL	TT	-	-	rs71361741		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53016156_53016157delTT	uc002iud.2	+						TOM1L1_uc010dca.1_Intron|TOM1L1_uc010wnb.1_Intron|TOM1L1_uc010wnc.1_Intron|TOM1L1_uc010dbz.2_Intron|TOM1L1_uc010wnd.1_Intron|TOM1L1_uc010dcb.1_Intron	NM_005486	NP_005477	O75674	TM1L1_HUMAN	target of myb1-like 1						intracellular protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	cytosol|endosome membrane|Golgi stack|lysosome	SH3 domain binding|ubiquitin binding			ovary(1)	1						AATTAATCTCTTTTATTTGGTG	0.243													4	3	---	---	---	---	
CLTC	1213	broad.mit.edu	37	17	57741929	57741929	+	Intron	DEL	G	-	-	rs76363283		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57741929delG	uc002ixq.1	+						CLTC_uc002ixp.2_Intron|CLTC_uc002ixr.1_Intron	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					aaaaaaaaaagaaaagaaaag	0.139			T	ALK|TFE3	ALCL|renal 								3	4	---	---	---	---	
ABCA6	23460	broad.mit.edu	37	17	67081661	67081662	+	Intron	INS	-	C	C	rs72477857		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67081661_67081662insC	uc002jhw.1	-							NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6						transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					ATCCAAAGGCaaaaaaaaaaaa	0.277													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11610673	11610674	+	IGR	INS	-	C	C			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11610673_11610674insC								FAM38B (908694 upstream) : GNAL (78462 downstream)																							AAGACTGAAGACaaaaaaaaaa	0.302													8	5	---	---	---	---	
MYO5B	4645	broad.mit.edu	37	18	47352665	47352666	+	3'UTR	INS	-	A	A	rs149289525	by1000genomes	TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47352665_47352666insA	uc002leb.2	-	40					MYO5B_uc002ldz.2_3'UTR|MYO5B_uc002lea.2_3'UTR	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		GCAGTAGGTACAAAAAATAATG	0.347													4	2	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8731631	8731632	+	Intron	INS	-	GAGTGCA	GAGTGCA			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8731631_8731632insGAGTGCA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						tgcccaggctggagtgcagagg	0.114													4	2	---	---	---	---	
CLDN14	23562	broad.mit.edu	37	21	37858151	37858152	+	Intron	INS	-	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37858151_37858152insT	uc002yvn.1	-						CLDN14_uc002yvo.1_Intron	NM_001146078	NP_001139550	O95500	CLD14_HUMAN	claudin 14						calcium-independent cell-cell adhesion|protein complex assembly|tight junction assembly	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity				0						GTTCCATTTCCTTTTTTTTTTT	0.396													3	4	---	---	---	---	
ETS2	2114	broad.mit.edu	37	21	40187100	40187113	+	Intron	DEL	GTGTGTGTGTGTGT	-	-	rs5843932		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40187100_40187113delGTGTGTGTGTGTGT	uc002yxg.2	+						ETS2_uc002yxf.2_Intron	NM_005239	NP_005230	P15036	ETS2_HUMAN	v-ets erythroblastosis virus E26 oncogene						positive regulation of transcription, DNA-dependent|skeletal system development	nucleus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|breast(1)|pancreas(1)	4		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				CTTTAtgtgagtgtgtgtgtgtgtgtgtgtgtgt	0.336													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44755901	44755901	+	IGR	DEL	C	-	-	rs62218934		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44755901delC								CRYAA (162988 upstream) : SIK1 (78497 downstream)																							accatcaccaccatcaccacc	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20151841	20151842	+	IGR	INS	-	CAC	CAC	rs10627070		TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151841_20151842insCAC								ZDHHC8 (16312 upstream) : LOC150197 (42013 downstream)																							accaccaccatcaccaccacca	0.025													2	5	---	---	---	---	
TMEM27	57393	broad.mit.edu	37	X	15677316	15677317	+	Intron	DEL	CA	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15677316_15677317delCA	uc004cxc.1	-							NM_020665	NP_065716	Q9HBJ8	TMM27_HUMAN	transmembrane protein 27 precursor						proteolysis	integral to membrane	metallopeptidase activity|peptidyl-dipeptidase activity			ovary(1)	1	Hepatocellular(33;0.183)					TCTCTCTCTCcacacacacaca	0.351													13	6	---	---	---	---	
CLCN5	1184	broad.mit.edu	37	X	49845141	49845142	+	Intron	INS	-	T	T			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49845141_49845142insT	uc004dos.1	+						CLCN5_uc004dor.1_Intron|CLCN5_uc004doq.1_Intron|CLCN5_uc004dot.1_Intron	NM_000084	NP_000075	P51795	CLCN5_HUMAN	chloride channel 5 isoform b						excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)					AATCTCGGTGGTTTTTTTTTTT	0.376													9	4	---	---	---	---	
KDM5C	8242	broad.mit.edu	37	X	53225887	53225887	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53225887delG	uc004drz.2	-	19	3495	c.2962delC	c.(2962-2964)CACfs	p.H988fs	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Frame_Shift_Del_p.H921fs|KDM5C_uc004dsa.2_Frame_Shift_Del_p.H987fs	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	988					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						AGGCAGAGGTGGGCTTTCTCC	0.602			N|F|S		clear cell renal carcinoma								68	35	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28780698	28780699	+	IGR	INS	-	AG	AG			TCGA-BP-5189-01A-02D-1429-08	TCGA-BP-5189-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28780698_28780699insAG								None (None upstream) : None (None downstream)																							CCCACTGATGACCTTCAAAGCA	0.426													13	7	---	---	---	---	
