Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTOR	2475	broad.mit.edu	37	1	11210198	11210198	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11210198C>T	uc001asd.2	-	31	4676	c.4555G>A	c.(4555-4557)GCT>ACT	p.A1519T		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1519	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						CCCCATGCAGCTGCAGCAGCC	0.542													10	42	---	---	---	---	PASS
PHACTR4	65979	broad.mit.edu	37	1	28800469	28800469	+	Silent	SNP	C	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28800469C>A	uc001bpw.2	+	7	1509	c.1227C>A	c.(1225-1227)CCC>CCA	p.P409P	PHACTR4_uc001bpv.1_RNA|PHACTR4_uc001bpx.2_Silent_p.P393P|PHACTR4_uc001bpy.2_Silent_p.P419P	NM_001048183	NP_001041648	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4 isoform 1	409	Pro-rich.						actin binding|protein phosphatase inhibitor activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		CCCATATACCCTCTAGGCTGC	0.527													35	64	---	---	---	---	PASS
PPIE	10450	broad.mit.edu	37	1	40209514	40209514	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40209514G>T	uc001cds.1	+	6	345	c.302G>T	c.(301-303)TGG>TTG	p.W101L	PPIE_uc001cdt.1_Missense_Mutation_p.W35L|PPIE_uc010oiy.1_Missense_Mutation_p.W35L|PPIE_uc001cdu.1_RNA|PPIE_uc001cdv.2_Missense_Mutation_p.W101L|PPIE_uc001cdw.2_Missense_Mutation_p.W101L|PPIE_uc001cdx.1_Missense_Mutation_p.W17L	NM_006112	NP_006103	Q9UNP9	PPIE_HUMAN	peptidylprolyl isomerase E isoform 1	101					protein folding|regulation of transcription, DNA-dependent	catalytic step 2 spliceosome	cyclosporin A binding|nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|protein binding|RNA binding				0	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GATGATGACTGGTTGAAGAAG	0.443													15	71	---	---	---	---	PASS
PCSK9	255738	broad.mit.edu	37	1	55509579	55509579	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55509579T>A	uc001cyf.1	+	2	562	c.271T>A	c.(271-273)TCA>ACA	p.S91T	PCSK9_uc010ool.1_RNA|PCSK9_uc010oom.1_Intron	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	91					cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						CCTCTCGCAGTCAGAGCGCAC	0.627													10	57	---	---	---	---	PASS
PCSK9	255738	broad.mit.edu	37	1	55509580	55509580	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55509580C>T	uc001cyf.1	+	2	563	c.272C>T	c.(271-273)TCA>TTA	p.S91L	PCSK9_uc010ool.1_RNA|PCSK9_uc010oom.1_Intron	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	91					cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						CTCTCGCAGTCAGAGCGCACT	0.627													10	58	---	---	---	---	PASS
INADL	10207	broad.mit.edu	37	1	62237112	62237112	+	Silent	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62237112A>G	uc001dab.2	+	6	648	c.534A>G	c.(532-534)AGA>AGG	p.R178R	INADL_uc009waf.1_Silent_p.R178R|INADL_uc001daa.2_Silent_p.R178R|INADL_uc001dad.3_5'UTR	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	178	PDZ 1.				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						GGGATCAAAGATTAAAGGAAA	0.308													20	47	---	---	---	---	PASS
IL23R	149233	broad.mit.edu	37	1	67705899	67705899	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67705899C>G	uc001ddo.2	+	9	1168	c.1083C>G	c.(1081-1083)ATC>ATG	p.I361M	IL23R_uc009waz.2_Missense_Mutation_p.I158M|IL23R_uc001ddp.2_Intron|IL23R_uc010opi.1_Intron|IL23R_uc010opj.1_Intron|IL23R_uc010opk.1_Intron|IL23R_uc010opl.1_Intron|IL23R_uc010opm.1_RNA|IL23R_uc001ddq.2_Missense_Mutation_p.I107M|IL23R_uc010opn.1_Missense_Mutation_p.I206M|IL23R_uc001ddr.2_Intron|IL23R_uc010opo.1_Missense_Mutation_p.I220M|IL23R_uc010opp.1_Intron|IL23R_uc010opq.1_Missense_Mutation_p.I190M|IL23R_uc010opr.1_RNA|IL23R_uc010ops.1_Missense_Mutation_p.I158M|IL23R_uc010opt.1_Missense_Mutation_p.I2M|IL23R_uc010opu.1_Missense_Mutation_p.I57M|IL23R_uc010opv.1_Missense_Mutation_p.I119M|IL23R_uc010opw.1_Intron|IL23R_uc010opx.1_Missense_Mutation_p.I2M|IL23R_uc010opy.1_Missense_Mutation_p.I128M|IL23R_uc010opz.1_Missense_Mutation_p.I2M|IL23R_uc010oqa.1_Missense_Mutation_p.I2M|IL23R_uc010oqb.1_Missense_Mutation_p.I190M|IL23R_uc010oqc.1_Missense_Mutation_p.I77M|IL23R_uc010oqd.1_Intron|IL23R_uc010oqe.1_Intron|IL23R_uc010oqf.1_Translation_Start_Site|IL23R_uc010oqg.1_Intron|IL23R_uc010oqh.1_Missense_Mutation_p.I2M|IL23R_uc001dds.2_Missense_Mutation_p.I106M|IL23R_uc001ddt.2_Intron	NM_144701	NP_653302	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor precursor	361	Helical; (Potential).				inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity				0						TGGGAATGATCGTCTTTGCTG	0.328													17	88	---	---	---	---	PASS
SH3GLB1	51100	broad.mit.edu	37	1	87200796	87200796	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87200796A>T	uc001dlw.2	+	7	1021	c.695A>T	c.(694-696)GAA>GTA	p.E232V	SH3GLB1_uc001dlx.2_Missense_Mutation_p.E253V|SH3GLB1_uc001dly.2_Missense_Mutation_p.E261V|SH3GLB1_uc001dlz.2_Missense_Mutation_p.E132V	NM_016009	NP_057093	Q9Y371	SHLB1_HUMAN	SH3-containing protein SH3GLB1	232	BAR.				anti-apoptosis|filopodium assembly|signal transduction	Golgi membrane|mitochondrial outer membrane	cytoskeletal adaptor activity|protein homodimerization activity|SH3 domain binding				0		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)		GACTTTGTAGAAGCCCAGATG	0.403													31	109	---	---	---	---	PASS
PKN2	5586	broad.mit.edu	37	1	89236095	89236095	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89236095G>T	uc001dmn.2	+	4	907	c.565G>T	c.(565-567)GTC>TTC	p.V189F	PKN2_uc001dmm.1_Missense_Mutation_p.V189F|PKN2_uc010osp.1_Missense_Mutation_p.V189F|PKN2_uc010osq.1_Missense_Mutation_p.V32F|PKN2_uc009wcv.2_Missense_Mutation_p.V189F	NM_006256	NP_006247	Q16513	PKN2_HUMAN	protein kinase N2	189	REM 2.				signal transduction	cytoplasm	ATP binding|histone deacetylase binding|protein kinase C activity			large_intestine(1)|lung(1)|skin(1)	3		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		AAAAATAGAAGTCATACGAAT	0.373													37	141	---	---	---	---	PASS
CD101	9398	broad.mit.edu	37	1	117568204	117568204	+	Silent	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117568204C>T	uc010oxb.1	+	8	2560	c.2502C>T	c.(2500-2502)TGC>TGT	p.C834C	CD101_uc009whd.2_Silent_p.C834C|CD101_uc010oxc.1_Silent_p.C834C|CD101_uc010oxd.1_Silent_p.C772C	NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2 precursor	834	Ig-like C2-type 7.|Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						CCATCCGCTGCAGCCTGGAGA	0.468													25	76	---	---	---	---	PASS
S100A7A	338324	broad.mit.edu	37	1	153391770	153391770	+	Silent	SNP	T	C	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153391770T>C	uc001fbt.1	+	3	348	c.291T>C	c.(289-291)TCT>TCC	p.S97S		NM_176823	NP_789793	Q86SG5	S1A7A_HUMAN	S100 calcium binding protein A7-like 1	97						cytoplasm	calcium ion binding			skin(1)	1	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CGCCCTGTTCTGGGGGAAGCC	0.527													15	48	---	---	---	---	PASS
LAMC2	3918	broad.mit.edu	37	1	183177097	183177097	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183177097T>A	uc001gqa.2	+	2	475	c.161T>A	c.(160-162)CTC>CAC	p.L54H	LAMC2_uc001gpz.3_Missense_Mutation_p.L54H|LAMC2_uc010poa.1_5'UTR	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	54	Laminin EGF-like 1.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						TTCCGCTGCCTCAACTGCAAT	0.488													113	311	---	---	---	---	PASS
LAMC2	3918	broad.mit.edu	37	1	183177098	183177098	+	Silent	SNP	C	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183177098C>A	uc001gqa.2	+	2	476	c.162C>A	c.(160-162)CTC>CTA	p.L54L	LAMC2_uc001gpz.3_Silent_p.L54L|LAMC2_uc010poa.1_5'UTR	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	54	Laminin EGF-like 1.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						TCCGCTGCCTCAACTGCAATG	0.488													112	314	---	---	---	---	PASS
LMOD1	25802	broad.mit.edu	37	1	201869657	201869657	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201869657G>A	uc001gxb.2	-	2	732	c.484C>T	c.(484-486)CGG>TGG	p.R162W	LMOD1_uc010ppu.1_Missense_Mutation_p.R111W	NM_012134	NP_036266	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	162					muscle contraction	cytoskeleton|cytosol|membrane fraction	tropomyosin binding			ovary(1)|pancreas(1)|skin(1)	3						GCCCTGACCCGGCCCTTGTCA	0.323													26	67	---	---	---	---	PASS
CNTN2	6900	broad.mit.edu	37	1	205035032	205035032	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205035032T>A	uc001hbr.2	+	14	2080	c.1811T>A	c.(1810-1812)GTC>GAC	p.V604D	CNTN2_uc001hbq.1_Missense_Mutation_p.V495D|CNTN2_uc001hbs.2_Missense_Mutation_p.V392D	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	604					axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ACAGTCCTGGTCCGAGGTGAG	0.627													18	34	---	---	---	---	PASS
TSNAX	7257	broad.mit.edu	37	1	231665067	231665067	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231665067A>T	uc001huw.2	+	2	241	c.83A>T	c.(82-84)GAT>GTT	p.D28V	TSNAX-DISC1_uc010pwe.1_5'UTR|TSNAX-DISC1_uc010pwf.1_5'UTR|TSNAX-DISC1_uc010pwg.1_5'UTR|TSNAX-DISC1_uc010pwh.1_5'UTR|TSNAX-DISC1_uc010pwi.1_5'UTR|TSNAX-DISC1_uc010pwj.1_5'UTR|TSNAX-DISC1_uc010pwk.1_5'UTR|TSNAX-DISC1_uc010pwl.1_RNA	NM_005999	NP_005990	Q99598	TSNAX_HUMAN	translin-associated factor X	28					cell differentiation|multicellular organismal development|spermatogenesis	nucleus|perinuclear region of cytoplasm	protein transporter activity|sequence-specific DNA binding				0		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				GAAGGGAAGGATGTTAATTCA	0.383													8	157	---	---	---	---	PASS
KLF11	8462	broad.mit.edu	37	2	10186515	10186515	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10186515T>C	uc002raf.1	+	2	443	c.281T>C	c.(280-282)CTA>CCA	p.L94P	KLF11_uc010yjc.1_Missense_Mutation_p.L77P	NM_003597	NP_003588	O14901	KLF11_HUMAN	Kruppel-like factor 11	94					apoptosis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|regulation of transcription involved in S phase of mitotic cell cycle	nucleus	sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		ACACCTGAACTACCAAAAGAC	0.502													11	57	---	---	---	---	PASS
KHK	3795	broad.mit.edu	37	2	27317803	27317803	+	Intron	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27317803G>A	uc002ril.2	+						KHK_uc002rim.2_Splice_Site_p.T115_splice|KHK_uc002rin.2_Intron|KHK_uc002rio.2_Intron	NM_000221	NP_000212	P50053	KHK_HUMAN	ketohexokinase isoform a						fructose catabolic process	cytosol	ATP binding|ketohexokinase activity|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCATGACACGTAAGGCCCCC	0.607													17	51	---	---	---	---	PASS
BRE	9577	broad.mit.edu	37	2	28531159	28531159	+	Intron	SNP	A	C	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28531159A>C	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron|BRE_uc002rlx.2_Intron|uc002rly.2_RNA	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					CACATCACCCACCTGCCAGTG	0.502													9	33	---	---	---	---	PASS
ABCG8	64241	broad.mit.edu	37	2	44073354	44073354	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44073354A>G	uc002rtq.2	+	3	316	c.226A>G	c.(226-228)ACA>GCA	p.T76A	ABCG8_uc010yoa.1_Missense_Mutation_p.T76A	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN	ATP-binding cassette sub-family G member 8	76	ABC transporter.|Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			skin(3)|ovary(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GATGCCCTGGACATCTCCCAG	0.537													23	65	---	---	---	---	PASS
RETSAT	54884	broad.mit.edu	37	2	85581632	85581632	+	5'UTR	SNP	A	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85581632A>T	uc002spd.2	-	1					ELMOD3_uc010fgg.2_5'Flank|ELMOD3_uc002spf.3_5'Flank|ELMOD3_uc002spg.3_5'Flank|ELMOD3_uc002sph.3_5'Flank|ELMOD3_uc010ysn.1_5'Flank|ELMOD3_uc010yso.1_5'Flank|ELMOD3_uc010ysp.1_5'Flank|RETSAT_uc010ysm.1_5'UTR|RETSAT_uc010fgf.2_5'UTR	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN	all-trans-13,14-dihydroretinol saturase						retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity			ovary(2)	2					Vitamin A(DB00162)	AAGCCACATCACGCCGGCGTC	0.627													19	58	---	---	---	---	PASS
FAP	2191	broad.mit.edu	37	2	163099945	163099945	+	5'UTR	SNP	G	C	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163099945G>C	uc002ucd.2	-	1					FAP_uc010zct.1_5'UTR|FAP_uc010fpd.2_5'UTR|FAP_uc010fpe.1_5'UTR	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit						endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						GTTGGAAGCTGAAGCCAGGAC	0.403													9	26	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215797332	215797332	+	3'UTR	SNP	C	T	T	rs17426207	by1000genomes	TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215797332C>T	uc002vew.2	-	53					ABCA12_uc002vev.2_3'UTR|ABCA12_uc010zjn.1_3'UTR	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATTGGTCACACGCTGAGATTG	0.388													3	43	---	---	---	---	PASS
SMARCAL1	50485	broad.mit.edu	37	2	217342998	217342998	+	Silent	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217342998A>G	uc002vgc.3	+	17	2931	c.2601A>G	c.(2599-2601)ACA>ACG	p.T867T	SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Silent_p.T867T|SMARCAL1_uc010fvg.2_Silent_p.T845T	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated	867	Helicase C-terminal.				chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CAGAAATGACAGAATCCACTG	0.488									Schimke_Immuno-Osseous_Dysplasia				44	79	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183797	10183797	+	Missense_Mutation	SNP	T	C	C	rs5030807		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183797T>C	uc003bvc.2	+	1	479	c.266T>C	c.(265-267)CTC>CCC	p.L89P	VHL_uc003bvd.2_Missense_Mutation_p.L89P	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	89			L -> H (in lung cancer).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L89H(10)|p.L89P(3)|p.L89R(3)|p.R60fs*35(1)|p.V84_E94>E(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCCGTATGGCTCAACTTCGAC	0.726	L89H(NCIH28_PLEURA)	1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				4	14	---	---	---	---	PASS
PTX3	5806	broad.mit.edu	37	3	157154654	157154654	+	5'UTR	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157154654C>T	uc003fbl.3	+	1					VEPH1_uc003fbj.1_Intron|VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	NM_002852	NP_002843	P26022	PTX3_HUMAN	pentraxin 3 precursor						inflammatory response	extracellular region				central_nervous_system(1)	1			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			CACTCTCCTCCGCTCAAACTC	0.507													19	35	---	---	---	---	PASS
APBB2	323	broad.mit.edu	37	4	41015685	41015685	+	Silent	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41015685G>A	uc003gvl.2	-	6	1380	c.750C>T	c.(748-750)ATC>ATT	p.I250I	APBB2_uc003gvm.2_Silent_p.I250I|APBB2_uc003gvn.2_Silent_p.I250I|APBB2_uc011byt.1_Silent_p.I233I	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,	250					cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						CCAGGTTCTGGATCCGGTGCA	0.587													141	432	---	---	---	---	PASS
SCARB2	950	broad.mit.edu	37	4	77084506	77084506	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77084506G>A	uc003hju.1	-	11	1609	c.1270C>T	c.(1270-1272)CGA>TGA	p.R424*	SCARB2_uc011cbu.1_Nonsense_Mutation_p.R281*	NM_005506	NP_005497	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	424	Lumenal (Potential).				cell adhesion|protein targeting to lysosome	integral to plasma membrane|lysosomal lumen|lysosomal membrane|membrane fraction	enzyme binding|receptor activity				0			Lung(101;0.196)			GACTTCAGTCGACTCGCCGTC	0.403													25	99	---	---	---	---	PASS
GPRIN3	285513	broad.mit.edu	37	4	90170546	90170546	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90170546G>T	uc003hsm.1	-	2	1235	c.716C>A	c.(715-717)ACT>AAT	p.T239N		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	239										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		AGATTCTCTAGTTAGAGGTTT	0.552													23	74	---	---	---	---	PASS
HHIP	64399	broad.mit.edu	37	4	145635414	145635414	+	Silent	SNP	T	C	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145635414T>C	uc003ijs.1	+	9	2116	c.1461T>C	c.(1459-1461)AGT>AGC	p.S487S		NM_022475	NP_071920	Q96QV1	HHIP_HUMAN	hedgehog-interacting protein precursor	487						cytoplasm|extracellular region	catalytic activity|protein binding|zinc ion binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		AGCCATTCAGTAATGGTCCTT	0.383													24	65	---	---	---	---	PASS
FNIP2	57600	broad.mit.edu	37	4	159790324	159790324	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159790324G>A	uc003iqe.3	+	13	2719	c.2536G>A	c.(2536-2538)GAA>AAA	p.E846K		NM_020840	NP_065891	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	846	Interaction with PRKAA1.				DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		GAAGGCTGCGGAAGGACCTGT	0.642													19	97	---	---	---	---	PASS
C4orf41	60684	broad.mit.edu	37	4	184618916	184618916	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184618916A>G	uc003ivx.2	+	25	2955	c.2779A>G	c.(2779-2781)ATT>GTT	p.I927V	C4orf41_uc003ivw.2_Missense_Mutation_p.I927V|C4orf41_uc010isc.2_Missense_Mutation_p.I271V|C4orf41_uc003ivy.2_Missense_Mutation_p.I533V	NM_021942	NP_068761	Q7Z392	CD041_HUMAN	hypothetical protein LOC60684 isoform a	927											0		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)		GGCCCTCACTATTGTTTCCAG	0.498													20	76	---	---	---	---	PASS
ZFR	51663	broad.mit.edu	37	5	32390443	32390443	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32390443G>C	uc003jhr.1	-	12	2160	c.2080C>G	c.(2080-2082)CCA>GCA	p.P694A	ZFR_uc011cny.1_5'Flank	NM_016107	NP_057191	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	694					multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding				0				STAD - Stomach adenocarcinoma(35;0.19)		AATGGGCCTGGAGGACCATGA	0.542													33	115	---	---	---	---	PASS
RASGRF2	5924	broad.mit.edu	37	5	80508333	80508333	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80508333G>A	uc003kha.1	+	23	3305	c.3305G>A	c.(3304-3306)AGA>AAA	p.R1102K	RNU5E_uc011cto.1_Intron|RASGRF2_uc011ctn.1_RNA	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine	1102	Ras-GEF.|Responsible of the affinity for farnesylated versus geranylgeranylated Ras (By similarity).				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		GCCTTAAACAGAAGTGCCATC	0.582													6	22	---	---	---	---	PASS
PPIP5K2	23262	broad.mit.edu	37	5	102502993	102502993	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102502993C>G	uc003kod.3	+	18	2550	c.2031C>G	c.(2029-2031)ATC>ATG	p.I677M	PPIP5K2_uc011cva.1_RNA|PPIP5K2_uc003koe.2_Missense_Mutation_p.I677M|PPIP5K2_uc003kof.2_5'Flank	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1	677					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)|skin(1)	2						CTTCTCAAATCAGACATCGAA	0.289													47	128	---	---	---	---	PASS
SLC22A4	6583	broad.mit.edu	37	5	131630693	131630693	+	Silent	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131630693C>T	uc003kwq.2	+	1	549	c.384C>T	c.(382-384)GTC>GTT	p.V128V	uc003kwm.3_Intron|SLC22A4_uc010jdq.1_5'Flank	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	solute carrier family 22 member 4	128	Extracellular (Potential).				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity				0		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	TGTCCACCGTCGTGACCGAGG	0.701													6	9	---	---	---	---	PASS
CDC23	8697	broad.mit.edu	37	5	137542357	137542357	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137542357A>G	uc003lcl.2	-	3	282	c.251T>C	c.(250-252)ATG>ACG	p.M84T	CDC23_uc003lcm.1_Missense_Mutation_p.M84T	NM_004661	NP_004652	Q9UJX2	CDC23_HUMAN	cell division cycle protein 23	84	TPR 1.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ATAGGCATCCATATCCTGGGC	0.398													29	86	---	---	---	---	PASS
PCDHGB1	56104	broad.mit.edu	37	5	140732064	140732064	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140732064A>C	uc003ljo.1	+	1	2237	c.2237A>C	c.(2236-2238)TAT>TCT	p.Y746S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA4_uc003ljq.1_5'Flank|PCDHGB1_uc011daq.1_Missense_Mutation_p.Y746S|PCDHGA4_uc003ljp.1_5'Flank	NM_018922	NP_061745	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1 isoform 1	746	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTTTGCCCTATTCCTACAAT	0.537													18	158	---	---	---	---	PASS
RBM27	54439	broad.mit.edu	37	5	145616911	145616911	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145616911A>G	uc003lnz.3	+	8	1361	c.1195A>G	c.(1195-1197)ACA>GCA	p.T399A	RBM27_uc003lny.2_Missense_Mutation_p.T399A	NM_018989	NP_061862	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	399	Pro-rich.				mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding			central_nervous_system(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCAGCCTGGGACAAGTGCAGT	0.423													8	139	---	---	---	---	PASS
ATP10B	23120	broad.mit.edu	37	5	160115094	160115094	+	5'UTR	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160115094G>A	uc003lym.1	-	5					ATP10B_uc003lyp.2_5'UTR|ATP10B_uc011deg.1_Silent_p.R40R|ATP10B_uc003lyo.2_5'Flank	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCAGCAGCAGGCGAAGATCTG	0.542													16	20	---	---	---	---	PASS
NEDD9	4739	broad.mit.edu	37	6	11213548	11213548	+	Missense_Mutation	SNP	A	G	G	rs111447705		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11213548A>G	uc003mzv.2	-	2	592	c.425T>C	c.(424-426)ATT>ACT	p.I142T	NEDD9_uc010joz.2_Missense_Mutation_p.I142T|NEDD9_uc003mzw.3_5'UTR|NEDD9_uc003mzx.2_Missense_Mutation_p.I142T	NM_006403	NP_006394	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally	142	Interacts strongly with spindle- regulatory protein D1M1.				actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			GGTTCCCCCAATGCTTCTCTG	0.458													20	40	---	---	---	---	PASS
BRPF3	27154	broad.mit.edu	37	6	36177669	36177669	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36177669G>A	uc003olv.3	+	5	2067	c.1843G>A	c.(1843-1845)GCA>ACA	p.A615T	BRPF3_uc010jwb.2_Missense_Mutation_p.A615T|BRPF3_uc011dtj.1_RNA|BRPF3_uc010jwc.2_RNA|BRPF3_uc011dtk.1_Missense_Mutation_p.A615T	NM_015695	NP_056510	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	615	Bromo.				histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding			ovary(1)|skin(1)	2						ACACATCTTCGCAGAACCAGT	0.507													19	28	---	---	---	---	PASS
ACTB	60	broad.mit.edu	37	7	5567272	5567272	+	3'UTR	SNP	C	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5567272C>A	uc003sos.3	-	5					ACTB_uc003sor.3_3'UTR|ACTB_uc003sot.3_3'UTR|ACTB_uc003soq.3_3'UTR|ACTB_uc010ksy.2_3'UTR	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin						'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		aaaaaaaaaccaaaacaaaac	0.363													8	46	---	---	---	---	PASS
FAM188B	84182	broad.mit.edu	37	7	30931623	30931623	+	3'UTR	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30931623G>A	uc003tbt.2	+	18					FAM188B_uc010kwe.2_3'UTR|AQP1_uc011kac.1_Intron|FAM188B_uc003tbu.2_3'UTR	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182												0						TCCTGTGACCGTTGGATGTGG	0.562													61	162	---	---	---	---	PASS
DPY19L1	23333	broad.mit.edu	37	7	35057549	35057549	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35057549C>G	uc003tem.3	-	3	282	c.137G>C	c.(136-138)CGT>CCT	p.R46P		NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1	46						integral to membrane					0						AGAAAAATGACGGTCATTTTC	0.323													21	71	---	---	---	---	PASS
PKD1L1	168507	broad.mit.edu	37	7	47873983	47873983	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47873983C>A	uc003tny.1	-	40	6128	c.6128G>T	c.(6127-6129)GGT>GTT	p.G2043V		NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	2043	Cytoplasmic (Potential).				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						GGAATTAGGACCTGATTCAAA	0.408													8	39	---	---	---	---	PASS
FKBP9L	360132	broad.mit.edu	37	7	55755510	55755510	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55755510A>G	uc010kzl.2	-	4	483	c.383T>C	c.(382-384)ATC>ACC	p.I128T	FKBP9L_uc010kzk.2_Missense_Mutation_p.I17T|FKBP9L_uc003tqt.2_Missense_Mutation_p.I17T|FKBP9L_uc011kcs.1_Missense_Mutation_p.I17T	NR_003949				SubName: Full=cDNA, FLJ79189, highly similar to FK506-binding protein 9 (EC 5.2.1.8);												0						AGGCGGAATGATCACTGTCCG	0.512													19	36	---	---	---	---	PASS
STAG3L2	442582	broad.mit.edu	37	7	74299371	74299371	+	3'UTR	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74299371C>T	uc003ubj.3	-	8					STAG3L2_uc011kfj.1_Intron	NM_001025202	NP_001020373	P0CL84	ST3L2_HUMAN	STAG3-like							nucleus	binding				0						tcccaaagtgctgggcttaca	0.159													3	9	---	---	---	---	PASS
PAX4	5078	broad.mit.edu	37	7	127252031	127252031	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127252031G>T	uc010lld.1	-	7	921	c.715C>A	c.(715-717)CCA>ACA	p.P239T	PAX4_uc003vmf.2_Missense_Mutation_p.P237T|PAX4_uc003vmg.1_Missense_Mutation_p.P239T|PAX4_uc003vmh.2_Missense_Mutation_p.P237T	NM_006193	NP_006184	O43316	PAX4_HUMAN	paired box 4	247					cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GCAACCCTTGGTACAGTCAGC	0.557													21	35	---	---	---	---	PASS
ESYT2	57488	broad.mit.edu	37	7	158531737	158531737	+	Silent	SNP	A	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158531737A>T	uc003wob.1	-	18	2391	c.2325T>A	c.(2323-2325)CTT>CTA	p.L775L	ESYT2_uc003wny.1_RNA|ESYT2_uc003wnz.1_Silent_p.L214L|ESYT2_uc003woa.1_Silent_p.L352L	NM_020728	NP_065779	A0FGR8	ESYT2_HUMAN	family with sequence similarity 62 (C2 domain	803	C2 3.					integral to membrane|plasma membrane				central_nervous_system(2)|kidney(1)	3						CGACCACGATAAGCTTGTTTC	0.612													9	137	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144999885	144999885	+	Silent	SNP	C	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144999885C>G	uc003zaf.1	-	31	4793	c.4623G>C	c.(4621-4623)CGG>CGC	p.R1541R	PLEC_uc003zab.1_Silent_p.R1404R|PLEC_uc003zac.1_Silent_p.R1408R|PLEC_uc003zad.2_Silent_p.R1404R|PLEC_uc003zae.1_Silent_p.R1372R|PLEC_uc003zag.1_Silent_p.R1382R|PLEC_uc003zah.2_Silent_p.R1390R|PLEC_uc003zaj.2_Silent_p.R1431R	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	1541	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CCGCCTCCTCCCGCCGCACCA	0.716													12	12	---	---	---	---	PASS
IARS	3376	broad.mit.edu	37	9	95021264	95021264	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95021264A>T	uc004art.1	-	19	2145	c.1888T>A	c.(1888-1890)TCC>ACC	p.S630T	IARS_uc004ars.1_Missense_Mutation_p.S475T|IARS_uc004aru.3_Missense_Mutation_p.S630T|IARS_uc010mqr.2_Missense_Mutation_p.S520T|IARS_uc010mqt.2_Intron	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase	630					isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	ACCACAGGGGAGTTAATCAGA	0.423													11	41	---	---	---	---	PASS
NR4A3	8013	broad.mit.edu	37	9	102590586	102590586	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102590586G>T	uc004baf.1	+	3	991	c.262G>T	c.(262-264)GAG>TAG	p.E88*	NR4A3_uc004bae.2_Nonsense_Mutation_p.E88*|NR4A3_uc004bag.1_Nonsense_Mutation_p.E88*|NR4A3_uc004bai.2_Nonsense_Mutation_p.E99*	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	88					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				CAAAGTGGAGGAGGGGCGGGC	0.468			T	EWSR1	extraskeletal myxoid chondrosarcoma								10	30	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21124510	21124510	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21124510C>A	uc001iqi.2	-	14	1778	c.1381G>T	c.(1381-1383)GGA>TGA	p.G461*	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron|NEBL_uc001iql.1_RNA	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	461	Nebulin 13.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						GCTTGCATTCCTTTCCCTTTA	0.448													73	225	---	---	---	---	PASS
NRP1	8829	broad.mit.edu	37	10	33559711	33559711	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33559711C>T	uc001iwx.3	-	3	845	c.322G>A	c.(322-324)GCC>ACC	p.A108T	NRP1_uc001iwv.3_Missense_Mutation_p.A108T|NRP1_uc009xlz.2_Missense_Mutation_p.A108T|NRP1_uc001iww.3_Intron|NRP1_uc001iwy.3_Missense_Mutation_p.A108T|NRP1_uc001iwz.2_Missense_Mutation_p.A108T|NRP1_uc001ixa.2_Missense_Mutation_p.A108T|NRP1_uc001ixb.1_Missense_Mutation_p.A108T|NRP1_uc001ixc.1_Missense_Mutation_p.A108T	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a	108	CUB 1.|Extracellular (Potential).				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)	GGAGGAGGGGCTATCTTTCCA	0.383													7	89	---	---	---	---	PASS
NRP1	8829	broad.mit.edu	37	10	33559713	33559713	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33559713A>T	uc001iwx.3	-	3	843	c.320T>A	c.(319-321)ATA>AAA	p.I107K	NRP1_uc001iwv.3_Missense_Mutation_p.I107K|NRP1_uc009xlz.2_Missense_Mutation_p.I107K|NRP1_uc001iww.3_Intron|NRP1_uc001iwy.3_Missense_Mutation_p.I107K|NRP1_uc001iwz.2_Missense_Mutation_p.I107K|NRP1_uc001ixa.2_Missense_Mutation_p.I107K|NRP1_uc001ixb.1_Missense_Mutation_p.I107K|NRP1_uc001ixc.1_Missense_Mutation_p.I107K	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a	107	CUB 1.|Extracellular (Potential).				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)	AGGAGGGGCTATCTTTCCACA	0.383													7	88	---	---	---	---	PASS
OPN4	94233	broad.mit.edu	37	10	88418429	88418429	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88418429C>A	uc001kdq.2	+	4	840	c.613C>A	c.(613-615)CCC>ACC	p.P205T	OPN4_uc001kdp.2_Missense_Mutation_p.P216T|OPN4_uc010qmk.1_Missense_Mutation_p.P216T|OPN4_uc009xsx.1_5'Flank	NM_033282	NP_150598	Q9UHM6	OPN4_HUMAN	opsin 4 isoform 1	205	Helical; Name=4; (Potential).				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|rhythmic process|visual perception	integral to membrane|plasma membrane	11-cis retinal binding|G-protein coupled photoreceptor activity			ovary(1)	1						GAGTCTGCCACCCTTCTTCGG	0.622													14	56	---	---	---	---	PASS
ANKRD1	27063	broad.mit.edu	37	10	92672564	92672564	+	3'UTR	SNP	T	C	C	rs3939	by1000genomes	TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92672564T>C	uc001khe.1	-	9						NM_014391	NP_055206	Q15327	ANKR1_HUMAN	cardiac ankyrin repeat protein						cellular lipid metabolic process|defense response|signal transduction		DNA binding				0		Colorectal(252;0.0475)				GTCTCTTCTCTTGGGCCATGC	0.398													4	100	---	---	---	---	PASS
CC2D2B	387707	broad.mit.edu	37	10	97779282	97779282	+	Intron	SNP	T	C	C	rs138261083	by1000genomes	TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97779282T>C	uc001kll.2	+						uc001klg.1_Intron|uc001klj.1_Intron|CC2D2B_uc001klk.2_Intron|CC2D2B_uc010qop.1_Intron|uc009xvb.1_RNA	NM_001001732	NP_001001732	Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B isoform											ovary(1)	1		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		atgagaaccgttgAGGTAGTC	0.209													25	86	---	---	---	---	PASS
TECTB	6975	broad.mit.edu	37	10	114053509	114053509	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114053509C>G	uc001kzr.1	+	5	497	c.497C>G	c.(496-498)TCC>TGC	p.S166C		NM_058222	NP_478129	Q96PL2	TECTB_HUMAN	tectorin beta precursor	166	ZP.					anchored to membrane|plasma membrane|proteinaceous extracellular matrix					0		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		GCCAAGTTCTCCATCAAGAAA	0.468													24	55	---	---	---	---	PASS
OR52B6	340980	broad.mit.edu	37	11	5602399	5602399	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5602399T>A	uc010qzi.1	+	1	293	c.293T>A	c.(292-294)ATG>AAG	p.M98K	HBG2_uc001mak.1_Intron	NM_001005162	NP_001005162	Q8NGF0	O52B6_HUMAN	olfactory receptor, family 52, subfamily B,	98	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;3.56e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCACCACCATGCCTAAGGCC	0.473													6	135	---	---	---	---	PASS
DNAJC24	120526	broad.mit.edu	37	11	31436530	31436530	+	Intron	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31436530G>A	uc001msx.2	+						DNAJC24_uc001msw.1_3'UTR|DNAJC24_uc009yjm.2_Intron	NM_181706	NP_859057	Q6P3W2	DJC24_HUMAN	zinc finger, CSL domain containing 3						protein folding		heat shock protein binding|metal ion binding|unfolded protein binding			breast(2)	2						ACAGCACATCGGCAACTCTTA	0.468													5	15	---	---	---	---	PASS
PACSIN3	29763	broad.mit.edu	37	11	47202030	47202030	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47202030C>A	uc001ndw.2	-	5	761	c.423G>T	c.(421-423)AAG>AAT	p.K141N	PACSIN3_uc001ndx.2_Missense_Mutation_p.K141N|PACSIN3_uc001ndy.2_Missense_Mutation_p.K141N|PACSIN3_uc001ndz.2_RNA|PACSIN3_uc001nea.2_RNA	NM_016223	NP_057307	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in	141					endocytosis|negative regulation of endocytosis|positive regulation of membrane protein ectodomain proteolysis	cytoplasm|plasma membrane	cytoskeletal protein binding				0						TCAGCCAGGGCTTCTGGGCCT	0.687													6	76	---	---	---	---	PASS
NUP160	23279	broad.mit.edu	37	11	47800579	47800579	+	3'UTR	SNP	T	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47800579T>G	uc001ngm.2	-	36					NUP160_uc009ylw.2_RNA	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						AAATCGGCCTTGAGTACAGGG	0.463													7	19	---	---	---	---	PASS
B3GAT3	26229	broad.mit.edu	37	11	62384532	62384532	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62384532G>A	uc001ntw.2	-	3	574	c.545C>T	c.(544-546)CCA>CTA	p.P182L	B3GAT3_uc009ynz.2_Missense_Mutation_p.P175L|B3GAT3_uc001ntx.2_RNA|B3GAT3_uc010rlz.1_Missense_Mutation_p.P182L	NM_012200	NP_036332	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	182	Lumenal (Potential).				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|manganese ion binding				0						CCCTGGTGGTGGTGGGTCCTT	0.637													14	150	---	---	---	---	PASS
TSGA10IP	254187	broad.mit.edu	37	11	65715209	65715209	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65715209C>T	uc001ogk.1	+	5	945	c.913C>T	c.(913-915)CGA>TGA	p.R305*	TSGA10IP_uc009yqw.1_RNA|TSGA10IP_uc009yqx.1_Intron	NM_152762	NP_689975	Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein	305											0						CCTCCGAAGGCGACAATGGAG	0.607													3	13	---	---	---	---	PASS
C2CD3	26005	broad.mit.edu	37	11	73753116	73753116	+	Silent	SNP	G	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73753116G>T	uc001ouu.2	-	29	5870	c.5643C>A	c.(5641-5643)TCC>TCA	p.S1881S	C2CD3_uc001out.2_RNA	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1881						centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					AAGTCAGAATGGAGGTTTGGG	0.478													19	58	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78369131	78369131	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78369131A>G	uc001ozl.3	-	34	8745	c.8282T>C	c.(8281-8283)ATG>ACG	p.M2761T	ODZ4_uc001ozk.3_Missense_Mutation_p.M986T|ODZ4_uc009yvb.1_Intron	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	2761	Extracellular (Potential).				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						GCTCTGTCTCATGAAGTGGAT	0.542													99	323	---	---	---	---	PASS
RBM7	10179	broad.mit.edu	37	11	114272549	114272549	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114272549T>C	uc001pov.2	+	2	236	c.226T>C	c.(226-228)TAT>CAT	p.Y76H	C11orf71_uc001pot.1_5'Flank|C11orf71_uc001pou.3_5'Flank|RBM7_uc001pow.2_Missense_Mutation_p.Y76H|RBM7_uc001pox.2_5'UTR	NM_016090	NP_057174	Q9Y580	RBM7_HUMAN	RNA binding motif protein 7	76	RRM.				meiosis		nucleotide binding|protein binding|RNA binding			ovary(2)	2		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.56e-06)|Epithelial(105;4.17e-05)|all cancers(92;0.000348)		AATCAAACTTTATGGAAGGCC	0.343													44	106	---	---	---	---	PASS
OR8D1	283159	broad.mit.edu	37	11	124180510	124180510	+	Silent	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124180510G>A	uc010sag.1	-	1	153	c.153C>T	c.(151-153)GTC>GTT	p.V51V		NM_001002917	NP_001002917	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D,	51	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GTAGAGGGCTGACTGCAATCA	0.512													7	131	---	---	---	---	PASS
LAG3	3902	broad.mit.edu	37	12	6886962	6886962	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6886962C>T	uc001qqt.3	+	7	1655	c.1306C>T	c.(1306-1308)CAA>TAA	p.Q436*	LAG3_uc001qqu.2_Nonsense_Mutation_p.Q266*	NM_002286	NP_002277	P18627	LAG3_HUMAN	lymphocyte-activation protein 3 precursor	436	Extracellular (Potential).					integral to membrane	antigen binding|MHC class II protein binding				0						CATAGGTGCCCAACGCTCTGG	0.358													10	141	---	---	---	---	PASS
SLC2A13	114134	broad.mit.edu	37	12	40258599	40258599	+	Silent	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40258599A>G	uc010skm.1	-	6	1335	c.1284T>C	c.(1282-1284)GCT>GCC	p.A428A	C12orf40_uc009zjv.1_Intron|SLC2A13_uc001rme.1_Silent_p.A75A	NM_052885	NP_443117	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose	428	Extracellular (Potential).					integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)				GACCTGACGGAGCTATTGGCT	0.413										HNSCC(50;0.14)			6	190	---	---	---	---	PASS
LACRT	90070	broad.mit.edu	37	12	55026040	55026040	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55026040C>A	uc001sgi.1	-	3	276	c.238G>T	c.(238-240)GAA>TAA	p.E80*		NM_033277	NP_150593	Q9GZZ8	LACRT_HUMAN	lacritin precursor	80					calcineurin-NFAT signaling pathway|positive regulation of epithelial cell proliferation|positive regulation of NFAT protein import into nucleus|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of secretion|protein localization in Golgi apparatus|tear secretion	extracellular region|stored secretory granule	collagen binding|fibronectin binding|glycoprotein binding|growth factor activity|laminin-1 binding|protein N-terminus binding			central_nervous_system(1)	1						GGGTTTAGTTCCTGCCTGCTT	0.552													42	95	---	---	---	---	PASS
ATP5B	506	broad.mit.edu	37	12	57036241	57036241	+	Splice_Site	SNP	C	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57036241C>A	uc001slr.2	-	7	1179	c.1074_splice	c.e7+1	p.Q358_splice		NM_001686	NP_001677	P06576	ATPB_HUMAN	mitochondrial ATP synthase beta subunit						angiogenesis|ATP hydrolysis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)	1						ATTTTTCTTACCTGTACAGAG	0.299													27	62	---	---	---	---	PASS
FGD6	55785	broad.mit.edu	37	12	95475277	95475277	+	3'UTR	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95475277A>G	uc001tdp.3	-	21					FGD6_uc009zsx.2_3'UTR	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6						actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						GAATCACAGAAGAGATGAAAC	0.353													21	64	---	---	---	---	PASS
TCP11L2	255394	broad.mit.edu	37	12	106729962	106729962	+	Silent	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106729962A>G	uc001tln.2	+	8	1287	c.1113A>G	c.(1111-1113)TCA>TCG	p.S371S		NM_152772	NP_689985	Q8N4U5	T11L2_HUMAN	t-complex 11 (mouse) like 2	371										ovary(3)	3						CAAGGATTTCAGCTGTTCTAC	0.428													3	76	---	---	---	---	PASS
KCTD10	83892	broad.mit.edu	37	12	109907452	109907452	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109907452G>T	uc001toi.1	-	2	173	c.85C>A	c.(85-87)CCC>ACC	p.P29T	KCTD10_uc009zvi.1_Missense_Mutation_p.P26T|KCTD10_uc001toj.1_Missense_Mutation_p.P37T|KCTD10_uc001tok.1_5'UTR	NM_031954	NP_114160	Q9H3F6	BACD3_HUMAN	potassium channel tetramerisation domain	29					proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	Cul3-RING ubiquitin ligase complex|cytoplasm|nucleus|voltage-gated potassium channel complex	voltage-gated potassium channel activity				0						TTGGAGCTGGGGCTCGTGCCC	0.572													6	78	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19412668	19412668	+	RNA	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19412668C>T	uc010tcj.1	-	1		c.33442G>A				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						TTCAACAGTTCAGAATTGAGC	0.348													15	60	---	---	---	---	PASS
LOC220429	220429	broad.mit.edu	37	13	50466990	50466990	+	Missense_Mutation	SNP	T	C	C	rs144184696	by1000genomes	TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50466990T>C	uc001vdk.2	+	1	2446	c.2264T>C	c.(2263-2265)CTG>CCG	p.L755P		NR_003268				Homo sapiens CTAGE family, member 5 pseudogene, mRNA (cDNA clone IMAGE:5270026).												0						GTCTGTCCACTGAGGGGTTTT	0.517													6	87	---	---	---	---	PASS
INTS6	26512	broad.mit.edu	37	13	51969612	51969612	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51969612A>G	uc001vfk.2	-	5	1051	c.437T>C	c.(436-438)TTA>TCA	p.L146S	INTS6_uc001vfj.2_Missense_Mutation_p.L133S|INTS6_uc001vfl.2_5'UTR	NM_012141	NP_036273	Q9UL03	INT6_HUMAN	integrator complex subunit 6 isoform a	146	VWFA.				snRNA processing	actin cytoskeleton|integrator complex	protein binding|transmembrane receptor activity			ovary(1)|lung(1)	2		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		ATTAAGAGGTAAATGAAGCTG	0.398													11	54	---	---	---	---	PASS
BAZ1A	11177	broad.mit.edu	37	14	35264070	35264070	+	Silent	SNP	C	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35264070C>A	uc001wsk.2	-	11	1816	c.1248G>T	c.(1246-1248)GTG>GTT	p.V416V	BAZ1A_uc001wsl.2_Silent_p.V416V	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	416					chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		GTCTAGTTTTCACTGGTGTTG	0.363													32	92	---	---	---	---	PASS
KIAA0586	9786	broad.mit.edu	37	14	58932590	58932590	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58932590C>G	uc001xdv.3	+	14	2142	c.1869C>G	c.(1867-1869)TTC>TTG	p.F623L	KIAA0586_uc010trr.1_Missense_Mutation_p.F740L|KIAA0586_uc001xdt.3_Missense_Mutation_p.F655L|KIAA0586_uc001xdu.3_Missense_Mutation_p.F684L|KIAA0586_uc010trs.1_Missense_Mutation_p.F614L|KIAA0586_uc010trt.1_Missense_Mutation_p.F559L|KIAA0586_uc010tru.1_Missense_Mutation_p.F559L	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein	623										ovary(1)	1						AGACTGACTTCTATGCAACAA	0.343													7	55	---	---	---	---	PASS
BDKRB2	624	broad.mit.edu	37	14	96703508	96703508	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96703508G>T	uc010avm.1	+	2	260	c.64G>T	c.(64-66)GCC>TCC	p.A22S	BDKRB2_uc010avl.1_Silent_p.R81R|BDKRB2_uc010twu.1_5'UTR|BDKRB2_uc001yfg.2_Missense_Mutation_p.A22S	NM_000623	NP_000614	P30411	BKRB2_HUMAN	bradykinin receptor B2	22	Extracellular (Potential).				arachidonic acid secretion|elevation of cytosolic calcium ion concentration|transmembrane receptor protein tyrosine kinase signaling pathway	endosome|integral to plasma membrane	bradykinin receptor activity|phosphatidylinositol phospholipase C activity|protease binding|protein heterodimerization activity|type 1 angiotensin receptor binding			ovary(3)|breast(1)|kidney(1)	5		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)		GCCCACCACGGCCTCTTTCAG	0.542													45	75	---	---	---	---	PASS
PAPOLA	10914	broad.mit.edu	37	14	97022676	97022676	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97022676A>G	uc001yfq.2	+	19	2140	c.1930A>G	c.(1930-1932)ACT>GCT	p.T644A	PAPOLA_uc001yfr.2_Missense_Mutation_p.T643A|PAPOLA_uc010twv.1_Missense_Mutation_p.T644A|PAPOLA_uc010avp.2_Missense_Mutation_p.T394A	NM_032632	NP_116021	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	644					mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|RNA binding				0		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		AAAAATACCTACTCCTATAGT	0.398													59	87	---	---	---	---	PASS
PLA2G4D	283748	broad.mit.edu	37	15	42379578	42379578	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42379578A>G	uc001zox.2	-	3	270	c.175T>C	c.(175-177)TTT>CTT	p.F59L		NM_178034	NP_828848	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD	59	C2.				phospholipid catabolic process	cytoplasmic vesicle membrane|cytosol	metal ion binding|phospholipase A2 activity			large_intestine(1)|skin(1)	2		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		TTGGTCTTAAACTTCATTCCA	0.547													59	181	---	---	---	---	PASS
GLCE	26035	broad.mit.edu	37	15	69561312	69561312	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69561312A>G	uc002ary.1	+	5	1811	c.1583A>G	c.(1582-1584)GAA>GGA	p.E528G		NM_015554	NP_056369	O94923	GLCE_HUMAN	D-glucuronyl C5-epimerase	528	Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process|heparin biosynthetic process	Golgi membrane|integral to membrane	UDP-glucuronate 5'-epimerase activity			ovary(2)	2						ACTGCAGGGGAAAAACTCGGA	0.418													4	123	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	76074470	76074470	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76074470A>G	uc010umm.1	+	8	649	c.572A>G	c.(571-573)CAG>CGG	p.Q191R	uc002bba.1_5'Flank					SubName: Full=cDNA FLJ59077, highly similar to Golgin subfamily A member 6;																		CGGTTACAGCAGACCATAAAG	0.577													4	36	---	---	---	---	PASS
DET1	55070	broad.mit.edu	37	15	89070834	89070834	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89070834G>A	uc002bmr.2	-	3	1419	c.1267C>T	c.(1267-1269)CGC>TGC	p.R423C	DET1_uc002bmp.3_RNA|DET1_uc010bnk.2_Intron|DET1_uc002bmq.2_Missense_Mutation_p.R434C	NM_001144074	NP_001137546	Q7L5Y6	DET1_HUMAN	de-etiolated 1 isoform 2	423						nucleus				lung(1)|pancreas(1)	2	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			GCTTACCGGCGCTGGATCTGC	0.443													12	54	---	---	---	---	PASS
MMP2	4313	broad.mit.edu	37	16	55519326	55519326	+	Silent	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55519326G>A	uc002ehz.3	+	4	956	c.645G>A	c.(643-645)TTG>TTA	p.L215L	MMP2_uc010vhd.1_Silent_p.L139L|MMP2_uc010ccc.2_Silent_p.L165L	NM_004530	NP_004521	P08253	MMP2_HUMAN	matrix metalloproteinase 2 isoform a	215	Collagenase-like 1.				angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Marimastat(DB00786)|Sulindac(DB00605)	TATGGACCTTGGGAGAAGGCC	0.587													15	71	---	---	---	---	PASS
ATMIN	23300	broad.mit.edu	37	16	81074846	81074846	+	Intron	SNP	A	C	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81074846A>C	uc002ffz.1	+						ATMIN_uc002fga.2_Intron|ATMIN_uc010vnn.1_Intron|ATMIN_uc002fgb.1_5'UTR	NM_015251	NP_056066	O43313	ATMIN_HUMAN	ATM interactor						response to DNA damage stimulus	nucleus	zinc ion binding				0						AGATGGAAAAACTCTTAATTA	0.313													5	18	---	---	---	---	PASS
ZPBP2	124626	broad.mit.edu	37	17	38031594	38031594	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38031594G>A	uc002hte.2	+	7	949	c.796G>A	c.(796-798)GTG>ATG	p.V266M	ZPBP2_uc002htf.2_Missense_Mutation_p.V244M	NM_199321	NP_955353	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2 isoform 2	266					binding of sperm to zona pellucida	extracellular region				ovary(1)	1	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			AATGCATTTTGTGGACCACAG	0.393													11	105	---	---	---	---	PASS
HEXIM1	10614	broad.mit.edu	37	17	43226528	43226528	+	5'UTR	SNP	A	C	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43226528A>C	uc002iig.2	+	1						NM_006460	NP_006451	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1						negative regulation of cyclin-dependent protein kinase activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	cyclin-dependent protein kinase inhibitor activity|protein binding|snRNA binding			ovary(1)	1						ACTAGCCAAAATTTCTTAAAC	0.373											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	48	113	---	---	---	---	PASS
LRRC37A3	374819	broad.mit.edu	37	17	62850588	62850588	+	3'UTR	SNP	G	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62850588G>T	uc002jey.2	-	14					LRRC37A3_uc010wqg.1_3'UTR|LRRC37A3_uc002jex.1_3'UTR|LRRC37A3_uc010wqf.1_3'UTR	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3							integral to membrane					0						CAGGAACGATGGCCCTGTGCT	0.478													9	10	---	---	---	---	PASS
GAA	2548	broad.mit.edu	37	17	78090845	78090845	+	Silent	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78090845C>T	uc002jxo.2	+	17	2450	c.2268C>T	c.(2266-2268)CTC>CTT	p.L756L	GAA_uc002jxp.2_Silent_p.L756L|GAA_uc002jxq.2_Silent_p.L756L	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	acid alpha-glucosidase preproprotein	756					cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)	CCCCAGTGCTCCAGGCCGGGA	0.647													21	53	---	---	---	---	PASS
PIGN	23556	broad.mit.edu	37	18	59777079	59777079	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59777079G>A	uc002lii.3	-	18	2010	c.1562C>T	c.(1561-1563)GCG>GTG	p.A521V	PIGN_uc002lij.3_Missense_Mutation_p.A521V	NM_176787	NP_789744	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	521	Helical; (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5		Colorectal(73;0.187)				TCTTAGAACCGCATACCATAT	0.358													11	173	---	---	---	---	PASS
ATP8B3	148229	broad.mit.edu	37	19	1811645	1811645	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1811645A>T	uc002ltw.2	-	2	325	c.91T>A	c.(91-93)TCA>ACA	p.S31T	ATP8B3_uc002ltv.2_5'UTR|ATP8B3_uc002ltx.2_RNA|ATP8B3_uc002ltz.1_5'UTR	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3	31	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCACGTCTGAGTCACCCGTG	0.662													9	20	---	---	---	---	PASS
ACSBG2	81616	broad.mit.edu	37	19	6182803	6182803	+	Silent	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6182803C>T	uc002mef.1	+	9	1175	c.948C>T	c.(946-948)GTC>GTT	p.V316V	ACSBG2_uc002mee.1_Silent_p.V129V|ACSBG2_uc002meg.1_Silent_p.V316V|ACSBG2_uc002meh.1_Silent_p.V316V|ACSBG2_uc002mei.1_Silent_p.V266V|ACSBG2_uc010xiz.1_Silent_p.V316V	NM_030924	NP_112186	Q5FVE4	ACBG2_HUMAN	bubblegum-related acyl-CoA synthetase 2	316					cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1						AACCTACTGTCTTCATTGGAG	0.483													9	35	---	---	---	---	PASS
ACTL9	284382	broad.mit.edu	37	19	8807932	8807932	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8807932G>A	uc002mkl.2	-	1	1241	c.1120C>T	c.(1120-1122)CCC>TCC	p.P374S		NM_178525	NP_848620	Q8TC94	ACTL9_HUMAN	actin-like 9	374						cytoplasm|cytoskeleton				large_intestine(2)|pancreas(1)	3						TTCCTGGTGGGCTGGGCAGCC	0.682													10	45	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	15989523	15989523	+	3'UTR	SNP	T	C	C	rs3952538		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15989523T>C	uc002nbs.1	-	13					CYP4F2_uc010xot.1_3'UTR	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,						leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						aattctaggcttcacttttga	0.259													3	35	---	---	---	---	PASS
ZNF493	284443	broad.mit.edu	37	19	21608374	21608374	+	3'UTR	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21608374C>T	uc002npx.2	+	2					ZNF493_uc002npw.2_3'UTR|ZNF493_uc002npy.2_3'UTR	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CAATTTACTGCACATAAGATA	0.363													7	20	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41066216	41066216	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41066216C>G	uc002ony.2	+	27	5908	c.5822C>G	c.(5821-5823)ACA>AGA	p.T1941R	SPTBN4_uc002onx.2_Missense_Mutation_p.T1941R|SPTBN4_uc002onz.2_Missense_Mutation_p.T1941R|SPTBN4_uc010egx.2_Missense_Mutation_p.T684R|SPTBN4_uc002ooa.2_Missense_Mutation_p.T617R	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	1941					actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GTCAGCTCCACAGCCGACGCC	0.657													21	98	---	---	---	---	PASS
RABAC1	10567	broad.mit.edu	37	19	42462491	42462491	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42462491C>T	uc002osf.2	-	3	398	c.314G>A	c.(313-315)GGC>GAC	p.G105D		NM_006423	NP_006414	Q9UI14	PRAF1_HUMAN	Rab acceptor 1	105	Helical; (By similarity).					cell junction|Golgi apparatus|integral to membrane|synaptic vesicle	identical protein binding				0						GTAACAGGCGCCGAAAAAGAC	0.582													9	23	---	---	---	---	PASS
ZNF45	7596	broad.mit.edu	37	19	44418082	44418082	+	Silent	SNP	G	A	A	rs142171881	byFrequency	TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44418082G>A	uc002oxu.1	-	4	1605	c.1506C>T	c.(1504-1506)TGC>TGT	p.C502C	ZNF45_uc002oxw.1_Silent_p.C502C|ZNF45_uc002oxv.1_Silent_p.C502C	NM_003425	NP_003416	Q02386	ZNF45_HUMAN	zinc finger protein 45	502	C2H2-type 13.				multicellular organismal development	nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						CACACCTCTCGCATTTATAGG	0.483													19	50	---	---	---	---	PASS
ZFP112	7771	broad.mit.edu	37	19	44833818	44833818	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44833818T>G	uc010ejj.2	-	5	623	c.510A>C	c.(508-510)AAA>AAC	p.K170N	ZFP112_uc002ozc.3_Missense_Mutation_p.K164N|ZFP112_uc010xwy.1_Missense_Mutation_p.K187N|ZFP112_uc010xwz.1_Missense_Mutation_p.K169N	NM_001083335	NP_001076804	Q9UJU3	ZF112_HUMAN	zinc finger protein 228 isoform 1	170					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)	5						ACCCTTGACTTTTTATATAAT	0.383													6	166	---	---	---	---	PASS
TOMM40	10452	broad.mit.edu	37	19	45406477	45406477	+	3'UTR	SNP	A	C	C			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45406477A>C	uc002ozx.3	+	10					TOMM40_uc002ozy.3_3'UTR|TOMM40_uc002paa.3_3'UTR|TOMM40_uc002ozz.2_3'UTR|APOE_uc002pab.2_5'Flank	NM_006114	NP_006105	O96008	TOM40_HUMAN	translocase of outer mitochondrial membrane 40						protein targeting to mitochondrion	integral to membrane of membrane fraction|integral to mitochondrial outer membrane|mitochondrial outer membrane translocase complex|pore complex	porin activity|protein transmembrane transporter activity|voltage-gated anion channel activity				0	Lung NSC(12;0.0018)|all_lung(12;0.00481)			OV - Ovarian serous cystadenocarcinoma(262;0.0033)|Epithelial(262;0.176)		CTCCACCTCCACCTCCCCCTG	0.672													5	12	---	---	---	---	PASS
ZSCAN1	284312	broad.mit.edu	37	19	58549265	58549265	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58549265G>T	uc002qrc.1	+	3	308	c.61G>T	c.(61-63)GAG>TAG	p.E21*	ZSCAN1_uc002qra.1_Nonsense_Mutation_p.E21*|ZSCAN1_uc002qrb.1_Nonsense_Mutation_p.E21*	NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	21					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		AACCCCGAGTGAGCAGGACGC	0.687													7	11	---	---	---	---	PASS
PROCR	10544	broad.mit.edu	37	20	33763988	33763988	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33763988T>A	uc002xbt.2	+	3	524	c.340T>A	c.(340-342)TGC>AGC	p.C114S	EDEM2_uc010zuv.1_Intron|PROCR_uc010zuw.1_Missense_Mutation_p.C151S	NM_006404	NP_006395	Q9UNN8	EPCR_HUMAN	endothelial protein C receptor precursor	114	Extracellular (Potential).				antigen processing and presentation|blood coagulation|immune response	integral to plasma membrane|MHC class I protein complex	receptor activity				0			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	GACCATCCGCTGCTTCCTGGG	0.597													23	98	---	---	---	---	PASS
C20orf24	55969	broad.mit.edu	37	20	35238021	35238021	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35238021C>T	uc002xfq.2	+	3	424	c.236C>T	c.(235-237)GCA>GTA	p.A79V	C20orf24_uc002xfo.2_Missense_Mutation_p.A105V|C20orf24_uc002xfp.2_Missense_Mutation_p.A79V|C20orf24_uc002xft.2_RNA|C20orf24_uc002xfr.2_Intron|C20orf24_uc002xfs.2_Missense_Mutation_p.A79V	NM_018840	NP_061328	Q9BUV8	CT024_HUMAN	RAB5-interacting protein isoform a	79							protein binding				0	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				CTGATCAATGCAGGAGTCCTG	0.393													76	247	---	---	---	---	PASS
C20orf165	128497	broad.mit.edu	37	20	44515557	44515557	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44515557G>A	uc002xqf.2	-	2	292	c.283C>T	c.(283-285)CAT>TAT	p.H95Y		NM_080608	NP_542175	Q9BR10	CT165_HUMAN	chromosome 20 open reading frame 165	95						integral to membrane					0		Myeloproliferative disorder(115;0.0122)				TGCCTCACATGCGGGAATTTG	0.637													63	203	---	---	---	---	PASS
SAMD10	140700	broad.mit.edu	37	20	62606758	62606758	+	3'UTR	SNP	G	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62606758G>T	uc002yhm.2	-	5					SAMD10_uc002yhn.2_RNA	NM_080621	NP_542188	Q9BYL1	SAM10_HUMAN	sterile alpha motif domain containing 10												0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TGGCCGCCCCGGCATCCCGCA	0.677													3	44	---	---	---	---	PASS
MORC3	23515	broad.mit.edu	37	21	37736413	37736413	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37736413G>A	uc002yvi.2	+	14	1551	c.1475G>A	c.(1474-1476)CGG>CAG	p.R492Q		NM_015358	NP_056173	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	492					cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding			ovary(2)	2						CTGTTGTTTCGGCCAACTGCT	0.383													44	153	---	---	---	---	PASS
NYX	60506	broad.mit.edu	37	X	41333572	41333572	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41333572G>A	uc004dfh.2	+	2	1296	c.866G>A	c.(865-867)AGC>AAC	p.S289N	NYX_uc011mku.1_Missense_Mutation_p.S284N	NM_022567	NP_072089	Q9GZU5	NYX_HUMAN	nyctalopin precursor	289	LRR 10.				response to stimulus|visual perception	intracellular|proteinaceous extracellular matrix				lung(2)	2						GACCGCAACAGCATCGCCTTC	0.692													3	34	---	---	---	---	PASS
AR	367	broad.mit.edu	37	X	66788741	66788741	+	Intron	SNP	A	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66788741A>T	uc004dwu.1	+						AR_uc011mpd.1_Intron|AR_uc011mpe.1_Intron|AR_uc011mpf.1_Intron|AR_uc004dwv.1_5'UTR	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1						cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)	GCCTATGCAAATGCCTGCCTG	0.512									Androgen_Insensitivity_Syndrome				16	15	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76952169	76952169	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76952169T>A	uc004ecp.3	-	5	498	c.266A>T	c.(265-267)TAT>TTT	p.Y89F	ATRX_uc004ecq.3_Missense_Mutation_p.Y89F|ATRX_uc004eco.3_5'UTR|ATRX_uc004ecr.2_Missense_Mutation_p.Y89F|ATRX_uc010nlx.1_Missense_Mutation_p.Y89F|ATRX_uc010nly.1_Missense_Mutation_p.Y34F	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	89					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TGATTCTACATACTTTGTTAC	0.308			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						49	34	---	---	---	---	PASS
AIFM1	9131	broad.mit.edu	37	X	129289191	129289191	+	Intron	SNP	G	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129289191G>A	uc004evg.2	-						AIFM1_uc011mus.1_Intron|AIFM1_uc004evh.2_Silent_p.G59G|AIFM1_uc004evi.2_Intron|AIFM1_uc004evk.2_Intron	NM_004208	NP_004199	O95831	AIFM1_HUMAN	programmed cell death 8 isoform 1						activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			ovary(4)|central_nervous_system(1)	5						CTAGGTTGCTGCCATCTTTCC	0.438													98	78	---	---	---	---	PASS
HPCAL4	51440	broad.mit.edu	37	1	40149941	40149942	+	Intron	INS	-	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40149941_40149942insT	uc001cdr.2	-						HPCAL4_uc010oix.1_Intron	NM_016257	NP_057341	Q9UM19	HPCL4_HUMAN	hippocalcin-like protein 4						central nervous system development	intracellular	calcium ion binding			central_nervous_system(1)	1	all_cancers(7;4.65e-13)|Lung NSC(20;2.88e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GGTGCCTTGCCCCCGCCACCCC	0.772													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143391935	143391936	+	IGR	INS	-	TG	TG			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143391935_143391936insTG								None (None upstream) : LOC100286793 (255703 downstream)																							ATATATATATATAAAGAGATTG	0.252													4	3	---	---	---	---	
RORC	6097	broad.mit.edu	37	1	151789608	151789609	+	Intron	DEL	GC	-	-	rs71093213		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151789608_151789609delGC	uc001ezh.2	-						RORC_uc001ezg.2_Intron|RORC_uc010pdo.1_Intron|RORC_uc010pdp.1_Intron	NM_005060	NP_005051	P51449	RORG_HUMAN	RAR-related orphan receptor C isoform a						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			gtgtgtgtgtgCGCGCGCGCGC	0.490													16	10	---	---	---	---	
KLHL20	27252	broad.mit.edu	37	1	173735619	173735620	+	Intron	DEL	AA	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173735619_173735620delAA	uc001gjc.2	+						KLHL20_uc010pmr.1_Intron|KLHL20_uc009wwf.2_Intron	NM_014458	NP_055273	Q9Y2M5	KLH20_HUMAN	kelch-like 20						cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity			ovary(1)	1						taaaaaatacaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	185834715	185834732	+	Intron	DEL	ACACACACACACACACAC	-	-	rs72151651		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185834715_185834732delACACACACACACACACAC	uc001grq.1	+							NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						ATATAAGcatacacacacacacacacacacacacacac	0.229													4	6	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54131004	54131005	+	Intron	INS	-	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54131004_54131005insT	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			tttgaaatacattaaaaaaaag	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	59742028	59742028	+	IGR	DEL	C	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59742028delC								None (None upstream) : BCL11A (936275 downstream)																							TTAAAATCAACCTTTGGAAGC	0.229													8	4	---	---	---	---	
NEB	4703	broad.mit.edu	37	2	152473987	152473987	+	Intron	DEL	A	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152473987delA	uc010fnx.2	-							NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TAAGCGCTACAAAAAAAAAAA	0.343													4	2	---	---	---	---	
NBEAL1	65065	broad.mit.edu	37	2	204045216	204045217	+	Frame_Shift_Del	DEL	GT	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204045216_204045217delGT	uc002uzt.3	+	42	6822_6823	c.6489_6490delGT	c.(6487-6492)GAGTTTfs	p.E2163fs	NBEAL1_uc002uzs.3_Frame_Shift_Del_p.E873fs	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	2163_2164	BEACH.						binding			ovary(1)|skin(1)	2						ATTTCCCAGAGTTTTTGGAAAA	0.356													59	27	---	---	---	---	
LOC728323	728323	broad.mit.edu	37	2	243056967	243056967	+	Intron	DEL	T	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:243056967delT	uc010zpd.1	+						LOC728323_uc010zpe.1_Intron|LOC728323_uc010zpf.1_Intron|LOC728323_uc010zpg.1_Intron	NR_024437				Homo sapiens cDNA FLJ60027 complete cds, moderately similar to F-box only protein 25.												0						CAGTGCTATCTTATGAAATAA	0.299													5	3	---	---	---	---	
KAT2B	8850	broad.mit.edu	37	3	20141252	20141253	+	Intron	DEL	AG	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20141252_20141253delAG	uc003cbq.2	+							NM_003884	NP_003875	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B						cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						TGTGTGTGTAagagagagagag	0.208													6	3	---	---	---	---	
CCDC80	151887	broad.mit.edu	37	3	112329033	112329034	+	Intron	INS	-	A	A	rs146699705		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112329033_112329034insA	uc003dzf.2	-						CCDC80_uc011bhv.1_Intron|CCDC80_uc003dzg.2_Intron|CCDC80_uc003dzh.1_Intron	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor											ovary(2)	2						TCTGTGCCCAGAAAAAAAAAAA	0.361													4	2	---	---	---	---	
GATA2	2624	broad.mit.edu	37	3	128200752	128200753	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128200752_128200753insT	uc003ekm.3	-	6	1487_1488	c.1052_1053insA	c.(1051-1053)AATfs	p.N351fs	GATA2_uc003ekn.3_Intron|GATA2_uc003eko.2_Frame_Shift_Ins_p.N351fs	NM_001145661	NP_001139133	P23769	GATA2_HUMAN	GATA binding protein 2 isoform 1	351	GATA-type 2.				blood coagulation|negative regulation of fat cell differentiation|negative regulation of fat cell proliferation|negative regulation of neural precursor cell proliferation|negative regulation of Notch signaling pathway|phagocytosis|positive regulation of angiogenesis|positive regulation of phagocytosis|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	C2H2 zinc finger domain binding|chromatin binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15				GBM - Glioblastoma multiforme(114;0.173)		TCGTCTGACAATTTGCACAACA	0.510			Mis		AML(CML blast transformation)								53	26	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	190433401	190433402	+	IGR	INS	-	AG	AG	rs146341792	by1000genomes	TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190433401_190433402insAG								IL1RAP (57558 upstream) : LOC647309 (137124 downstream)																							TAAAATCAGAAAAAGTTCATTG	0.297													3	5	---	---	---	---	
ARAP2	116984	broad.mit.edu	37	4	36109441	36109445	+	Intron	DEL	TTATG	-	-	rs71888363		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36109441_36109445delTTATG	uc003gsq.1	-							NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH						regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						CAATCATATCTTATGTTATATTATA	0.210													5	4	---	---	---	---	
UGDH	7358	broad.mit.edu	37	4	39505927	39505928	+	Intron	INS	-	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39505927_39505928insA	uc003guk.1	-						UGDH_uc011byp.1_Intron|UGDH_uc003gul.1_Intron	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase						glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)	gactccatctcaaaaaaaaaaa	0.139													4	2	---	---	---	---	
PALLD	23022	broad.mit.edu	37	4	169602692	169602692	+	Intron	DEL	T	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169602692delT	uc011cjx.1	+						PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		TGGAACACAAttttttttttt	0.194									Pancreatic_Cancer_Familial_Clustering_of				4	2	---	---	---	---	
TRIP13	9319	broad.mit.edu	37	5	914836	914837	+	Intron	DEL	GT	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:914836_914837delGT	uc003jbr.2	+							NM_004237	NP_004228	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13						double-strand break repair|reciprocal meiotic recombination|synaptonemal complex assembly|transcription from RNA polymerase II promoter		ATP binding|identical protein binding|nucleoside-triphosphatase activity|transcription cofactor activity				0			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			ATGTACACACgtgtgtgtgtgt	0.441													12	6	---	---	---	---	
RPS14	6208	broad.mit.edu	37	5	149826951	149826952	+	Intron	INS	-	T	T	rs141773002	by1000genomes	TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149826951_149826952insT	uc003lsh.2	-						RPS14_uc003lsi.2_Intron|RPS14_uc003lsj.2_Intron	NM_001025071	NP_001020242	P62263	RS14_HUMAN	ribosomal protein S14						endocrine pancreas development|erythrocyte differentiation|maturation of SSU-rRNA|negative regulation of transcription from RNA polymerase II promoter|ribosomal small subunit assembly|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	mRNA 5'-UTR binding|protein binding|structural constituent of ribosome|translation regulator activity			central_nervous_system(1)	1		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCATCACGCTGTAAGGACGAAG	0.381													2	6	---	---	---	---	
SCAND3	114821	broad.mit.edu	37	6	28554609	28554610	+	5'UTR	DEL	AC	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28554609_28554610delAC	uc003nlo.2	-	1					uc003nlp.1_5'Flank	NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN	SCAN domain containing 3						DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			ovary(1)	1						ATATAAGAAAACACTCAACACA	0.426													6	3	---	---	---	---	
FAM135A	57579	broad.mit.edu	37	6	71236468	71236469	+	Intron	DEL	AT	-	-	rs111717563		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71236468_71236469delAT	uc003pfj.2	+						FAM135A_uc003pfi.2_Intron|FAM135A_uc003pfh.2_Intron|FAM135A_uc003pfl.2_Intron|FAM135A_uc003pfn.2_Intron|FAM135A_uc003pfo.1_Intron|FAM135A_uc010kan.1_5'Flank	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN	hypothetical protein LOC57579 isoform c											central_nervous_system(1)	1						acacacacacatacacacacac	0.218													3	6	---	---	---	---	
RSPH10B2	728194	broad.mit.edu	37	7	5985001	5985001	+	Intron	DEL	G	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5985001delG	uc003sph.1	-						RSPH10B2_uc003spg.1_Intron|RSPH10B2_uc010ktd.1_Intron|RSPH10B2_uc011jwk.1_Intron	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B											ovary(1)|pancreas(1)|skin(1)	3						tgtaatcccagcactttggga	0.119													5	3	---	---	---	---	
COL28A1	340267	broad.mit.edu	37	7	7413336	7413337	+	Intron	INS	-	T	T	rs35277875		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7413336_7413337insT	uc003src.1	-						COL28A1_uc011jxe.1_Intron	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor						cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		ATTCTGGtttcttttttttttt	0.208													6	3	---	---	---	---	
COL28A1	340267	broad.mit.edu	37	7	7477250	7477251	+	Intron	INS	-	A	A	rs146114839	by1000genomes	TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7477250_7477251insA	uc003src.1	-						COL28A1_uc011jxe.1_Intron|COL28A1_uc003srd.2_Intron|COL28A1_uc003sre.1_5'Flank	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor						cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		gcatcttttgtaaccactgcta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	139888591	139888591	+	IGR	DEL	T	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139888591delT								LOC100134229 (9152 upstream) : SLC37A3 (144963 downstream)																							TCATTCTTGCTTTTTTTTTTT	0.139													4	2	---	---	---	---	
SNAI2	6591	broad.mit.edu	37	8	49831218	49831219	+	3'UTR	DEL	GT	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49831218_49831219delGT	uc003xqp.2	-	3						NM_003068	NP_003059	O43623	SNAI2_HUMAN	snail 2						canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				CTCTCtgtgggtgtgtgtgtgt	0.282													4	2	---	---	---	---	
TNFSF8	944	broad.mit.edu	37	9	117692251	117692252	+	Intron	INS	-	AGAG	AGAG	rs147427714		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117692251_117692252insAGAG	uc004bji.1	-							NM_001244	NP_001235	P32971	TNFL8_HUMAN	tumor necrosis factor (ligand) superfamily,						cell proliferation|cell-cell signaling|immune response|induction of apoptosis|signal transduction	extracellular space|integral to plasma membrane	cytokine activity|tumor necrosis factor receptor binding			lung(3)|skin(2)|ovary(1)	6						agtatatatatatatataGAGA	0.168													4	3	---	---	---	---	
PKN3	29941	broad.mit.edu	37	9	131478874	131478875	+	Intron	INS	-	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131478874_131478875insT	uc004bvw.2	+						PKN3_uc010myh.2_Intron|PKN3_uc011mbk.1_Intron	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta						signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						aagactgtgtctcaaaaaaaaa	0.228													5	5	---	---	---	---	
TTF1	7270	broad.mit.edu	37	9	135251296	135251297	+	3'UTR	DEL	CT	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135251296_135251297delCT	uc004cbl.2	-	11					TTF1_uc011mcp.1_RNA|TTF1_uc004cbm.2_3'UTR	NM_007344	NP_031370	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase						negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		tctcgaactcctgacctcagat	0.045													8	9	---	---	---	---	
IDE	3416	broad.mit.edu	37	10	94275019	94275019	+	Intron	DEL	T	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94275019delT	uc001kia.2	-							NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TAAAAGTGTCttttttttttt	0.144													4	2	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128836112	128836112	+	Intron	DEL	C	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128836112delC	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CTTTTTGGGTCtttttttttt	0.393													6	3	---	---	---	---	
RTN3	10313	broad.mit.edu	37	11	63523428	63523429	+	Intron	INS	-	A	A	rs112296263		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63523428_63523429insA	uc001nxq.2	+						RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Intron|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Intron|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b						apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						ggctccgtctcaaaaaaaaaaa	0.158													8	5	---	---	---	---	
RNF169	254225	broad.mit.edu	37	11	74457267	74457267	+	5'Flank	DEL	T	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74457267delT	uc001ovl.3	+							NM_001098638	NP_001092108	Q8NCN4	RN169_HUMAN	ring finger protein 169								zinc ion binding			ovary(1)	1						TTCAATACTCttttttttttt	0.294													4	2	---	---	---	---	
UBASH3B	84959	broad.mit.edu	37	11	122680263	122680264	+	Intron	DEL	AT	-	-	rs146476661		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122680263_122680264delAT	uc001pyi.3	+							NM_032873	NP_116262	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing,							cytoplasm|nucleus	protein tyrosine phosphatase activity			central_nervous_system(1)	1		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		TGCAATGTAAATACTCTTCTAA	0.351													2	4	---	---	---	---	
KNTC1	9735	broad.mit.edu	37	12	123024332	123024333	+	Intron	INS	-	T	T			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123024332_123024333insT	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ttttgaatgacttttttttttt	0.168													4	2	---	---	---	---	
CCNDBP1	23582	broad.mit.edu	37	15	43481303	43481304	+	Intron	INS	-	AAAA	AAAA			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43481303_43481304insAAAA	uc001zqv.2	+						CCNDBP1_uc001zqu.2_Intron|CCNDBP1_uc010bdc.2_Intron|CCNDBP1_uc010bdb.2_Intron|CCNDBP1_uc010udl.1_Intron|CCNDBP1_uc001zqw.2_Intron|CCNDBP1_uc001zqx.2_Intron|CCNDBP1_uc010bdd.2_Intron|CCNDBP1_uc001zqy.2_Intron	NM_012142	NP_036274	O95273	CCDB1_HUMAN	cyclin D-type binding-protein 1 isoform 1						cell cycle	cytoplasm|nucleus	protein binding			ovary(1)|kidney(1)	2		all_cancers(109;3.31e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.42e-07)		aaaaaaaaaagaaaaagaaaga	0.149													8	4	---	---	---	---	
GABPB1	2553	broad.mit.edu	37	15	50581976	50581977	+	Intron	INS	-	TTTTTT	TTTTTT	rs140176493	by1000genomes	TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50581976_50581977insTTTTTT	uc001zyb.2	-						GABPB1_uc001zya.2_Intron|GABPB1_uc010ufg.1_Intron|GABPB1_uc001zyc.2_Intron|GABPB1_uc001zyd.2_Intron|GABPB1_uc001zye.2_Intron|GABPB1_uc001zyf.2_Intron	NM_005254	NP_005245	Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta						positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)	1						tttcttttttcttttttaaata	0.129													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78675656	78675656	+	IGR	DEL	T	-	-	rs112849950		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78675656delT								CRABP1 (35084 upstream) : IREB2 (54862 downstream)																							ATAAGGAGAAttttttttttt	0.209													5	3	---	---	---	---	
SLCO3A1	28232	broad.mit.edu	37	15	92694019	92694020	+	Intron	INS	-	A	A			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92694019_92694020insA	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)			ACTTTAGGCAGAAAAAAAAAAA	0.337													4	2	---	---	---	---	
SLC5A11	115584	broad.mit.edu	37	16	24922487	24922488	+	Intron	INS	-	AA	AA			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24922487_24922488insAA	uc002dmu.2	+						SLC5A11_uc002dms.2_Intron|SLC5A11_uc010vcd.1_Intron|SLC5A11_uc002dmt.2_Intron|SLC5A11_uc010vce.1_Intron|SLC5A11_uc010bxt.2_Intron|SLC5A11_uc002dmv.2_Intron	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose						apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		gagactctctcaaaaaaaaaaa	0.134													10	5	---	---	---	---	
HEATR3	55027	broad.mit.edu	37	16	50128490	50128493	+	Intron	DEL	TTTG	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50128490_50128493delTTTG	uc002efw.2	+						HEATR3_uc002efx.2_Intron	NM_182922	NP_891552	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3								binding			ovary(1)|skin(1)	2						AGGGTTTTTTTTTGTTTGTTTGTT	0.304													9	6	---	---	---	---	
WWP2	11060	broad.mit.edu	37	16	69832384	69832384	+	Intron	DEL	T	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69832384delT	uc002exu.1	+						WWP2_uc002ext.2_Intron|WWP2_uc002exv.1_Intron	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase						entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						AGGTTAGGGATTTTTTTTTTT	0.279													4	5	---	---	---	---	
EFCAB5	374786	broad.mit.edu	37	17	28320513	28320513	+	Intron	DEL	A	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28320513delA	uc002het.2	+						EFCAB5_uc010wbi.1_Intron|EFCAB5_uc010wbj.1_Intron|EFCAB5_uc010wbk.1_Intron|EFCAB5_uc010csd.2_Intron|EFCAB5_uc010cse.2_Intron|EFCAB5_uc010csf.2_Intron	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5 isoform a								calcium ion binding			ovary(1)|skin(1)	2						TTTGAGCATTACCAAAAAAAA	0.353													4	2	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39914430	39914431	+	Intron	INS	-	T	T	rs150430167		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39914430_39914431insT	uc002hxq.2	-						JUP_uc010wfs.1_Intron|JUP_uc002hxr.2_Intron|JUP_uc002hxs.2_Intron	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		tttgttttttgttttttttttc	0.183													3	3	---	---	---	---	
TXNL1	9352	broad.mit.edu	37	18	54283363	54283363	+	Intron	DEL	A	-	-	rs35834292		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54283363delA	uc002lgg.2	-						TXNL1_uc010xdz.1_Intron|TXNL1_uc002lgh.2_Intron|TXNL1_uc002lgi.2_Intron|TXNL1_uc002lgj.1_Intron	NM_004786	NP_004777	O43396	TXNL1_HUMAN	thioredoxin-like 1						cell redox homeostasis|electron transport chain|glycerol ether metabolic process|transport	cytoplasm	electron carrier activity|protein disulfide oxidoreductase activity				0				READ - Rectum adenocarcinoma(59;0.193)|Colorectal(16;0.211)		actctgtctcaaaaaaaaaaa	0.100													4	3	---	---	---	---	
FBN3	84467	broad.mit.edu	37	19	8188250	8188250	+	Intron	DEL	G	-	-	rs10419582	by1000genomes	TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8188250delG	uc002mjf.2	-							NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						aaaaaaaaaagaagaagaaaa	0.239													12	6	---	---	---	---	
C19orf44	84167	broad.mit.edu	37	19	16625197	16625198	+	Intron	INS	-	A	A	rs76201706		TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16625197_16625198insA	uc002neh.1	+						MED26_uc002nee.2_Intron|C19orf44_uc002neg.2_Intron|C19orf44_uc010eai.1_Intron	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167												0						cctgtctccagaaaaaaaaaaa	0.282													5	3	---	---	---	---	
ZNF331	55422	broad.mit.edu	37	19	54079781	54079784	+	Intron	DEL	AGTT	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54079781_54079784delAGTT	uc002qbx.1	+						ZNF331_uc002qby.1_Intron|ZNF331_uc002qbz.1_Intron|ZNF331_uc002qca.1_Intron|ZNF331_uc010eqr.1_Intron|ZNF331_uc002qcb.1_Intron|ZNF331_uc002qcc.1_Intron|ZNF331_uc002qcd.1_Intron	NM_018555	NP_061025	Q9NQX6	ZN331_HUMAN	zinc finger protein 331						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)	6				GBM - Glioblastoma multiforme(134;0.00555)		ATGAATTCTCAGTTAGTATTGTAC	0.230			T	?	follicular thyroid adenoma								5	4	---	---	---	---	
COL6A2	1292	broad.mit.edu	37	21	47533759	47533759	+	Intron	DEL	C	-	-			TCGA-CJ-6027-01A-11D-1669-08	TCGA-CJ-6027-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47533759delC	uc002zia.1	+						COL6A2_uc002zhy.1_Intron|COL6A2_uc002zhz.1_Intron|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCTCACAGCACCCCATGTCTC	0.572													13	6	---	---	---	---	
