Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIAA1751	85452	broad.mit.edu	37	1	1919956	1919956	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1919956C>G	uc001aim.1	-	4	447	c.291G>C	c.(289-291)AAG>AAC	p.K97N	KIAA1751_uc009vkz.1_Missense_Mutation_p.K97N|KIAA1751_uc001ain.1_Missense_Mutation_p.K97N	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	97										pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CTCACCTCATCTTCTCAGTGA	0.587													36	56	---	---	---	---	PASS
MAD2L2	10459	broad.mit.edu	37	1	11736134	11736134	+	Silent	SNP	C	G	G			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11736134C>G	uc001asp.2	-	6	584	c.396G>C	c.(394-396)GTG>GTC	p.V132V	MAD2L2_uc009vnc.2_Silent_p.V132V|MAD2L2_uc001asq.3_Silent_p.V132V	NM_006341	NP_006332	Q9UI95	MD2L2_HUMAN	MAD2 homolog	132	Mediates interaction with REV1 and REV3L and homodimerization.|HORMA.				cell division|DNA damage response, signal transduction resulting in transcription|double-strand break repair|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of mitotic anaphase-promoting complex activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of transcription, DNA-dependent|regulation of cell growth|transcription, DNA-dependent	cytoplasm|nucleoplasm|spindle|zeta DNA polymerase complex	JUN kinase binding				0	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CGGCATCGCACACGCTGATCT	0.592								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					3	59	---	---	---	---	PASS
EPHA8	2046	broad.mit.edu	37	1	22913109	22913109	+	Silent	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22913109G>A	uc001bfx.1	+	4	1085	c.960G>A	c.(958-960)CCG>CCA	p.P320P	EPHA8_uc001bfw.2_Silent_p.P320P	NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	320	Extracellular (Potential).|Cys-rich.					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCCTGGACCCGCCGTCCTCAG	0.672													6	58	---	---	---	---	PASS
CFHR4	10877	broad.mit.edu	37	1	196883638	196883638	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196883638G>T	uc001gto.2	+	4	522	c.453G>T	c.(451-453)ATG>ATT	p.M151I	CFHR4_uc009wyy.2_Missense_Mutation_p.M397I|CFHR4_uc001gtp.2_Missense_Mutation_p.M398I	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	151	Sushi 3.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						TTTGTGATATGCCTGTTTTTG	0.368													24	47	---	---	---	---	PASS
SLC4A1AP	22950	broad.mit.edu	37	2	27907937	27907937	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27907937A>G	uc002rlk.3	+	10	2191	c.1909A>G	c.(1909-1911)ACT>GCT	p.T637A		NM_018158	NP_060628	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger),	637						cytoplasm|nucleus	double-stranded RNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)					ACTCCCTCCAACTCTAATGAG	0.289													4	125	---	---	---	---	PASS
BRE	9577	broad.mit.edu	37	2	28531155	28531155	+	Intron	SNP	A	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28531155A>C	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron|BRE_uc002rlx.2_Intron|uc002rly.2_RNA	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					TCCACACATCACCCACCTGCC	0.512													8	44	---	---	---	---	PASS
PPM1B	5495	broad.mit.edu	37	2	44436369	44436369	+	Silent	SNP	T	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44436369T>C	uc002rtt.2	+	3	1295	c.867T>C	c.(865-867)AGT>AGC	p.S289S	PPM1B_uc002rts.2_Silent_p.S289S|PPM1B_uc002rtu.2_Silent_p.S289S|PPM1B_uc002rtv.2_Silent_p.S2S|PPM1B_uc002rtw.2_Silent_p.S289S|PPM1B_uc002rtx.2_Silent_p.S289S	NM_002706	NP_002697	O75688	PPM1B_HUMAN	protein phosphatase 1B isoform 1	289					protein dephosphorylation	protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity			kidney(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				ATAACATGAGTATTGTACTAG	0.323													48	41	---	---	---	---	PASS
GLS	2744	broad.mit.edu	37	2	191792206	191792206	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191792206C>T	uc002usf.2	+	12	1687	c.1423C>T	c.(1423-1425)CAT>TAT	p.H475Y	GLS_uc002use.2_Missense_Mutation_p.H475Y|GLS_uc002usg.1_Missense_Mutation_p.H136Y|GLS_uc002ush.2_Missense_Mutation_p.H136Y|GLS_uc010zgi.1_Missense_Mutation_p.H46Y|GLS_uc010zgj.1_5'Flank	NM_014905	NP_055720	O94925	GLSK_HUMAN	glutaminase precursor	475					cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GTTTGCTTTCCATGTAAGTAA	0.363													27	57	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179501956	179501956	+	3'UTR	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179501956G>A	uc003fkh.2	+	21						NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13						ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TTGGCGAAAAGAAGCCATACG	0.358													8	113	---	---	---	---	PASS
LAP3	51056	broad.mit.edu	37	4	17609234	17609234	+	3'UTR	SNP	T	G	G			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17609234T>G	uc003gph.1	+	13						NM_015907	NP_056991	P28838	AMPL_HUMAN	leucine aminopeptidase 3						proteolysis	nucleus	aminopeptidase activity|magnesium ion binding|manganese ion binding|metalloexopeptidase activity|zinc ion binding				0						AAAAATGTCTTCACTCTGTCT	0.363													16	51	---	---	---	---	PASS
UGT2B10	7365	broad.mit.edu	37	4	69870669	69870669	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69870669C>A	uc011cao.1	-	9	1517	c.1381G>T	c.(1381-1383)GCT>TCT	p.A461S	UGT2B10_uc011can.1_Missense_Mutation_p.A377S			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;	498	Helical; (Potential).				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						GCCACACAGGCCAGCAGGAAC	0.448													12	130	---	---	---	---	PASS
NPNT	255743	broad.mit.edu	37	4	106848542	106848542	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106848542G>T	uc003hya.2	+	3	427	c.222G>T	c.(220-222)AAG>AAT	p.K74N	NPNT_uc011cfc.1_Missense_Mutation_p.K91N|NPNT_uc011cfd.1_Missense_Mutation_p.K74N|NPNT_uc011cfe.1_Missense_Mutation_p.K74N|NPNT_uc010ilt.1_Missense_Mutation_p.K74N|NPNT_uc011cff.1_Missense_Mutation_p.K74N|NPNT_uc010ilu.1_5'UTR	NM_001033047	NP_001028219	Q6UXI9	NPNT_HUMAN	nephronectin precursor	74	EGF-like 1.				cell differentiation	membrane	calcium ion binding			skin(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		GGCCAAACAAGTGCAAGTGTC	0.423													13	18	---	---	---	---	PASS
PDE5A	8654	broad.mit.edu	37	4	120548404	120548404	+	Intron	SNP	G	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120548404G>C	uc003idh.2	-						PDE5A_uc003idf.2_5'UTR|PDE5A_uc003idg.2_Intron|uc003idj.1_5'Flank	NM_001083	NP_001074	O76074	PDE5A_HUMAN	phosphodiesterase 5A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|zinc ion binding				0					Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Vardenafil(DB00862)	GCAACAACGCGCGCAGGTGAG	0.428													5	18	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	129015567	129015567	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129015567G>A	uc003kvb.1	+	17	2599	c.2599G>A	c.(2599-2601)GAG>AAG	p.E867K	ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	867	Spacer.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AGGCCTCTGGGAGAAGATCTC	0.433													42	146	---	---	---	---	PASS
KIF20A	10112	broad.mit.edu	37	5	137522079	137522079	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137522079C>T	uc003lcj.2	+	18	2810	c.2314C>T	c.(2314-2316)CGT>TGT	p.R772C	KIF20A_uc011cyo.1_Missense_Mutation_p.R754C	NM_005733	NP_005724	O95235	KI20A_HUMAN	kinesin family member 20A	772	Globular (Potential).				cytokinesis|M phase of mitotic cell cycle|microtubule-based movement|protein transport|vesicle-mediated transport	Golgi apparatus|microtubule|nucleoplasm	ATP binding|microtubule motor activity|protein binding|transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AGGAAAACTTCGTCAAGCCTT	0.473													27	76	---	---	---	---	PASS
PCDHA5	56143	broad.mit.edu	37	5	140201426	140201426	+	Silent	SNP	C	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140201426C>T	uc003lhl.2	+	1	66	c.66C>T	c.(64-66)TAC>TAT	p.Y22Y	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Silent_p.Y22Y|PCDHA5_uc003lhj.1_Silent_p.Y22Y	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5 isoform 1 precursor	22					homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)|breast(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTTGCCTACTGGAAGGCAG	0.577													43	122	---	---	---	---	PASS
PCDHB6	56130	broad.mit.edu	37	5	140531865	140531865	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140531865C>T	uc003lir.2	+	1	2027	c.2027C>T	c.(2026-2028)CCG>CTG	p.P676L	PCDHB6_uc011dah.1_Missense_Mutation_p.P540L	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	676	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGGCGGCCCCGGCCCAAGCC	0.682													9	253	---	---	---	---	PASS
PCDHB15	56121	broad.mit.edu	37	5	140625765	140625765	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140625765G>A	uc003lje.2	+	1	619	c.619G>A	c.(619-621)GAG>AAG	p.E207K		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	207	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGAGCAGGCCGAGCTCAGATT	0.577													21	59	---	---	---	---	PASS
PCDHGB5	56101	broad.mit.edu	37	5	140778135	140778135	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140778135G>T	uc003lkf.1	+	1	441	c.441G>T	c.(439-441)CAG>CAT	p.Q147H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Missense_Mutation_p.Q147H	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	protocadherin gamma subfamily B, 5 isoform 1	147	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTCTGCACAGCCTGGCACAA	0.393													41	124	---	---	---	---	PASS
MSX2	4488	broad.mit.edu	37	5	174156661	174156661	+	3'UTR	SNP	A	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174156661A>C	uc003mcy.2	+	2						NM_002449	NP_002440	P35548	MSX2_HUMAN	msh homeobox 2						cranial suture morphogenesis|negative regulation of transcription, DNA-dependent|osteoblast differentiation	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0196)|all_lung(126;0.0303)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CGAAGGCAGTACCAGCCAGTA	0.527													10	24	---	---	---	---	PASS
SLC34A1	6569	broad.mit.edu	37	5	176825447	176825447	+	3'UTR	SNP	T	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176825447T>C	uc003mgk.3	+	13						NM_003052	NP_003043	Q06495	NPT2A_HUMAN	solute carrier family 34 (sodium phosphate),						phosphate ion homeostasis|response to cadmium ion|response to lead ion|response to mercury ion|sodium ion transport	brush border membrane|integral to plasma membrane	protein binding|sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(1)	1	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			agagtgtcggtgtgtgtgcat	0.323													8	19	---	---	---	---	PASS
BTN2A3	54718	broad.mit.edu	37	6	26422353	26422353	+	Missense_Mutation	SNP	C	T	T	rs141013110		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26422353C>T	uc011dkl.1	+	1	37	c.7C>T	c.(7-9)CCA>TCA	p.P3S	BTN2A3_uc011dkm.1_RNA					RecName: Full=Butyrophilin subfamily 2 member A3; Flags: Precursor;												0						GCTCATGGAACCAGCTGCTGC	0.622													4	119	---	---	---	---	PASS
SRF	6722	broad.mit.edu	37	6	43146557	43146557	+	Silent	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43146557G>A	uc003oui.2	+	6	1843	c.1368G>A	c.(1366-1368)CAG>CAA	p.Q456Q	SRF_uc011dvf.1_Silent_p.Q252Q	NM_003131	NP_003122	P11831	SRF_HUMAN	serum response factor (c-fos serum response	456					angiogenesis involved in wound healing|cell migration involved in sprouting angiogenesis|cellular senescence|heart looping|muscle cell homeostasis|neuron development|positive regulation of cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription via serum response element binding|regulation of smooth muscle cell differentiation|response to cytokine stimulus|response to hormone stimulus|response to toxin|transcription from RNA polymerase II promoter|trophectodermal cell differentiation	endoplasmic reticulum	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|serum response element binding|transcription factor binding			ovary(1)|breast(1)|central_nervous_system(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.011)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			GCGTCCCCCAGGTGTTCCTGA	0.493													58	207	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75861721	75861721	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75861721G>T	uc003phs.2	-	20	4028	c.3862C>A	c.(3862-3864)CAG>AAG	p.Q1288K	COL12A1_uc003pht.2_Missense_Mutation_p.Q124K	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1288	VWFA 3.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						CTGAAGTTCTGTTGGCGAATG	0.433													39	121	---	---	---	---	PASS
RWDD2A	112611	broad.mit.edu	37	6	83904158	83904158	+	5'UTR	SNP	A	G	G			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83904158A>G	uc003pjx.3	+	2					PGM3_uc003pjv.2_5'Flank|PGM3_uc003pjw.2_5'Flank|PGM3_uc011dyz.1_5'Flank|RWDD2A_uc011dza.1_Intron	NM_033411	NP_219479	Q9UIY3	RWD2A_HUMAN	RWD domain containing 2A												0		all_cancers(76;2.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00217)		BRCA - Breast invasive adenocarcinoma(397;0.045)		AGGCAGGCTGATTGCGAGGCA	0.498													8	19	---	---	---	---	PASS
FAM184A	79632	broad.mit.edu	37	6	119297201	119297201	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119297201G>T	uc003pyj.2	-	12	2812	c.2464C>A	c.(2464-2466)CGC>AGC	p.R822S	FAM184A_uc003pyk.3_Missense_Mutation_p.R702S|FAM184A_uc003pyl.3_Missense_Mutation_p.R702S|FAM184A_uc003pyi.2_RNA	NM_024581	NP_078857	Q8NB25	F184A_HUMAN	hypothetical protein LOC79632 isoform 1	822										ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7						AGTTCTGAGCGCAAGGAAGCT	0.289													3	66	---	---	---	---	PASS
SHPRH	257218	broad.mit.edu	37	6	146273498	146273498	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146273498A>T	uc003qlf.2	-	3	1149	c.750T>A	c.(748-750)AAT>AAA	p.N250K	SHPRH_uc003qld.2_Missense_Mutation_p.N250K|SHPRH_uc003qle.2_Missense_Mutation_p.N250K|SHPRH_uc003qlg.1_5'UTR|SHPRH_uc003qlj.1_Missense_Mutation_p.N139K|SHPRH_uc003qlk.1_Missense_Mutation_p.N250K	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	250					DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GAATAATAGAATTGTGTAACT	0.328													7	30	---	---	---	---	PASS
BMPER	168667	broad.mit.edu	37	7	34085973	34085973	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34085973A>G	uc011kap.1	+	7	746	c.632A>G	c.(631-633)CAC>CGC	p.H211R		NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor	211	VWFC 3.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						TGTCCCCAGCACCTTAGTCAC	0.423													24	197	---	---	---	---	PASS
LRWD1	222229	broad.mit.edu	37	7	102106463	102106463	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102106463G>T	uc003uzn.2	+	2	418	c.280G>T	c.(280-282)GAG>TAG	p.E94*	ALKBH4_uc003uzl.2_5'Flank|ALKBH4_uc003uzm.2_5'Flank|LRWD1_uc003uzo.2_5'UTR	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain	94	LRR 4.				chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						CCCCAAGCTCGAGGAACTCAG	0.637													13	33	---	---	---	---	PASS
FOXP2	93986	broad.mit.edu	37	7	114269973	114269973	+	Silent	SNP	A	G	G	rs149757187		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114269973A>G	uc003vhb.2	+	5	884	c.510A>G	c.(508-510)CAA>CAG	p.Q170Q	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Silent_p.Q195Q|FOXP2_uc003vha.2_Silent_p.Q78Q|FOXP2_uc011kmu.1_Silent_p.Q187Q|FOXP2_uc011kmv.1_Silent_p.Q170Q|FOXP2_uc010ljz.1_Silent_p.Q78Q|FOXP2_uc003vgt.1_RNA|FOXP2_uc003vgv.1_Silent_p.Q170Q|FOXP2_uc003vgx.2_Silent_p.Q170Q|FOXP2_uc003vhd.2_Silent_p.Q170Q|FOXP2_uc003vhc.2_Silent_p.Q195Q	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	170	Gln-rich.				camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						agcagcagcaacaacaacaac	0.164													5	50	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147869391	147869391	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147869391G>A	uc003weu.1	+	18	3347	c.2831G>A	c.(2830-2832)GGG>GAG	p.G944E		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	944	Laminin G-like 3.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			AGGATGAATGGGGTGACACTT	0.542										HNSCC(39;0.1)			5	87	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106811085	106811085	+	Silent	SNP	C	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106811085C>A	uc003ymd.2	+	7	896	c.873C>A	c.(871-873)GCC>GCA	p.A291A	ZFPM2_uc011lhs.1_Silent_p.A22A|uc003yme.1_5'Flank	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	291					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AAGACAGTGCCCATCAGATTT	0.512													35	142	---	---	---	---	PASS
DNAJB5	25822	broad.mit.edu	37	9	34997035	34997035	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34997035T>C	uc003zvt.2	+	4	964	c.826T>C	c.(826-828)TGC>CGC	p.C276R	DNAJB5_uc003zvs.2_Missense_Mutation_p.C310R|DNAJB5_uc011los.1_Missense_Mutation_p.C348R	NM_012266	NP_036398	O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	276					protein folding|response to unfolded protein		heat shock protein binding|unfolded protein binding				0			LUSC - Lung squamous cell carcinoma(32;0.00575)			GCTGTGTGGCTGCACTGTGAA	0.552													60	247	---	---	---	---	PASS
GCNT1	2650	broad.mit.edu	37	9	79118095	79118095	+	Silent	SNP	G	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79118095G>T	uc010mpf.2	+	3	1139	c.798G>T	c.(796-798)CTG>CTT	p.L266L	GCNT1_uc010mpg.2_Silent_p.L266L|GCNT1_uc010mph.2_Silent_p.L266L|GCNT1_uc004akf.3_Silent_p.L266L|GCNT1_uc010mpi.2_Silent_p.L266L|GCNT1_uc004akh.3_Silent_p.L266L	NM_001490	NP_001481	Q02742	GCNT1_HUMAN	beta-1,3-galactosyl-O-glycosyl-glycoprotein	266	Lumenal (Potential).|Catalytic (By similarity).				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity				0						ATGGAAAGCTGACAAACACAG	0.468													38	84	---	---	---	---	PASS
C9orf103	414328	broad.mit.edu	37	9	86258688	86258688	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86258688T>C	uc004amu.1	+	5	571	c.557T>C	c.(556-558)ATG>ACG	p.M186T	C9orf103_uc004amt.1_Missense_Mutation_p.M140T|C9orf103_uc010mpv.1_Missense_Mutation_p.M140T	NM_001001551	NP_001001551	Q5T6J7	GNTK_HUMAN	gluconokinase-like protein	186					carbohydrate metabolic process	cytoplasm	ATP binding|gluconokinase activity|shikimate kinase activity				0						ACCCTAAAAATGAAATGACAA	0.408													18	45	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135202348	135202348	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135202348C>T	uc004cbk.2	-	10	4820	c.4637G>A	c.(4636-4638)GGC>GAC	p.G1546D	SETX_uc004cbj.2_Missense_Mutation_p.G1165D|SETX_uc010mzt.2_Missense_Mutation_p.G1165D	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	1546					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		ACACTTTGTGCCACTCAAAGA	0.373													4	104	---	---	---	---	PASS
GPRIN2	9721	broad.mit.edu	37	10	46999690	46999690	+	Silent	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46999690G>A	uc001jec.2	+	3	945	c.810G>A	c.(808-810)CTG>CTA	p.L270L	GPRIN2_uc010qfq.1_Silent_p.L33L	NM_014696	NP_055511	O60269	GRIN2_HUMAN	G protein-regulated inducer of neurite outgrowth	270											0						AGTCTGGGCTGCAGGCTCAGC	0.627													4	136	---	---	---	---	PASS
ANXA7	310	broad.mit.edu	37	10	75155821	75155821	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75155821G>A	uc001jtz.2	-	6	555	c.482C>T	c.(481-483)TCT>TTT	p.S161F	ANXA7_uc001jua.2_Intron|ANXA7_uc001jub.2_Intron|ANXA7_uc010qki.1_Intron|ANXA7_uc009xre.2_Intron|ANXA7_uc009xrf.1_Intron	NM_004034	NP_004025	P20073	ANXA7_HUMAN	annexin VII isoform 2	161							calcium ion binding|calcium-dependent phospholipid binding|calcium-dependent protein binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)					ATAATCCAAAGAAACAGGAGA	0.333													8	33	---	---	---	---	PASS
WAPAL	23063	broad.mit.edu	37	10	88259942	88259942	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88259942C>A	uc001kdo.2	-	3	1500	c.1058G>T	c.(1057-1059)GGA>GTA	p.G353V	WAPAL_uc001kdn.2_Missense_Mutation_p.G396V|WAPAL_uc009xsw.2_Missense_Mutation_p.G353V	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	353	Mediates interaction with the cohesin complex.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1						TCTAGTCCGTCCAACTGTCCC	0.448													25	107	---	---	---	---	PASS
GPR120	338557	broad.mit.edu	37	10	95347072	95347072	+	Silent	SNP	C	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95347072C>A	uc010qnt.1	+	4	896	c.840C>A	c.(838-840)CGC>CGA	p.R280R	GPR120_uc010qnu.1_Silent_p.R264R	NM_181745	NP_859529	Q5NUL3	O3FA1_HUMAN	G protein-coupled receptor 120	280	Cytoplasmic (Potential).				negative regulation of cytokine secretion|negative regulation of inflammatory response|regulation of glucose transport	integral to membrane|plasma membrane	fatty acid binding				0		Colorectal(252;0.122)				GGCTCTTCCGCACCCTCTTCC	0.557													4	141	---	---	---	---	PASS
TLL2	7093	broad.mit.edu	37	10	98182481	98182481	+	Silent	SNP	A	G	G			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98182481A>G	uc001kml.1	-	6	868	c.642T>C	c.(640-642)TGT>TGC	p.C214C	TLL2_uc009xvf.1_Silent_p.C162C	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor	214	Metalloprotease (By similarity).				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CATAGGAGCAACAGCTGGACA	0.562													3	98	---	---	---	---	PASS
OR9Q1	219956	broad.mit.edu	37	11	57947459	57947459	+	Silent	SNP	C	A	A	rs151328020		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57947459C>A	uc001nmj.2	+	3	859	c.543C>A	c.(541-543)CTC>CTA	p.L181L		NM_001005212	NP_001005212	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q,	181	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.222)				TCTGTGACCTCCCTCCTCTGT	0.473													4	86	---	---	---	---	PASS
CORO1B	57175	broad.mit.edu	37	11	67209168	67209168	+	Intron	SNP	G	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67209168G>T	uc001olj.1	-						CORO1B_uc009yrs.1_Intron|CORO1B_uc001olk.1_Intron|CORO1B_uc009yrt.1_Intron|CORO1B_uc009yru.1_Intron|CORO1B_uc001oll.1_Intron|CORO1B_uc010rps.1_Intron|CORO1B_uc009yrv.1_Missense_Mutation_p.H164N	NM_020441	NP_065174	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B						actin cytoskeleton organization	actin cytoskeleton|cytoplasm	actin filament binding			large_intestine(1)|ovary(1)	2			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			AGGGGTCCGTGGGGGGGGGGA	0.473													3	6	---	---	---	---	PASS
ALDH3B2	222	broad.mit.edu	37	11	67433825	67433825	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67433825T>C	uc001omr.2	-	5	638	c.199A>G	c.(199-201)AAG>GAG	p.K67E	ALDH3B2_uc001oms.2_Missense_Mutation_p.K67E|ALDH3B2_uc009ysa.1_Missense_Mutation_p.K67E	NM_000695	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3B2	67					alcohol metabolic process|cellular aldehyde metabolic process|lipid metabolic process		3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase			lung(1)|kidney(1)	2					NADH(DB00157)	GCCAGGACCTTCTCTGTGCCC	0.657													5	7	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92616485	92616485	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92616485A>C	uc001pdj.3	+	23	12880	c.12863A>C	c.(12862-12864)AAC>ACC	p.N4288T	FAT3_uc001pdi.3_Missense_Mutation_p.N728T	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	4288	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GTGGCCCCCAACCTCCCCGCC	0.657										TCGA Ovarian(4;0.039)			6	42	---	---	---	---	PASS
NCKAP5L	57701	broad.mit.edu	37	12	50197831	50197831	+	5'UTR	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50197831G>A	uc009zlk.2	-	3						NM_001037806	NP_001032895	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like											central_nervous_system(1)	1						CTGACATCTGGCCCTGGGAAC	0.592													29	66	---	---	---	---	PASS
SMUG1	23583	broad.mit.edu	37	12	54577492	54577492	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54577492T>C	uc001sff.1	-	3	362	c.233A>G	c.(232-234)GAA>GGA	p.E78G	SMUG1_uc001sfa.1_5'Flank|SMUG1_uc001sfe.1_Missense_Mutation_p.E78G|SMUG1_uc001sfg.1_Missense_Mutation_p.E78G|SMUG1_uc009znf.1_Missense_Mutation_p.E78G|SMUG1_uc001sfb.3_Missense_Mutation_p.E78G|SMUG1_uc001sfc.3_Missense_Mutation_p.E78G|SMUG1_uc001sfd.3_Missense_Mutation_p.E78G	NM_014311	NP_055126	Q53HV7	SMUG1_HUMAN	single-strand-selective monofunctional	78				Missing (in Ref. 3; BAC03670).	depyrimidination	nucleolus|nucleoplasm	DNA binding|protein binding|single-strand selective uracil DNA N-glycosylase activity				0						GAAGAGTACTTCCTTGGGGCC	0.582								BER_DNA_glycosylases					33	39	---	---	---	---	PASS
COL4A1	1282	broad.mit.edu	37	13	110830522	110830522	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110830522G>A	uc001vqw.3	-	32	2637	c.2515C>T	c.(2515-2517)CCG>TCG	p.P839S	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	839	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			TTAGGGCCCGGCATGTCCAGT	0.557													4	161	---	---	---	---	PASS
DHRS4L1	728635	broad.mit.edu	37	14	24517930	24517930	+	Silent	SNP	C	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24517930C>A	uc010alc.2	+	8	585	c.585C>A	c.(583-585)CTC>CTA	p.L195L	DHRS4L1_uc010tnu.1_RNA	NM_001082488	NP_001075957	P0CG22	DR4L1_HUMAN	dehydrogenase/reductase (SDR family) member 4	195							binding|oxidoreductase activity				0						TGCTGGGCCTCAACAAGACCT	0.483													4	175	---	---	---	---	PASS
COQ6	51004	broad.mit.edu	37	14	74420179	74420179	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74420179G>T	uc001xph.2	+	2	285	c.205G>T	c.(205-207)GAA>TAA	p.E69*	COQ6_uc001xpe.2_Silent_p.S13S|COQ6_uc001xpf.2_Silent_p.S13S|COQ6_uc010tuk.1_Nonsense_Mutation_p.E44*|COQ6_uc010tul.1_Silent_p.S33S|COQ6_uc010tum.1_Nonsense_Mutation_p.E69*|COQ6_uc010tun.1_Silent_p.S33S|COQ6_uc001xpg.2_Nonsense_Mutation_p.E69*	NM_182476	NP_872282	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 homolog isoform a	69					ubiquinone biosynthetic process	mitochondrion	flavin adenine dinucleotide binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen				0				BRCA - Breast invasive adenocarcinoma(234;0.00337)		CCTGTTGCTCGAAGCAGGTCC	0.383													25	47	---	---	---	---	PASS
ALDH6A1	4329	broad.mit.edu	37	14	74531621	74531621	+	Silent	SNP	C	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74531621C>A	uc001xpo.2	-	11	1506	c.1407G>T	c.(1405-1407)GTG>GTT	p.V469V	C14orf45_uc010tup.1_3'UTR|C14orf45_uc001xpm.1_Intron|ALDH6A1_uc010asa.2_Silent_p.V314V|ALDH6A1_uc010tuq.1_Silent_p.V456V	NM_005589	NP_005580	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6A1 precursor	469						mitochondrial matrix|nucleus	fatty-acyl-CoA binding|malonate-semialdehyde dehydrogenase (acetylating) activity|methylmalonate-semialdehyde dehydrogenase (acylating) activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00354)	NADH(DB00157)	CATTCACTCCCACCTAAAACA	0.448													6	28	---	---	---	---	PASS
TTC7B	145567	broad.mit.edu	37	14	91123577	91123577	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91123577G>A	uc001xyp.2	-	11	1404	c.1282C>T	c.(1282-1284)CCA>TCA	p.P428S	TTC7B_uc010ats.2_RNA	NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	428	TPR 4.						binding			ovary(2)	2		Melanoma(154;0.222)				GCATCGTCTGGCTTCAGGCGG	0.577													21	52	---	---	---	---	PASS
TM6SF1	53346	broad.mit.edu	37	15	83791521	83791521	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83791521C>G	uc002bjp.2	+	6	603	c.494C>G	c.(493-495)ACA>AGA	p.T165R	TM6SF1_uc010bmq.2_Missense_Mutation_p.T165R|TM6SF1_uc002bjq.2_Intron|TM6SF1_uc010bmr.2_Intron|TM6SF1_uc002bjr.2_Missense_Mutation_p.T17R	NM_023003	NP_075379	Q9BZW5	TM6S1_HUMAN	transmembrane 6 superfamily member 1 isoform 1	165						integral to membrane				ovary(1)	1						AAGTATGGAACACGAATTTGC	0.358													13	60	---	---	---	---	PASS
PRKCB	5579	broad.mit.edu	37	16	24046821	24046821	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24046821G>A	uc002dmd.2	+	5	679	c.482G>A	c.(481-483)CGC>CAC	p.R161H	PRKCB_uc002dme.2_Missense_Mutation_p.R161H	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	161					apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	CGCCGCGGCCGCATCTACATC	0.612													35	63	---	---	---	---	PASS
CES1	1066	broad.mit.edu	37	16	55860205	55860205	+	Missense_Mutation	SNP	C	T	T	rs5023782		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55860205C>T	uc002eim.2	-	3	368	c.260G>A	c.(259-261)TGC>TAC	p.C87Y	CES1_uc002eil.2_Missense_Mutation_p.C88Y|CES1_uc002ein.2_Missense_Mutation_p.C87Y	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor	87					response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	ATCTTGGGTGCACCTGGGGAG	0.502													30	440	---	---	---	---	PASS
COQ9	57017	broad.mit.edu	37	16	57486775	57486775	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57486775G>A	uc002elq.2	+	3	321	c.305G>A	c.(304-306)CGC>CAC	p.R102H	COQ9_uc002elp.1_Missense_Mutation_p.R102H|COQ9_uc010vhn.1_Missense_Mutation_p.R102H|COQ9_uc010vho.1_Missense_Mutation_p.R102H|COQ9_uc010vhp.1_Missense_Mutation_p.R102H|COQ9_uc002elr.2_Missense_Mutation_p.R102H	NM_020312	NP_064708	O75208	COQ9_HUMAN	coenzyme Q9 homolog precursor	102					ubiquinone biosynthetic process	mitochondrion				breast(1)	1						TTGCAGCACCGCATCCTGACG	0.602													5	176	---	---	---	---	PASS
RAB34	83871	broad.mit.edu	37	17	27041908	27041908	+	Silent	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27041908G>A	uc002hce.2	-	9	1239	c.615C>T	c.(613-615)GTC>GTT	p.V205V	RAB34_uc002hcg.2_Silent_p.V197V|RAB34_uc002hcf.2_Silent_p.V206V|RAB34_uc010was.1_Silent_p.V262V|RAB34_uc010wat.1_Silent_p.V254V|RAB34_uc002hch.2_Silent_p.V205V|RAB34_uc010wau.1_Silent_p.V183V|RAB34_uc010wav.1_Intron	NM_031934	NP_114140	Q9BZG1	RAB34_HUMAN	Ras-related protein RAB34 isoform 1	205					protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding				0	Lung NSC(42;0.00431)					AGAATTCTCGGACATTCTCAC	0.582													25	41	---	---	---	---	PASS
CACNA1G	8913	broad.mit.edu	37	17	48703992	48703992	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48703992C>A	uc002irk.1	+	38	7386	c.7014C>A	c.(7012-7014)AGC>AGA	p.S2338R	CACNA1G_uc002irj.1_Missense_Mutation_p.S2132R|CACNA1G_uc002irl.1_Missense_Mutation_p.S2222R|CACNA1G_uc002irm.1_Missense_Mutation_p.S2259R|CACNA1G_uc002irn.1_Missense_Mutation_p.S2204R|CACNA1G_uc002iro.1_Missense_Mutation_p.S2211R|CACNA1G_uc002irp.1_Missense_Mutation_p.S2293R|CACNA1G_uc002irq.1_Missense_Mutation_p.S2315R|CACNA1G_uc002irr.1_Missense_Mutation_p.S2245R|CACNA1G_uc002irs.1_Missense_Mutation_p.S2282R|CACNA1G_uc002irt.1_Missense_Mutation_p.S2227R|CACNA1G_uc002irv.1_Missense_Mutation_p.S2234R|CACNA1G_uc002irw.1_Missense_Mutation_p.S2267R|CACNA1G_uc002iru.1_Missense_Mutation_p.S2304R|CACNA1G_uc002irx.1_Missense_Mutation_p.S2079R|CACNA1G_uc002iry.1_Missense_Mutation_p.S2068R|CACNA1G_uc002irz.1_Missense_Mutation_p.S2151R|CACNA1G_uc002isa.1_Missense_Mutation_p.S2124R|CACNA1G_uc002isb.1_Missense_Mutation_p.S2165R|CACNA1G_uc002isc.1_Missense_Mutation_p.S2240R|CACNA1G_uc002isd.1_Missense_Mutation_p.S2133R|CACNA1G_uc002ise.1_Missense_Mutation_p.S2161R|CACNA1G_uc002isf.1_Missense_Mutation_p.S2188R|CACNA1G_uc002isg.1_Missense_Mutation_p.S2106R|CACNA1G_uc002ish.1_Missense_Mutation_p.S2113R|CACNA1G_uc002isi.1_Missense_Mutation_p.S2101R	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G	2338	Cytoplasmic (Potential).				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	CTCCGTCCAGCGACTCCAAGG	0.637											OREG0024569	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	28	---	---	---	---	PASS
ST8SIA5	29906	broad.mit.edu	37	18	44268797	44268797	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44268797C>T	uc002lcj.1	-	4	965	c.397G>A	c.(397-399)GAG>AAG	p.E133K	ST8SIA5_uc002lci.1_5'UTR|ST8SIA5_uc010xcy.1_Missense_Mutation_p.E169K|ST8SIA5_uc010xcz.1_Missense_Mutation_p.E102K	NM_013305	NP_037437	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide	133	Lumenal (Potential).				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane				upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						GTGTCCACCTCATACTTGAGC	0.602													44	46	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76753965	76753965	+	Silent	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76753965G>A	uc002lmt.2	+	2	1974	c.1974G>A	c.(1972-1974)ACG>ACA	p.T658T	SALL3_uc010dra.2_Silent_p.T265T	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	658					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGATGCAAACGTCGGAAACCT	0.642													6	17	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10090547	10090547	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10090547G>A	uc002mmq.1	-	37	2766	c.2680C>T	c.(2680-2682)CGA>TGA	p.R894*		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	894	Triple-helical region.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			TGCCCTGGTCGCCCATCTTTA	0.478													35	86	---	---	---	---	PASS
ZNF335	63925	broad.mit.edu	37	20	44586316	44586316	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44586316G>T	uc002xqw.2	-	17	2474	c.2351C>A	c.(2350-2352)GCT>GAT	p.A784D	ZNF335_uc002xqv.2_5'Flank|ZNF335_uc010zxk.1_Missense_Mutation_p.A629D	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	784					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				CGACTCCTCAGCTCCTGGGTG	0.622													14	26	---	---	---	---	PASS
KRTAP10-12	386685	broad.mit.edu	37	21	46117944	46117944	+	3'UTR	SNP	G	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46117944G>C	uc002zfw.1	+	1					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198699	NP_941972	P60413	KR10C_HUMAN	keratin associated protein 10-12							keratin filament					0						TCCCACTACTGGCCCCTCGGC	0.637													5	11	---	---	---	---	PASS
C21orf70	85395	broad.mit.edu	37	21	46363676	46363676	+	Silent	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46363676G>A	uc002zgl.2	+	2	225	c.207G>A	c.(205-207)CTG>CTA	p.L69L	C21orf70_uc002zgm.2_Silent_p.L69L	NM_058190	NP_478070	Q9NSI2	CU070_HUMAN	hypothetical protein LOC85395	69											0				Colorectal(79;0.248)		AGCTGGAGCTGGACGTGAGGA	0.582													34	60	---	---	---	---	PASS
SLC19A1	6573	broad.mit.edu	37	21	46951439	46951439	+	Silent	SNP	G	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46951439G>A	uc002zhl.1	-	3	932	c.813C>T	c.(811-813)TCC>TCT	p.S271S	SLC19A1_uc010gpy.1_Silent_p.S271S|SLC19A1_uc011aft.1_Silent_p.S231S|SLC19A1_uc002zhm.1_Silent_p.S271S|SLC19A1_uc010gpz.1_Silent_p.S150S	NM_194255	NP_919231	P41440	S19A1_HUMAN	solute carrier family 19 member 1	271	Helical; (Probable).				folic acid metabolic process	integral to plasma membrane|membrane fraction	folic acid binding|folic acid transporter activity|methotrexate transporter activity|reduced folate carrier activity				0				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)		CCCACCAGAGGGACCACAGGC	0.682													51	68	---	---	---	---	PASS
POM121L9P	29774	broad.mit.edu	37	22	24659734	24659734	+	RNA	SNP	T	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24659734T>C	uc002zzs.3	+	7		c.3466T>C			uc011ajp.1_5'Flank	NR_003714				Homo sapiens mRNA; cDNA DKFZp434P211 (from clone DKFZp434P211).												0						CTCTCTCCTGTGGGAGGGGGG	0.632													3	11	---	---	---	---	PASS
KDELR3	11015	broad.mit.edu	37	22	38877247	38877247	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38877247T>C	uc003avv.2	+	4	538	c.382T>C	c.(382-384)TCA>CCA	p.S128P	KDELR3_uc003avu.2_Missense_Mutation_p.S128P	NM_006855	NP_006846	O43731	ERD23_HUMAN	KDEL receptor 3 isoform a	128	Helical; (Potential).				protein retention in ER lumen|protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|integral to membrane	ER retention sequence binding|receptor activity			ovary(2)	2	Melanoma(58;0.0286)					CTATCTGGAATCAGTGGCTAT	0.473													119	232	---	---	---	---	PASS
CYP2D6	1565	broad.mit.edu	37	22	42522550	42522550	+	3'UTR	SNP	G	A	A	rs142105976	by1000genomes	TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42522550G>A	uc003bce.2	-	9					uc003bcd.1_Intron|CYP2D6_uc010gyu.2_3'UTR|CYP2D6_uc003bcf.2_3'UTR	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,								electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						TGGCTAGGGAGCAGGCTGGGG	0.582													3	53	---	---	---	---	PASS
ZXDA	7789	broad.mit.edu	37	X	57935560	57935560	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57935560T>C	uc004dve.2	-	1	1508	c.1295A>G	c.(1294-1296)GAC>GGC	p.D432G		NM_007156	NP_009087	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	432	C2H2-type 6.|Required for interaction with ZXDC.				positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						ACAAGCCTTGTCATATTGCTT	0.502													3	67	---	---	---	---	PASS
CLCNKB	1188	broad.mit.edu	37	1	16366357	16366357	+	Intron	DEL	C	-	-			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16366357delC	uc001axw.3	+						FAM131C_uc010obz.1_Intron	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CACGGGACAACCCCCACCCAC	0.622													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	32888256	32888257	+	IGR	INS	-	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32888256_32888257insA								BSDC1 (28194 upstream) : ZBTB8A (42401 downstream)																							ctccatctcagaaaaaaaaaaa	0.139													4	2	---	---	---	---	
FUBP1	8880	broad.mit.edu	37	1	78444764	78444765	+	5'UTR	INS	-	GGCCG	GGCCG	rs140681455	by1000genomes	TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78444764_78444765insGGCCG	uc001dii.2	-	1					FUBP1_uc001dih.3_RNA|FUBP1_uc010orm.1_5'UTR|DNAJB4_uc010orn.1_5'Flank	NM_003902	NP_003893	Q96AE4	FUBP1_HUMAN	far upstream element-binding protein						transcription from RNA polymerase II promoter	nucleus	protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			central_nervous_system(2)|lung(1)	3						AAGAAAATGGCGGCCGTCGAAG	0.525													4	2	---	---	---	---	
WDR26	80232	broad.mit.edu	37	1	224599406	224599407	+	Intron	INS	-	T	T	rs67168562		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224599406_224599407insT	uc001hop.3	-						WDR26_uc001hoq.3_Intron|WDR26_uc010pvh.1_5'Flank	NM_025160	NP_079436	Q9H7D7	WDR26_HUMAN	WD repeat domain 26 isoform a							cytoplasm|nucleus					0				GBM - Glioblastoma multiforme(131;0.0104)		ATTTGTAAATCttttttttttt	0.119													4	3	---	---	---	---	
RND3	390	broad.mit.edu	37	2	151343674	151343675	+	Intron	INS	-	T	T	rs72865945		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151343674_151343675insT	uc002txe.2	-						RND3_uc002txf.2_Intron|RND3_uc002txg.2_Intron|RND3_uc010zbv.1_Intron|RND3_uc010zbw.1_5'Flank	NM_005168	NP_005159	P61587	RND3_HUMAN	ras homolog gene family, member E precursor						actin cytoskeleton organization|cell adhesion|small GTPase mediated signal transduction	Golgi membrane	GTP binding|GTPase activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.106)		ttttttttttcttttttttttt	0.540													4	2	---	---	---	---	
ANKAR	150709	broad.mit.edu	37	2	190541861	190541861	+	Intron	DEL	G	-	-	rs56090484		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190541861delG	uc002uqw.1	+						ANKAR_uc002uqu.2_Intron|ANKAR_uc002uqv.1_Intron	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing							integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			ttttttttttggaacagagtc	0.124													3	4	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10191622	10191623	+	Frame_Shift_Ins	INS	-	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191622_10191623insA	uc003bvc.2	+	3	828_829	c.615_616insA	c.(613-618)CGCATTfs	p.R205fs	VHL_uc003bvd.2_Frame_Shift_Ins_p.R164fs	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	205_206					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.I206fs*10(2)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CACAGGAGCGCATTGCACATCA	0.465		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				16	16	---	---	---	---	
IRAK2	3656	broad.mit.edu	37	3	10283670	10283671	+	Intron	INS	-	A	A	rs73028497		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10283670_10283671insA	uc003bve.1	+							NM_001570	NP_001561	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2						activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8						aaaaaaaaaagaaaaaaAAAAA	0.144													3	5	---	---	---	---	
RNF13	11342	broad.mit.edu	37	3	149679001	149679001	+	3'UTR	DEL	T	-	-			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149679001delT	uc003exn.3	+	11					RNF13_uc003exp.3_3'UTR|RNF13_uc010hvh.2_3'UTR	NM_007282	NP_009213	O43567	RNF13_HUMAN	ring finger protein 13						protein autoubiquitination	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane|nuclear inner membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TTTTTTAGTATTCTACAGTTT	0.284													11	6	---	---	---	---	
SAMD7	344658	broad.mit.edu	37	3	169642738	169642738	+	Intron	DEL	T	-	-			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169642738delT	uc003fgd.2	+						SAMD7_uc003fge.2_Intron|SAMD7_uc011bpo.1_Intron	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7											skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			TGCTGGTTTGTTTTTTTTTTT	0.318													6	3	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	32000586	32000597	+	Intron	DEL	TTTGTTTTTGTT	-	-	rs71863988		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32000586_32000597delTTTGTTTTTGTT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CCTTAAGAAGtttgtttttgtttttgtttttg	0.222													3	3	---	---	---	---	
MXD3	83463	broad.mit.edu	37	5	176738937	176738952	+	5'UTR	DEL	CGCCCCGCCCCCGGGA	-	-			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176738937_176738952delCGCCCCGCCCCCGGGA	uc003mgb.2	-	1					MXD3_uc010jkk.2_5'UTR|MXD3_uc003mga.3_5'UTR|MXD3_uc003mgc.2_5'UTR	NM_031300	NP_112590	Q9BW11	MAD3_HUMAN	MAX dimerization protein 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0	all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACAggggcccgccccgcccccgggacgccccgccc	0.574													5	5	---	---	---	---	
ZNF394	84124	broad.mit.edu	37	7	99097021	99097022	+	Intron	INS	-	A	A			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99097021_99097022insA	uc003uqs.2	-						ZNF394_uc003uqt.2_Intron|ZNF394_uc003uqu.1_Intron	NM_032164	NP_115540	Q53GI3	ZN394_HUMAN	zinc finger protein 394						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					agaacaacaagaaaaaaaaaaa	0.168													3	3	---	---	---	---	
PNPLA8	50640	broad.mit.edu	37	7	108150621	108150622	+	Intron	INS	-	A	A	rs35880371		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108150621_108150622insA	uc003vff.1	-						PNPLA8_uc003vfg.1_Intron|PNPLA8_uc003vfh.1_Intron|PNPLA8_uc003vfi.1_Intron|PNPLA8_uc003vfj.1_Intron|PNPLA8_uc003vfk.1_Intron	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8						fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2						taaagtataataaaaaaaaaaa	0.203													4	2	---	---	---	---	
MSR1	4481	broad.mit.edu	37	8	16012445	16012446	+	Intron	DEL	AC	-	-			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16012445_16012446delAC	uc003wwz.2	-						MSR1_uc010lsu.2_Intron|MSR1_uc003wxa.2_Intron|MSR1_uc003wxb.2_Intron|MSR1_uc011kxz.1_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1						cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		gtgcgtgcatacacacacacac	0.257													8	4	---	---	---	---	
CNGB3	54714	broad.mit.edu	37	8	87640991	87640991	+	Intron	DEL	A	-	-			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87640991delA	uc003ydx.2	-						CNGB3_uc010maj.2_Intron	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3						signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						ATATTTCAGGAAAAAAAAAAA	0.284													7	4	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139774852	139774853	+	Intron	INS	-	A	A	rs149851445	by1000genomes	TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139774852_139774853insA	uc003yvd.2	-						COL22A1_uc011ljo.1_5'Flank	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			cacacacacacaACAGCCCTag	0.267										HNSCC(7;0.00092)			6	3	---	---	---	---	
PRKG1	5592	broad.mit.edu	37	10	52912754	52912754	+	Intron	DEL	G	-	-	rs75959880		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52912754delG	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TTTTTTTTTTGTTTTGCTGCC	0.333													4	2	---	---	---	---	
BTRC	8945	broad.mit.edu	37	10	103292507	103292508	+	Intron	INS	-	TGTGTG	TGTGTG			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103292507_103292508insTGTGTG	uc001kta.2	+						BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Intron	NM_033637	NP_378663	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing protein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CTGAAGCTATAtgtgtgtgtgt	0.317													4	2	---	---	---	---	
C11orf2	738	broad.mit.edu	37	11	64863970	64863970	+	Intron	DEL	G	-	-	rs111768307		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64863970delG	uc001ocr.1	+							NM_013265	NP_037397	Q9UID3	FFR_HUMAN	chromosome 11 open reading frame 2						lipid transport|protein transport	Golgi apparatus|integral to membrane					0						CACGGGGAGTGGGGGGGTGCG	0.647													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	16278002	16278005	+	IGR	DEL	CCTT	-	-			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16278002_16278005delCCTT								DERA (87688 upstream) : MGST1 (222071 downstream)																							tttcttcctcccttccttccttcc	0.191													4	2	---	---	---	---	
FAIM2	23017	broad.mit.edu	37	12	50291547	50291548	+	Intron	INS	-	C	C	rs144837790	by1000genomes	TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50291547_50291548insC	uc001rvj.1	-						FAIM2_uc001rvi.1_Intron|FAIM2_uc001rvk.1_Intron	NM_012306	NP_036438	Q9BWQ8	FAIM2_HUMAN	Fas apoptotic inhibitory molecule 2						anti-apoptosis|apoptosis	cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|ovary(1)|skin(1)	3						AGCCAAGCGCACCCCCCCCCAG	0.564													4	2	---	---	---	---	
SIP1	8487	broad.mit.edu	37	14	39597689	39597690	+	Intron	INS	-	T	T	rs149334273		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39597689_39597690insT	uc001wuq.2	+						SIP1_uc001wur.2_Intron|SIP1_uc001wus.2_Intron|SIP1_uc010amx.2_Intron	NM_003616	NP_003607	O14893	GEMI2_HUMAN	SMN-interacting protein 1 isoform alpha						ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	Cajal body|cytosol|spliceosomal complex	protein binding				0	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0121)		tttttcttttcttttttttttt	0.000													6	3	---	---	---	---	
INO80	54617	broad.mit.edu	37	15	41308143	41308143	+	Intron	DEL	A	-	-			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41308143delA	uc001zni.2	-						INO80_uc010ucu.1_Intron	NM_017553	NP_060023	Q9ULG1	INO80_HUMAN	INO80 complex homolog 1						cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4						actctgtctcaaaaaaaaaaa	0.149													6	3	---	---	---	---	
MYH1	4619	broad.mit.edu	37	17	10402593	10402594	+	Intron	INS	-	T	T			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10402593_10402594insT	uc002gmo.2	-						uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult							muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						GCATGGAGAAATTTGAGGCAGA	0.351													3	4	---	---	---	---	
CASC3	22794	broad.mit.edu	37	17	38323195	38323195	+	Intron	DEL	T	-	-			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38323195delT	uc010cwt.1	+						CASC3_uc010cws.1_3'UTR|CASC3_uc002hue.2_Intron	NM_007359	NP_031385	O15234	CASC3_HUMAN	metastatic lymph node 51						mRNA processing|mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|response to stress|RNA splicing	exon-exon junction complex|nuclear speck|perinuclear region of cytoplasm	identical protein binding|RNA binding|ubiquitin protein ligase binding			ovary(1)	1						AGATAAGGTCTTTTTtttttt	0.234													3	5	---	---	---	---	
ATP5SL	55101	broad.mit.edu	37	19	41938473	41938474	+	Intron	INS	-	GTGT	GTGT	rs149102482	by1000genomes	TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41938473_41938474insGTGT	uc002oqw.1	-						CYP2F1_uc010xvw.1_Intron|ATP5SL_uc002oqu.1_Intron|ATP5SL_uc002oqv.2_Intron|ATP5SL_uc010xwa.1_Intron|ATP5SL_uc002oqx.1_Intron|ATP5SL_uc002oqy.1_Intron|ATP5SL_uc002oqz.1_Intron|ATP5SL_uc002ora.1_3'UTR|ATP5SL_uc010xwb.1_3'UTR	NM_018035	NP_060505	Q9NW81	AT5SL_HUMAN	ATP5S-like											large_intestine(1)|breast(1)	2						ACAgtgtgtgcgtgtgtgtgtg	0.416													4	2	---	---	---	---	
ZNF335	63925	broad.mit.edu	37	20	44597959	44597959	+	Intron	DEL	G	-	-	rs144514871		TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44597959delG	uc002xqw.2	-						ZNF335_uc010zxk.1_Intron|ZNF335_uc002xqx.1_Intron|ZNF335_uc002xqy.2_5'Flank	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				ccatgagacaggggtgactgt	0.114													5	6	---	---	---	---	
TXNRD2	10587	broad.mit.edu	37	22	19919684	19919685	+	Intron	DEL	AA	-	-			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19919684_19919685delAA	uc011ahc.1	-						TXNRD2_uc002zql.1_Intron|TXNRD2_uc002zqm.1_Intron|TXNRD2_uc002zqn.1_Intron|TXNRD2_uc002zqo.1_Intron|TXNRD2_uc002zqp.1_Intron|TXNRD2_uc002zqr.1_Intron|TXNRD2_uc010grv.1_Intron|TXNRD2_uc002zqj.1_Intron|TXNRD2_uc002zqs.2_Intron	NM_006440	NP_006431	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2 precursor						cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)					actccgtctcaaaaaaaaaaaa	0.238													8	5	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467625	1467626	+	Intron	INS	-	TC	TC			TCGA-CZ-5984-01A-11D-1669-08	TCGA-CZ-5984-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467625_1467626insTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	tcctttctttttctttctttct	0.000													4	2	---	---	---	---	
