Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ATAD3B	83858	broad.mit.edu	37	1	1431162	1431162	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1431162C>T	uc001afv.2	+	16	2013	c.1912C>T	c.(1912-1914)CGG>TGG	p.R638W	ATAD3B_uc001afx.2_Missense_Mutation_p.R592W|ATAD3B_uc001afy.2_Missense_Mutation_p.R191W	NM_031921	NP_114127	Q5T9A4	ATD3B_HUMAN	AAA-ATPase  TOB3	638							ATP binding|nucleoside-triphosphatase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TGGTGGCGGTCGGCCGTTCTG	0.652													11	86	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19440528	19440528	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19440528C>T	uc001bbi.2	-	76	11243	c.11239G>A	c.(11239-11241)GAT>AAT	p.D3747N	UBR4_uc001bbj.1_Missense_Mutation_p.D162N	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	3747					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TACACTCGATCAGCTTTGTCC	0.498											OREG0013168	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	42	54	---	---	---	---	PASS
HTR6	3362	broad.mit.edu	37	1	19992308	19992308	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19992308C>T	uc001bcl.2	+	1	529	c.62C>T	c.(61-63)TCG>TTG	p.S21L		NM_000871	NP_000862	P50406	5HT6R_HUMAN	5-hydroxytryptamine (serotonin) receptor 6	21	Extracellular (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	histamine receptor activity|protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.81e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00117)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	Granisetron(DB00889)|Ondansetron(DB00904)|Sertindole(DB06144)	gggccgccgtcggccccgggg	0.453													10	11	---	---	---	---	PASS
ALPL	249	broad.mit.edu	37	1	21887195	21887195	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21887195C>T	uc001bet.2	+	3	395	c.138C>T	c.(136-138)CTC>CTT	p.L46L	ALPL_uc010odn.1_Missense_Mutation_p.S8L|ALPL_uc010odo.1_5'UTR|ALPL_uc010odp.1_Missense_Mutation_p.S8L|ALPL_uc001beu.3_Silent_p.L46L	NM_000478	NP_000469	P05186	PPBT_HUMAN	tissue-nonspecific alkaline phosphatase	46					response to vitamin D|skeletal system development	anchored to membrane|cytoplasm|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)	TTCAGAAGCTCAACACCAACG	0.547													25	41	---	---	---	---	PASS
EXTL1	2134	broad.mit.edu	37	1	26355755	26355755	+	Missense_Mutation	SNP	C	T	T	rs147835535		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26355755C>T	uc001blf.2	+	2	1718	c.851C>T	c.(850-852)TCG>TTG	p.S284L		NM_004455	NP_004446	Q92935	EXTL1_HUMAN	exostoses-like 1	284	Lumenal (Potential).				skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)		GAGGCTGCCTCGCGCTTCCTC	0.632													48	83	---	---	---	---	PASS
PTPRU	10076	broad.mit.edu	37	1	29585210	29585210	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29585210G>T	uc001bru.2	+	3	509	c.399G>T	c.(397-399)TGG>TGT	p.W133C	PTPRU_uc001brv.2_Missense_Mutation_p.W133C|PTPRU_uc001brw.2_Missense_Mutation_p.W133C|PTPRU_uc009vtq.2_Missense_Mutation_p.W133C|PTPRU_uc009vtr.2_Missense_Mutation_p.W133C	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	133	Extracellular (Potential).|MAM.				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		GTGCTGTGTGGAATATGACTG	0.627													66	95	---	---	---	---	PASS
PTPRU	10076	broad.mit.edu	37	1	29647244	29647244	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29647244G>A	uc001bru.2	+	27	3875	c.3765G>A	c.(3763-3765)CAG>CAA	p.Q1255Q	PTPRU_uc001brv.2_Silent_p.Q1251Q|PTPRU_uc001brw.2_Silent_p.Q1245Q|PTPRU_uc009vtq.2_Silent_p.Q1251Q|PTPRU_uc009vtr.2_Silent_p.Q1242Q|PTPRU_uc001brx.2_5'UTR	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1255	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		ACCCGCTGCAGAGCACCACGC	0.652													23	48	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34118047	34118047	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34118047C>T	uc001bxn.1	-	28	4371	c.4342G>A	c.(4342-4344)GAC>AAC	p.D1448N	CSMD2_uc001bxm.1_Missense_Mutation_p.D1488N|CSMD2_uc001bxo.1_Missense_Mutation_p.D361N	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1448	CUB 9.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCTGTCAGGTCTCCCCCGCAG	0.552													37	60	---	---	---	---	PASS
CSF3R	1441	broad.mit.edu	37	1	36931785	36931785	+	3'UTR	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36931785C>T	uc001caw.1	-	17					MRPS15_uc001cas.2_5'Flank|CSF3R_uc001cat.1_3'UTR|CSF3R_uc009vvc.1_3'UTR|CSF3R_uc001cau.1_3'UTR|CSF3R_uc001cav.1_Missense_Mutation_p.R755Q|CSF3R_uc001cax.1_3'UTR|CSF3R_uc001cay.1_3'UTR	NM_000760	NP_000751	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor isoform a						cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity			central_nervous_system(2)|ovary(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GTATGCAGATCGCCTGGGAGG	0.502													24	31	---	---	---	---	PASS
ZCCHC11	23318	broad.mit.edu	37	1	52991942	52991942	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52991942G>C	uc001ctx.2	-	2	245	c.11C>G	c.(10-12)TCT>TGT	p.S4C	ZCCHC11_uc001cty.2_Missense_Mutation_p.S4C|ZCCHC11_uc001ctz.2_Missense_Mutation_p.S4C|ZCCHC11_uc009vze.1_Missense_Mutation_p.S4C|ZCCHC11_uc009vzf.1_Intron|ZCCHC11_uc001cub.2_Missense_Mutation_p.S4C|ZCCHC11_uc001cuc.2_RNA|ZCCHC11_uc001cud.2_Missense_Mutation_p.S4C	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform	4					miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						TAAGGTTTTAGACTCTTCCAT	0.313													27	30	---	---	---	---	PASS
ACOT11	26027	broad.mit.edu	37	1	55050433	55050433	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55050433G>T	uc001cxm.1	+	2	221	c.139G>T	c.(139-141)GTG>TTG	p.V47L	ACOT11_uc001cxj.1_5'UTR|ACOT11_uc001cxk.2_Missense_Mutation_p.V13L|ACOT11_uc001cxl.1_Missense_Mutation_p.V47L	NM_015547	NP_056362	Q8WXI4	ACO11_HUMAN	thioesterase, adipose associated isoform BFIT1	47	Acyl coenzyme A hydrolase 1.				fatty acid metabolic process|intracellular signal transduction|response to cold		acyl-CoA thioesterase activity|carboxylesterase activity			central_nervous_system(1)	1						CCCCACGGAGGTGCAGATGAG	0.632													8	79	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91781509	91781509	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91781509C>T	uc001doa.3	-	28	3103	c.3003G>A	c.(3001-3003)ACG>ACA	p.T1001T	HFM1_uc009wdb.2_RNA|HFM1_uc010osu.1_Silent_p.T680T|HFM1_uc001dob.3_Silent_p.T189T|HFM1_uc010osv.1_Silent_p.T685T	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	1001	SEC63.						ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TTTCTGCCGTCGTATCACTAT	0.313													22	35	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113616220	113616220	+	Silent	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113616220G>T	uc001edf.1	+	1	390	c.192G>T	c.(190-192)CCG>CCT	p.P64P	LRIG2_uc009wgn.1_5'UTR|uc001ede.1_5'Flank	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	64	LRRNT.|Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TGCCCGCACCGAGCTGGAGGG	0.672											OREG0013684	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	66	96	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113661920	113661920	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113661920C>T	uc001edf.1	+	17	2944	c.2746C>T	c.(2746-2748)CGA>TGA	p.R916*	LRIG2_uc009wgn.1_Nonsense_Mutation_p.R813*	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	916	Cytoplasmic (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CTCCAGGACCCGAGAATACTG	0.423													12	172	---	---	---	---	PASS
TTF2	8458	broad.mit.edu	37	1	117632775	117632775	+	Missense_Mutation	SNP	A	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117632775A>G	uc001egy.2	+	14	2461	c.2441A>G	c.(2440-2442)AAG>AGG	p.K814R		NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase	814					mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		ATTTTAACCAAGAGCCTTTTG	0.478													4	206	---	---	---	---	PASS
WARS2	10352	broad.mit.edu	37	1	119575726	119575726	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119575726C>T	uc001ehn.2	-	6	919	c.891G>A	c.(889-891)ATG>ATA	p.M297I	WARS2_uc010oxf.1_Missense_Mutation_p.M203I|WARS2_uc001ehm.2_3'UTR|WARS2_uc010oxg.1_Missense_Mutation_p.M240I|WARS2_uc010oxh.1_3'UTR	NM_015836	NP_056651	Q9UGM6	SYWM_HUMAN	mitochondrial tryptophanyl tRNA synthetase 2	297					tryptophanyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|tryptophan-tRNA ligase activity				0	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)		Lung(183;0.0629)	L-Tryptophan(DB00150)	GAGCAGTGTTCATGCCCGCGC	0.592													64	92	---	---	---	---	PASS
HSD3B1	3283	broad.mit.edu	37	1	120057214	120057214	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120057214G>A	uc001ehv.1	+	4	1213	c.1068G>A	c.(1066-1068)TGG>TGA	p.W356*	HSD3B1_uc001ehw.2_Nonsense_Mutation_p.W358*	NM_000862	NP_000853	P14060	3BHS1_HUMAN	3 beta-hydroxysteroid dehydrogenase 1	356					androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	NADH(DB00157)|Trilostane(DB01108)	CGGTGGAGTGGGTTGGTTCCC	0.493													7	34	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144856874	144856874	+	Missense_Mutation	SNP	A	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144856874A>C	uc001elw.3	-	40	6902	c.6611T>G	c.(6610-6612)ATA>AGA	p.I2204R	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.I2098R|PDE4DIP_uc001elv.3_Missense_Mutation_p.I1211R	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	2204					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAGAGACACTATCTTTTTGAC	0.522			T	PDGFRB	MPD								11	49	---	---	---	---	PASS
ANKRD34A	284615	broad.mit.edu	37	1	145474701	145474701	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145474701C>T	uc001enq.1	+	4	2666	c.1373C>T	c.(1372-1374)GCG>GTG	p.A458V	NBPF10_uc001emp.3_Intron|LIX1L_uc001enr.2_5'Flank	NM_001039888	NP_001034977	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34	458	Pro-rich.										0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TATGCCGGGGCGCCAGGCTCT	0.652													22	28	---	---	---	---	PASS
SLC27A3	11000	broad.mit.edu	37	1	153751662	153751662	+	Silent	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153751662G>C	uc001fcz.2	+	8	1925	c.1860G>C	c.(1858-1860)GTG>GTC	p.V620V	SLC27A3_uc009won.2_RNA	NM_024330	NP_077306	Q5K4L6	S27A3_HUMAN	solute carrier family 27 member 3	620					fatty acid metabolic process	integral to membrane|mitochondrial membrane	ligase activity|nucleotide binding			ovary(1)	1	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TTCAGGAGGTGAACGTCTATG	0.587													125	149	---	---	---	---	PASS
ATP8B2	57198	broad.mit.edu	37	1	154321509	154321509	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154321509C>A	uc001fex.2	+	28	3587	c.3587C>A	c.(3586-3588)TCC>TAC	p.S1196Y		NM_020452	NP_065185	P98198	AT8B2_HUMAN	ATPase, class I, type 8B, member 2 isoform a	1182	Cytoplasmic (Potential).				ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CGCTCCAGCTCCAGCTGGATT	0.622													4	50	---	---	---	---	PASS
PEAR1	375033	broad.mit.edu	37	1	156877498	156877498	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156877498C>T	uc001fqj.1	+	7	857	c.741C>T	c.(739-741)TCC>TCT	p.S247S	PEAR1_uc009wsl.1_Silent_p.S48S|PEAR1_uc001fqk.1_5'UTR	NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	247	EGF-like 2.					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CACAGGGCTCCTGCAGCTGCC	0.617													36	256	---	---	---	---	PASS
GPR161	23432	broad.mit.edu	37	1	168059878	168059878	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168059878C>T	uc001gfc.2	-	6	1442	c.1128G>A	c.(1126-1128)GCG>GCA	p.A376A	GPR161_uc001gfb.2_Silent_p.A244A|GPR161_uc010pll.1_Silent_p.A286A|GPR161_uc010plm.1_Silent_p.A262A|GPR161_uc009wvo.2_Silent_p.A393A|GPR161_uc001gfd.2_Silent_p.A376A|GPR161_uc010pln.1_Silent_p.A396A|GPR161_uc001gfe.1_Silent_p.A376A	NM_153832	NP_722561	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161 isoform 2	376	Cytoplasmic (Potential).				multicellular organismal development	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_hematologic(923;0.215)					CTGCCATGAGCGCAGTGAGGT	0.597													19	26	---	---	---	---	PASS
C1orf112	55732	broad.mit.edu	37	1	169798416	169798416	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169798416C>T	uc001ggp.2	+	14	1450	c.1140C>T	c.(1138-1140)CTC>CTT	p.L380L	C1orf112_uc001ggj.2_RNA|C1orf112_uc001ggq.2_Silent_p.L380L|C1orf112_uc009wvt.2_Silent_p.L57L|C1orf112_uc010plu.1_Missense_Mutation_p.S308L|C1orf112_uc009wvu.1_Silent_p.L256L|C1orf112_uc001ggr.2_Silent_p.L245L|C1orf112_uc010plv.1_Silent_p.L322L	NM_018186	NP_060656	Q9NSG2	CA112_HUMAN	hypothetical protein LOC55732	380											0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TATCTCTACTCAAAGCCGTTT	0.368													34	48	---	---	---	---	PASS
FMO3	2328	broad.mit.edu	37	1	171080030	171080030	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171080030G>A	uc001ghi.2	+	6	830	c.719G>A	c.(718-720)GGA>GAA	p.G240E	FMO3_uc001ghh.2_Missense_Mutation_p.G240E|FMO3_uc010pmb.1_Missense_Mutation_p.G220E|FMO3_uc010pmc.1_Missense_Mutation_p.G177E	NM_001002294	NP_001002294	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	240					xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ACTCGATTTGGAACCTTCCTC	0.468													85	139	---	---	---	---	PASS
FMO3	2328	broad.mit.edu	37	1	171085395	171085395	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171085395G>C	uc001ghi.2	+	8	1342	c.1231G>C	c.(1231-1233)GAG>CAG	p.E411Q	FMO3_uc001ghh.2_Missense_Mutation_p.E411Q|FMO3_uc010pmb.1_Missense_Mutation_p.E391Q|FMO3_uc010pmc.1_Missense_Mutation_p.E348Q	NM_001002294	NP_001002294	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	411					xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TGATATTAATGAGAAAATGGA	0.358													62	68	---	---	---	---	PASS
KIF21B	23046	broad.mit.edu	37	1	200959778	200959778	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200959778G>A	uc001gvs.1	-	19	3078	c.2761C>T	c.(2761-2763)CGA>TGA	p.R921*	KIF21B_uc001gvr.1_Nonsense_Mutation_p.R921*|KIF21B_uc009wzl.1_Nonsense_Mutation_p.R921*|KIF21B_uc010ppn.1_Nonsense_Mutation_p.R921*	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	921					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						ATGATCCGTCGCTCCAGGGAC	0.562													29	47	---	---	---	---	PASS
LMOD1	25802	broad.mit.edu	37	1	201915418	201915418	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201915418G>A	uc001gxb.2	-	1	299	c.51C>T	c.(49-51)ATC>ATT	p.I17I	LMOD1_uc010ppu.1_Silent_p.I17I	NM_012134	NP_036266	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	17					muscle contraction	cytoskeleton|cytosol|membrane fraction	tropomyosin binding			ovary(1)|pancreas(1)|skin(1)	3						GCAGGCTGTCGATGTCGGGGT	0.622													24	27	---	---	---	---	PASS
CR2	1380	broad.mit.edu	37	1	207644250	207644250	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207644250C>T	uc001hfw.2	+	7	1485	c.1391C>T	c.(1390-1392)CCC>CTC	p.P464L	CR2_uc001hfv.2_Missense_Mutation_p.P464L|CR2_uc009xch.2_Missense_Mutation_p.P464L|CR2_uc009xci.1_5'Flank	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	464	Sushi 7.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						CCCCCTGTACCCCAATGCAAA	0.448													11	74	---	---	---	---	PASS
MIR205	406988	broad.mit.edu	37	1	209605512	209605512	+	RNA	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209605512C>T	hsa-mir-205|MI0000285	+			c.35C>T			LOC642587_uc009xcn.2_Intron|LOC642587_uc010psk.1_RNA																	0						CTTCTCTTGTCCTTCATTCCA	0.463													21	35	---	---	---	---	PASS
RPS6KC1	26750	broad.mit.edu	37	1	213415398	213415398	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213415398C>T	uc010ptr.1	+	11	2738	c.2579C>T	c.(2578-2580)TCT>TTT	p.S860F	RPS6KC1_uc001hkd.2_Missense_Mutation_p.S848F|RPS6KC1_uc010pts.1_Missense_Mutation_p.S648F|RPS6KC1_uc010ptt.1_Missense_Mutation_p.S648F|RPS6KC1_uc010ptu.1_Missense_Mutation_p.S679F|RPS6KC1_uc010ptv.1_Missense_Mutation_p.S395F|RPS6KC1_uc001hke.2_Missense_Mutation_p.S679F	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	860	Protein kinase 2.				cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		GAACCAACTTCTTTATTCCAG	0.363													49	92	---	---	---	---	PASS
PROX1	5629	broad.mit.edu	37	1	214178591	214178591	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214178591G>A	uc001hkh.2	+	3	2081	c.1809G>A	c.(1807-1809)CTG>CTA	p.L603L		NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	603	Prospero-type homeobox.				aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CCAATATGCTGAAGACCTACT	0.383													32	47	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228437684	228437684	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228437684C>A	uc009xez.1	+	14	4096	c.4052C>A	c.(4051-4053)GCA>GAA	p.A1351E	OBSCN_uc001hsn.2_Missense_Mutation_p.A1351E	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	1351	Ig-like 14.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GCGGTGTTTGCAAAGGAGCAG	0.647													15	108	---	---	---	---	PASS
TARBP1	6894	broad.mit.edu	37	1	234528184	234528184	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234528184C>T	uc001hwd.2	-	29	4675	c.4675G>A	c.(4675-4677)GAG>AAG	p.E1559K		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	1559					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AGAGATTTCTCAGGAAAGCAA	0.383													84	134	---	---	---	---	PASS
OR2G3	81469	broad.mit.edu	37	1	247769064	247769064	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247769064G>A	uc010pyz.1	+	1	177	c.177G>A	c.(175-177)ATG>ATA	p.M59I		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	59	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ATACCCCAATGTACTTTTTTC	0.423													14	412	---	---	---	---	PASS
OR2AK2	391191	broad.mit.edu	37	1	248129125	248129125	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248129125G>T	uc010pzd.1	+	1	492	c.492G>T	c.(490-492)TGG>TGT	p.W164C	OR2L13_uc001ids.2_Intron	NM_001004491	NP_001004491	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK,	164	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CATGTGCATGGGCCAGTGGTT	0.413													112	168	---	---	---	---	PASS
NCOA1	8648	broad.mit.edu	37	2	24981004	24981004	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24981004G>T	uc002rfk.2	+	19	4302	c.4044G>T	c.(4042-4044)ATG>ATT	p.M1348I	NCOA1_uc010eye.2_Missense_Mutation_p.M1348I|NCOA1_uc002rfi.2_Missense_Mutation_p.M1197I|NCOA1_uc002rfj.2_Missense_Mutation_p.M1348I|NCOA1_uc002rfl.2_Missense_Mutation_p.M1348I|NCOA1_uc010eyf.2_Missense_Mutation_p.M241I	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1	1348									PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCCAGGAATGAACACTGTGT	0.483			T	PAX3	alveolar rhadomyosarcoma								25	50	---	---	---	---	PASS
AGBL5	60509	broad.mit.edu	37	2	27278619	27278619	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27278619C>G	uc002rie.2	+	7	1195	c.978C>G	c.(976-978)ATC>ATG	p.I326M	AGBL5_uc002ric.2_Missense_Mutation_p.I326M|AGBL5_uc002rid.2_Missense_Mutation_p.I326M|AGBL5_uc002rif.2_RNA	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1	326					protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCCGGCCATCTATGGGGCCA	0.552													41	58	---	---	---	---	PASS
EHBP1	23301	broad.mit.edu	37	2	63058184	63058184	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63058184G>C	uc002sby.2	+	7	1007	c.525G>C	c.(523-525)TTG>TTC	p.L175F	EHBP1_uc010fcp.2_Missense_Mutation_p.L175F|EHBP1_uc002sbx.2_Missense_Mutation_p.L175F|EHBP1_uc002sbz.2_Missense_Mutation_p.L175F|EHBP1_uc002scb.2_Missense_Mutation_p.L175F	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1	175						cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TGGCTAGTTTGATGAGTATGA	0.343									Hereditary_Prostate_Cancer				47	79	---	---	---	---	PASS
EHBP1	23301	broad.mit.edu	37	2	63058260	63058260	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63058260G>C	uc002sby.2	+	7	1083	c.601G>C	c.(601-603)GTG>CTG	p.V201L	EHBP1_uc010fcp.2_Missense_Mutation_p.V201L|EHBP1_uc002sbx.2_Missense_Mutation_p.V201L|EHBP1_uc002sbz.2_Missense_Mutation_p.V201L|EHBP1_uc002scb.2_Missense_Mutation_p.V201L	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1	201	Potential.					cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TGAGAACAGAGTGAACCAAGA	0.343									Hereditary_Prostate_Cancer				23	37	---	---	---	---	PASS
TET3	200424	broad.mit.edu	37	2	74327961	74327961	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74327961C>T	uc002skb.3	+	9	3641	c.3641C>T	c.(3640-3642)GCC>GTC	p.A1214V		NM_144993	NP_659430	O43151	TET3_HUMAN	tet oncogene family member 3	1214							metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						CCCACAGACGCCCACCACCCC	0.652													5	12	---	---	---	---	PASS
CCDC93	54520	broad.mit.edu	37	2	118709951	118709951	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118709951C>T	uc002tlj.2	-	13	1192	c.1066G>A	c.(1066-1068)GAG>AAG	p.E356K	CCDC93_uc010fld.1_Missense_Mutation_p.E356K	NM_019044	NP_061917	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	356	Potential.									large_intestine(1)|ovary(1)	2						CTGCTCACCTCTGTCAGCGTT	0.408											OREG0003818	type=REGULATORY REGION|Gene=AK001858|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	42	58	---	---	---	---	PASS
MARCO	8685	broad.mit.edu	37	2	119739237	119739237	+	Intron	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119739237G>C	uc002tln.1	+						MARCO_uc010yyf.1_Intron	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure						cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity			ovary(3)|skin(2)|central_nervous_system(1)	6						ATCAAGGTAAGAACTACAGGA	0.448													45	70	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128392713	128392713	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128392713C>T	uc002top.2	+	42	5707	c.5654C>T	c.(5653-5655)CCC>CTC	p.P1885L	MYO7B_uc002tos.1_5'UTR|MYO7B_uc002tot.2_5'UTR	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	1885	FERM 2.|MyTH4 3.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GTGACGCTCCCCTACCAGGTG	0.607													3	17	---	---	---	---	PASS
TANC1	85461	broad.mit.edu	37	2	160031616	160031616	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160031616G>A	uc002uag.2	+	12	1930	c.1656G>A	c.(1654-1656)CTG>CTA	p.L552L	TANC1_uc010fol.1_Silent_p.L446L|TANC1_uc010zcm.1_Silent_p.L544L|TANC1_uc010fom.1_Silent_p.L358L|TANC1_uc002uai.1_5'Flank	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	552						cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						AGAGCATGCTGAGCCTCCGAT	0.577													76	92	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179586864	179586864	+	Intron	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179586864G>C	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTGGGTTCTGGAGGATGAGA	0.373													4	219	---	---	---	---	PASS
STK17B	9262	broad.mit.edu	37	2	197028073	197028073	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197028073G>A	uc002utk.2	-	2	359	c.35C>T	c.(34-36)TCA>TTA	p.S12L	STK17B_uc010fsh.2_Missense_Mutation_p.S12L	NM_004226	NP_004217	O94768	ST17B_HUMAN	serine/threonine kinase 17B	12					apoptosis|induction of apoptosis|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity			lung(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.141)			TAGTAGGCCTGAAATACTTCG	0.343													33	56	---	---	---	---	PASS
CDK15	65061	broad.mit.edu	37	2	202700390	202700390	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202700390C>T	uc002uyt.2	+	8	804	c.755C>T	c.(754-756)CCC>CTC	p.P252L	CDK15_uc010ftm.2_Missense_Mutation_p.P117L|CDK15_uc002uys.2_Missense_Mutation_p.P201L|CDK15_uc010ftn.1_Missense_Mutation_p.P201L|CDK15_uc010fto.1_Missense_Mutation_p.P231L	NM_139158	NP_631897	Q96Q40	CDK15_HUMAN	PFTAIRE protein kinase 2	252	Protein kinase.						ATP binding|cyclin-dependent protein kinase activity|metal ion binding|protein binding			breast(2)|ovary(1)|lung(1)|kidney(1)	5					Adenosine triphosphate(DB00171)	AAGTCCATTCCCAGCCAGACA	0.527													14	54	---	---	---	---	PASS
STK36	27148	broad.mit.edu	37	2	219545378	219545378	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219545378G>A	uc002viu.2	+	10	1455	c.1189G>A	c.(1189-1191)GAG>AAG	p.E397K	STK36_uc002viv.2_Missense_Mutation_p.E397K	NM_015690	NP_056505	Q9NRP7	STK36_HUMAN	serine/threonine kinase 36	397					cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding			ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		GGAGAGGCCAGAGGTGCTGGG	0.542													10	20	---	---	---	---	PASS
CUL3	8452	broad.mit.edu	37	2	225376190	225376190	+	Nonsense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225376190G>C	uc002vny.2	-	6	1148	c.764C>G	c.(763-765)TCA>TGA	p.S255*	CUL3_uc010zls.1_Nonsense_Mutation_p.S189*|CUL3_uc010fwy.1_Nonsense_Mutation_p.S261*	NM_003590	NP_003581	Q13618	CUL3_HUMAN	cullin 3	255					cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TTCTTCCGTTGATTTGTCAAG	0.353													94	163	---	---	---	---	PASS
TSEN2	80746	broad.mit.edu	37	3	12545158	12545158	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12545158C>T	uc003bxc.2	+	5	1093	c.706C>T	c.(706-708)CAT>TAT	p.H236Y	TSEN2_uc003bwy.2_Missense_Mutation_p.H236Y|TSEN2_uc003bwz.2_Missense_Mutation_p.H177Y|TSEN2_uc003bxa.2_Missense_Mutation_p.H236Y|TSEN2_uc011auq.1_Missense_Mutation_p.H236Y|TSEN2_uc003bxb.2_Missense_Mutation_p.H236Y|TSEN2_uc011aur.1_Missense_Mutation_p.H145Y	NM_025265	NP_079541	Q8NCE0	SEN2_HUMAN	tRNA-intron nuclease 2 isoform 1	236					mRNA processing|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|nucleolus|tRNA-intron endonuclease complex	nucleic acid binding|tRNA-intron endonuclease activity			central_nervous_system(1)	1						TGGCCTTCATCATGAAGACGG	0.577													18	14	---	---	---	---	PASS
TMEM43	79188	broad.mit.edu	37	3	14170986	14170986	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14170986G>A	uc003byk.2	+	2	341	c.87G>A	c.(85-87)CTG>CTA	p.L29L	TMEM43_uc003byl.1_5'Flank	NM_024334	NP_077310	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	29	Nuclear (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|nuclear inner membrane				ovary(1)	1						TGGAACGGCTGAGCGAGACCT	0.493													29	58	---	---	---	---	PASS
EFHB	151651	broad.mit.edu	37	3	19938194	19938194	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19938194G>A	uc003cbl.3	-	9	1906	c.1710C>T	c.(1708-1710)TTC>TTT	p.F570F	EFHB_uc003cbm.2_Silent_p.F440F	NM_144715	NP_653316	Q8N7U6	EFHB_HUMAN	EF hand domain family, member B	570	EF-hand 1.				signal transduction	proteinaceous extracellular matrix	calcium ion binding				0						CATAGTGCCTGAAGGCTGCCA	0.433													60	103	---	---	---	---	PASS
DHX30	22907	broad.mit.edu	37	3	47870505	47870505	+	Intron	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47870505C>T	uc003cru.2	+						DHX30_uc003crs.2_Intron|DHX30_uc003crt.2_Intron|DHX30_uc010hjr.1_Intron	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 30							mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TCTCTCTTCTCTTCCCCAGAA	0.502													11	19	---	---	---	---	PASS
P4HTM	54681	broad.mit.edu	37	3	49039978	49039978	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49039978G>A	uc003cvg.2	+	4	1022	c.673G>A	c.(673-675)GAG>AAG	p.E225K	P4HTM_uc003cvh.2_Missense_Mutation_p.E225K|P4HTM_uc010hkm.1_Missense_Mutation_p.E111K	NM_177939	NP_808808	Q9NXG6	P4HTM_HUMAN	hypoxia-inducible factor prolyl 4-hydroxylase	225	Lumenal (Potential).|EF-hand 2.					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)	GATGACTCCAGAGAGCATTCA	0.587													65	117	---	---	---	---	PASS
P4HTM	54681	broad.mit.edu	37	3	49043509	49043509	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49043509G>A	uc003cvg.2	+	8	1526	c.1177G>A	c.(1177-1179)GAT>AAT	p.D393N	P4HTM_uc003cvh.2_Missense_Mutation_p.D454N|WDR6_uc011bbx.1_5'Flank|WDR6_uc003cvj.2_5'Flank|WDR6_uc011bby.1_5'Flank|WDR6_uc010hkn.2_5'Flank|WDR6_uc011bbz.1_5'Flank	NM_177939	NP_808808	Q9NXG6	P4HTM_HUMAN	hypoxia-inducible factor prolyl 4-hydroxylase	393	Lumenal (Potential).|Fe2OG dioxygenase.					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)	TCTGATTCAGGATGACGTGGA	0.582													75	114	---	---	---	---	PASS
P4HTM	54681	broad.mit.edu	37	3	49043512	49043512	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49043512G>T	uc003cvg.2	+	8	1529	c.1180G>T	c.(1180-1182)GAC>TAC	p.D394Y	P4HTM_uc003cvh.2_Missense_Mutation_p.D455Y|WDR6_uc011bbx.1_5'Flank|WDR6_uc003cvj.2_5'Flank|WDR6_uc011bby.1_5'Flank|WDR6_uc010hkn.2_5'Flank|WDR6_uc011bbz.1_5'Flank	NM_177939	NP_808808	Q9NXG6	P4HTM_HUMAN	hypoxia-inducible factor prolyl 4-hydroxylase	394	Lumenal (Potential).|Fe2OG dioxygenase.					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)	GATTCAGGATGACGTGGACCT	0.582													73	112	---	---	---	---	PASS
ITIH3	3699	broad.mit.edu	37	3	52830560	52830560	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52830560C>T	uc003dfv.2	+	3	214	c.178C>T	c.(178-180)CAC>TAC	p.H60Y	ITIH3_uc011bek.1_Missense_Mutation_p.H60Y	NM_002217	NP_002208	Q06033	ITIH3_HUMAN	inter-alpha (globulin) inhibitor H3	60	VIT.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CCGTTTTGCTCACAATGTTGT	0.542													14	24	---	---	---	---	PASS
C3orf63	23272	broad.mit.edu	37	3	56681054	56681054	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56681054G>A	uc003did.3	-	14	1812	c.1711C>T	c.(1711-1713)CGA>TGA	p.R571*	C3orf63_uc003dic.3_Nonsense_Mutation_p.R175*|C3orf63_uc003die.3_Nonsense_Mutation_p.R571*	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b	571										ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		ATAAACTCTCGTTTACCTGAA	0.313													40	61	---	---	---	---	PASS
UBA3	9039	broad.mit.edu	37	3	69105003	69105003	+	Missense_Mutation	SNP	T	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69105003T>A	uc003dno.2	-	17	1322	c.1302A>T	c.(1300-1302)AAA>AAT	p.K434N	UBA3_uc003dnq.2_Missense_Mutation_p.K420N|UBA3_uc011bfy.1_Missense_Mutation_p.K257N|UBA3_uc011bfz.1_Missense_Mutation_p.K257N	NM_003968	NP_003959	Q8TBC4	UBA3_HUMAN	ubiquitin-activating enzyme 3 isoform 1	434	Interaction with UBE2M core domain.				protein neddylation|proteolysis	nucleus	acid-amino acid ligase activity|ATP binding|protein heterodimerization activity			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.98e-05)|Epithelial(33;0.000363)|LUSC - Lung squamous cell carcinoma(21;0.012)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.206)|Kidney(39;0.241)		GTAAAATACCTTTCAATGTTT	0.303													30	146	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77617511	77617511	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77617511G>C	uc003dpy.3	+	13	2540	c.1897G>C	c.(1897-1899)GAG>CAG	p.E633Q	ROBO2_uc003dpz.2_Missense_Mutation_p.E637Q|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.E637Q	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	633	Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AGTGCAGAAAGAGCTAGGAGA	0.433													7	135	---	---	---	---	PASS
ROBO1	6091	broad.mit.edu	37	3	78684989	78684989	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78684989C>T	uc003dqe.2	-	23	3515	c.3307G>A	c.(3307-3309)GGA>AGA	p.G1103R	ROBO1_uc003dqb.2_Missense_Mutation_p.G1064R|ROBO1_uc003dqc.2_Missense_Mutation_p.G1003R|ROBO1_uc003dqd.2_Missense_Mutation_p.G1058R|ROBO1_uc010hoh.2_Missense_Mutation_p.G295R|ROBO1_uc011bgl.1_Missense_Mutation_p.G675R	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	1103	Cytoplasmic (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TTCTGCTGTCCCAGTGGTTTC	0.502													28	160	---	---	---	---	PASS
ZPLD1	131368	broad.mit.edu	37	3	102175056	102175056	+	Missense_Mutation	SNP	T	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102175056T>A	uc003dvs.1	+	11	1229	c.347T>A	c.(346-348)GTC>GAC	p.V116D	ZPLD1_uc003dvt.1_Missense_Mutation_p.V132D|ZPLD1_uc011bhg.1_Missense_Mutation_p.V116D	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	116	ZP.|Extracellular (Potential).					integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						ATTCCTGGAGTCAGTGCTTAT	0.358													23	119	---	---	---	---	PASS
ZPLD1	131368	broad.mit.edu	37	3	102175057	102175057	+	Silent	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102175057C>G	uc003dvs.1	+	11	1230	c.348C>G	c.(346-348)GTC>GTG	p.V116V	ZPLD1_uc003dvt.1_Silent_p.V132V|ZPLD1_uc011bhg.1_Silent_p.V116V	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	116	ZP.|Extracellular (Potential).					integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						TTCCTGGAGTCAGTGCTTATG	0.363													24	123	---	---	---	---	PASS
DZIP3	9666	broad.mit.edu	37	3	108403129	108403129	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108403129C>G	uc003dxd.2	+	27	3372	c.2950C>G	c.(2950-2952)CAA>GAA	p.Q984E	DZIP3_uc003dxf.1_Missense_Mutation_p.Q984E|DZIP3_uc011bhm.1_Missense_Mutation_p.Q435E	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	984					protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						TACTGTTCCTCAAATGCCTGC	0.393													168	245	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108746587	108746587	+	Intron	SNP	T	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108746587T>A	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						GAGGAATTAATCACAACTCAC	0.348													6	201	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108746588	108746588	+	Intron	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108746588C>T	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						AGGAATTAATCACAACTCACC	0.348													7	200	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113135402	113135402	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113135402G>A	uc003eae.1	-	6	689	c.643C>T	c.(643-645)CCT>TCT	p.P215S		NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2	215										central_nervous_system(1)	1						CTCAGAGAAGGATATTCATAG	0.333													16	36	---	---	---	---	PASS
KIAA2018	205717	broad.mit.edu	37	3	113378598	113378598	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113378598G>A	uc003eam.2	-	7	2342	c.1931C>T	c.(1930-1932)TCA>TTA	p.S644L	KIAA2018_uc003eal.2_Missense_Mutation_p.S588L	NM_001009899	NP_001009899	Q68DE3	K2018_HUMAN	hypothetical protein LOC205717	644					regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3						GTTAGACGCTGATAAAGATGA	0.393													88	118	---	---	---	---	PASS
ZBTB20	26137	broad.mit.edu	37	3	114070442	114070442	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114070442G>A	uc003ebi.2	-	4	663	c.483C>T	c.(481-483)GGC>GGT	p.G161G	ZBTB20_uc003ebj.2_Silent_p.G88G|ZBTB20_uc010hqp.2_Silent_p.G88G|ZBTB20_uc003ebk.2_Silent_p.G88G|ZBTB20_uc003ebl.2_Silent_p.G88G|ZBTB20_uc003ebm.2_Silent_p.G88G|ZBTB20_uc003ebn.2_Silent_p.G88G|uc003ebo.1_5'Flank	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform	161	BTB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CCCGTAGCACGCCGCTGTACA	0.567													27	51	---	---	---	---	PASS
PARP9	83666	broad.mit.edu	37	3	122269520	122269520	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122269520C>G	uc010hri.2	-	6	1487	c.1342G>C	c.(1342-1344)GAT>CAT	p.D448H	PARP9_uc003eff.3_Missense_Mutation_p.D413H|PARP9_uc011bjs.1_Missense_Mutation_p.D413H|PARP9_uc003efg.2_Intron|PARP9_uc003efi.2_Missense_Mutation_p.D413H|PARP9_uc003efh.2_Missense_Mutation_p.D448H|PARP9_uc003efj.2_Missense_Mutation_p.D413H	NM_001146102	NP_001139574	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	448	Macro 2.				cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding			ovary(1)|pancreas(1)|prostate(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0519)		AAAACTTCATCAAACAAAATC	0.338													81	94	---	---	---	---	PASS
MYLK	4638	broad.mit.edu	37	3	123376143	123376143	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123376143G>A	uc003ego.2	-	24	4400	c.4118C>T	c.(4117-4119)TCA>TTA	p.S1373L	MYLK_uc010hrr.2_5'UTR|MYLK_uc011bjv.1_Missense_Mutation_p.S173L|MYLK_uc011bjw.1_Missense_Mutation_p.S1373L|MYLK_uc003egp.2_Missense_Mutation_p.S1304L|MYLK_uc003egq.2_Missense_Mutation_p.S1373L|MYLK_uc003egr.2_Missense_Mutation_p.S1304L|MYLK_uc003egs.2_Missense_Mutation_p.S1197L	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	1373	Actin-binding (calcium/calmodulin- insensitive) (By similarity).|Fibronectin type-III.				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CTTGTTGGCTGAGTCCCAGAT	0.552													20	137	---	---	---	---	PASS
IFT122	55764	broad.mit.edu	37	3	129226555	129226555	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129226555C>T	uc003emm.2	+	23	3042	c.2836C>T	c.(2836-2838)CAG>TAG	p.Q946*	IFT122_uc003eml.2_Nonsense_Mutation_p.Q997*|IFT122_uc003emn.2_Nonsense_Mutation_p.Q887*|IFT122_uc003emo.2_Nonsense_Mutation_p.Q836*|IFT122_uc003emp.2_Nonsense_Mutation_p.Q796*|IFT122_uc010htc.2_Nonsense_Mutation_p.Q939*|IFT122_uc011bky.1_Nonsense_Mutation_p.Q737*|IFT122_uc003emq.2_Nonsense_Mutation_p.Q786*|IFT122_uc003emr.2_Nonsense_Mutation_p.Q699*|IFT122_uc011bla.1_Nonsense_Mutation_p.Q720*|IFT122_uc010hte.2_Nonsense_Mutation_p.Q272*|IFT122_uc003ems.2_Nonsense_Mutation_p.Q328*|IFT122_uc011bkx.1_Nonsense_Mutation_p.Q787*|IFT122_uc010htd.1_Nonsense_Mutation_p.Q425*	NM_052989	NP_443715	Q9HBG6	IF122_HUMAN	WD repeat domain 10 isoform 2	946					camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2						CTACCACTTCCAGCGTTTGGC	0.572													113	123	---	---	---	---	PASS
CPNE4	131034	broad.mit.edu	37	3	131261514	131261514	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131261514C>T	uc003eok.2	-	15	1861	c.1426G>A	c.(1426-1428)GAC>AAC	p.D476N	CPNE4_uc011blq.1_Missense_Mutation_p.D494N|CPNE4_uc003eol.2_Missense_Mutation_p.D494N|CPNE4_uc003eom.2_Missense_Mutation_p.D476N|CPNE4_uc003eoj.2_Missense_Mutation_p.D27N	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV	476	VWFA.									upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TCACTGAAGTCAGCGTTCCCT	0.562													37	149	---	---	---	---	PASS
RBP2	5948	broad.mit.edu	37	3	139173596	139173596	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139173596C>T	uc003eth.2	-	3	380	c.329G>A	c.(328-330)TGG>TAG	p.W110*		NM_004164	NP_004155	P50120	RET2_HUMAN	retinol binding protein 2, cellular	110					epidermis development|retinoid metabolic process|steroid metabolic process|vitamin A metabolic process	cytosol	retinal binding|retinol binding|transporter activity			skin(1)	1					Vitamin A(DB00162)	CCCCTCAATCCACTGCTTCCA	0.532													121	169	---	---	---	---	PASS
TRPC1	7220	broad.mit.edu	37	3	142503613	142503613	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142503613G>T	uc003evc.2	+	7	1164	c.1028G>T	c.(1027-1029)CGA>CTA	p.R343L	TRPC1_uc003evb.2_Missense_Mutation_p.R309L	NM_003304	NP_003295	P48995	TRPC1_HUMAN	transient receptor potential cation channel,	343	Cytoplasmic (Potential).				axon guidance|cytosolic calcium ion homeostasis|positive regulation of release of sequestered calcium ion into cytosol|response to calcium ion	cytosol|integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						TCGGGTTACCGACGCAAGCCC	0.418													127	52	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	150906168	150906168	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150906168G>A	uc003eyp.2	+	12	1692	c.1654G>A	c.(1654-1656)GAG>AAG	p.E552K	MED12L_uc011bnz.1_Missense_Mutation_p.E412K|MED12L_uc003eyn.2_Missense_Mutation_p.E552K|MED12L_uc003eyo.2_Missense_Mutation_p.E552K	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	552					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGTCTTAGATGAGAAGGAGTC	0.348													53	188	---	---	---	---	PASS
KPNA4	3840	broad.mit.edu	37	3	160219934	160219934	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160219934G>A	uc003fdn.2	-	17	1830	c.1524C>T	c.(1522-1524)TTC>TTT	p.F508F		NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4	508					NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			CAGATGAATTGAAACCAAATG	0.338													88	399	---	---	---	---	PASS
LRRIQ4	344657	broad.mit.edu	37	3	169546552	169546552	+	Silent	SNP	T	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169546552T>C	uc003fgb.2	+	2	1026	c.1026T>C	c.(1024-1026)CCT>CCC	p.P342P		NM_001080460	NP_001073929	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	342	LRR 14.										0						TCTAGTTACCTTCAGAATTGG	0.378													6	256	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			85	103	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178938934	178938934	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178938934G>A	uc003fjk.2	+	14	2333	c.2176G>A	c.(2176-2178)GAA>AAA	p.E726K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	726					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E726K(2)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GAAGAAGGATGAAACACAAAA	0.363		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			16	124	---	---	---	---	PASS
KLHL24	54800	broad.mit.edu	37	3	183382716	183382716	+	Silent	SNP	A	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183382716A>G	uc003flv.2	+	5	1408	c.1113A>G	c.(1111-1113)AGA>AGG	p.R371R	KLHL24_uc003flw.2_Silent_p.R371R|KLHL24_uc003flx.2_Silent_p.R371R	NM_017644	NP_060114	Q6TFL4	KLH24_HUMAN	DRE1 protein	371	Kelch 2.					axon|cytoplasm|perikaryon				ovary(1)	1	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			AAGGTGGAAGAATCAACAGCC	0.403													48	513	---	---	---	---	PASS
YEATS2	55689	broad.mit.edu	37	3	183528294	183528294	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183528294C>T	uc003fly.2	+	31	4387	c.4192C>T	c.(4192-4194)CAC>TAC	p.H1398Y		NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	1398					histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GAGTAATATTCACCAGGCCAT	0.413													22	104	---	---	---	---	PASS
ECE2	9718	broad.mit.edu	37	3	184002858	184002858	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184002858G>A	uc003fni.3	+	9	1505	c.1467G>A	c.(1465-1467)CAG>CAA	p.Q489Q	ECE2_uc011brh.1_Silent_p.Q342Q|ECE2_uc003fnl.3_Silent_p.Q417Q|ECE2_uc003fnm.3_Silent_p.Q371Q|ECE2_uc003fnk.3_Silent_p.Q342Q|ECE2_uc011bri.1_Silent_p.Q404Q|ECE2_uc010hxv.2_Silent_p.Q133Q	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	489	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ATTATTTGCAGCAGGTGTCAG	0.562											OREG0015945	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	389	---	---	---	---	PASS
C3orf21	152002	broad.mit.edu	37	3	194991425	194991425	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194991425C>T	uc003fum.3	-	1	471	c.363G>A	c.(361-363)GCG>GCA	p.A121A		NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002	121						integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		GTGAGCGCAGCGCGACGCGGG	0.687													56	24	---	---	---	---	PASS
ZFYVE28	57732	broad.mit.edu	37	4	2306648	2306648	+	Silent	SNP	G	A	A	rs143269293		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2306648G>A	uc003gex.1	-	8	1738	c.1419C>T	c.(1417-1419)CTC>CTT	p.L473L	ZFYVE28_uc011bvk.1_Silent_p.L403L|ZFYVE28_uc011bvl.1_Silent_p.L443L|ZFYVE28_uc003gew.1_Silent_p.L359L	NM_020972	NP_066023	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	473					negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			skin(2)|ovary(1)	3						TGGTGCCCGCGAGGCTGGCCC	0.682													4	142	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	54256801	54256801	+	Intron	SNP	A	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54256801A>T	uc003haa.2	+						FIP1L1_uc003gzx.3_Intron|FIP1L1_uc011bzt.1_Intron|FIP1L1_uc003gzy.2_Intron|FIP1L1_uc011bzu.1_Intron|FIP1L1_uc003gzz.2_Intron|FIP1L1_uc003hab.2_Intron|FIP1L1_uc003hac.2_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	ACCTGGTAAGATTATTGTGGA	0.289			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			36	31	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	54852862	54852862	+	Intron	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54852862C>T	uc003haa.2	+						RPL21P44_uc011bzv.1_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	TCACTTGAACCCAGGTACCTT	0.468			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			31	42	---	---	---	---	PASS
HSD17B11	51170	broad.mit.edu	37	4	88261719	88261719	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88261719C>G	uc003hqp.2	-	6	968	c.735G>C	c.(733-735)AGG>AGC	p.R245S		NM_016245	NP_057329	Q8NBQ5	DHB11_HUMAN	estradiol 17-beta-dehydrogenase 11	245					androgen catabolic process|steroid biosynthetic process	cytoplasm|extracellular region	binding|estradiol 17-beta-dehydrogenase activity			ovary(2)	2		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		CATGCATCAGCCTGTTTACCA	0.403													21	76	---	---	---	---	PASS
SMARCAD1	56916	broad.mit.edu	37	4	95200089	95200089	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95200089C>G	uc003htc.3	+	19	2561	c.2306C>G	c.(2305-2307)ACA>AGA	p.T769R	SMARCAD1_uc003htb.3_Missense_Mutation_p.T771R|SMARCAD1_uc003htd.3_Missense_Mutation_p.T771R|SMARCAD1_uc010ila.2_Missense_Mutation_p.T634R|SMARCAD1_uc011cdw.1_Missense_Mutation_p.T339R	NM_020159	NP_064544	Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated	769					chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity			skin(2)|ovary(1)|breast(1)	4				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		GAAAAAAACACAGAAATGTGC	0.323													9	49	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114095564	114095564	+	Intron	SNP	T	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114095564T>A	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc003ibc.2_Intron|ANK2_uc011cgb.1_Intron	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTTTTATTTTTCTCGCAGTCT	0.403													9	8	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126412458	126412458	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126412458G>T	uc003ifj.3	+	17	14481	c.14481G>T	c.(14479-14481)AGG>AGT	p.R4827S	FAT4_uc011cgp.1_Missense_Mutation_p.R3068S|FAT4_uc003ifi.1_Missense_Mutation_p.R2304S	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4827	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						CTAGAACAAGGAATCCAGCGG	0.502													17	93	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134072188	134072188	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134072188G>T	uc003iha.2	+	1	1719	c.893G>T	c.(892-894)CGG>CTG	p.R298L	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.R298L	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	298	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		CCCCGGGCGCGGGAGCTTTTC	0.622													36	63	---	---	---	---	PASS
NAA15	80155	broad.mit.edu	37	4	140264007	140264007	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140264007C>T	uc003ihu.1	+	5	686	c.430C>T	c.(430-432)CGA>TGA	p.R144*		NM_057175	NP_476516	Q9BXJ9	NAA15_HUMAN	NMDA receptor regulated 1	144					angiogenesis|cell differentiation|N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	protein binding			ovary(1)|skin(1)	2						ACTTCAGCTTCGACCTGCGCA	0.348													75	102	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151520150	151520150	+	Intron	SNP	T	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151520150T>C	uc010ipj.2	-						LRBA_uc003ilt.3_Intron|LRBA_uc003ilu.3_Intron	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					GAATGGTTTATACACTGACCA	0.463													58	79	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153247289	153247289	+	Missense_Mutation	SNP	G	T	T	rs149680468		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153247289G>T	uc003ims.2	-	10	1662	c.1513C>A	c.(1513-1515)CGC>AGC	p.R505S	FBXW7_uc011cii.1_Missense_Mutation_p.R505S|FBXW7_uc003imt.2_Missense_Mutation_p.R505S|FBXW7_uc011cih.1_Missense_Mutation_p.R329S|FBXW7_uc003imq.2_Missense_Mutation_p.R425S|FBXW7_uc003imr.2_Missense_Mutation_p.R387S	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	505	WD 4.		R -> L (in an ovarian cancer cell line).		interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	p.R505C(36)|p.R505L(6)|p.R505G(4)|p.R425C(2)|p.R425G(2)|p.R266G(2)|p.R505H(2)|p.R505S(1)|p.R505P(1)|p.R266C(1)		haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGAACACAGCGGACTGCTGCA	0.468			Mis|N|D|F		colorectal|endometrial|T-ALL								56	78	---	---	---	---	PASS
AADAT	51166	broad.mit.edu	37	4	170994374	170994374	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170994374G>A	uc003isr.2	-	5	909	c.567C>T	c.(565-567)AAC>AAT	p.N189N	AADAT_uc003iss.2_Silent_p.N189N|AADAT_uc003ist.2_Silent_p.N193N	NM_016228	NP_057312	Q8N5Z0	AADAT_HUMAN	kynurenine aminotransferase II	189					2-oxoglutarate metabolic process|biosynthetic process|glutamate metabolic process|lysine catabolic process	mitochondrial matrix	2-aminoadipate transaminase activity|kynurenine-oxoglutarate transaminase activity|protein homodimerization activity				0		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0355)|LUSC - Lung squamous cell carcinoma(193;0.118)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	ATTTGGGGGTGTTTTTCTGGG	0.388													101	132	---	---	---	---	PASS
CYP4V2	285440	broad.mit.edu	37	4	187130031	187130031	+	Missense_Mutation	SNP	G	A	A	rs138739819	byFrequency	TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187130031G>A	uc003iyw.3	+	9	1407	c.1103G>A	c.(1102-1104)CGT>CAT	p.R368H	CYP4V2_uc010ism.2_RNA	NM_207352	NP_997235	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily v,	368					response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		AAGTCTGACCGTCCCGCTACA	0.468													63	101	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13793676	13793676	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13793676G>C	uc003jfd.2	-	49	8214	c.8172C>G	c.(8170-8172)TTC>TTG	p.F2724L		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2724	AAA 3 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TAAATATAGAGAACTGCCTCT	0.502									Kartagener_syndrome				41	162	---	---	---	---	PASS
RNASEN	29102	broad.mit.edu	37	5	31495482	31495482	+	Intron	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31495482G>C	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron|RNASEN_uc003jhi.2_Intron|RNASEN_uc010iui.1_Intron	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						TTGATGGCCTGAGGGGAAAAA	0.383													14	25	---	---	---	---	PASS
PDE4D	5144	broad.mit.edu	37	5	59064198	59064198	+	Intron	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59064198C>T	uc003jsa.2	-						PDE4D_uc003jry.2_5'UTR|PDE4D_uc003jrz.2_Silent_p.A46A|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Silent_p.A46A	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	CCGATTTCCTCGCTGTCTTGG	0.512													63	74	---	---	---	---	PASS
CCDC125	202243	broad.mit.edu	37	5	68602672	68602672	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68602672C>G	uc003jvv.1	-	5	632	c.589G>C	c.(589-591)GAG>CAG	p.E197Q	CCDC125_uc003jvx.1_Missense_Mutation_p.E196Q|CCDC125_uc003jvy.1_Intron|CCDC125_uc003jvw.2_Missense_Mutation_p.E72Q	NM_176816	NP_789786	Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	197	Potential.					cytoplasm					0		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		CAAGATTCCTCTATATTTTTA	0.269													58	88	---	---	---	---	PASS
TMEM174	134288	broad.mit.edu	37	5	72469927	72469927	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72469927G>A	uc010izc.2	+	2	715	c.667G>A	c.(667-669)GAA>AAA	p.E223K		NM_153217	NP_694949	Q8WUU8	TM174_HUMAN	transmembrane protein 174	223						integral to membrane				ovary(1)	1		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		GACACAGCTGGAAGAGGAGGC	0.468													46	66	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79032599	79032599	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79032599G>T	uc003kgc.2	+	2	8083	c.8011G>T	c.(8011-8013)GAA>TAA	p.E2671*		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2671						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AGATCACAGTGAAGAAAAAGA	0.398													3	42	---	---	---	---	PASS
MTX3	345778	broad.mit.edu	37	5	79284338	79284338	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79284338G>A	uc010jag.2	-	5	478	c.451C>T	c.(451-453)CTC>TTC	p.L151F	MTX3_uc010jah.2_Missense_Mutation_p.L151F|MTX3_uc003kge.3_Missense_Mutation_p.L90F|MTX3_uc003kgf.1_5'Flank	NM_001010891	NP_001010891	Q5HYI7	MTX3_HUMAN	metaxin 3	151					protein targeting to mitochondrion	mitochondrial outer membrane					0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.63e-45)|Epithelial(54;2.9e-40)|all cancers(79;4.68e-35)		CTGGTCAGGAGAATCCTATTC	0.463													9	19	---	---	---	---	PASS
FER	2241	broad.mit.edu	37	5	108436132	108436132	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108436132G>C	uc003kop.1	+	17	2344	c.1960G>C	c.(1960-1962)GAT>CAT	p.D654H	FER_uc011cvg.1_Missense_Mutation_p.D479H	NM_005246	NP_005237	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	654	Protein kinase.				intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		AAGGAAGAAGGATGAACTAAA	0.358													31	26	---	---	---	---	PASS
SLC22A4	6583	broad.mit.edu	37	5	131630483	131630483	+	Silent	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131630483G>C	uc003kwq.2	+	1	339	c.174G>C	c.(172-174)CTG>CTC	p.L58L	uc003kwm.3_Intron|SLC22A4_uc010jdq.1_5'Flank	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	solute carrier family 22 member 4	58	Extracellular (Potential).				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity				0		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	CCGCGAACCTGAGCAGCGCCT	0.682													19	50	---	---	---	---	PASS
PCDHB15	56121	broad.mit.edu	37	5	140626008	140626008	+	Missense_Mutation	SNP	A	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140626008A>G	uc003lje.2	+	1	862	c.862A>G	c.(862-864)ATA>GTA	p.I288V		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	288	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCTCAGGAGATAGACAAACC	0.413													3	95	---	---	---	---	PASS
PCDHGB2	56103	broad.mit.edu	37	5	140740504	140740504	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140740504G>A	uc003ljs.1	+	1	802	c.802G>A	c.(802-804)GAC>AAC	p.D268N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc011dar.1_Missense_Mutation_p.D268N	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	268	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACAGCCACCGACCGGGATGA	0.493													14	43	---	---	---	---	PASS
PCDHGA6	56109	broad.mit.edu	37	5	140755477	140755477	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140755477C>T	uc003ljy.1	+	1	1827	c.1827C>T	c.(1825-1827)CTC>CTT	p.L609L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Silent_p.L609L	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	609	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCGCCTGCTCAAGGCCAGCG	0.692													10	104	---	---	---	---	PASS
DBN1	1627	broad.mit.edu	37	5	176884741	176884741	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176884741G>C	uc003mgy.2	-	13	1966	c.1794C>G	c.(1792-1794)TTC>TTG	p.F598L	DBN1_uc011dga.1_Missense_Mutation_p.F330L|DBN1_uc003mgx.2_Missense_Mutation_p.F600L|DBN1_uc010jkn.1_Missense_Mutation_p.F548L	NM_004395	NP_004386	Q16643	DREB_HUMAN	drebrin 1 isoform a	598					actin filament organization|regulation of dendrite development|regulation of neuronal synaptic plasticity	actomyosin|cytoplasm|dendrite	actin binding|profilin binding			breast(3)|ovary(1)|lung(1)|skin(1)	6	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGATTGACTGAAGTACCCCT	0.597											OREG0016462	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	24	---	---	---	---	PASS
C5orf45	51149	broad.mit.edu	37	5	179264608	179264608	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179264608G>A	uc003mla.2	-	7	859	c.815C>T	c.(814-816)TCA>TTA	p.S272L	SQSTM1_uc011dgr.1_3'UTR|SQSTM1_uc011dgs.1_3'UTR|SQSTM1_uc003mkw.3_3'UTR|SQSTM1_uc003mkx.2_3'UTR|C5orf45_uc003mky.2_Intron|C5orf45_uc011dgt.1_Intron|C5orf45_uc011dgu.1_Intron|C5orf45_uc003mlc.2_Missense_Mutation_p.S217L|C5orf45_uc003mlb.2_Missense_Mutation_p.S138L	NM_016175	NP_057259	Q6NTE8	CE045_HUMAN	hypothetical protein LOC51149 isoform 1	272											0						GCCTTCTCTTGAGGCCTGTGC	0.627													32	62	---	---	---	---	PASS
SERPINB1	1992	broad.mit.edu	37	6	2840762	2840762	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2840762C>T	uc003mub.2	-	2	103	c.59G>A	c.(58-60)AGT>AAT	p.S20N	SERPINB1_uc003muc.2_Translation_Start_Site	NM_030666	NP_109591	P30740	ILEU_HUMAN	serine (or cysteine) proteinase inhibitor, clade	20					regulation of proteolysis	cytoplasm|extracellular space	serine-type endopeptidase inhibitor activity			breast(4)|ovary(1)	5	Ovarian(93;0.0412)			OV - Ovarian serous cystadenocarcinoma(45;0.0717)		ATTGTTCTCACTCAACGCCAG	0.537													37	33	---	---	---	---	PASS
SLC17A1	6568	broad.mit.edu	37	6	25826862	25826862	+	Splice_Site	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25826862C>T	uc003nfh.3	-	3	151	c.35_splice	c.e3-1	p.V12_splice	SLC17A1_uc011djy.1_Splice_Site|SLC17A1_uc010jqb.1_Splice_Site_p.V10_splice|SLC17A1_uc010jqc.1_Splice_Site_p.V10_splice	NM_005074	NP_005065	Q14916	NPT1_HUMAN	solute carrier family 17 (sodium phosphate),						sodium ion transport|urate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(3)|pancreas(1)	4						AAACCTGGAACTACAAAGTAA	0.398													6	43	---	---	---	---	PASS
HIST1H3F	8968	broad.mit.edu	37	6	26250542	26250542	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26250542C>T	uc003nhg.1	-	1	294	c.292G>A	c.(292-294)GAG>AAG	p.E98K	HIST1H2BH_uc003nhh.2_5'Flank	NM_021018	NP_066298	P68431	H31_HUMAN	histone cluster 1, H3f	98					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0						AGGTAAGCCTCGCAGGCCTCC	0.602											OREG0017241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	50	102	---	---	---	---	PASS
OR2B3	442184	broad.mit.edu	37	6	29054567	29054567	+	Silent	SNP	G	A	A	rs139179669		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29054567G>A	uc003nlx.2	-	1	524	c.459C>T	c.(457-459)TTC>TTT	p.F153F		NM_001005226	NP_001005226			olfactory receptor, family 2, subfamily B,									p.F153F(1)		skin(1)	1						CTGAGTTGCCGAAACCAATGA	0.488													25	41	---	---	---	---	PASS
AIF1	199	broad.mit.edu	37	6	31584147	31584147	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31584147G>T	uc003nuy.2	+	5	297	c.223G>T	c.(223-225)GAG>TAG	p.E75*	AIF1_uc010jsy.2_Nonsense_Mutation_p.E87*|AIF1_uc003nva.2_Nonsense_Mutation_p.E21*	NM_001623	NP_001614	P55008	AIF1_HUMAN	allograft inflammatory factor 1 isoform 3	75	EF-hand 1.				actin filament bundle assembly|cell cycle arrest|inflammatory response|negative regulation of cell proliferation	nucleus|ruffle membrane	actin filament binding|calcium ion binding			ovary(1)	1						ACGAATGCTGGAGAAACTTGG	0.542													34	61	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32014110	32014110	+	Missense_Mutation	SNP	T	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32014110T>A	uc003nzl.2	-	31	10644	c.10442A>T	c.(10441-10443)TAC>TTC	p.Y3481F	TNXB_uc003nzg.1_5'Flank|TNXB_uc003nzh.1_5'UTR	NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	3528	Fibronectin type-III 27.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						CGTGTCCCTGTACTGGACCAC	0.642													7	51	---	---	---	---	PASS
FKBPL	63943	broad.mit.edu	37	6	32096798	32096798	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32096798G>A	uc003nzr.2	-	2	1030	c.760C>T	c.(760-762)CTT>TTT	p.L254F	ATF6B_uc003nzo.2_5'Flank|ATF6B_uc003nzn.2_5'Flank|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_5'Flank	NM_022110	NP_071393	Q9UIM3	FKBPL_HUMAN	WAF-1/CIP1 stabilizing protein 39	254	TPR 2.				response to radiation	membrane|nucleus	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0						TTGGCATGAAGGACAGTTCGT	0.592													52	94	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33133329	33133329	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33133329C>T	uc003ocx.1	-	63	4975	c.4747G>A	c.(4747-4749)GAT>AAT	p.D1583N	COL11A2_uc010jul.1_Missense_Mutation_p.D153N|COL11A2_uc003ocy.1_Missense_Mutation_p.D1497N|COL11A2_uc003ocz.1_Missense_Mutation_p.D1476N	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	1583	Fibrillar collagen NC1.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						CACTGACCATCGGGAAGCTCT	0.532													86	115	---	---	---	---	PASS
PPIL1	51645	broad.mit.edu	37	6	36823644	36823644	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36823644G>A	uc003omu.2	-	4	698	c.446C>T	c.(445-447)TCC>TTC	p.S149F		NM_016059	NP_057143	Q9Y3C6	PPIL1_HUMAN	peptidylprolyl isomerase-like 1	149	PPIase cyclophilin-type.				protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1						GCGGTCCTGGGAGTTTGTTTC	0.547													49	94	---	---	---	---	PASS
FAM83B	222584	broad.mit.edu	37	6	54805161	54805161	+	Silent	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54805161G>T	uc003pck.2	+	5	1508	c.1392G>T	c.(1390-1392)CGG>CGT	p.R464R		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	464										ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					CAAATGTTCGGAGGTCTTTTA	0.438													17	77	---	---	---	---	PASS
MANEA	79694	broad.mit.edu	37	6	96053844	96053844	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96053844G>C	uc003poo.1	+	5	1092	c.952G>C	c.(952-954)GAT>CAT	p.D318H		NM_024641	NP_078917	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	318	Catalytic (Probable).|Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	glycoprotein endo-alpha-1,2-mannosidase activity			ovary(2)|breast(1)	3		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		AAGTGGTTTTGATGGAATTTA	0.348													29	42	---	---	---	---	PASS
C6orf174	387104	broad.mit.edu	37	6	127797008	127797008	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127797008C>G	uc003qbd.2	-	6	3028	c.2163G>C	c.(2161-2163)CAG>CAC	p.Q721H	C6orf174_uc003qbc.2_5'Flank	NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor	721	Potential.					integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		CGTACTGCAGCTGCATGACCT	0.672													35	149	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129470193	129470193	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129470193C>T	uc003qbn.2	+	7	1084	c.979C>T	c.(979-981)CAG>TAG	p.Q327*	LAMA2_uc003qbo.2_Nonsense_Mutation_p.Q327*	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	327	Laminin EGF-like 1.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		AGGATTCCATCAGAAACCCTG	0.403													76	87	---	---	---	---	PASS
MAP3K5	4217	broad.mit.edu	37	6	136879933	136879933	+	Intron	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136879933G>A	uc003qhc.2	-						MAP3K5_uc011edj.1_Intron	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		AAAGAAAAGTGGTACCTTAGT	0.214													43	77	---	---	---	---	PASS
MIOS	54468	broad.mit.edu	37	7	7612875	7612875	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7612875G>C	uc003srf.2	+	4	1077	c.769G>C	c.(769-771)GAG>CAG	p.E257Q	MIOS_uc010ktp.1_Missense_Mutation_p.E257Q	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog	257	WD 4.										0						TAGAAAATTTGAGAAGCCAGT	0.433													59	86	---	---	---	---	PASS
EVX1	2128	broad.mit.edu	37	7	27285874	27285874	+	Missense_Mutation	SNP	T	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27285874T>C	uc003szd.1	+	3	1540	c.1054T>C	c.(1054-1056)TGT>CGT	p.C352R	EVX1_uc011jzn.1_Missense_Mutation_p.C170R|EVX1_uc010kuy.1_3'UTR	NM_001989	NP_001980	P49640	EVX1_HUMAN	even-skipped homeobox 1	352						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						CTGCCTCGCCTGTCACAGCGG	0.766													2	6	---	---	---	---	PASS
MCM7	4176	broad.mit.edu	37	7	99696789	99696789	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99696789G>A	uc003usw.1	-	5	949	c.439C>T	c.(439-441)CGT>TGT	p.R147C	MCM7_uc003usv.1_5'UTR|MCM7_uc003usx.1_5'UTR|AP4M1_uc011kjg.1_5'Flank|AP4M1_uc010lgl.1_5'Flank|AP4M1_uc003utb.3_5'Flank|AP4M1_uc003utc.3_5'Flank|AP4M1_uc010lgm.2_5'Flank|AP4M1_uc003utd.2_5'Flank|AP4M1_uc011kjh.1_5'Flank|AP4M1_uc003ute.3_5'Flank|AP4M1_uc003utf.3_5'Flank	NM_005916	NP_005907	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	147					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of phosphorylation|response to DNA damage stimulus|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				Atorvastatin(DB01076)	CGGATCACACGAGGCTTGTTG	0.517													59	76	---	---	---	---	PASS
IRF5	3663	broad.mit.edu	37	7	128587850	128587850	+	Silent	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128587850C>G	uc003vog.2	+	8	946	c.825C>G	c.(823-825)CCC>CCG	p.P275P	IRF5_uc003voh.2_Silent_p.P259P|IRF5_uc010llt.2_Silent_p.P183P|IRF5_uc003voi.2_Silent_p.P259P|IRF5_uc003voj.3_Silent_p.P259P|IRF5_uc010llw.1_3'UTR	NM_002200	NP_002191	Q13568	IRF5_HUMAN	interferon regulatory factor 5 isoform a	269					interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						TCAGCAACCCCCATGGCTGCC	0.657													3	22	---	---	---	---	PASS
TSPAN33	340348	broad.mit.edu	37	7	128807655	128807655	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128807655C>T	uc003vop.1	+	8	1021	c.792C>T	c.(790-792)ATC>ATT	p.I264I	TSPAN33_uc003voq.1_Silent_p.I96I	NM_178562	NP_848657	Q86UF1	TSN33_HUMAN	tetraspanin 33	264	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1						TGAATCAGATCAAAGATCAGA	0.527													17	8	---	---	---	---	PASS
ZYX	7791	broad.mit.edu	37	7	143079462	143079462	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143079462G>A	uc003wcw.2	+	3	485	c.330G>A	c.(328-330)GAG>GAA	p.E110E	ZYX_uc011ktd.1_5'UTR|ZYX_uc003wcx.2_Silent_p.E110E|ZYX_uc011kte.1_Silent_p.E110E|ZYX_uc011ktf.1_5'UTR	NM_001010972	NP_001010972	Q15942	ZYX_HUMAN	zyxin	110					cell adhesion|cell-cell signaling|interspecies interaction between organisms|signal transduction	cell-cell adherens junction|cytoplasm|focal adhesion|integral to plasma membrane|nucleus|stress fiber	protein binding|zinc ion binding				0	Melanoma(164;0.205)					CGCCTCTGGAGGAGGAGATCT	0.706													5	15	---	---	---	---	PASS
ABCF2	10061	broad.mit.edu	37	7	150923419	150923419	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150923419C>A	uc003wjp.2	-	2	237	c.126G>T	c.(124-126)AAG>AAT	p.K42N	ABCF2_uc003wjo.1_Missense_Mutation_p.K42N	NM_007189	NP_009120	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F, member 2	42						ATP-binding cassette (ABC) transporter complex|mitochondrial envelope	ATP binding|ATPase activity|transporter activity			central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGGCCTCATTCTTCTCTGCCA	0.517													39	140	---	---	---	---	PASS
ABCF2	10061	broad.mit.edu	37	7	150923420	150923420	+	Missense_Mutation	SNP	T	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150923420T>A	uc003wjp.2	-	2	236	c.125A>T	c.(124-126)AAG>ATG	p.K42M	ABCF2_uc003wjo.1_Missense_Mutation_p.K42M	NM_007189	NP_009120	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F, member 2	42						ATP-binding cassette (ABC) transporter complex|mitochondrial envelope	ATP binding|ATPase activity|transporter activity			central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGCCTCATTCTTCTCTGCCAC	0.517													39	137	---	---	---	---	PASS
HR	55806	broad.mit.edu	37	8	21982982	21982982	+	Missense_Mutation	SNP	T	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21982982T>G	uc003xas.2	-	5	2257	c.1592A>C	c.(1591-1593)GAC>GCC	p.D531A	HR_uc003xat.2_Missense_Mutation_p.D531A	NM_005144	NP_005135	O43593	HAIR_HUMAN	hairless protein isoform a	531							DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|ovary(1)	2		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		GGTGGCTGTGTCTTCCTCCTG	0.682													10	13	---	---	---	---	PASS
LOXL2	4017	broad.mit.edu	37	8	23186002	23186002	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23186002C>T	uc003xdh.1	-	6	1382	c.1043G>A	c.(1042-1044)GGG>GAG	p.G348E		NM_002318	NP_002309	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2 precursor	348	SRCR 3.				aging|cell adhesion|protein modification process	extracellular space|membrane	copper ion binding|electron carrier activity|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor|scavenger receptor activity			breast(2)|ovary(1)	3		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		GCAGACGGTCCCCCATTCTCC	0.627													18	53	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35624453	35624453	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35624453C>T	uc003xjr.1	+	15	2675	c.2347C>T	c.(2347-2349)CGG>TGG	p.R783W	UNC5D_uc003xjs.1_Missense_Mutation_p.R778W|UNC5D_uc003xju.1_Missense_Mutation_p.R359W	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	783	Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GTGCAGTAACCGGCAGCCCCT	0.582													28	19	---	---	---	---	PASS
CYP7A1	1581	broad.mit.edu	37	8	59410984	59410984	+	Missense_Mutation	SNP	A	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59410984A>G	uc003xtm.3	-	2	188	c.125T>C	c.(124-126)CTG>CCG	p.L42P		NM_000780	NP_000771	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A,	42					bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				AGCACAGCCCAGGTATGGAAT	0.408									Neonatal_Giant_Cell_Hepatitis				27	282	---	---	---	---	PASS
CYP7A1	1581	broad.mit.edu	37	8	59410985	59410985	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59410985G>T	uc003xtm.3	-	2	187	c.124C>A	c.(124-126)CTG>ATG	p.L42M		NM_000780	NP_000771	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A,	42					bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				GCACAGCCCAGGTATGGAATT	0.408									Neonatal_Giant_Cell_Hepatitis				27	279	---	---	---	---	PASS
OSGIN2	734	broad.mit.edu	37	8	90926317	90926317	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90926317C>T	uc003yeg.2	+	3	426	c.80C>T	c.(79-81)TCA>TTA	p.S27L	OSGIN2_uc003yeh.2_Missense_Mutation_p.S71L	NM_004337	NP_004328	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family	27					germ cell development|meiosis						0			BRCA - Breast invasive adenocarcinoma(11;0.0344)			AATGGACCCTCAGGAATATGC	0.289													76	308	---	---	---	---	PASS
COX6C	1345	broad.mit.edu	37	8	100904230	100904230	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100904230G>A	uc003yiy.1	-	2	80	c.20C>T	c.(19-21)CCA>CTA	p.P7L		NM_004374	NP_004365	P09669	COX6C_HUMAN	cytochrome c oxidase subunit VIc proprotein	7	Mitochondrial matrix (By similarity).				respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	cytochrome-c oxidase activity		HMGA2/COX6C(2)	soft_tissue(2)	2			all cancers(13;8.32e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CCGAGGTTTTGGCAAAACTTC	0.363			T	HMGA2	uterine leiomyoma								141	92	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	101054100	101054100	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101054100G>C	uc003yjb.1	-	12	2063	c.1868C>G	c.(1867-1869)TCT>TGT	p.S623C	RGS22_uc003yja.1_Missense_Mutation_p.S442C|RGS22_uc003yjc.1_Missense_Mutation_p.S611C|RGS22_uc011lgz.1_RNA|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	623					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			GTCAGTAAAAGATGTTAAATG	0.353													43	51	---	---	---	---	PASS
FBXO43	286151	broad.mit.edu	37	8	101146458	101146458	+	Silent	SNP	T	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101146458T>A	uc003yjd.2	-	4	2522	c.1809A>T	c.(1807-1809)GGA>GGT	p.G603G	FBXO43_uc003yje.2_Silent_p.G569G	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b	603					meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			TCAAAACTTCTCCCCAGGGAG	0.408													22	206	---	---	---	---	PASS
FBXO43	286151	broad.mit.edu	37	8	101146459	101146459	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101146459C>A	uc003yjd.2	-	4	2521	c.1808G>T	c.(1807-1809)GGA>GTA	p.G603V	FBXO43_uc003yje.2_Missense_Mutation_p.G569V	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b	603					meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			CAAAACTTCTCCCCAGGGAGA	0.413													24	208	---	---	---	---	PASS
KCNQ3	3786	broad.mit.edu	37	8	133196481	133196481	+	Intron	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133196481G>A	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TCAGGGTCAGGACTTACCCAA	0.537													6	216	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144997746	144997746	+	Silent	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144997746C>A	uc003zaf.1	-	31	6932	c.6762G>T	c.(6760-6762)CTG>CTT	p.L2254L	PLEC_uc003zab.1_Silent_p.L2117L|PLEC_uc003zac.1_Silent_p.L2121L|PLEC_uc003zad.2_Silent_p.L2117L|PLEC_uc003zae.1_Silent_p.L2085L|PLEC_uc003zag.1_Silent_p.L2095L|PLEC_uc003zah.2_Silent_p.L2103L|PLEC_uc003zaj.2_Silent_p.L2144L	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2254	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CCGACTGCTTCAGCCGCTCGG	0.761													20	35	---	---	---	---	PASS
CYC1	1537	broad.mit.edu	37	8	145151959	145151959	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145151959G>C	uc003zaz.3	+	6	838	c.795G>C	c.(793-795)CAG>CAC	p.Q265H	CYC1_uc003zay.2_Missense_Mutation_p.Q206H	NM_001916	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	265					respiratory electron transport chain|transport	cell junction|integral to membrane|mitochondrial inner membrane|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCATGTCCCAGATAGCCAAGG	0.582													16	12	---	---	---	---	PASS
CYC1	1537	broad.mit.edu	37	8	145152203	145152203	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145152203G>A	uc003zaz.3	+	7	985	c.942G>A	c.(940-942)CTG>CTA	p.L314L	CYC1_uc003zay.2_Silent_p.L255L	NM_001916	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	314					respiratory electron transport chain|transport	cell junction|integral to membrane|mitochondrial inner membrane|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGTCAGTCCTGAAGAGTCGGA	0.577													40	30	---	---	---	---	PASS
CPSF1	29894	broad.mit.edu	37	8	145626474	145626474	+	Intron	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145626474G>A	uc003zcj.2	-						CPSF1_uc003zck.1_Intron|CPSF1_uc011lle.1_Intron|MIR1234_hsa-mir-1234|MI0006324_5'Flank|CPSF1_uc011llf.1_Intron	NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,						mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CCCGTCCTGGGGGCAGAGGGG	0.687													29	16	---	---	---	---	PASS
NFKBIL2	4796	broad.mit.edu	37	8	145659005	145659005	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145659005C>T	uc011llg.1	-	22	3540	c.3525G>A	c.(3523-3525)CTG>CTA	p.L1175L	uc011llh.1_5'Flank	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	1175					cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			TCTGGTGGCTCAGAAAGAAGC	0.642													43	141	---	---	---	---	PASS
ZNF658	26149	broad.mit.edu	37	9	40772474	40772474	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40772474C>A	uc004abs.2	-	5	2953	c.2801G>T	c.(2800-2802)GGG>GTG	p.G934V	ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Missense_Mutation_p.G934V	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658	934					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GGGTTTCTCCCCCGTATGAAC	0.438													47	323	---	---	---	---	PASS
ZNF658	26149	broad.mit.edu	37	9	40772516	40772516	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40772516G>A	uc004abs.2	-	5	2911	c.2759C>T	c.(2758-2760)TCT>TTT	p.S920F	ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Missense_Mutation_p.S920F	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658	920	C2H2-type 20.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TGACTTCTCAGAGAAGGTTTT	0.453													45	296	---	---	---	---	PASS
C9orf125	84302	broad.mit.edu	37	9	104239109	104239109	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104239109G>A	uc004bbm.2	-	2	588	c.266C>T	c.(265-267)TCA>TTA	p.S89L	uc004bbl.1_5'Flank	NM_032342	NP_115718	Q9BRR3	CI125_HUMAN	hypothetical protein LOC84302	89						integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)				AATGGGCACTGAGCCATTGGC	0.577													17	51	---	---	---	---	PASS
CTNNAL1	8727	broad.mit.edu	37	9	111734973	111734973	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111734973C>T	uc004bdo.1	-	9	1371	c.1329G>A	c.(1327-1329)CAG>CAA	p.Q443Q	CTNNAL1_uc010mts.1_Intron|CTNNAL1_uc010mtt.1_Silent_p.Q443Q|CTNNAL1_uc004bdp.1_Silent_p.Q443Q|CTNNAL1_uc004bdq.1_5'UTR	NM_003798	NP_003789	Q9UBT7	CTNL1_HUMAN	catenin, alpha-like 1	443					cell adhesion|Rho protein signal transduction	actin cytoskeleton|cytosol|plasma membrane	cadherin binding|structural molecule activity			ovary(1)	1				STAD - Stomach adenocarcinoma(157;0.0768)		GCTGCTCTTTCTGTTCAGAGA	0.343													63	78	---	---	---	---	PASS
QSOX2	169714	broad.mit.edu	37	9	139103153	139103153	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139103153G>A	uc010nbi.2	-	11	1544	c.1506C>T	c.(1504-1506)CTC>CTT	p.L502L		NM_181701	NP_859052	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2 precursor	502	ERV/ALR sulfhydryl oxidase.				cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity			ovary(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		TCCACAGCCAGAGGATGGCTT	0.572													39	64	---	---	---	---	PASS
SNAPC4	6621	broad.mit.edu	37	9	139282968	139282968	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139282968C>T	uc004chh.2	-	10	1060	c.1051G>A	c.(1051-1053)GAG>AAG	p.E351K		NM_003086	NP_003077	Q5SXM2	SNPC4_HUMAN	small nuclear RNA activating complex,	351	Myb-like 2.				snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter	snRNA-activating protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		TCCTCCTCCTCTGTCCACTCC	0.612													42	61	---	---	---	---	PASS
C9orf173	441476	broad.mit.edu	37	9	140146534	140146534	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140146534G>C	uc004cmk.1	+	3	359	c.347G>C	c.(346-348)CGA>CCA	p.R116P	C9orf173_uc004cmj.1_Missense_Mutation_p.R117P|C9orf173_uc011meu.1_Intron|C9orf173_uc010ncd.1_Intron|C9orf173_uc011mev.1_Missense_Mutation_p.R116P|C9orf173_uc004cml.1_Missense_Mutation_p.R116P			Q8N7X2	CI173_HUMAN	SubName: Full=LOC441476 protein;	117										pancreas(1)	1						CCGTCCGTACGAGAGTCCTCC	0.672													24	40	---	---	---	---	PASS
COBRA1	25920	broad.mit.edu	37	9	140150507	140150507	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140150507G>A	uc004cmm.3	+	2	454	c.251G>A	c.(250-252)GGG>GAG	p.G84E		NM_015456	NP_056271	Q8WX92	NELFB_HUMAN	cofactor of BRCA1	84					negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleoplasm	protein binding				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.137)	OV - Ovarian serous cystadenocarcinoma(145;9.42e-05)|Epithelial(140;0.000766)		GCTTCGGAGGGGAAGGCTGAG	0.617													17	119	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27389215	27389215	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27389215C>G	uc001ith.2	-	1	213	c.41G>C	c.(40-42)GGC>GCC	p.G14A	ANKRD26_uc009xku.1_Missense_Mutation_p.G14A	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	14						centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						CGCGAAGGAGCCCAAGGGCGA	0.667													12	39	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27389216	27389216	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27389216C>A	uc001ith.2	-	1	212	c.40G>T	c.(40-42)GGC>TGC	p.G14C	ANKRD26_uc009xku.1_Missense_Mutation_p.G14C	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	14						centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						GCGAAGGAGCCCAAGGGCGAC	0.667													13	39	---	---	---	---	PASS
ZNF33A	7581	broad.mit.edu	37	10	38345001	38345001	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38345001C>T	uc001izh.2	+	5	2124	c.1946C>T	c.(1945-1947)TCA>TTA	p.S649L	ZNF33A_uc001izg.2_Missense_Mutation_p.S650L|ZNF33A_uc010qev.1_Missense_Mutation_p.S656L|ZNF33A_uc001izi.1_Intron	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b	649	C2H2-type 12.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						TGCCATAAGTCAGCTCTAATT	0.378													84	32	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49430397	49430397	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49430397C>A	uc001jgi.2	-	12	1521	c.1414G>T	c.(1414-1416)GTC>TTC	p.V472F	FRMPD2_uc001jgh.2_Missense_Mutation_p.V441F|FRMPD2_uc001jgj.2_Missense_Mutation_p.V450F	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	472	FERM.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		AAGGCAAGGACCCCCAGCTGC	0.532													14	245	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73574711	73574711	+	Silent	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73574711G>C	uc001jrx.3	+	68	10118	c.9741G>C	c.(9739-9741)CTG>CTC	p.L3247L	CDH23_uc001jsg.3_Silent_p.L1007L|CDH23_uc001jsh.3_Silent_p.L972L|CDH23_uc001jsi.3_Silent_p.L972L|CDH23_uc001jsj.3_Silent_p.L144L|CDH23_uc010qjr.1_Silent_p.L109L	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	3247	Cytoplasmic (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						TCTTGCAGCTGATACAGACTG	0.652													6	18	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73575039	73575039	+	3'UTR	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73575039G>C	uc001jrx.3	+	68					CDH23_uc001jsg.3_3'UTR|CDH23_uc001jsh.3_3'UTR|CDH23_uc001jsi.3_3'UTR|CDH23_uc001jsj.3_3'UTR|CDH23_uc010qjr.1_3'UTR	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						GCTGTGACTAGACAGGGAAGC	0.647													8	7	---	---	---	---	PASS
USP54	159195	broad.mit.edu	37	10	75276202	75276202	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75276202G>T	uc001juo.2	-	18	3999	c.3982C>A	c.(3982-3984)CAG>AAG	p.Q1328K	USP54_uc010qkk.1_Missense_Mutation_p.Q510K|USP54_uc001juk.2_Missense_Mutation_p.Q416K|USP54_uc001jul.2_Missense_Mutation_p.Q416K|USP54_uc001jum.2_RNA|USP54_uc001jun.2_RNA	NM_152586	NP_689799	Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1328					ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)					TGAGAAGCCTGAAGACTGGCC	0.532													46	62	---	---	---	---	PASS
KCNMA1	3778	broad.mit.edu	37	10	79011015	79011015	+	Splice_Site	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79011015C>T	uc001jxn.2	-	3	718	c.541_splice	c.e3-1	p.V181_splice	KCNMA1_uc001jxj.2_Splice_Site_p.V181_splice|KCNMA1_uc009xrt.1_Splice_Site|KCNMA1_uc001jxo.2_Splice_Site_p.V181_splice|KCNMA1_uc001jxm.2_Splice_Site_p.V181_splice|KCNMA1_uc001jxq.2_Splice_Site_p.V181_splice	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	CTAAGACAACCTGTAAAAGAA	0.398											OREG0020289	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	35	---	---	---	---	PASS
ANXA11	311	broad.mit.edu	37	10	81917738	81917738	+	Silent	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81917738G>T	uc001kbq.1	-	15	2145	c.1320C>A	c.(1318-1320)CTC>CTA	p.L440L	ANXA11_uc010qlx.1_Silent_p.L540L|ANXA11_uc001kbr.1_Silent_p.L440L|ANXA11_uc001kbs.1_Silent_p.L440L|ANXA11_uc001kbt.1_Silent_p.L440L|ANXA11_uc010qly.1_Silent_p.L407L|ANXA11_uc009xsq.1_Silent_p.L444L|ANXA11_uc001kbu.1_Silent_p.L440L	NM_145869	NP_665876	P50995	ANX11_HUMAN	annexin A11	440	Annexin 4.				cell cycle|cytokinesis, completion of separation|phagocytosis|response to calcium ion	azurophil granule|melanosome|midbody|nuclear envelope|nucleoplasm|phagocytic vesicle|specific granule|spindle	calcium-dependent phospholipid binding|calcium-dependent protein binding|S100 alpha binding			ovary(1)	1	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			TGGCCTTGTTGAGCCTCTCCG	0.537													13	87	---	---	---	---	PASS
HPSE2	60495	broad.mit.edu	37	10	100481512	100481512	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100481512C>T	uc001kpn.1	-	5	918	c.858G>A	c.(856-858)CTG>CTA	p.L286L	HPSE2_uc009xwc.1_Silent_p.L276L|HPSE2_uc001kpo.1_Silent_p.L218L|HPSE2_uc009xwd.1_Silent_p.L164L	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2	286					carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		ACAGGCTCTTCAGCTGGATGT	0.498													77	90	---	---	---	---	PASS
NT5C2	22978	broad.mit.edu	37	10	104865453	104865453	+	Intron	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104865453C>T	uc001kwo.2	-						NT5C2_uc010qqp.1_Intron|NT5C2_uc001kwq.2_Intron|NT5C2_uc001kwp.2_Intron	NM_012229	NP_036361	P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II						purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|metal ion binding|nucleotide binding|protein binding				0		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	TAAAGGTTCTCTGTACTCACC	0.363													43	65	---	---	---	---	PASS
NT5C2	22978	broad.mit.edu	37	10	104865481	104865481	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104865481C>G	uc001kwo.2	-	6	557	c.371G>C	c.(370-372)GGA>GCA	p.G124A	NT5C2_uc010qqp.1_Missense_Mutation_p.G95A|NT5C2_uc001kwq.2_Missense_Mutation_p.G124A|NT5C2_uc001kwp.2_5'UTR	NM_012229	NP_036361	P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II	124					purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|metal ion binding|nucleotide binding|protein binding				0		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	AAAGTTAAATCCATGTGCACA	0.378													53	81	---	---	---	---	PASS
HABP2	3026	broad.mit.edu	37	10	115348129	115348129	+	3'UTR	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115348129G>T	uc001lai.3	+	13						NM_004132	NP_004123	Q14520	HABP2_HUMAN	hyaluronan binding protein 2 preproprotein						cell adhesion|proteolysis	extracellular space	glycosaminoglycan binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)		TGGCTTCTAAGGTACTGTCTT	0.562													13	46	---	---	---	---	PASS
ATE1	11101	broad.mit.edu	37	10	123658405	123658405	+	Missense_Mutation	SNP	T	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123658405T>C	uc001lfp.2	-	7	975	c.893A>G	c.(892-894)TAT>TGT	p.Y298C	ATE1_uc001lfq.2_Intron|ATE1_uc010qtr.1_Intron|ATE1_uc010qts.1_Missense_Mutation_p.Y202C|ATE1_uc010qtt.1_Missense_Mutation_p.Y291C|ATE1_uc001lfr.2_Intron|ATE1_uc009xzu.2_Intron	NM_007041	NP_008972	O95260	ATE1_HUMAN	arginyltransferase 1 isoform 2	298					protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity				0		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				GGCCACTTGATACTTGACATA	0.438													42	68	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	127824200	127824200	+	Silent	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127824200C>A	uc001ljk.2	-	5	791	c.378G>T	c.(376-378)CGG>CGT	p.R126R	ADAM12_uc010qul.1_Silent_p.R123R|ADAM12_uc001ljm.2_Silent_p.R126R|ADAM12_uc001ljn.2_Silent_p.R123R|ADAM12_uc001ljl.3_Silent_p.R123R	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	126					cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CAGAATATCCCCGTACATGTC	0.468													7	58	---	---	---	---	PASS
PKP3	11187	broad.mit.edu	37	11	399030	399030	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:399030C>T	uc001lpc.2	+	5	1183	c.1107C>T	c.(1105-1107)CTC>CTT	p.L369L		NM_007183	NP_009114	Q9Y446	PKP3_HUMAN	plakophilin 3	369	ARM 2.				cell adhesion	desmosome|nucleus	binding			skin(1)	1		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGTGAAGCTCTTCAACCACG	0.612													15	87	---	---	---	---	PASS
OR52R1	119695	broad.mit.edu	37	11	4825572	4825572	+	Silent	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4825572C>A	uc010qym.1	-	1	276	c.276G>T	c.(274-276)GTG>GTT	p.V92V		NM_001005177	NP_001005177	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R,	13	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGATGAAGGACACAGGATGAG	0.488													3	70	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26465322	26465322	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26465322G>A	uc001mqt.3	+	3	397	c.252G>A	c.(250-252)GAG>GAA	p.E84E	ANO3_uc010rdr.1_Silent_p.E68E	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	84	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TTAATACTGAGGAGAATAAAA	0.343													16	57	---	---	---	---	PASS
MPPED2	744	broad.mit.edu	37	11	30439182	30439182	+	Splice_Site	SNP	T	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30439182T>A	uc001msr.2	-	4	657	c.537_splice	c.e4-1	p.W179_splice	MPPED2_uc001msq.3_Splice_Site_p.W179_splice|MPPED2_uc009yji.2_Splice_Site_p.W53_splice	NM_001584	NP_001575	Q15777	MPPD2_HUMAN	metallophosphoesterase domain containing 2						nervous system development		hydrolase activity|metal ion binding			skin(1)	1						CACGGGGTCCTTTGGGGGAGA	0.532													10	33	---	---	---	---	PASS
ARFGAP2	84364	broad.mit.edu	37	11	47188385	47188385	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47188385C>T	uc001ndt.2	-	13	1273	c.1258G>A	c.(1258-1260)GAG>AAG	p.E420K	ARFGAP2_uc010rha.1_Missense_Mutation_p.E151K|ARFGAP2_uc010rhb.1_Missense_Mutation_p.E392K|ARFGAP2_uc001ndu.2_Missense_Mutation_p.E284K|ARFGAP2_uc010rhc.1_Missense_Mutation_p.E151K	NM_032389	NP_115765	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating	420	Required for interaction with coatomer.				protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding			ovary(1)	1						TGACGCGCCTCACTAGACTCG	0.567													138	188	---	---	---	---	PASS
LRRC55	219527	broad.mit.edu	37	11	56954921	56954921	+	Silent	SNP	C	A	A	rs142633236		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56954921C>A	uc001njl.1	+	2	1140	c.993C>A	c.(991-993)CGC>CGA	p.R331R	LRRC55_uc001njm.1_5'Flank	NM_001005210	NP_001005210	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	301						integral to membrane					0						GCTGCCACCGCTGGAGCAAGG	0.587													5	52	---	---	---	---	PASS
LRRC55	219527	broad.mit.edu	37	11	56954922	56954922	+	Missense_Mutation	SNP	T	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56954922T>A	uc001njl.1	+	2	1141	c.994T>A	c.(994-996)TGG>AGG	p.W332R	LRRC55_uc001njm.1_5'Flank	NM_001005210	NP_001005210	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	302						integral to membrane					0						CTGCCACCGCTGGAGCAAGGC	0.587													5	51	---	---	---	---	PASS
PRG3	10394	broad.mit.edu	37	11	57148124	57148124	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57148124G>A	uc001njv.1	-	2	168	c.58C>T	c.(58-60)CTG>TTG	p.L20L		NM_006093	NP_006084	Q9Y2Y8	PRG3_HUMAN	proteoglycan 3 precursor	20					basophil activation|histamine biosynthetic process|immune response|leukotriene biosynthetic process|negative regulation of translation|neutrophil activation|positive regulation of interleukin-8 biosynthetic process|superoxide anion generation		sugar binding				0						GACTTACCCAGATGAAGAGCA	0.507													6	13	---	---	---	---	PASS
DTX4	23220	broad.mit.edu	37	11	58949569	58949569	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58949569C>T	uc001nns.2	+	2	826	c.569C>T	c.(568-570)TCC>TTC	p.S190F	DTX4_uc001nnr.2_Missense_Mutation_p.S84F	NM_015177	NP_055992	Q9Y2E6	DTX4_HUMAN	deltex 4 homolog	190					Notch signaling pathway	cytoplasm	zinc ion binding			lung(2)|central_nervous_system(1)	3		all_epithelial(135;0.125)				TCCCCCTGCTCCTGTCCCCAG	0.632													23	25	---	---	---	---	PASS
ZP1	22917	broad.mit.edu	37	11	60638697	60638697	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60638697G>T	uc001nqd.2	+	6	1042	c.1022G>T	c.(1021-1023)GGC>GTC	p.G341V	ZP1_uc001nqe.2_Missense_Mutation_p.G48V	NM_207341	NP_997224	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 precursor	341	Extracellular (Potential).|ZP.				single fertilization	integral to membrane|plasma membrane|proteinaceous extracellular matrix					0						CAGGTGGCTGGCGACCAGCTC	0.607													15	48	---	---	---	---	PASS
CD6	923	broad.mit.edu	37	11	60780938	60780938	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60780938G>A	uc001nqq.2	+	7	1417	c.1194G>A	c.(1192-1194)GAG>GAA	p.E398E	CD6_uc009yni.2_Silent_p.E297E|CD6_uc009ynj.2_Silent_p.E275E|CD6_uc001nqp.2_Silent_p.E398E|CD6_uc001nqr.2_Silent_p.E398E|CD6_uc001nqs.2_RNA|CD6_uc001nqt.2_Silent_p.E398E	NM_006725	NP_006716	P30203	CD6_HUMAN	CD6 molecule precursor	398	Extracellular (Potential).				cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1						AATCTCGGGAGCTAATGCTCC	0.438													75	258	---	---	---	---	PASS
C11orf9	745	broad.mit.edu	37	11	61547302	61547302	+	Intron	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61547302C>G	uc001nsc.1	+						C11orf9_uc001nse.1_Intron|C11orf9_uc010rll.1_Intron	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2						central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						CACTTTTCCTCTTGGTCCTCA	0.622													14	23	---	---	---	---	PASS
ESRRA	2101	broad.mit.edu	37	11	64083327	64083327	+	Silent	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64083327C>A	uc001nzq.1	+	7	1338	c.1161C>A	c.(1159-1161)CTC>CTA	p.L387L	ESRRA_uc001nzr.1_Silent_p.L386L|ESRRA_uc001nzs.1_Silent_p.L387L|PRDX5_uc001nzu.2_5'Flank|PRDX5_uc001nzv.2_5'Flank|PRDX5_uc001nzw.2_5'Flank|PRDX5_uc001nzx.2_5'Flank	NM_004451	NP_004442	P11474	ERR1_HUMAN	estrogen-related receptor alpha	387	Ligand binding domain.				positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein domain specific binding|sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding				0						CGCTACCGCTCCTCCGCCAGA	0.677													18	38	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65270077	65270077	+	RNA	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65270077G>A	uc010roh.1	+	1		c.4845G>A			uc001ody.2_RNA|MALAT1_uc001odz.2_Intron	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						TTTTGTTGATGAGGGAGGGGA	0.343													25	43	---	---	---	---	PASS
PCF11	51585	broad.mit.edu	37	11	82876801	82876801	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82876801C>T	uc001ozx.3	+	5	1207	c.862C>T	c.(862-864)CAG>TAG	p.Q288*	PCF11_uc010rsu.1_Nonsense_Mutation_p.Q288*	NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11	288					mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1						CTTACAAATTCAGGATTTAAA	0.423													9	16	---	---	---	---	PASS
PCF11	51585	broad.mit.edu	37	11	82877735	82877735	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82877735C>T	uc001ozx.3	+	5	2141	c.1796C>T	c.(1795-1797)TCT>TTT	p.S599F	PCF11_uc010rsu.1_Missense_Mutation_p.S599F	NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11	599					mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1						AGATGGAAATCTGGTTGGGAA	0.333													38	86	---	---	---	---	PASS
USP2	9099	broad.mit.edu	37	11	119243758	119243758	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119243758C>T	uc001pwm.3	-	2	728	c.433G>A	c.(433-435)GAC>AAC	p.D145N	USP2_uc001pwn.3_Intron	NM_004205	NP_004196	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2 isoform a	145	Necessary for interaction with MDM4.				cell cycle|muscle organ development|negative regulation of transcription from RNA polymerase II promoter|positive regulation of mitotic cell cycle|protein deubiquitination|protein stabilization|ubiquitin-dependent protein catabolic process	nucleus|perinuclear region of cytoplasm	cyclin binding|cysteine-type endopeptidase activity|metal ion binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity			ovary(2)|urinary_tract(1)|skin(1)	4		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		CGGGCCAGGTCTGATTGGCTG	0.612													81	30	---	---	---	---	PASS
B4GALNT3	283358	broad.mit.edu	37	12	662805	662805	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:662805G>C	uc001qii.1	+	14	1716	c.1716G>C	c.(1714-1716)CAG>CAC	p.Q572H	B4GALNT3_uc001qij.1_Missense_Mutation_p.Q475H|B4GALNT3_uc001qik.1_Missense_Mutation_p.Q121H	NM_173593	NP_775864	Q6L9W6	B4GN3_HUMAN	beta	572	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			TCGCAGAGCAGAGACGGGGTG	0.637													31	59	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9225294	9225294	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9225294C>T	uc001qvk.1	-	30	4043	c.3930G>A	c.(3928-3930)GGG>GGA	p.G1310G	A2M_uc001qvj.1_Silent_p.G352G|A2M_uc009zgk.1_Silent_p.G1160G	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	1310					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	TGCTGTATTCCCCAGGCAGCT	0.517													22	218	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13716391	13716391	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13716391G>A	uc001rbt.2	-	13	3960	c.3781C>T	c.(3781-3783)CAG>TAG	p.Q1261*		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	1261	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TCCAGTTCCTGCAGGGAGTTG	0.592													56	63	---	---	---	---	PASS
PLEKHA5	54477	broad.mit.edu	37	12	19514590	19514590	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19514590G>C	uc001reb.2	+	23	3146	c.3060G>C	c.(3058-3060)ATG>ATC	p.M1020I	PLEKHA5_uc010sie.1_Missense_Mutation_p.M1181I|PLEKHA5_uc001rea.2_Missense_Mutation_p.M1078I|PLEKHA5_uc009zin.2_Missense_Mutation_p.M778I|PLEKHA5_uc010sif.1_Missense_Mutation_p.M1009I|PLEKHA5_uc010sig.1_Missense_Mutation_p.M1002I|PLEKHA5_uc010sih.1_Missense_Mutation_p.M975I|PLEKHA5_uc001rec.1_Missense_Mutation_p.M829I|PLEKHA5_uc009zio.2_Missense_Mutation_p.M286I	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	1020							1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					CTGTGGAAATGATGGATAAAG	0.294													19	34	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40618944	40618944	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40618944G>A	uc001rmg.3	+	1	132	c.11G>A	c.(10-12)GGC>GAC	p.G4D		NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	4					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				ATGGCTAGTGGCAGCTGTCAG	0.607													17	21	---	---	---	---	PASS
PFKM	5213	broad.mit.edu	37	12	48516643	48516643	+	Splice_Site	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48516643G>T	uc001rrc.2	+	2	255	c.85_splice	c.e2+1	p.G29_splice	PFKM_uc001rra.1_Splice_Site|PFKM_uc001rrb.1_Splice_Site_p.G100_splice|PFKM_uc001rrd.2_Splice_Site|PFKM_uc001rre.1_Splice_Site_p.G29_splice|PFKM_uc001rrg.1_Splice_Site_p.G29_splice	NM_000289	NP_000280	P08237	K6PF_HUMAN	phosphofructokinase, muscle						fructose 6-phosphate metabolic process|glycolysis|muscle cell homeostasis	6-phosphofructokinase complex|apical plasma membrane	6-phosphofructokinase activity|ATP binding|identical protein binding|kinase binding|metal ion binding|protein C-terminus binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4						GATGCCCAAGGTAAGGAGGAG	0.468													8	46	---	---	---	---	PASS
TUBA1C	84790	broad.mit.edu	37	12	49666851	49666851	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49666851G>A	uc001rtt.1	+	4	1291	c.1191G>A	c.(1189-1191)CTG>CTA	p.L397L	TUBA1C_uc001rts.2_Silent_p.L362L|TUBA1C_uc010smh.1_Silent_p.L467L|uc010smi.1_5'UTR	NM_032704	NP_116093	Q9BQE3	TBA1C_HUMAN	tubulin alpha 6	397					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0						AGTTTGACCTGATGTATGCCA	0.587													50	59	---	---	---	---	PASS
KRT84	3890	broad.mit.edu	37	12	52774241	52774241	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52774241G>A	uc001sah.1	-	7	1378	c.1330C>T	c.(1330-1332)CAG>TAG	p.Q444*		NM_033045	NP_149034	Q9NSB2	KRT84_HUMAN	keratin, hair, basic, 4	444	Rod.|Coil 2.					keratin filament	structural constituent of epidermis			skin(1)	1	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TCGCACAGCTGCCGCGCCATG	0.647											OREG0021848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	42	40	---	---	---	---	PASS
HNRNPA1	3178	broad.mit.edu	37	12	54674580	54674580	+	5'UTR	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54674580C>T	uc001sfl.2	+	1					CBX5_uc001sfk.3_5'Flank|CBX5_uc001sfi.3_5'Flank|HNRNPA1_uc001sfm.2_5'UTR|HNRNPA1_uc009zng.2_5'UTR|HNRNPA1_uc009znh.2_5'UTR|HNRNPA1_uc009zni.2_5'UTR|HNRNPA1_uc001sfn.2_5'UTR|HNRNPA1_uc001sfo.3_RNA|HNRNPA1_uc001sfp.1_5'UTR|HNRNPA1_uc009znj.1_5'Flank	NM_031157	NP_112420	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1						interspecies interaction between organisms|mRNA transport|nuclear import	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|single-stranded DNA binding			skin(2)|ovary(1)	3						AGTCTCTCTTCACCCTGCCGT	0.517													59	86	---	---	---	---	PASS
COPZ1	22818	broad.mit.edu	37	12	54739300	54739300	+	Splice_Site	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54739300G>T	uc001sfs.1	+	5	354	c.317_splice	c.e5+1	p.R106_splice	COPZ1_uc001sft.2_Splice_Site_p.R55_splice|COPZ1_uc009znm.1_Splice_Site_p.R114_splice|COPZ1_uc010sot.1_Splice_Site_p.R83_splice	NM_016057	NP_057141	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol					0						AGATGCTGAGGTGAGCAGGAC	0.458													4	79	---	---	---	---	PASS
STAT2	6773	broad.mit.edu	37	12	56743203	56743203	+	Intron	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56743203C>T	uc001slc.2	-						STAT2_uc001slb.2_Intron|STAT2_uc001sld.2_Intron|STAT2_uc010sqn.1_Missense_Mutation_p.E446K	NM_005419	NP_005410	P52630	STAT2_HUMAN	signal transducer and activator of transcription						interspecies interaction between organisms|JAK-STAT cascade|regulation of transcription from RNA polymerase II promoter|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	cytosol|nucleoplasm|plasma membrane	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3						CCTCCATTTTCACTCACTTTC	0.507													106	176	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57593029	57593029	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57593029G>A	uc001snd.2	+	61	10177	c.9711G>A	c.(9709-9711)CTG>CTA	p.L3237L		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3237	LDL-receptor class B 29.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TCTTTGCACTGACCCTGTTTG	0.602													233	325	---	---	---	---	PASS
STAC3	246329	broad.mit.edu	37	12	57638093	57638093	+	Intron	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57638093C>T	uc001snp.2	-						STAC3_uc009zpl.2_Intron|STAC3_uc001snq.2_Intron|STAC3_uc010srm.1_Intron	NM_145064	NP_659501	Q96MF2	STAC3_HUMAN	SH3 and cysteine rich domain 3						intracellular signal transduction		identical protein binding|metal ion binding			ovary(2)|skin(1)	3						AGCCATTTCTCTCACCCGCCA	0.552											OREG0021942	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	38	60	---	---	---	---	PASS
GLI1	2735	broad.mit.edu	37	12	57861784	57861784	+	Missense_Mutation	SNP	A	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57861784A>G	uc001snx.2	+	10	1163	c.1085A>G	c.(1084-1086)TAT>TGT	p.Y362C	GLI1_uc009zpq.2_Missense_Mutation_p.Y234C	NM_005269	NP_005260	P08151	GLI1_HUMAN	GLI family zinc finger 1 isoform 1	362	C2H2-type 5.				epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding			skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15			GBM - Glioblastoma multiforme(3;3.99e-32)			CAGAAGCCGTATGTATGTAAG	0.507													30	41	---	---	---	---	PASS
DYRK2	8445	broad.mit.edu	37	12	68051350	68051350	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68051350G>T	uc001str.3	+	3	1065	c.663G>T	c.(661-663)AGG>AGT	p.R221S	DYRK2_uc001sts.3_Missense_Mutation_p.R148S	NM_006482	NP_006473	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	221					apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|positive regulation of glycogen biosynthetic process|smoothened signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|manganese ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(1)|central_nervous_system(1)	4			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		TGGCTTACAGGTATGAGGTCC	0.562													5	63	---	---	---	---	PASS
SLC41A2	84102	broad.mit.edu	37	12	105255155	105255155	+	Intron	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105255155G>A	uc001tla.2	-							NM_032148	NP_115524	Q96JW4	S41A2_HUMAN	solute carrier family 41, member 2							integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity			ovary(1)|skin(1)	2						AATGCTGAAAGAGATAAAATT	0.343													12	35	---	---	---	---	PASS
ACACB	32	broad.mit.edu	37	12	109623543	109623543	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109623543G>A	uc001tob.2	+	12	2097	c.1978G>A	c.(1978-1980)GAG>AAG	p.E660K	ACACB_uc001toc.2_Missense_Mutation_p.E660K	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	660	Biotin carboxylation.				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	AAACCCAGACGAGGCAAGTTA	0.478													14	44	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116549243	116549243	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116549243G>A	uc001tvw.2	-	3	440	c.385C>T	c.(385-387)CTG>TTG	p.L129L		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	129					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CTTTCTAACAGATTGTGGATC	0.368													39	62	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120582788	120582788	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120582788C>T	uc001txo.2	-	40	5107	c.5094G>A	c.(5092-5094)CCG>CCA	p.P1698P		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	1698					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCATCAGCCACGGCAGCAAGT	0.612													36	77	---	---	---	---	PASS
TMEM132B	114795	broad.mit.edu	37	12	126068523	126068523	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126068523G>A	uc001uhe.1	+	5	1413	c.1405G>A	c.(1405-1407)GAT>AAT	p.D469N		NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	469	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CAAGTCTGCCGATGAAGATGT	0.478													139	183	---	---	---	---	PASS
TMEM132B	114795	broad.mit.edu	37	12	126138642	126138642	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126138642C>T	uc001uhe.1	+	9	2631	c.2623C>T	c.(2623-2625)CAA>TAA	p.Q875*	TMEM132B_uc001uhf.1_Nonsense_Mutation_p.Q387*	NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	875	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CTTCCCCACTCAAGGGAAGTC	0.507													27	51	---	---	---	---	PASS
ZMYM5	9205	broad.mit.edu	37	13	20413087	20413087	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20413087G>A	uc010tcn.1	-	5	890	c.625C>T	c.(625-627)CAG>TAG	p.Q209*	ZMYM5_uc001umm.1_Nonsense_Mutation_p.Q33*|ZMYM5_uc001umn.2_Nonsense_Mutation_p.Q209*|ZMYM5_uc001umo.2_Intron	NM_001142684	NP_001136156	Q9UJ78	ZMYM5_HUMAN	zinc finger protein 237 isoform 3	209						nucleus	zinc ion binding				0		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		GGCTGTTTCTGATTACTGGGA	0.373													104	110	---	---	---	---	PASS
NBEA	26960	broad.mit.edu	37	13	36124678	36124678	+	Nonsense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36124678C>G	uc001uvb.2	+	42	6856	c.6650C>G	c.(6649-6651)TCA>TGA	p.S2217*	NBEA_uc010abi.2_Nonsense_Mutation_p.S873*|NBEA_uc010tee.1_Nonsense_Mutation_p.S10*|NBEA_uc010tef.1_Nonsense_Mutation_p.S10*|NBEA_uc010teg.1_Nonsense_Mutation_p.S10*	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	2217						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GCTGTATTTTCAAGACGTTAC	0.358													29	33	---	---	---	---	PASS
RCBTB1	55213	broad.mit.edu	37	13	50134125	50134125	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50134125G>A	uc001vde.1	-	5	634	c.373C>T	c.(373-375)CTC>TTC	p.L125F		NM_018191	NP_060661	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and	125	RCC1 2.				cell cycle|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(1)	1		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		TTGATCAAGAGATTGGTACAG	0.488													103	147	---	---	---	---	PASS
LIG4	3981	broad.mit.edu	37	13	108861930	108861930	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108861930C>T	uc001vqn.2	-	2	1960	c.1687G>A	c.(1687-1689)GAG>AAG	p.E563K	LIG4_uc001vqo.2_Missense_Mutation_p.E563K|LIG4_uc010agg.1_Missense_Mutation_p.E496K|LIG4_uc010agf.2_Missense_Mutation_p.E563K|LIG4_uc001vqp.2_Missense_Mutation_p.E563K	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	563					cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					GGTACGATCTCTGCTGCTTTA	0.413								NHEJ					38	58	---	---	---	---	PASS
F10	2159	broad.mit.edu	37	13	113798358	113798358	+	Silent	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113798358C>G	uc001vsx.2	+	6	753	c.696C>G	c.(694-696)CTC>CTG	p.L232L	F10_uc010agq.1_RNA|F10_uc001vsy.2_Silent_p.L232L|F10_uc001vsz.2_Silent_p.L232L	NM_000504	NP_000495	P00742	FA10_HUMAN	coagulation factor X preproprotein	232					blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of cell migration|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|phospholipid binding|protein binding|serine-type endopeptidase activity			pancreas(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Heparin(DB01109)|Menadione(DB00170)|Reteplase(DB00015)|Tenecteplase(DB00031)	ACAACAACCTCACCAGGATCG	0.617													52	77	---	---	---	---	PASS
MMP14	4323	broad.mit.edu	37	14	23311854	23311854	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23311854G>T	uc001whc.2	+	4	850	c.616G>T	c.(616-618)GGC>TGC	p.G206C		NM_004995	NP_004986	P50281	MMP14_HUMAN	matrix metalloproteinase 14 preproprotein	206	Extracellular (Potential).					extracellular matrix|integral to plasma membrane|melanosome	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)		CTACTTCCCAGGCCCCAACAT	0.577													23	83	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23855739	23855739	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23855739C>T	uc001wjv.2	-	33	4811	c.4744G>A	c.(4744-4746)GAC>AAC	p.D1582N		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	1582	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		ATCTCCTCGTCCTTCTCTGCC	0.627													122	204	---	---	---	---	PASS
LRRC16B	90668	broad.mit.edu	37	14	24526211	24526211	+	Missense_Mutation	SNP	T	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24526211T>A	uc001wlj.2	+	13	1197	c.1040T>A	c.(1039-1041)CTC>CAC	p.L347H		NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	347	LRR 4.									ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)		AATCCTGGGCTCCTCGCCACG	0.612													7	17	---	---	---	---	PASS
MBIP	51562	broad.mit.edu	37	14	36780895	36780895	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36780895C>G	uc001wtm.2	-	6	762	c.674G>C	c.(673-675)AGA>ACA	p.R225T	MBIP_uc001wto.2_Missense_Mutation_p.R225T|MBIP_uc010tpy.1_Missense_Mutation_p.R84T|MBIP_uc001wtn.2_Missense_Mutation_p.R225T	NM_016586	NP_057670	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1 isoform 1	225	Interaction with MAP3K12.				histone H3 acetylation|inactivation of MAPK activity involved in osmosensory signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm|nucleolus	identical protein binding|protein kinase inhibitor activity				0	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		TCCTTCAGGTCTAGTCTGTGG	0.378													24	49	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64494261	64494261	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64494261G>A	uc001xgm.2	+	43	6694	c.6464G>A	c.(6463-6465)AGA>AAA	p.R2155K	SYNE2_uc001xgl.2_Missense_Mutation_p.R2155K	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2155	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GAGGATCTGAGATTAATGCTC	0.308													14	112	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64494262	64494262	+	Missense_Mutation	SNP	A	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64494262A>T	uc001xgm.2	+	43	6695	c.6465A>T	c.(6463-6465)AGA>AGT	p.R2155S	SYNE2_uc001xgl.2_Missense_Mutation_p.R2155S	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2155	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGGATCTGAGATTAATGCTCA	0.308													14	113	---	---	---	---	PASS
C14orf174	161394	broad.mit.edu	37	14	77845098	77845098	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77845098G>C	uc001xtq.1	+	1	1337	c.1337G>C	c.(1336-1338)AGA>ACA	p.R446T	TMED8_uc010ast.1_5'Flank|TMED8_uc001xto.1_5'Flank	NM_001010860	NP_001010860	Q9P1V8	SAM15_HUMAN	hypothetical protein LOC161394	446											0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0278)		GAGCCTAAAAGAGGAAAGTTG	0.378													38	46	---	---	---	---	PASS
SERPINA5	5104	broad.mit.edu	37	14	95053973	95053973	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95053973C>T	uc001ydm.2	+	3	484	c.274C>T	c.(274-276)CTG>TTG	p.L92L	SERPINA5_uc010ave.2_Silent_p.L92L|SERPINA5_uc001ydn.1_Silent_p.L92L	NM_000624	NP_000615	P05154	IPSP_HUMAN	serine (or cysteine) proteinase inhibitor, clade	92					fusion of sperm to egg plasma membrane|regulation of proteolysis|spermatogenesis	extracellular region|membrane|protein complex	acrosin binding|heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(2)	2				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	GATGCAGATCCTGGAGGGCCT	0.597													6	35	---	---	---	---	PASS
NUDT14	256281	broad.mit.edu	37	14	105639498	105639498	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105639498C>T	uc010tyn.1	-	5	643	c.529G>A	c.(529-531)GAG>AAG	p.E177K	NUDT14_uc001yqi.2_RNA	NM_177533	NP_803877	O95848	NUD14_HUMAN	nudix-type motif 14	177	Nudix hydrolase.					cytoplasm	metal ion binding|protein binding|UDP-sugar diphosphatase activity			skin(1)	1		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		TCAATGAGCTCACCCTCCTCC	0.622										HNSCC(42;0.11)			33	36	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106311923	106311923	+	RNA	SNP	A	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106311923A>G	uc010tyt.1	-	3608		c.57000T>C			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysj.2_Missense_Mutation_p.I44T|uc001ysk.1_Missense_Mutation_p.I44T|uc001ysl.1_Missense_Mutation_p.I44T|uc001ysm.1_5'UTR|uc001ysn.1_5'UTR|uc001yso.1_5'UTR					Parts of antibodies, mostly variable regions.												0						GTACCCAGTTATCAAGCATGC	0.562													39	58	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34130533	34130533	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34130533G>A	uc001zhi.2	+	89	12422	c.12352G>A	c.(12352-12354)GAA>AAA	p.E4118K	RYR3_uc010bar.2_Missense_Mutation_p.E4113K	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	4118					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGAAGAAGATGAAGATTCTTC	0.478													83	111	---	---	---	---	PASS
MGA	23269	broad.mit.edu	37	15	42053973	42053973	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42053973G>A	uc010ucy.1	+	21	7616	c.7435G>A	c.(7435-7437)GAC>AAC	p.D2479N	MGA_uc010ucz.1_Missense_Mutation_p.D2270N|MGA_uc010uda.1_Missense_Mutation_p.D1095N	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	2440						MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		AGATCAGGCAGACAAATTGAT	0.373													5	9	---	---	---	---	PASS
ZFP106	64397	broad.mit.edu	37	15	42742728	42742728	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42742728C>A	uc001zpw.2	-	2	2008	c.1673G>T	c.(1672-1674)AGT>ATT	p.S558I	ZFP106_uc001zpu.2_5'Flank|ZFP106_uc001zpv.2_Intron|ZFP106_uc001zpx.2_Intron|ZFP106_uc010udh.1_Missense_Mutation_p.S341I|ZFP106_uc001zpy.1_Missense_Mutation_p.S581I	NM_022473	NP_071918	Q9H2Y7	ZF106_HUMAN	zinc finger protein 106 homolog	558						nucleolus	zinc ion binding			central_nervous_system(2)|ovary(1)	3		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.6e-07)		GTTCCTGGTACTTTTAGAAGT	0.363													32	196	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43724535	43724535	+	Missense_Mutation	SNP	T	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43724535T>A	uc001zrs.2	-	17	3665	c.3517A>T	c.(3517-3519)ACT>TCT	p.T1173S	TP53BP1_uc010udp.1_Missense_Mutation_p.T1173S|TP53BP1_uc001zrq.3_Missense_Mutation_p.T1178S|TP53BP1_uc001zrr.3_Missense_Mutation_p.T1178S|TP53BP1_uc010udq.1_Missense_Mutation_p.T1178S	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	1173					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TTCTTTATAGTCTGGGTTGCT	0.483								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					4	137	---	---	---	---	PASS
MYO5C	55930	broad.mit.edu	37	15	52486209	52486209	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52486209C>T	uc010bff.2	-	41	5256	c.5119G>A	c.(5119-5121)GAT>AAT	p.D1707N	GNB5_uc002abt.1_5'Flank|MYO5C_uc010uga.1_RNA|uc002abv.2_Intron	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	1707						myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		TATTTGGTATCCAACATCAGC	0.418													5	125	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63054650	63054650	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63054650C>G	uc002alb.3	+	36	4959	c.4959C>G	c.(4957-4959)ATC>ATG	p.I1653M	TLN2_uc002alc.3_Missense_Mutation_p.I46M|TLN2_uc002ald.2_Missense_Mutation_p.I46M	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1653					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						TCACTTCTATCAGGTCAGTTT	0.522													47	90	---	---	---	---	PASS
PPIB	5479	broad.mit.edu	37	15	64452400	64452400	+	Intron	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64452400G>C	uc002and.2	-						PPIB_uc010bgx.1_Intron	NM_000942	NP_000933	P23284	PPIB_HUMAN	peptidylprolyl isomerase B precursor						protein folding	endoplasmic reticulum lumen|melanosome	peptide binding|peptidyl-prolyl cis-trans isomerase activity|unfolded protein binding				0					L-Proline(DB00172)	ATCCTTTCTAGAAAAAGGGAA	0.478													34	37	---	---	---	---	PASS
HEXA	3073	broad.mit.edu	37	15	72643537	72643537	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72643537C>T	uc002aun.3	-	6	816	c.609G>A	c.(607-609)TGG>TGA	p.W203*	uc002aug.2_RNA|CELF6_uc002auk.3_Intron|HEXA_uc010ukn.1_Nonsense_Mutation_p.W214*|HEXA_uc002auo.3_Nonsense_Mutation_p.W66*|HEXA_uc010bix.2_Nonsense_Mutation_p.W203*|HEXA_uc010biy.2_Nonsense_Mutation_p.W66*|HEXA_uc010uko.1_Nonsense_Mutation_p.W29*|HEXA_uc010biz.1_RNA	NM_000520	NP_000511	P06865	HEXA_HUMAN	hexosaminidase A preproprotein	203					cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity			ovary(3)|upper_aerodigestive_tract(1)	4						CTACCAGATGCCAGTGGAACA	0.458													20	58	---	---	---	---	PASS
SGK269	79834	broad.mit.edu	37	15	77471836	77471836	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77471836C>T	uc002bcm.2	-	3	2741	c.2433G>A	c.(2431-2433)AAG>AAA	p.K811K	SGK269_uc002bcn.2_Silent_p.K811K	NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	811	Pro-rich.				cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		CTGGCGTACTCTTAGGTGTGC	0.502													58	75	---	---	---	---	PASS
SGK269	79834	broad.mit.edu	37	15	77473983	77473983	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77473983C>A	uc002bcm.2	-	3	594	c.286G>T	c.(286-288)GAG>TAG	p.E96*	SGK269_uc002bcn.2_Nonsense_Mutation_p.E96*	NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	96					cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		GGTTTGTTCTCACAGTGTTCT	0.438													86	105	---	---	---	---	PASS
WDR93	56964	broad.mit.edu	37	15	90270543	90270543	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90270543G>A	uc002boj.2	+	9	1137	c.1036G>A	c.(1036-1038)GAG>AAG	p.E346K	WDR93_uc010bnr.2_Missense_Mutation_p.E346K|WDR93_uc010upz.1_Missense_Mutation_p.E63K	NM_020212	NP_064597	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	346					electron transport chain	mitochondrial inner membrane	oxidoreductase activity, acting on NADH or NADPH			ovary(2)	2	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			TAGGGAGTGGGAGGAAGAGCC	0.552													17	23	---	---	---	---	PASS
C15orf51	196968	broad.mit.edu	37	15	100345119	100345119	+	RNA	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100345119C>T	uc010urx.1	-	2		c.148G>A			C15orf51_uc010ury.1_Intron|C15orf51_uc010urz.1_RNA|C15orf51_uc010bow.2_Intron|uc010box.2_5'Flank	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						AGTTAGCTCTCGGCACATGGT	0.418													39	83	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1394611	1394611	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1394611C>T	uc002clk.1	+	19	1774	c.1774C>T	c.(1774-1776)CAG>TAG	p.Q592*	BAIAP3_uc002clj.2_Nonsense_Mutation_p.Q574*|BAIAP3_uc010uuz.1_Nonsense_Mutation_p.Q557*|BAIAP3_uc010uva.1_Nonsense_Mutation_p.Q529*|BAIAP3_uc010uvc.1_Nonsense_Mutation_p.Q521*	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	592					G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				GCCAGGACCACAGCGCCTGCC	0.642													73	374	---	---	---	---	PASS
C16orf63	123811	broad.mit.edu	37	16	15978045	15978045	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15978045C>T	uc002dec.1	-	2	51	c.46G>A	c.(46-48)GAA>AAA	p.E16K	C16orf63_uc002ded.1_Missense_Mutation_p.E16K	NM_144600	NP_653201	Q96NB1	FOPNL_HUMAN	hypothetical protein LOC123811	16	Necessary and sufficient for homooligomerization and localization to centrosomes and pericentriolar satellites.				cilium assembly|microtubule anchoring	centriolar satellite|microtubule basal body|motile cilium	identical protein binding				0						CCCTTTTTTTCCAAGGTGTCC	0.373													34	64	---	---	---	---	PASS
SLC5A11	115584	broad.mit.edu	37	16	24909416	24909416	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24909416G>A	uc002dmu.2	+	10	1224	c.992G>A	c.(991-993)CGC>CAC	p.R331H	SLC5A11_uc002dms.2_Missense_Mutation_p.R267H|SLC5A11_uc010vcd.1_Missense_Mutation_p.R296H|SLC5A11_uc002dmt.2_Silent_p.P198P|SLC5A11_uc010vce.1_Missense_Mutation_p.R261H|SLC5A11_uc010bxt.2_Missense_Mutation_p.R267H	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	331	Extracellular (Potential).				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		ATGGTCAGCCGCATCCTCTTC	0.502													59	91	---	---	---	---	PASS
RABEP2	79874	broad.mit.edu	37	16	28917057	28917057	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28917057C>T	uc002drq.2	-	11	1507	c.1459G>A	c.(1459-1461)GAG>AAG	p.E487K	uc010vct.1_Intron|RABEP2_uc010vdf.1_Missense_Mutation_p.E416K|RABEP2_uc010byn.2_Missense_Mutation_p.E451K	NM_024816	NP_079092	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	487	Potential.				endocytosis|protein transport	early endosome	growth factor activity|GTPase activator activity			ovary(1)|breast(1)|skin(1)	3						CGCTCCATCTCTGTCCTCAGG	0.672													37	46	---	---	---	---	PASS
CD2BP2	10421	broad.mit.edu	37	16	30365571	30365571	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30365571C>T	uc002dxr.2	-	2	404	c.151G>A	c.(151-153)GAG>AAG	p.E51K	CD2BP2_uc002dxs.2_Missense_Mutation_p.E51K	NM_006110	NP_006101	O95400	CD2B2_HUMAN	CD2 antigen (cytoplasmic tail) binding protein	51					assembly of spliceosomal tri-snRNP	cytoplasm|nucleoplasm|U5 snRNP	protein binding|ribonucleoprotein binding			ovary(1)	1						TCCTCCTCCTCATCGCTATCC	0.522													183	288	---	---	---	---	PASS
HEATR3	55027	broad.mit.edu	37	16	50120226	50120226	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50120226G>A	uc002efw.2	+	11	1636	c.1474G>A	c.(1474-1476)GCA>ACA	p.A492T	HEATR3_uc002efx.2_Missense_Mutation_p.A406T	NM_182922	NP_891552	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	492							binding			ovary(1)|skin(1)	2						TCAGACGCTTGCACAGCATCT	0.498													10	13	---	---	---	---	PASS
IRX5	10265	broad.mit.edu	37	16	54967521	54967521	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54967521G>A	uc002ehv.2	+	3	1188	c.1188G>A	c.(1186-1188)ACG>ACA	p.T396T	IRX5_uc002ehw.2_Silent_p.T330T	NM_005853	NP_005844	P78411	IRX5_HUMAN	iroquois homeobox protein 5	396					response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|vitamin D binding				0						CAGGCGGGACGGTGCTGTCCC	0.716													22	32	---	---	---	---	PASS
CPNE2	221184	broad.mit.edu	37	16	57151476	57151476	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57151476G>A	uc002eks.1	+	5	733	c.504G>A	c.(502-504)AAG>AAA	p.K168K	CPNE2_uc010cct.1_Silent_p.K194K|CPNE2_uc010ccu.1_Silent_p.K168K	NM_152727	NP_689940	Q96FN4	CPNE2_HUMAN	copine II	168	C2 2.									central_nervous_system(1)|skin(1)	2		all_neural(199;0.224)				GGCTGGACAAGAAGGTAAGGC	0.652													15	22	---	---	---	---	PASS
HSF4	3299	broad.mit.edu	37	16	67201678	67201678	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67201678G>A	uc002erl.1	+	11	1875	c.910G>A	c.(910-912)GAG>AAG	p.E304K	HSF4_uc002erm.1_Intron|HSF4_uc002ern.1_Intron|HSF4_uc010cec.1_Intron|NOL3_uc010vjc.1_5'Flank	NM_001040667	NP_001035757	Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4 isoform b	304	Interactions with DUSP26, MAPK1 and MAPK2.				response to stress	nucleus	sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GGGGGATGGCGAGGCCGGGCT	0.647													11	9	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	70928358	70928358	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70928358G>T	uc002ezr.2	-	55	9367	c.9239C>A	c.(9238-9240)GCG>GAG	p.A3080E		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3081										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				TTACCTGAACGCGATCTCATA	0.522													13	27	---	---	---	---	PASS
PSMD7	5713	broad.mit.edu	37	16	74330812	74330812	+	5'UTR	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74330812G>C	uc002fcq.2	+	1					PSMD7_uc010vmr.1_5'UTR	NM_002811	NP_002802	P51665	PSD7_HUMAN	proteasome 26S non-ATPase subunit 7						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding				0						GGTGTGTCGCGATGCCGGAGC	0.647													5	18	---	---	---	---	PASS
LDHD	197257	broad.mit.edu	37	16	75147780	75147780	+	Intron	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75147780G>A	uc002fdm.2	-						LDHD_uc002fdn.2_Intron	NM_153486	NP_705690	Q86WU2	LDHD_HUMAN	D-lactate dehydrogenase isoform 1 precursor								D-lactate dehydrogenase (cytochrome) activity|flavin adenine dinucleotide binding|protein binding				0						TGGATCCAGGGAGATGGCAGG	0.607													80	111	---	---	---	---	PASS
CMIP	80790	broad.mit.edu	37	16	81725390	81725390	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81725390G>A	uc002fgp.2	+	11	1471	c.1399G>A	c.(1399-1401)GAT>AAT	p.D467N	CMIP_uc002fgq.1_Missense_Mutation_p.D373N|CMIP_uc010vnq.1_Missense_Mutation_p.D280N|CMIP_uc002fgr.1_Missense_Mutation_p.D314N|CMIP_uc010vnr.1_5'Flank	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip	433						cytoplasm|nucleus					0						GTCAGACTATGATGACTGGAG	0.527													8	15	---	---	---	---	PASS
ANKRD11	29123	broad.mit.edu	37	16	89350994	89350994	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89350994C>T	uc002fmx.1	-	9	2417	c.1956G>A	c.(1954-1956)CTG>CTA	p.L652L	ANKRD11_uc002fmy.1_Silent_p.L652L|ANKRD11_uc002fnc.1_Silent_p.L652L|ANKRD11_uc002fnb.1_Silent_p.L609L	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	652	Lys-rich.					nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TTTTCAACTTCAGCTCTTGGC	0.388													125	186	---	---	---	---	PASS
RILP	83547	broad.mit.edu	37	17	1551211	1551211	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1551211C>T	uc002ftd.2	-	6	1156	c.862G>A	c.(862-864)GAG>AAG	p.E288K	SCARF1_uc002fsy.1_5'Flank|SCARF1_uc002fsz.1_5'Flank|SCARF1_uc002fta.1_5'Flank|SCARF1_uc010cjv.1_5'Flank	NM_031430	NP_113618	Q96NA2	RILP_HUMAN	Rab interacting lysosomal protein	288	Necessary for the interaction with RAB7 and RAB34, lysosomal distribution and morphology.				endosome to lysosome transport|protein transport	late endosome membrane|lysosomal membrane|phagocytic vesicle membrane	Rab GTPase binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TTCATGGCCTCGAGCAGAAGG	0.607													34	51	---	---	---	---	PASS
HIC1	3090	broad.mit.edu	37	17	1961106	1961106	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1961106C>T	uc010cjy.2	+	2	1179	c.1179C>T	c.(1177-1179)GGC>GGT	p.G393G	HIC1_uc002fty.3_Silent_p.G374G|HIC1_uc002ftz.3_Silent_p.G374G	NM_001098202	NP_001091672	Q14526	HIC1_HUMAN	hypermethylated in cancer 1 isoform 2	393					multicellular organismal development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)	1				READ - Rectum adenocarcinoma(1115;0.236)		GCGGCGACGGCGACGACTACA	0.587													5	5	---	---	---	---	PASS
OR3A4	390756	broad.mit.edu	37	17	3213742	3213742	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3213742C>T	uc002fvi.2	+	1	204	c.138C>T	c.(136-138)CTC>CTT	p.L46L		NR_024128				RecName: Full=Olfactory receptor 3A4; AltName: Full=Olfactory receptor 17-24;          Short=OR17-24;											ovary(1)	1						GAGGCACCCTCAGCATCCTGG	0.542													50	70	---	---	---	---	PASS
OR3A4	390756	broad.mit.edu	37	17	3214068	3214068	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3214068C>T	uc002fvi.2	+	1	530	c.464C>T	c.(463-465)TCC>TTC	p.S155F		NR_024128				RecName: Full=Olfactory receptor 3A4; AltName: Full=Olfactory receptor 17-24;          Short=OR17-24;											ovary(1)	1						TGTGTCTTTTCCTTCACCAAT	0.547													86	128	---	---	---	---	PASS
TRPV3	162514	broad.mit.edu	37	17	3427651	3427651	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3427651G>A	uc002fvt.1	-	13	1906	c.1584C>T	c.(1582-1584)ATC>ATT	p.I528I	TRPV3_uc002fvs.1_Intron|TRPV3_uc010vrh.1_Silent_p.I512I|TRPV3_uc010vri.1_Silent_p.I483I|TRPV3_uc010vrj.1_Silent_p.I512I|TRPV3_uc010vrk.1_Intron|TRPV3_uc010vrl.1_Silent_p.I512I|TRPV3_uc010vrm.1_Intron|TRPV3_uc002fvr.2_Silent_p.I528I|TRPV3_uc002fvu.2_Silent_p.I528I|TRPV3_uc010vrn.1_Intron	NM_145068	NP_659505	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel,	528	Helical; (Potential).					integral to membrane	calcium channel activity			ovary(4)	4					Menthol(DB00825)	GCACAGCTTGGATAAAACTGT	0.517													43	38	---	---	---	---	PASS
GP1BA	2811	broad.mit.edu	37	17	4837744	4837744	+	Silent	SNP	T	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4837744T>C	uc010vsq.1	+	3	1881	c.1806T>C	c.(1804-1806)CCT>CCC	p.P602P	uc002fzn.1_RNA	NM_000173	NP_000164	P07359	GP1BA_HUMAN	platelet glycoprotein Ib alpha polypeptide	615											0						GGGTACGGCCTAATGGCCGTG	0.622											OREG0024109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	130	---	---	---	---	PASS
C1QBP	708	broad.mit.edu	37	17	5337084	5337084	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5337084C>T	uc002gby.1	-	4	559	c.481G>A	c.(481-483)GAA>AAA	p.E161K		NM_001212	NP_001203	Q07021	C1QBP_HUMAN	complement component 1, q subcomponent binding	161					blood coagulation, intrinsic pathway|immune response|interspecies interaction between organisms	mitochondrial matrix|nucleus|plasma membrane				ovary(1)	1						GATGTCAGTTCAGGCTGGGGA	0.458													76	114	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7700550	7700550	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7700550C>T	uc002giu.1	+	50	7934	c.7920C>T	c.(7918-7920)ATC>ATT	p.I2640I		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2640					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AGTCCAGCATCACACGGCTCT	0.537													73	104	---	---	---	---	PASS
PIK3R5	23533	broad.mit.edu	37	17	8793452	8793452	+	Intron	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8793452C>T	uc002glt.2	-						PIK3R5_uc010vuz.1_Intron|PIK3R5_uc002glu.3_Intron|PIK3R5_uc010coa.1_Intron|PIK3R5_uc010cob.1_Intron	NM_014308	NP_055123	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5						platelet activation	cytosol|membrane|nucleus				breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						GCCTGAAACCCCAGGAGGAGA	0.607													13	24	---	---	---	---	PASS
FOXN1	8456	broad.mit.edu	37	17	26861381	26861381	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26861381G>A	uc010crm.2	+	7	1158	c.960G>A	c.(958-960)CGG>CGA	p.R320R	FOXN1_uc002hbj.2_Silent_p.R320R	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1	320	Fork-head.				defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					ATTCTGTCCGGCACAACCTAT	0.582													4	124	---	---	---	---	PASS
CHAD	1101	broad.mit.edu	37	17	48545632	48545632	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48545632G>A	uc010dbr.2	-	1	596	c.543C>T	c.(541-543)AAC>AAT	p.N181N	ACSF2_uc002iqu.2_Intron|ACSF2_uc010wml.1_Intron|ACSF2_uc010wmm.1_Intron|ACSF2_uc010wmn.1_Intron|ACSF2_uc010wmo.1_Intron|CHAD_uc010dbs.2_Silent_p.N181N|ACSF2_uc010dbt.1_5'Flank	NM_001267	NP_001258	O15335	CHAD_HUMAN	chondroadherin precursor	181	LRR 5.				regulation of cell growth	proteinaceous extracellular matrix	extracellular matrix structural constituent			ovary(2)|central_nervous_system(1)	3	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			AGCTCAACGCGTTTTCCGACA	0.622													69	113	---	---	---	---	PASS
TUBD1	51174	broad.mit.edu	37	17	57951925	57951925	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57951925G>A	uc002ixw.1	-	6	1187	c.909C>T	c.(907-909)CTC>CTT	p.L303L	TUBD1_uc010ddf.1_Intron|TUBD1_uc010ddg.1_Silent_p.L268L|TUBD1_uc010ddh.1_Intron|TUBD1_uc010wok.1_Silent_p.L303L|TUBD1_uc002ixx.1_Intron|TUBD1_uc010wol.1_Silent_p.L87L|TUBD1_uc010ddi.1_Intron	NM_016261	NP_057345	Q9UJT1	TBD_HUMAN	delta-tubulin	303					cell differentiation|microtubule-based movement|multicellular organismal development|protein polymerization|spermatogenesis	centriole|microtubule|nucleus	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)			CATTAGAAATGAGCATCTGTC	0.423													74	250	---	---	---	---	PASS
SPHK1	8877	broad.mit.edu	37	17	74382930	74382930	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74382930C>T	uc002jrf.1	+	8	1227	c.418C>T	c.(418-420)CTA>TTA	p.L140L	SPHK1_uc002jrg.1_Silent_p.L89L|SPHK1_uc002jrh.2_Silent_p.L154L|SPHK1_uc002jrj.2_Silent_p.L226L|SPHK1_uc002jri.2_Silent_p.L140L|SPHK1_uc002jrk.3_Silent_p.L140L|uc010wtd.1_RNA	NM_001142602	NP_001136074	Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1 isoform 3	140	DAGKc.				'de novo' posttranslational protein folding|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|calcium-mediated signaling|positive regulation of angiogenesis|positive regulation of cell growth|positive regulation of cell migration|positive regulation of fibroblast proliferation|positive regulation of mitotic cell cycle|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|positive regulation of smooth muscle contraction|regulation of tumor necrosis factor-mediated signaling pathway|sphingoid catabolic process|sphingosine metabolic process	cytosol|membrane fraction|nucleus|plasma membrane|soluble fraction	ATP binding|calmodulin binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|DNA binding|magnesium ion binding|protein phosphatase 2A binding|sphinganine kinase activity			kidney(1)	1						CAACTGCACGCTATTGCTGTG	0.602													11	102	---	---	---	---	PASS
BAHCC1	57597	broad.mit.edu	37	17	79425950	79425950	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79425950G>A	uc002kaf.2	+	18	5560	c.5560G>A	c.(5560-5562)GAG>AAG	p.E1854K	BAHCC1_uc002kae.2_Missense_Mutation_p.E1084K	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	1854							DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			ggaggaagaggaggaggaCAG	0.557													3	11	---	---	---	---	PASS
MIB1	57534	broad.mit.edu	37	18	19379821	19379821	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19379821G>A	uc002ktq.2	+	9	1257	c.1257G>A	c.(1255-1257)CTG>CTA	p.L419L	MIB1_uc002ktp.2_Silent_p.L58L	NM_020774	NP_065825	Q86YT6	MIB1_HUMAN	mindbomb homolog 1	419					Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(4)	4			STAD - Stomach adenocarcinoma(5;0.212)			CACAACTCCTGAAGAAATTAT	0.353													42	61	---	---	---	---	PASS
ZNF396	252884	broad.mit.edu	37	18	32949403	32949403	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32949403G>A	uc010xcf.1	-	4	916	c.784C>T	c.(784-786)CAG>TAG	p.Q262*		NM_145756	NP_665699	Q96N95	ZN396_HUMAN	zinc finger protein 396	262	C2H2-type 1.				viral reproduction	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GCTGAGCTCTGACTAAAGATT	0.408													64	93	---	---	---	---	PASS
SKA1	220134	broad.mit.edu	37	18	47906588	47906588	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47906588C>T	uc002let.2	+	3	365	c.181C>T	c.(181-183)CAG>TAG	p.Q61*	SKA1_uc002leu.2_Nonsense_Mutation_p.Q61*|SKA1_uc010xdl.1_Nonsense_Mutation_p.Q61*	NM_145060	NP_659497	Q96BD8	SKA1_HUMAN	spindle and KT associated 1	61	Potential.				cell division|chromosome segregation|mitotic anaphase|mitotic prometaphase|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytosol|spindle microtubule	microtubule binding				0						ATTGGAAATTCAGTATCAAGA	0.299													44	71	---	---	---	---	PASS
MAPK4	5596	broad.mit.edu	37	18	48241563	48241563	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48241563G>C	uc002lev.2	+	3	1661	c.661G>C	c.(661-663)GAG>CAG	p.E221Q	MAPK4_uc010xdm.1_Missense_Mutation_p.E10Q|MAPK4_uc010doz.2_Missense_Mutation_p.E221Q	NM_002747	NP_002738	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	221	Protein kinase.				cell cycle		ATP binding|MAP kinase activity			lung(4)|skin(2)	6		Colorectal(6;0.0297)		Colorectal(21;0.156)		CATCCTGGCTGAGATGCTTAC	0.532													43	56	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74580737	74580737	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74580737C>T	uc002lmi.2	+	4	652	c.454C>T	c.(454-456)CAG>TAG	p.Q152*	ZNF236_uc002lmj.2_RNA|ZNF236_uc002lmk.1_Nonsense_Mutation_p.Q152*	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	152					cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		TGGAACCCGGCAGCATGCCTG	0.527													66	110	---	---	---	---	PASS
WDR18	57418	broad.mit.edu	37	19	994262	994262	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:994262G>A	uc002lqm.1	+	10	1244	c.1218G>A	c.(1216-1218)GAG>GAA	p.E406E	WDR18_uc002lqn.1_RNA|WDR18_uc010drx.1_Silent_p.E369E|WDR18_uc010dry.1_Silent_p.E383E	NM_024100	NP_077005	Q9BV38	WDR18_HUMAN	WD repeat domain 18	406										skin(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGAGCTGGAGGACGAGGTGC	0.687													15	17	---	---	---	---	PASS
FSD1	79187	broad.mit.edu	37	19	4318941	4318941	+	Silent	SNP	A	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4318941A>T	uc002lzy.2	+	10	1185	c.1032A>T	c.(1030-1032)ACA>ACT	p.T344T	FSD1_uc002lzz.2_Silent_p.T344T|FSD1_uc002maa.2_Silent_p.T157T	NM_024333	NP_077309	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing	344	B30.2/SPRY.				cell division|mitosis	cleavage furrow|microtubule|microtubule organizing center|nucleus				skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTCCTACACAGTTCTGGGTA	0.607													30	73	---	---	---	---	PASS
SH2D3A	10045	broad.mit.edu	37	19	6752605	6752605	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6752605C>T	uc002mft.2	-	10	1924	c.1730G>A	c.(1729-1731)TGA>TAA	p.*577*	SH2D3A_uc010xjg.1_Silent_p.*484*	NM_005490	NP_005481	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	577					JNK cascade|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			breast(2)	2						TCTGCGCTCTCAGCGGTCAGG	0.667													5	4	---	---	---	---	PASS
PNPLA6	10908	broad.mit.edu	37	19	7606545	7606545	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7606545C>T	uc010xjq.1	+	11	1365	c.1170C>T	c.(1168-1170)ACC>ACT	p.T390T	PNPLA6_uc002mgq.1_Silent_p.T342T|PNPLA6_uc010xjp.1_Silent_p.T342T|PNPLA6_uc002mgr.1_Silent_p.T342T|PNPLA6_uc002mgs.2_Silent_p.T381T	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b	381	Cytoplasmic (Potential).				cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3						CCGATCCCACCGGGGCCCCGC	0.682													8	6	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9060544	9060544	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9060544G>C	uc002mkp.2	-	3	27106	c.26902C>G	c.(26902-26904)CCA>GCA	p.P8968A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8970	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTGACCACTGGAGATGTCACT	0.463													99	135	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10600376	10600376	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10600376C>G	uc002moq.1	-	4	1635	c.1479G>C	c.(1477-1479)GAG>GAC	p.E493D	KEAP1_uc002mop.1_Missense_Mutation_p.E211D|KEAP1_uc002mor.1_Missense_Mutation_p.E493D	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	493	Kelch 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			ACTCGTTCCTCTCTGGGTAGT	0.597													34	56	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10602799	10602799	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10602799C>T	uc002moq.1	-	3	935	c.779G>A	c.(778-780)CGA>CAA	p.R260Q	KEAP1_uc002mop.1_5'UTR|KEAP1_uc002mor.1_Missense_Mutation_p.R260Q	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	260	BACK.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	p.R260*(1)		lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			GTAGAACCGTCGCTGTTCGCA	0.627													38	59	---	---	---	---	PASS
AKAP8	10270	broad.mit.edu	37	19	15465863	15465863	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15465863C>T	uc002nav.2	-	14	2003	c.1942G>A	c.(1942-1944)GAG>AAG	p.E648K	AKAP8_uc010dzy.2_Missense_Mutation_p.E197K	NM_005858	NP_005849	O43823	AKAP8_HUMAN	A-kinase anchor protein 8	648					signal transduction	nuclear matrix				ovary(1)|breast(1)	2						TTTCCAGCCTCTGCAGCCTCA	0.607													26	52	---	---	---	---	PASS
FCHO1	23149	broad.mit.edu	37	19	17893894	17893894	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17893894G>A	uc010ebb.2	+	23	2195	c.2006G>A	c.(2005-2007)GGG>GAG	p.G669E	FCHO1_uc002nhg.3_Missense_Mutation_p.G669E|FCHO1_uc002nhh.2_Missense_Mutation_p.G669E|FCHO1_uc010xpw.1_Missense_Mutation_p.G619E|FCHO1_uc002nhi.2_Missense_Mutation_p.G125E|FCHO1_uc002nhj.2_Missense_Mutation_p.G13E	NM_001161358	NP_001154830	O14526	FCHO1_HUMAN	FCH domain only 1 isoform b	669										breast(1)	1						GTGTTCAGCGGGACCCCACCA	0.597													10	62	---	---	---	---	PASS
TSSK6	83983	broad.mit.edu	37	19	19625897	19625897	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19625897C>T	uc002nmr.2	-	1	573	c.340G>A	c.(340-342)GAC>AAC	p.D114N	TSSK6_uc002nmq.2_RNA|NDUFA13_uc002nms.2_5'Flank|NDUFA13_uc010xqx.1_5'Flank|NDUFA13_uc010xqy.1_5'Flank	NM_032037	NP_114426	Q9BXA6	TSSK6_HUMAN	testis-specific serine kinase 6	114	Protein kinase.				multicellular organismal development|sperm chromatin condensation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			stomach(1)	1						GCAAAGAGGTCGCGCGCCTGA	0.657													38	75	---	---	---	---	PASS
TSSK6	83983	broad.mit.edu	37	19	19626086	19626086	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19626086C>T	uc002nmr.2	-	1	384	c.151G>A	c.(151-153)GAC>AAC	p.D51N	TSSK6_uc002nmq.2_RNA|NDUFA13_uc002nms.2_5'Flank|NDUFA13_uc010xqx.1_5'Flank|NDUFA13_uc010xqy.1_5'Flank	NM_032037	NP_114426	Q9BXA6	TSSK6_HUMAN	testis-specific serine kinase 6	51	Protein kinase.				multicellular organismal development|sperm chromatin condensation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			stomach(1)	1						TTGACGAAGTCCGGGGGCGCT	0.617													44	52	---	---	---	---	PASS
LPAR2	9170	broad.mit.edu	37	19	19737830	19737830	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19737830G>A	uc002nnb.3	-	2	403	c.264C>T	c.(262-264)CTC>CTT	p.L88L	LPAR2_uc002nna.3_Silent_p.L88L|LPAR2_uc002nnc.3_Silent_p.L88L	NM_004720	NP_004711	Q9HBW0	LPAR2_HUMAN	lysophosphatidic acid receptor 2	88	Helical; Name=2; (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration	cell surface|integral to plasma membrane	LIM domain binding|lipid binding			ovary(1)|breast(1)	2						TGTGGAACATGAGGAAGAGGT	0.647													15	23	---	---	---	---	PASS
KIAA0355	9710	broad.mit.edu	37	19	34843609	34843609	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34843609C>T	uc002nvd.3	+	14	3821	c.2962C>T	c.(2962-2964)CCC>TCC	p.P988S		NM_014686	NP_055501	O15063	K0355_HUMAN	hypothetical protein LOC9710	988										ovary(1)	1	Esophageal squamous(110;0.162)					TTCCCCGCTTCCCAGCACGCT	0.582													31	79	---	---	---	---	PASS
GRAMD1A	57655	broad.mit.edu	37	19	35504575	35504575	+	Missense_Mutation	SNP	A	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35504575A>G	uc010xse.1	+	9	987	c.850A>G	c.(850-852)AGC>GGC	p.S284G	GRAMD1A_uc002nxi.1_Missense_Mutation_p.S371G|GRAMD1A_uc002nxk.2_Missense_Mutation_p.S277G|GRAMD1A_uc002nxl.2_Missense_Mutation_p.S50G|GRAMD1A_uc010xsf.1_Missense_Mutation_p.S289G|GRAMD1A_uc002nxm.1_RNA|GRAMD1A_uc002nxn.1_5'Flank	NM_020895	NP_065946	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A isoform 1	284						integral to membrane					0	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			TTCCCGAGCCAGCAGCGACGC	0.652													7	64	---	---	---	---	PASS
GRAMD1A	57655	broad.mit.edu	37	19	35504576	35504576	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35504576G>T	uc010xse.1	+	9	988	c.851G>T	c.(850-852)AGC>ATC	p.S284I	GRAMD1A_uc002nxi.1_Missense_Mutation_p.S371I|GRAMD1A_uc002nxk.2_Missense_Mutation_p.S277I|GRAMD1A_uc002nxl.2_Missense_Mutation_p.S50I|GRAMD1A_uc010xsf.1_Missense_Mutation_p.S289I|GRAMD1A_uc002nxm.1_RNA|GRAMD1A_uc002nxn.1_5'Flank	NM_020895	NP_065946	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A isoform 1	284						integral to membrane					0	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			TCCCGAGCCAGCAGCGACGCA	0.652													7	64	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41066123	41066123	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41066123C>T	uc002ony.2	+	27	5815	c.5729C>T	c.(5728-5730)GCC>GTC	p.A1910V	SPTBN4_uc002onx.2_Missense_Mutation_p.A1910V|SPTBN4_uc002onz.2_Missense_Mutation_p.A1910V|SPTBN4_uc010egx.2_Missense_Mutation_p.A653V|SPTBN4_uc002ooa.2_Missense_Mutation_p.A586V	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	1910	Spectrin 16.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGTGAACATGCCGAGGCCATC	0.687													24	42	---	---	---	---	PASS
CEACAM20	125931	broad.mit.edu	37	19	45020998	45020998	+	Intron	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45020998G>A	uc010ejn.1	-						CEACAM20_uc010ejo.1_Intron|CEACAM20_uc010ejp.1_Intron|CEACAM20_uc010ejq.1_Intron	NM_001102597	NP_001096067	Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion							integral to membrane				large_intestine(2)	2		Prostate(69;0.0352)				GCGACCCTGAGAGACTCACCT	0.612													5	5	---	---	---	---	PASS
GIPR	2696	broad.mit.edu	37	19	46181223	46181223	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46181223G>A	uc002pcu.1	+	11	1083	c.984G>A	c.(982-984)CGG>CGA	p.R328R	GIPR_uc002pct.1_Silent_p.R328R|GIPR_uc010xxp.1_Silent_p.R292R|GIPR_uc010xxq.1_RNA	NM_000164	NP_000155	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor	328	Cytoplasmic (Potential).				generation of precursor metabolites and energy|response to nutrient	integral to membrane|plasma membrane				skin(1)	1		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		TGAGGACACGGCAAATGCGCT	0.592													4	159	---	---	---	---	PASS
ZNF534	147658	broad.mit.edu	37	19	52941042	52941042	+	Missense_Mutation	SNP	G	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52941042G>T	uc002pzk.2	+	4	429	c.368G>T	c.(367-369)GGA>GTA	p.G123V	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Missense_Mutation_p.G110V	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	123					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AATCAACATGGATTAACTCTT	0.358													21	30	---	---	---	---	PASS
LILRA1	11024	broad.mit.edu	37	19	55107247	55107247	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55107247C>T	uc002qgh.1	+	6	987	c.805C>T	c.(805-807)CCT>TCT	p.P269S	LILRA2_uc010yfg.1_Missense_Mutation_p.P267S|LILRA1_uc010yfh.1_Missense_Mutation_p.P269S	NM_006863	NP_006854	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor,	269	Extracellular (Potential).|Ig-like C2-type 3.				cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity			skin(2)|ovary(1)	3				GBM - Glioblastoma multiforme(193;0.0348)		CCTCCAGCTCCCTGGCCCACA	0.607													26	134	---	---	---	---	PASS
DUXA	503835	broad.mit.edu	37	19	57672161	57672161	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57672161C>A	uc002qoa.1	-	2	75	c.30G>T	c.(28-30)ATG>ATT	p.M10I		NM_001012729	NP_001012747	A6NLW8	DUXA_HUMAN	double homeobox A	10						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		TTGTTTTTACCATCTCTGTAG	0.368													18	117	---	---	---	---	PASS
DUXA	503835	broad.mit.edu	37	19	57672162	57672162	+	Missense_Mutation	SNP	A	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57672162A>C	uc002qoa.1	-	2	74	c.29T>G	c.(28-30)ATG>AGG	p.M10R		NM_001012729	NP_001012747	A6NLW8	DUXA_HUMAN	double homeobox A	10						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		TGTTTTTACCATCTCTGTAGG	0.373													17	116	---	---	---	---	PASS
NSFL1C	55968	broad.mit.edu	37	20	1433284	1433284	+	Intron	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1433284G>C	uc002wfc.2	-						NSFL1C_uc002wfd.2_Intron|NSFL1C_uc002wfe.2_Intron|NSFL1C_uc002wff.2_Intron|NSFL1C_uc010gag.2_Intron	NM_016143	NP_057227	Q9UNZ2	NSF1C_HUMAN	p47 protein isoform a							chromosome|Golgi stack|nucleus	lipid binding|protein binding				0						CCCTGTGGAAGAAAAGGCCAT	0.547													62	94	---	---	---	---	PASS
SLC23A2	9962	broad.mit.edu	37	20	4866462	4866462	+	Intron	SNP	A	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4866462A>G	uc002wlg.1	-						SLC23A2_uc010zqr.1_Intron|SLC23A2_uc002wlh.1_Intron|SLC23A2_uc002wli.2_Intron	NM_005116	NP_005107	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase						L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2						AATAACTGCAATTACCTGTGG	0.458													17	24	---	---	---	---	PASS
CRNKL1	51340	broad.mit.edu	37	20	20018062	20018062	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20018062C>G	uc002wrs.2	-	14	2316	c.2284G>C	c.(2284-2286)GAA>CAA	p.E762Q		NM_016652	NP_057736	Q9BZJ0	CRNL1_HUMAN	crooked neck-like 1 protein	762	HAT 15.				spliceosome assembly	catalytic step 2 spliceosome|cytoplasm|nuclear speck	RNA binding			ovary(2)|large_intestine(1)	3						AATTCTTCTTCAAAACTTCGC	0.403													149	213	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33337252	33337252	+	Nonsense_Mutation	SNP	T	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33337252T>A	uc002xav.2	-	10	5317	c.2746A>T	c.(2746-2748)AAG>TAG	p.K916*	NCOA6_uc002xaw.2_Nonsense_Mutation_p.K916*	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	916	Gln-rich.|NCOA6IP-binding region.|Poly-Lys.|CREBBP-binding region.|TBP/GTF2A-binding region.|NCOA1-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						GGTTTCTTCTTCTTCGGTTTA	0.378													30	192	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33337253	33337253	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33337253C>T	uc002xav.2	-	10	5316	c.2745G>A	c.(2743-2745)AAG>AAA	p.K915K	NCOA6_uc002xaw.2_Silent_p.K915K	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	915	Gln-rich.|NCOA6IP-binding region.|Poly-Lys.|CREBBP-binding region.|TBP/GTF2A-binding region.|NCOA1-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						GTTTCTTCTTCTTCGGTTTAT	0.378													31	189	---	---	---	---	PASS
CSE1L	1434	broad.mit.edu	37	20	47711383	47711383	+	Silent	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47711383C>T	uc002xty.2	+	24	2843	c.2709C>T	c.(2707-2709)TTC>TTT	p.F903F	CSE1L_uc010zyg.1_Silent_p.F686F|CSE1L_uc010ghx.2_Silent_p.F847F|CSE1L_uc010ghy.2_Silent_p.F524F|CSE1L_uc010zyh.1_Silent_p.F552F	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein	903					apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			AGACTGCCTTCTCACAGTTGG	0.408													48	73	---	---	---	---	PASS
USP25	29761	broad.mit.edu	37	21	17138410	17138410	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17138410C>A	uc002yjy.1	+	3	435	c.218C>A	c.(217-219)GCA>GAA	p.A73E	USP25_uc011aby.1_Missense_Mutation_p.A73E|USP25_uc002yjz.1_Missense_Mutation_p.A73E|USP25_uc010gla.1_Missense_Mutation_p.A73E	NM_013396	NP_037528	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	73					protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)|liver(2)	5				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TACCAAACAGCACTTCCTGGC	0.383													6	84	---	---	---	---	PASS
CHODL	140578	broad.mit.edu	37	21	19629100	19629100	+	Silent	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19629100C>A	uc002ykv.2	+	2	745	c.354C>A	c.(352-354)CTC>CTA	p.L118L	CHODL_uc002ykr.2_Silent_p.L77L|CHODL_uc002yks.2_Silent_p.L77L|CHODL_uc002ykt.2_Silent_p.L77L|CHODL_uc002yku.2_Silent_p.L77L	NM_024944	NP_079220	Q9H9P2	CHODL_HUMAN	chondrolectin precursor	118	Extracellular (Potential).|C-type lectin.				muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		GCCCAGATCTCTACCAGTGGT	0.512													49	84	---	---	---	---	PASS
DSCR4	10281	broad.mit.edu	37	21	39493330	39493330	+	Missense_Mutation	SNP	G	A	A	rs148504310		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39493330G>A	uc002ywp.2	-	1	125	c.20C>T	c.(19-21)ACG>ATG	p.T7M	DSCR8_uc002ywt.3_5'Flank|DSCR8_uc010gnp.2_5'Flank|DSCR8_uc010gnq.2_5'Flank|DSCR8_uc010gnr.2_5'Flank|DSCR8_uc010gns.2_5'Flank	NM_005867	NP_005858	P56555	DSCR4_HUMAN	Down syndrome critical region protein 4	7										ovary(1)	1						atcatctctcgtcaagatgat	0.000													18	23	---	---	---	---	PASS
SNRPD3	6634	broad.mit.edu	37	22	24953658	24953658	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24953658C>T	uc003aam.1	+	2	456	c.16C>T	c.(16-18)CCG>TCG	p.P6S	C22orf13_uc003aah.2_5'Flank|C22orf13_uc003aal.2_5'Flank|C22orf13_uc003aai.3_5'Flank|C22orf13_uc003aaj.3_5'Flank|C22orf13_uc003aak.3_5'Flank|SNRPD3_uc011aju.1_Missense_Mutation_p.P6S	NM_004175	NP_004166	P62318	SMD3_HUMAN	small nuclear ribonucleoprotein polypeptide D3	6					histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	enzyme binding|histone pre-mRNA DCP binding			ovary(1)	1						TATTGGTGTGCCGATTAAAGT	0.478													4	174	---	---	---	---	PASS
MN1	4330	broad.mit.edu	37	22	28196346	28196346	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28196346G>A	uc003adj.2	-	1	1141	c.186C>T	c.(184-186)GGC>GGT	p.G62G		NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1	62							binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						CCATGTTCATGCCCAAGATCG	0.672			T	ETV6	AML|meningioma								64	58	---	---	---	---	PASS
C22orf31	25770	broad.mit.edu	37	22	29456416	29456416	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29456416C>A	uc003aej.1	-	2	546	c.419G>T	c.(418-420)GGA>GTA	p.G140V		NM_015370	NP_056185	O95567	CV031_HUMAN	hypothetical protein LOC25770	140											0						TCTGATGCCTCCTGCAGGCCT	0.522													44	212	---	---	---	---	PASS
MTMR3	8897	broad.mit.edu	37	22	30416154	30416154	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30416154G>A	uc003agv.3	+	17	2834	c.2506G>A	c.(2506-2508)GAG>AAG	p.E836K	MTMR3_uc003agu.3_Missense_Mutation_p.E836K|MTMR3_uc003agw.3_Missense_Mutation_p.E836K	NM_021090	NP_066576	Q13615	MTMR3_HUMAN	myotubularin-related protein 3 isoform c	836					phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			AGTCCCTTTTGAGACCAGAGG	0.478													62	75	---	---	---	---	PASS
SYN3	8224	broad.mit.edu	37	22	32914270	32914270	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32914270G>A	uc003amx.2	-	12	1529	c.1370C>T	c.(1369-1371)TCC>TTC	p.S457F	SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Missense_Mutation_p.S456F|SYN3_uc011amc.1_Missense_Mutation_p.S91F	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa	457	J; Pro-rich linker.				neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						CCTCTGTTGGGAGGGGCTTCC	0.577													70	81	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38153942	38153942	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38153942G>A	uc003atr.2	+	16	6281	c.6010G>A	c.(6010-6012)GAG>AAG	p.E2004K	TRIOBP_uc003atu.2_Missense_Mutation_p.E1832K|TRIOBP_uc003atv.2_Missense_Mutation_p.E291K|TRIOBP_uc003atw.2_Missense_Mutation_p.E291K|TRIOBP_uc003atx.1_5'UTR|TRIOBP_uc010gxh.2_5'UTR	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	2004					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GCCTGCTGGTGAGGGGCCGCG	0.672													6	7	---	---	---	---	PASS
SREBF2	6721	broad.mit.edu	37	22	42289166	42289166	+	Missense_Mutation	SNP	A	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42289166A>T	uc003bbi.2	+	12	2423	c.2254A>T	c.(2254-2256)AGT>TGT	p.S752C	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|SREBF2_uc003bbj.2_RNA	NM_004599	NP_004590	Q12772	SRBP2_HUMAN	sterol regulatory element-binding transcription	752	Cytoplasmic (Potential).				cholesterol metabolic process	ER to Golgi transport vesicle membrane|Golgi membrane|nucleus|SREBP-SCAP-Insig complex	protein C-terminus binding			breast(2)|ovary(1)|central_nervous_system(1)	4						CCCCGAGCACAGTGCTGTTCC	0.607													6	143	---	---	---	---	PASS
PKDREJ	10343	broad.mit.edu	37	22	46654628	46654628	+	Missense_Mutation	SNP	G	A	A	rs143126011	byFrequency	TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46654628G>A	uc003bhh.2	-	1	4592	c.4592C>T	c.(4591-4593)CCG>CTG	p.P1531L		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	1531	Cytoplasmic (Potential).				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		GAGGGTCTCCGGGGTCTTGAT	0.488													5	446	---	---	---	---	PASS
SBF1	6305	broad.mit.edu	37	22	50897936	50897936	+	Silent	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50897936G>A	uc003blh.2	-	27	3846	c.3651C>T	c.(3649-3651)GTC>GTT	p.V1217V	SBF1_uc011arx.1_Silent_p.V881V	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1	1217	Myotubularin phosphatase.				protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		AGAGGCCGACGACACCTTTGC	0.527													22	28	---	---	---	---	PASS
AMELX	265	broad.mit.edu	37	X	11316382	11316382	+	Missense_Mutation	SNP	G	C	C			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11316382G>C	uc004cut.2	+	4	197	c.129G>C	c.(127-129)CAG>CAC	p.Q43H	ARHGAP6_uc004cup.1_Intron|ARHGAP6_uc004cuo.1_Intron|ARHGAP6_uc004cur.1_Intron|ARHGAP6_uc004cun.1_Intron|ARHGAP6_uc011mif.1_Intron|AMELX_uc004cus.2_Missense_Mutation_p.Q57H|AMELX_uc004cuu.2_Missense_Mutation_p.Q27H	NM_001142	NP_001133	Q99217	AMELX_HUMAN	amelogenin (X chromosome) isoform 1 precursor	43					cell adhesion|cell proliferation|chondrocyte differentiation|enamel mineralization|epithelial to mesenchymal transition|ion homeostasis|odontogenesis of dentine-containing tooth|osteoblast differentiation|positive regulation of collagen biosynthetic process|positive regulation of tooth mineralization|signal transduction	proteinaceous extracellular matrix	cell surface binding|growth factor activity|hydroxyapatite binding|identical protein binding|structural constituent of tooth enamel				0						AGTGGTACCAGAGCATAAGGC	0.348													159	26	---	---	---	---	PASS
MAP7D2	256714	broad.mit.edu	37	X	20030525	20030525	+	Missense_Mutation	SNP	C	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20030525C>T	uc004czr.1	-	14	1910	c.1891G>A	c.(1891-1893)GAT>AAT	p.D631N	MAP7D2_uc004czq.1_Missense_Mutation_p.D516N|MAP7D2_uc011mji.1_Missense_Mutation_p.D579N|MAP7D2_uc010nfo.1_Missense_Mutation_p.D672N|MAP7D2_uc011mjj.1_Missense_Mutation_p.D586N	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	631										ovary(2)|breast(1)	3						GATTTCCCATCAAGGGCATCC	0.433													123	18	---	---	---	---	PASS
SSX6	280657	broad.mit.edu	37	X	47978943	47978943	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47978943C>A	uc004dix.1	+	7	616	c.494C>A	c.(493-495)ACC>AAC	p.T165N		NM_173357	NP_775493			SubName: Full=Putative uncharacterized protein SSX1;												0						CATGCCTGGACCCACAGACTG	0.498													185	38	---	---	---	---	PASS
MAGT1	84061	broad.mit.edu	37	X	77112282	77112282	+	Missense_Mutation	SNP	C	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77112282C>G	uc004fof.2	-	5	778	c.716G>C	c.(715-717)AGA>ACA	p.R239T	MAGT1_uc004fog.3_Intron	NM_032121	NP_115497	Q9H0U3	MAGT1_HUMAN	magnesium transporter 1	207					protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				upper_aerodigestive_tract(1)	1						CATATTACTTCTTCGAAGATA	0.353													74	16	---	---	---	---	PASS
CXorf48	54967	broad.mit.edu	37	X	134303630	134303630	+	Missense_Mutation	SNP	G	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134303630G>A	uc004eyk.1	-	2	823	c.167C>T	c.(166-168)TCG>TTG	p.S56L	CXorf48_uc004eyl.1_Missense_Mutation_p.S56L	NM_001031705	NP_001026875	Q8WUE5	CX048_HUMAN	hypothetical protein LOC54967 isoform 1	56											0	Acute lymphoblastic leukemia(192;0.000127)					GAAGTAGATCGACTCATCAAT	0.408													20	5	---	---	---	---	PASS
MAGEA12	4111	broad.mit.edu	37	X	151900253	151900253	+	Missense_Mutation	SNP	C	A	A			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151900253C>A	uc010ntp.2	-	3	902	c.548G>T	c.(547-549)GGC>GTC	p.G183V	MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Missense_Mutation_p.G183V|CSAG1_uc004fge.2_5'Flank|CSAG1_uc004fgf.2_5'Flank|CSAG1_uc004fgd.2_5'Flank	NM_005367	NP_005358	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	183	MAGE.									skin(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GTAGGAGAGGCCCAGGCAGGT	0.572													12	248	---	---	---	---	PASS
RAP1GAP	5909	broad.mit.edu	37	1	21935885	21935885	+	Intron	DEL	A	-	-	rs34097078		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21935885delA	uc001bex.2	-						RAP1GAP_uc001bev.2_Intron|RAP1GAP_uc001bew.2_Intron|RAP1GAP_uc001bey.2_Intron	NM_002885	NP_002876	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein isoform c						regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding			breast(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		TGACCTTGTGAAAAAAAAAAA	0.448													5	3	---	---	---	---	
AK2	204	broad.mit.edu	37	1	33486747	33486747	+	Intron	DEL	A	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33486747delA	uc001bwp.1	-						uc001bwn.2_Intron|AK2_uc001bwo.1_Intron|AK2_uc010ohq.1_Intron|AK2_uc009vud.1_Intron|AK2_uc010ohr.1_Intron|AK2_uc001bwq.1_Intron	NM_001625	NP_001616	P54819	KAD2_HUMAN	adenylate kinase 2 isoform a						nucleobase, nucleoside and nucleotide interconversion	mitochondrial intermembrane space	adenylate kinase activity|ATP binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				actcccatctaaaaaaaaaaa	0.065													4	2	---	---	---	---	
LRP8	7804	broad.mit.edu	37	1	53793512	53793514	+	In_Frame_Del	DEL	GCA	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53793512_53793514delGCA	uc001cvi.1	-	1	213_215	c.71_73delTGC	c.(70-75)CTGCAG>CAG	p.L24del	LRP8_uc001cvh.1_5'Flank|LRP8_uc001cvk.1_In_Frame_Del_p.L24del|LRP8_uc001cvj.1_In_Frame_Del_p.L24del|LRP8_uc001cvl.1_In_Frame_Del_p.L24del|uc001cvn.1_5'Flank	NM_004631	NP_004622	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein	24					cytokine-mediated signaling pathway|endocytosis|lipid metabolic process|platelet activation|proteolysis	caveola	calcium ion binding|very-low-density lipoprotein particle receptor activity				0						TGCTGGagctgcagcagcagcag	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	200691572	200691573	+	IGR	INS	-	AGAA	AGAA	rs142719838	by1000genomes	TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200691572_200691573insAGAA								DDX59 (52446 upstream) : CAMSAP1L1 (17113 downstream)																							gagaaagagagagaaagaaaga	0.030													2	4	---	---	---	---	
CAPG	822	broad.mit.edu	37	2	85626370	85626374	+	Frame_Shift_Del	DEL	CAGGA	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85626370_85626374delCAGGA	uc002spl.1	-	6	801_805	c.551_555delTCCTG	c.(550-555)ATCCTGfs	p.I184fs	CAPG_uc002spm.1_Frame_Shift_Del_p.I184fs|CAPG_uc010ysq.1_Frame_Shift_Del_p.I184fs|CAPG_uc010fgi.1_Frame_Shift_Del_p.I184fs|CAPG_uc010fgj.1_Frame_Shift_Del_p.I78fs	NM_001747	NP_001738	P40121	CAPG_HUMAN	gelsolin-like capping protein	184_185	Gelsolin-like 2.				barbed-end actin filament capping|protein complex assembly	F-actin capping protein complex|melanosome|nuclear membrane|nucleolus	actin binding				0						TGTTGCGTTCCAGGATGTTGGACTT	0.605													29	16	---	---	---	---	
RGPD5	84220	broad.mit.edu	37	2	113138302	113138302	+	Intron	DEL	G	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113138302delG	uc002ths.1	-						RGPD8_uc010fkk.1_Intron	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform						intracellular transport	cytoplasm	binding				0						CGTTATAGATGCATCTGCAAT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113477589	113477589	+	5'Flank	DEL	C	-	-	rs11273854		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113477589delC	uc002tid.2	+											RecName: Full=5'-nucleotidase domain-containing protein 4;																		cttttcttttcccttccttcc	0.000													4	2	---	---	---	---	
R3HDM1	23518	broad.mit.edu	37	2	136433223	136433224	+	Intron	INS	-	TT	TT	rs72538400		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136433223_136433224insTT	uc002tuo.2	+						R3HDM1_uc010fni.2_Intron|R3HDM1_uc002tup.2_Intron|R3HDM1_uc010zbh.1_Intron	NM_015361	NP_056176	Q15032	R3HD1_HUMAN	R3H domain containing 1								nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)		ACTTTATAGTCAAGAGTTTTAT	0.277													2	4	---	---	---	---	
LCT	3938	broad.mit.edu	37	2	136587400	136587401	+	Intron	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs137885947	by1000genomes	TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136587400_136587401insGTGTGTGTGT	uc002tuu.1	-							NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		GGAATGAGAAAgtgtgtgtgtg	0.416													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	215593261	215593262	+	IGR	INS	-	T	T	rs33960630		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215593261_215593262insT								VWC2L (152608 upstream) : BARD1 (13 downstream)																							TGGCATTAGACTTTTTTTTTTT	0.292													3	3	---	---	---	---	
ZFAND2B	130617	broad.mit.edu	37	2	220071889	220071889	+	Intron	DEL	T	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220071889delT	uc002vka.2	+						ZFAND2B_uc010zkt.1_Intron|ZFAND2B_uc010fwd.1_Intron|ZFAND2B_uc002vjy.1_Intron|ZFAND2B_uc002vjz.1_Intron|ZFAND2B_uc002vkb.1_5'Flank	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B							endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGGGGGGGTGGTCAGCGGC	0.627													3	3	---	---	---	---	
VGLL4	9686	broad.mit.edu	37	3	11685143	11685144	+	Intron	INS	-	A	A	rs34152653		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11685143_11685144insA	uc003bwf.2	-						VGLL4_uc010hdx.1_5'UTR|VGLL4_uc003bwg.2_Intron	NM_014667	NP_055482	Q14135	VGLL4_HUMAN	vestigial like 4 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		ATGCAAAAGTTAAAAAAAAAAA	0.406													6	3	---	---	---	---	
DNASE1L3	1776	broad.mit.edu	37	3	58196755	58196755	+	5'Flank	DEL	T	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58196755delT	uc003djo.1	-						DNASE1L3_uc011bfd.1_5'Flank|DNASE1L3_uc003djp.1_Intron|DNASE1L3_uc003djq.1_Intron	NM_004944	NP_004935	Q13609	DNSL3_HUMAN	deoxyribonuclease I-like 3 precursor						apoptosis|DNA catabolic process	nucleus	calcium ion binding|DNA binding|endodeoxyribonuclease activity, producing 5'-phosphomonoesters			breast(2)|large_intestine(1)	3				BRCA - Breast invasive adenocarcinoma(55;0.00021)|KIRC - Kidney renal clear cell carcinoma(284;0.0445)|Kidney(284;0.0556)|OV - Ovarian serous cystadenocarcinoma(275;0.202)		AATTACTGGATTTCTCCTTGC	0.458													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137009703	137009704	+	IGR	INS	-	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137009703_137009704insT								IL20RB (279783 upstream) : SOX14 (473875 downstream)																							tccttccttccttccttccttc	0.000													3	4	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7656929	7656930	+	Intron	INS	-	AC	AC	rs144046004	by1000genomes	TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7656929_7656930insAC	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						CTTGTGCGTGTacacacacaca	0.485													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	136487479	136487480	+	IGR	DEL	CA	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:136487479_136487480delCA								None (None upstream) : None (None downstream)																							CCAAGGTTTTCACAAACTCTGC	0.450													4	3	---	---	---	---	
MARCH1	55016	broad.mit.edu	37	4	165119006	165119007	+	Intron	INS	-	AT	AT	rs140822955	by1000genomes	TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165119006_165119007insAT	uc003iqs.1	-						ANP32C_uc011cjk.1_5'Flank	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CAAATATTATAATAAAGGGACT	0.401													7	5	---	---	---	---	
GLP1R	2740	broad.mit.edu	37	6	39053971	39053982	+	3'UTR	DEL	ACACACACACAT	-	-	rs140424730	by1000genomes	TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39053971_39053982delACACACACACAT	uc003ooj.3	+	13					GLP1R_uc003ooh.2_Intron|GLP1R_uc003ooi.2_Intron	NM_002062	NP_002053	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor precursor						activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled			lung(3)|breast(1)|pancreas(1)	5					Exenatide(DB01276)|Glucagon recombinant(DB00040)	acacacacacacacacacacatacaTCCTGCT	0.462													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	98688793	98688796	+	IGR	DEL	GGAA	-	-	rs58687659		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98688793_98688796delGGAA								MIR2113 (216296 upstream) : POU3F2 (593784 downstream)																							gaagagggagggaaggaaggaagg	0.108													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1429841	1429845	+	IGR	DEL	GGAAG	-	-	rs140250546	by1000genomes	TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1429841_1429845delGGAAG								UNCX (153229 upstream) : MICALL2 (44151 downstream)																							aaggaaggaaggaagggagAGAGAA	0.039													7	6	---	---	---	---	
HDAC9	9734	broad.mit.edu	37	7	18826460	18826463	+	Intron	DEL	TTCC	-	-	rs5022872	byFrequency	TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18826460_18826463delTTCC	uc003suh.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc011jyd.1_Intron|HDAC9_uc003sui.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc003sua.1_Intron	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	ccttccttcattccttccttcctt	0.201													5	4	---	---	---	---	
GALNT11	63917	broad.mit.edu	37	7	151800067	151800067	+	Intron	DEL	A	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151800067delA	uc010lqg.1	+						GALNT11_uc011kvm.1_Intron|GALNT11_uc003wku.2_Intron|GALNT11_uc003wkv.1_Intron|GALNT11_uc011kvn.1_Intron	NM_022087	NP_071370	Q8NCW6	GLT11_HUMAN	N-acetylgalactosaminyltransferase 11							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		actccgtctcaaaaaaaaaaa	0.194													4	2	---	---	---	---	
CYC1	1537	broad.mit.edu	37	8	145151905	145151905	+	Intron	DEL	G	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145151905delG	uc003zaz.3	+						CYC1_uc003zay.2_Intron	NM_001916	NP_001907	P08574	CY1_HUMAN	cytochrome c-1						respiratory electron transport chain|transport	cell junction|integral to membrane|mitochondrial inner membrane|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ACATGAGCCTGAGAATAGCCC	0.597													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44084399	44084400	+	IGR	INS	-	TAATC	TAATC			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44084399_44084400insTAATC								FAM75A6 (453669 upstream) : FAM27C (905836 downstream)																							GATAAAGACTATATATAAAAAT	0.277													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	87817437	87817437	+	IGR	DEL	T	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87817437delT								NTRK2 (178932 upstream) : AGTPBP1 (344018 downstream)																							aggatactcctgcctcagcct	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	92908435	92908438	+	IGR	DEL	TTCC	-	-	rs140823491		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92908435_92908438delTTCC								LOC100129066 (573761 upstream) : DIRAS2 (463676 downstream)																							ttttgtatgattccttccttcctt	0.000													4	2	---	---	---	---	
TTF1	7270	broad.mit.edu	37	9	135263729	135263730	+	Intron	INS	-	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135263729_135263730insT	uc004cbl.2	-						TTF1_uc011mcp.1_Intron|TTF1_uc004cbm.2_Intron	NM_007344	NP_031370	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase						negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		TCTAACttttcttttttttttt	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3433828	3433829	+	Intron	INS	-	GAAA	GAAA	rs58404982		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3433828_3433829insGAAA	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																		aaggaaggaaggaaagaaagaa	0.054													4	3	---	---	---	---	
DCLRE1C	64421	broad.mit.edu	37	10	14977714	14977714	+	Intron	DEL	G	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14977714delG	uc001inn.2	-						DCLRE1C_uc010qbx.1_Intron|DCLRE1C_uc001inl.2_Intron|DCLRE1C_uc009xji.2_Intron|DCLRE1C_uc001inm.2_Intron|DCLRE1C_uc001ino.2_Intron|DCLRE1C_uc009xjh.2_Intron|DCLRE1C_uc001inp.2_Intron|DCLRE1C_uc001inq.2_Intron|DCLRE1C_uc001inr.2_Intron|DCLRE1C_uc009xjj.1_5'Flank	NM_001033855	NP_001029027	Q96SD1	DCR1C_HUMAN	artemis protein isoform a						DNA recombination	nucleus	5'-3' exonuclease activity|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)	1						AACCACACCAGGCACTCAGCT	0.388								Involved_in_tolerance_or_repair_of_DNA_crosslinks|NHEJ					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	31005104	31005105	+	Intron	INS	-	GAAGGAAG	GAAGGAAG			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31005104_31005105insGAAGGAAG	uc010qdx.1	+											SubName: Full=cDNA FLJ59642, highly similar to Supervillin;																		aaggaaggaaggaaggaaagaa	0.010													4	2	---	---	---	---	
AGAP11	119385	broad.mit.edu	37	10	88754812	88754813	+	Intron	INS	-	ATA	ATA	rs35989321		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88754812_88754813insATA	uc001kee.2	+						AGAP11_uc001kef.2_Intron	NM_133447	NP_597704	Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0						AATTGATGATGataataatagt	0.282													5	3	---	---	---	---	
KBTBD4	55709	broad.mit.edu	37	11	47597411	47597412	+	Intron	INS	-	T	T	rs35653820		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47597411_47597412insT	uc001nfx.2	-						NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_Intron|KBTBD4_uc001nfz.2_Intron|KBTBD4_uc001nfy.2_Intron	NM_016506	NP_057590	Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4											ovary(1)|central_nervous_system(1)	2						CCTAAAATTGCttttttttttt	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113662516	113662516	+	IGR	DEL	T	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113662516delT								CLDN25 (11309 upstream) : USP28 (6082 downstream)																							ATGTAAAATCTTTTTTTTTTT	0.239													4	2	---	---	---	---	
TIMELESS	8914	broad.mit.edu	37	12	56824949	56824949	+	Intron	DEL	C	-	-	rs79733408		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56824949delC	uc001slf.2	-						TIMELESS_uc001slg.2_Intron	NM_003920	NP_003911	Q9UNS1	TIM_HUMAN	timeless homolog						cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8						accagcctggccaacatggtg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	23424824	23424825	+	IGR	DEL	AT	-	-	rs75222506		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23424824_23424825delAT								None (None upstream) : SGCG (330235 downstream)																							TTTAAAAATCATATAAATTTGA	0.267													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	75588839	75588840	+	IGR	INS	-	CTTCCTTC	CTTCCTTC	rs9543833		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75588839_75588840insCTTCCTTC								KLF12 (880445 upstream) : LOC647288 (223050 downstream)																							tttctttctttcttccttcctt	0.139													4	3	---	---	---	---	
C14orf145	145508	broad.mit.edu	37	14	81251990	81251990	+	Intron	DEL	A	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81251990delA	uc001xux.2	-						C14orf145_uc010asz.1_Intron	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		ACCCACAAGGAAAAAAAAAAT	0.294													5	3	---	---	---	---	
TTC7B	145567	broad.mit.edu	37	14	91121458	91121458	+	Intron	DEL	A	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91121458delA	uc001xyp.2	-						TTC7B_uc010ats.2_Intron	NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)				CTTCCAACTGAAAAATGAGAC	0.428													75	37	---	---	---	---	
SLC24A4	123041	broad.mit.edu	37	14	92818259	92818260	+	Intron	INS	-	AAGGA	AAGGA	rs57027749		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92818259_92818260insAAGGA	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		ggaaggaaaggaaggaaaggaa	0.119													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	103775352	103775353	+	IGR	INS	-	GAAA	GAAA	rs138743388	by1000genomes	TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103775352_103775353insGAAA								TNFAIP2 (171576 upstream) : EIF5 (25140 downstream)																							aaggaaggaaggaaggaaggaa	0.139													4	2	---	---	---	---	
TMEM121	80757	broad.mit.edu	37	14	105996050	105996052	+	In_Frame_Del	DEL	GCC	-	-	rs10569304		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105996050_105996052delGCC	uc001yrp.1	+	2	1030_1032	c.879_881delGCC	c.(877-882)GTGCCG>GTG	p.P299del	ADAM6_uc010tyt.1_Intron|uc001yrr.2_5'Flank	NM_025268	NP_079544	Q9BTD3	TM121_HUMAN	hole protein	299	Pro-rich.					integral to membrane					0		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.0959)|all cancers(159;0.235)		GCAACTCGGTgccgccgccgccg	0.660													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106234031	106234032	+	Intron	INS	-	G	G			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106234031_106234032insG	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_Intron|uc001ysi.1_Intron					Parts of antibodies, mostly variable regions.												0						GGACAGTTTGTGAGAGCGTGGG	0.505													5	3	---	---	---	---	
IL4R	3566	broad.mit.edu	37	16	27367405	27367405	+	Intron	DEL	C	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27367405delC	uc002don.2	+						IL4R_uc002dop.3_Intron|IL4R_uc010bxy.2_Intron|IL4R_uc002doo.2_Intron	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a						immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CCACttttttctttttttttt	0.219													4	2	---	---	---	---	
NLRC5	84166	broad.mit.edu	37	16	57073467	57073468	+	Intron	INS	-	T	T	rs148574042	by1000genomes	TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57073467_57073468insT	uc002ekk.1	+						NLRC5_uc010ccq.1_Intron|NLRC5_uc002ekn.2_Intron|NLRC5_uc002ekl.2_Intron|NLRC5_uc002ekm.2_Intron|NLRC5_uc010ccr.1_Intron|NLRC5_uc010ccs.1_Intron|NLRC5_uc002eko.1_5'Flank|NLRC5_uc002ekp.1_5'Flank	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27						defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				tctctacatactttttttttta	0.000													5	3	---	---	---	---	
TMCO7	79613	broad.mit.edu	37	16	69059906	69059906	+	Intron	DEL	T	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69059906delT	uc002ewi.3	+							NM_024562	NP_078838	Q9C0B7	TMCO7_HUMAN	transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)		AAACtttttcttttttttttt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43675430	43675431	+	IGR	INS	-	A	A	rs1724389		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43675430_43675431insA								LRRC37A4 (79914 upstream) : LOC644172 (2060 downstream)																							TACACTGTTTTTTTTTTTTTTT	0.277													4	3	---	---	---	---	
HOXB3	3213	broad.mit.edu	37	17	46629934	46629934	+	5'UTR	DEL	C	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46629934delC	uc002inn.2	-	1					HOXB3_uc010wlm.1_Intron|HOXB3_uc010dbf.2_5'UTR|HOXB3_uc010dbg.2_Intron|HOXB3_uc002ino.2_5'UTR|HOXB3_uc010wlk.1_Intron|HOXB3_uc010wll.1_Intron	NM_002146	NP_002137	P14651	HXB3_HUMAN	homeobox B3						angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						ACACGCCGGAccccccccccc	0.512													4	3	---	---	---	---	
SPAG9	9043	broad.mit.edu	37	17	49067393	49067393	+	Intron	DEL	T	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49067393delT	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron|SPAG9_uc002ita.2_Intron|SPAG9_uc002ite.2_Intron	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CATTACAGCAttttttttttt	0.184													4	2	---	---	---	---	
LRRC37A3	374819	broad.mit.edu	37	17	62851781	62851783	+	Intron	DEL	GTG	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62851781_62851783delGTG	uc002jey.2	-						LRRC37A3_uc010wqg.1_Intron|LRRC37A3_uc002jex.1_Intron|LRRC37A3_uc010wqf.1_Intron	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3							integral to membrane					0						CGCGAGACTAgtggtggtgcatg	0.039													4	2	---	---	---	---	
UNC13D	201294	broad.mit.edu	37	17	73833153	73833154	+	Intron	INS	-	T	T			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73833153_73833154insT	uc002jpp.2	-						UNC13D_uc010wsk.1_Intron|UNC13D_uc002jpq.1_Intron|UNC13D_uc010dgq.1_Intron	NM_199242	NP_954712	Q70J99	UN13D_HUMAN	unc-13 homolog D						positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding			upper_aerodigestive_tract(1)|skin(1)	2			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			tttgttttgtgttttttttttt	0.248									Familial_Hemophagocytic_Lymphohistiocytosis				4	2	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544327	80544327	+	Intron	DEL	G	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544327delG	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			aaggtgggccggggggggaaa	0.000													5	3	---	---	---	---	
TBCD	6904	broad.mit.edu	37	17	80878413	80878413	+	Intron	DEL	T	-	-	rs3214869		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80878413delT	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kgb.1_Intron	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GCGTCTATCCTTTTTTTTTTT	0.443													6	4	---	---	---	---	
MARCH2	51257	broad.mit.edu	37	19	8495419	8495419	+	Intron	DEL	A	-	-	rs74326673		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8495419delA	uc002mjv.2	+						MARCH2_uc002mjw.2_Intron|MARCH2_uc002mjx.2_Intron	NM_016496	NP_057580	Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2						endocytosis	cytoplasmic vesicle|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						aatctgtctcaaaaaaaaaaa	0.249													4	2	---	---	---	---	
AP1M2	10053	broad.mit.edu	37	19	10688099	10688100	+	Intron	INS	-	TTT	TTT	rs34328803		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10688099_10688100insTTT	uc002mpc.2	-						AP1M2_uc002mpd.2_Intron	NM_005498	NP_005489	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit						cellular membrane organization|post-Golgi vesicle-mediated transport|protein targeting|regulation of defense response to virus by virus|vesicle targeting|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding			ovary(2)	2			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			TTACCAAGCCCttttttttttt	0.262													4	2	---	---	---	---	
MEGF8	1954	broad.mit.edu	37	19	42858271	42858271	+	Intron	DEL	T	-	-	rs36065839		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42858271delT	uc002otl.3	+						MEGF8_uc002otm.3_Intron	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8							integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				AGTATTGCTGTTTTTTTTTTT	0.517													4	2	---	---	---	---	
ZNF225	7768	broad.mit.edu	37	19	44634853	44634854	+	Intron	INS	-	AA	AA	rs56206619		TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44634853_44634854insAA	uc002oyj.1	+						ZNF225_uc010eje.1_Intron|ZNF225_uc010ejf.1_Intron|uc002oyk.1_3'UTR	NM_013362	NP_037494	Q9UK10	ZN225_HUMAN	zinc finger protein 225						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)|all_neural(266;0.202)				gactccatctcaaaaaaaaaaa	0.099													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	41471322	41471322	+	IGR	DEL	T	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41471322delT								RBX1 (102656 upstream) : MIR1281 (17195 downstream)																							CGCAGTCTCCttttttttttt	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	42720019	42720020	+	IGR	INS	-	TGG	TGG			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42720019_42720020insTGG								TCF20 (108574 upstream) : NFAM1 (56395 downstream)																							ggcggaggttatggtggtggtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2042213	2042214	+	IGR	DEL	CA	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2042213_2042214delCA								ASMT (280240 upstream) : DHRSX (95343 downstream)																							GTGCACCACCCACACACACACA	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	24447607	24447607	+	IGR	DEL	T	-	-			TCGA-18-5595-01A-01D-1632-08	TCGA-18-5595-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24447607delT								FAM48B1 (64067 upstream) : PDK3 (35737 downstream)																							attaaacctcttttttttTTT	0.164													6	3	---	---	---	---	
