Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CHD5	26038	broad.mit.edu	37	1	6196587	6196587	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6196587C>A	uc001amb.1	-	17	2786	c.2686G>T	c.(2686-2688)GAG>TAG	p.E896*	CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA|CHD5_uc009vlx.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	896	Helicase ATP-binding.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TTGAACCTCTCTGGAGTCAGG	0.552													22	69	---	---	---	---	PASS
TNFRSF25	8718	broad.mit.edu	37	1	6524782	6524782	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6524782G>T	uc001ane.2	-						TNFRSF25_uc001ana.2_Intron|TNFRSF25_uc001anb.2_Intron|TNFRSF25_uc001anc.2_Intron|TNFRSF25_uc001and.2_Intron|TNFRSF25_uc009vlz.2_Intron|TNFRSF25_uc001anf.2_Intron|TNFRSF25_uc001ang.2_Intron|TNFRSF25_uc001anh.2_Intron|TNFRSF25_uc001ani.1_Intron	NM_003790	NP_003781	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily,						apoptosis|induction of apoptosis by extracellular signals	cytosol|extracellular region|integral to plasma membrane	tumor necrosis factor receptor activity			central_nervous_system(2)|breast(1)	3	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		CTGGGAGGCTGGTGGGGGTGC	0.587													5	15	---	---	---	---	PASS
ZBTB48	3104	broad.mit.edu	37	1	6648820	6648820	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6648820G>T	uc009vmc.1	+	10	1809	c.1686G>T	c.(1684-1686)GTG>GTT	p.V562V	ZBTB48_uc001anx.2_Silent_p.V562V|ZBTB48_uc009vmd.1_Silent_p.V562V|ZBTB48_uc001any.1_Silent_p.V200V	NM_005341	NP_005332	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	562	C2H2-type 10.					cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		TTGCAGCCGTGGAGCAACTGC	0.632													12	21	---	---	---	---	PASS
SLC45A1	50651	broad.mit.edu	37	1	8390781	8390781	+	Missense_Mutation	SNP	G	A	A	rs139151699	byFrequency	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8390781G>A	uc001apb.2	+	4	1228	c.1228G>A	c.(1228-1230)GGC>AGC	p.G410S	SLC45A1_uc001apc.2_Missense_Mutation_p.G108S	NM_001080397	NP_001073866	Q9Y2W3	S45A1_HUMAN	DNB5	410					carbohydrate transport	integral to membrane	symporter activity			central_nervous_system(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GGCCCCCGACGGCTTCTACCG	0.682													11	26	---	---	---	---	PASS
CLSTN1	22883	broad.mit.edu	37	1	9791886	9791886	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9791886C>A	uc001aqh.2	-	17	3255	c.2496G>T	c.(2494-2496)GTG>GTT	p.V832V	CLSTN1_uc001aqi.2_Silent_p.V822V|CLSTN1_uc010oag.1_Silent_p.V813V|CLSTN1_uc001aqf.2_Silent_p.V68V	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN	calsyntenin 1 isoform 1	832	Extracellular (Potential).				homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding			skin(1)	1	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		GTTCCGGGTGCACGAACTGTG	0.592													4	20	---	---	---	---	PASS
C1orf187	374946	broad.mit.edu	37	1	11766571	11766571	+	Missense_Mutation	SNP	C	A	A	rs41275444		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11766571C>A	uc001asr.1	+	2	396	c.256C>A	c.(256-258)CAG>AAG	p.Q86K		NM_198545	NP_940947	Q8NBI3	DRAXI_HUMAN	chromosome 1 open reading frame 187 precursor	86					axon guidance|commissural neuron differentiation in spinal cord|dorsal spinal cord development|forebrain development|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular region					0	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.48e-06)|COAD - Colon adenocarcinoma(227;0.000283)|BRCA - Breast invasive adenocarcinoma(304;0.000316)|Kidney(185;0.000841)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|STAD - Stomach adenocarcinoma(313;0.00754)|READ - Rectum adenocarcinoma(331;0.0651)		CGCCACCAGGCAGGCCTCCAG	0.711													7	11	---	---	---	---	PASS
PRAMEF12	390999	broad.mit.edu	37	1	12837316	12837316	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12837316G>T	uc001aui.2	+	3	1053	c.1026G>T	c.(1024-1026)CTG>CTT	p.L342L		NM_001080830	NP_001074299	O95522	PRA12_HUMAN	PRAME family member 12	342										ovary(3)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCTCAGTTCTGCTGGAGCAAG	0.587													35	61	---	---	---	---	PASS
EPHA2	1969	broad.mit.edu	37	1	16456843	16456843	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16456843G>T	uc001aya.1	-	15	2684	c.2547C>A	c.(2545-2547)CTC>CTA	p.L849L		NM_004431	NP_004422	P29317	EPHA2_HUMAN	ephrin receptor EphA2 precursor	849	Mediates interaction with ARHGEF16 and ELMO2.|Protein kinase.|Cytoplasmic (Potential).				activation of Rac GTPase activity|angiogenesis|apoptosis|cell chemotaxis|negative regulation of protein kinase B signaling cascade|positive regulation of establishment of protein localization in plasma membrane|protein kinase B signaling cascade|regulation of blood vessel endothelial cell migration|regulation of cell adhesion mediated by integrin|regulation of lamellipodium assembly|response to growth factor stimulus	focal adhesion|integral to plasma membrane|lamellipodium membrane|ruffle membrane	ATP binding|ephrin receptor activity|protein binding			lung(3)|central_nervous_system(3)|stomach(2)|ovary(2)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)	ACTGCATCATGAGCTGGTAGA	0.627													8	22	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17281810	17281810	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17281810G>T	uc001azt.2	+	24	3538	c.3469G>T	c.(3469-3471)GAA>TAA	p.E1157*	CROCC_uc001azu.2_Nonsense_Mutation_p.E460*	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	1157	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CTCACAGGCAGAAGAGCTTCG	0.697													8	24	---	---	---	---	PASS
ARHGEF10L	55160	broad.mit.edu	37	1	17961049	17961049	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17961049C>A	uc001ban.2	+	17	1896	c.1737C>A	c.(1735-1737)GCC>GCA	p.A579A	ARHGEF10L_uc009vpe.1_Silent_p.A540A|ARHGEF10L_uc001bao.2_Silent_p.A540A|ARHGEF10L_uc001bap.2_Intron|ARHGEF10L_uc010ocr.1_Silent_p.A337A|ARHGEF10L_uc001baq.2_Intron|ARHGEF10L_uc010ocs.1_Intron|ARHGEF10L_uc001bar.2_Intron|ARHGEF10L_uc009vpf.2_Intron	NM_018125	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF)	579					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CCAGGCCTGCCAACCACAGGT	0.453													33	72	---	---	---	---	PASS
IL22RA1	58985	broad.mit.edu	37	1	24448198	24448198	+	Silent	SNP	C	A	A	rs143248338		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24448198C>A	uc001biq.1	-	7	861	c.822G>T	c.(820-822)CCG>CCT	p.P274P	IL22RA1_uc010oeg.1_Silent_p.P206P|IL22RA1_uc009vrb.1_Silent_p.P138P|IL22RA1_uc010oeh.1_Silent_p.P274P	NM_021258	NP_067081	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1 precursor	274	Cytoplasmic (Potential).					integral to membrane	interferon receptor activity			skin(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		TGAAGCGCAGCGGCTGGAAAG	0.607													4	6	---	---	---	---	PASS
PTPRU	10076	broad.mit.edu	37	1	29609253	29609253	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29609253A>T	uc001bru.2	+	12	2044	c.1934A>T	c.(1933-1935)GAC>GTC	p.D645V	PTPRU_uc001brv.2_Missense_Mutation_p.D645V|PTPRU_uc001brw.2_Missense_Mutation_p.D645V|PTPRU_uc009vtq.2_Missense_Mutation_p.D645V|PTPRU_uc009vtr.2_Missense_Mutation_p.D645V	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	645	Extracellular (Potential).|Fibronectin type-III 4.				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		GGTGGACAGGACTGCTTCCCA	0.667													5	30	---	---	---	---	PASS
SNIP1	79753	broad.mit.edu	37	1	38006033	38006033	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38006033C>A	uc001cbi.2	-	3	724	c.651G>T	c.(649-651)GAG>GAT	p.E217D	SNIP1_uc010oid.1_RNA	NM_024700	NP_078976	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein	217					production of miRNAs involved in gene silencing by miRNA	nucleus	protein binding	p.E217Q(1)		upper_aerodigestive_tract(1)|lung(1)	2		Myeloproliferative disorder(586;0.0393)				TAGCGGGCACCTCTTTTTCTT	0.532													20	36	---	---	---	---	PASS
LEPRE1	64175	broad.mit.edu	37	1	43232245	43232245	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43232245C>A	uc001chv.2	-	1	511	c.398G>T	c.(397-399)AGC>ATC	p.S133I	LEPRE1_uc001chw.2_Missense_Mutation_p.S133I|LEPRE1_uc001chx.3_Missense_Mutation_p.S133I|LEPRE1_uc001chy.3_Missense_Mutation_p.S133I|LEPRE1_uc001chz.2_Missense_Mutation_p.S133I|C1orf50_uc001cia.3_5'Flank	NM_022356	NP_071751	Q32P28	P3H1_HUMAN	leprecan 1 isoform 1	133					negative regulation of cell proliferation	endoplasmic reticulum|proteinaceous extracellular matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			ovary(3)|lung(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CATCTCTTCGCTGAGCGAGTG	0.711													4	10	---	---	---	---	PASS
ZCCHC11	23318	broad.mit.edu	37	1	52954643	52954643	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52954643C>A	uc001ctx.2	-	9	1687	c.1453G>T	c.(1453-1455)GCC>TCC	p.A485S	ZCCHC11_uc001cty.2_Missense_Mutation_p.A485S|ZCCHC11_uc001ctz.2_Missense_Mutation_p.A485S|ZCCHC11_uc009vze.1_Missense_Mutation_p.A485S|ZCCHC11_uc009vzf.1_Missense_Mutation_p.A244S|ZCCHC11_uc001cub.2_Missense_Mutation_p.A485S|ZCCHC11_uc001cuc.2_RNA	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform	485					miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						TTGCCAAGGGCAGTAAGTAAA	0.363													18	43	---	---	---	---	PASS
TMED5	50999	broad.mit.edu	37	1	93621951	93621951	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93621951A>T	uc001dpn.2	-	3	824	c.377T>A	c.(376-378)CTG>CAG	p.L126Q	TMED5_uc001dpo.2_Missense_Mutation_p.L126Q|TMED5_uc001dpp.2_RNA	NM_016040	NP_057124	Q9Y3A6	TMED5_HUMAN	transmembrane emp24 protein transport domain	126	GOLD.|Lumenal (Potential).				transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|integral to membrane				ovary(1)	1		all_lung(203;0.0223)|Lung NSC(277;0.071)|Melanoma(281;0.147)|Glioma(108;0.188)		all cancers(265;0.00108)|GBM - Glioblastoma multiforme(16;0.00407)|Epithelial(280;0.0797)		CATATTATCCAGGATTAATTC	0.358													29	46	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103483444	103483444	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103483444G>T	uc001dul.2	-						COL11A1_uc001duk.2_Intron|COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ATACCCTATAGAGAAACACAC	0.388													41	67	---	---	---	---	PASS
FNDC7	163479	broad.mit.edu	37	1	109265066	109265066	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109265066G>C	uc001dvx.2	+	5	708	c.708G>C	c.(706-708)TTG>TTC	p.L236F	FNDC7_uc010ova.1_Missense_Mutation_p.L3F	NM_001144937	NP_001138409	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	237	Fibronectin type-III 3.					extracellular region				ovary(1)|skin(1)	2		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		TGATGGCTTTGAGCGACTCTT	0.468													7	29	---	---	---	---	PASS
RBM15	64783	broad.mit.edu	37	1	110884310	110884310	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110884310C>A	uc001dzl.1	+	1	2366	c.2283C>A	c.(2281-2283)TCC>TCA	p.S761S	RBM15_uc001dzm.1_Silent_p.S761S|uc001dzj.2_5'Flank	NM_022768	NP_073605	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	761					interspecies interaction between organisms	nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTGCTTCCTCCAAGCTGAAGT	0.567			T	MKL1	acute megakaryocytic leukemia								11	58	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113666601	113666601	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113666601G>T	uc001edf.1	+	18	3274	c.3076G>T	c.(3076-3078)GAG>TAG	p.E1026*	LRIG2_uc009wgn.1_Nonsense_Mutation_p.E923*	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	1026	Cytoplasmic (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TCATCAAAATGAGGGCCTGGC	0.502													20	29	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118628604	118628604	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118628604G>T	uc001ehk.2	-	13	1771	c.1703C>A	c.(1702-1704)CCA>CAA	p.P568Q		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	568						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GTTGTTCCATGGTGGGGGTAG	0.403													14	56	---	---	---	---	PASS
ANKRD35	148741	broad.mit.edu	37	1	145558874	145558874	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145558874C>A	uc001eob.1	+	7	601	c.493C>A	c.(493-495)CAC>AAC	p.H165N	NBPF10_uc001emp.3_Intron|ANKRD35_uc010oyx.1_Missense_Mutation_p.H8N	NM_144698	NP_653299	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	165	ANK 4.									ovary(4)|skin(1)	5	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCTGGGTGGGCACGCAGCTAT	0.562													20	64	---	---	---	---	PASS
ADAMTSL4	54507	broad.mit.edu	37	1	150530973	150530973	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150530973C>A	uc001eux.2	+	15	2643	c.2407C>A	c.(2407-2409)CAG>AAG	p.Q803K	ADAMTSL4_uc001euw.2_Missense_Mutation_p.Q803K|ADAMTSL4_uc009wlw.2_Missense_Mutation_p.Q826K|ADAMTSL4_uc010pcg.1_Missense_Mutation_p.Q764K|ADAMTSL4_uc009wlx.2_5'UTR	NM_019032	NP_061905	Q6UY14	ATL4_HUMAN	thrombospondin repeat containing 1 isoform 1	803	TSP type-1 3.				apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding			ovary(1)|skin(1)	2	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CGGCCGGGGCCAGAGAAGCCG	0.657													14	23	---	---	---	---	PASS
LASS2	29956	broad.mit.edu	37	1	150939874	150939874	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150939874C>A	uc001evy.2	-	7	993	c.606G>T	c.(604-606)AAG>AAT	p.K202N	LASS2_uc001evz.2_Missense_Mutation_p.K202N|LASS2_uc009wmh.2_Missense_Mutation_p.K52N	NM_181746	NP_859530	Q96G23	CERS2_HUMAN	LAG1 longevity assurance 2	202	TLC.|Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0	all_lung(15;8.07e-35)|Lung NSC(24;7.93e-31)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCACCTTTCGCTTGACATCAG	0.502													13	27	---	---	---	---	PASS
RPTN	126638	broad.mit.edu	37	1	152127910	152127910	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152127910C>A	uc001ezs.1	-	3	1730	c.1665G>T	c.(1663-1665)CAG>CAT	p.Q555H		NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin	555	Gln-rich.					proteinaceous extracellular matrix	calcium ion binding				0						AGTGGGAACTCTGGCCTTGTC	0.507													205	417	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152187517	152187517	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152187517G>T	uc001ezt.1	-	3	6664	c.6588C>A	c.(6586-6588)TCC>TCA	p.S2196S		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2196	24.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCCGTGGCTGGAGGAGTGCC	0.632													16	271	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152326015	152326015	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152326015G>T	uc001ezw.3	-	3	4320	c.4247C>A	c.(4246-4248)ACA>AAA	p.T1416K	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1416							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTTCCAGTTGTCCTGGACCC	0.517													5	230	---	---	---	---	PASS
NPR1	4881	broad.mit.edu	37	1	153658631	153658631	+	Silent	SNP	T	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153658631T>C	uc001fcs.3	+	10	2134	c.1713T>C	c.(1711-1713)CGT>CGC	p.R571R	NPR1_uc010pdz.1_Silent_p.R317R|NPR1_uc010pea.1_Intron	NM_000906	NP_000897	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1 precursor	571	Cytoplasmic (Potential).|Protein kinase.				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity			ovary(3)|lung(2)|stomach(1)|breast(1)	7	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	GTGTGAACCGTAAACGCATTG	0.557													5	14	---	---	---	---	PASS
PBXIP1	57326	broad.mit.edu	37	1	154923709	154923709	+	Silent	SNP	T	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154923709T>C	uc001ffr.2	-	5	467	c.408A>G	c.(406-408)GCA>GCG	p.A136A	PBXIP1_uc001ffs.2_Silent_p.A107A|PBXIP1_uc010pep.1_5'UTR|PBXIP1_uc009woy.1_RNA	NM_020524	NP_065385	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein	136					cell differentiation|multicellular organismal development|negative regulation of transcription, DNA-dependent	cytosol|microtubule|nucleus	protein binding|transcription corepressor activity			large_intestine(1)	1	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GACTCTCACCTGCTTTGGGGG	0.592													7	15	---	---	---	---	PASS
ARHGEF2	9181	broad.mit.edu	37	1	155931687	155931687	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155931687C>A	uc001fmt.2	-	11	1351	c.1233G>T	c.(1231-1233)GAG>GAT	p.E411D	ARHGEF2_uc001fmr.2_Missense_Mutation_p.E383D|ARHGEF2_uc001fms.2_Missense_Mutation_p.E410D|ARHGEF2_uc001fmu.2_Missense_Mutation_p.E455D|ARHGEF2_uc010pgt.1_Missense_Mutation_p.E384D|ARHGEF2_uc010pgu.1_Missense_Mutation_p.E456D	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor 2	411	DH.				actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GGTCCTGGCGCTCCTCCTCGA	0.587													37	56	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157509155	157509155	+	Splice_Site	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157509155C>A	uc001fqu.2	-	7	1282	c.1124_splice	c.e7-1	p.V375_splice	FCRL5_uc009wsm.2_Splice_Site_p.V375_splice|FCRL5_uc010phv.1_Splice_Site_p.V375_splice|FCRL5_uc010phw.1_Splice_Site_p.V290_splice|FCRL5_uc001fqv.1_Splice_Site_p.V375_splice|FCRL5_uc010phx.1_Splice_Site_p.V126_splice	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5							integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GACACGGGAACTGAGAGAGAG	0.368													12	25	---	---	---	---	PASS
CD5L	922	broad.mit.edu	37	1	157804231	157804231	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157804231G>C	uc001frk.3	-	4	827	c.684C>G	c.(682-684)TGC>TGG	p.C228W		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	228	SRCR 2.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CATCATGGTTGCAGGTGTTCT	0.488													12	29	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158592861	158592861	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158592861G>A	uc001fst.1	-	43	6231	c.6032C>T	c.(6031-6033)GCC>GTC	p.A2011V		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2011	Spectrin 19.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CAGCAGAGCGGCATAACGCTC	0.483													5	335	---	---	---	---	PASS
FCRLB	127943	broad.mit.edu	37	1	161697326	161697326	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161697326G>T	uc001gbh.2	+	8	1389	c.1155G>T	c.(1153-1155)CTG>CTT	p.L385L	FCRLB_uc009wus.2_Silent_p.L385L|FCRLB_uc001gbj.2_3'UTR|FCRLB_uc001gbk.2_3'UTR|FCRLB_uc001gbl.2_3'UTR|FCRLB_uc001gbm.2_3'UTR|FCRLB_uc001gbi.2_Silent_p.L385L|FCRLB_uc001gbn.3_3'UTR	NM_001002901	NP_001002901	Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	385						endoplasmic reticulum					0	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			AAGGCCTTCTGAGCCGGGTGG	0.647													17	40	---	---	---	---	PASS
RASAL2	9462	broad.mit.edu	37	1	178427449	178427449	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178427449C>T	uc001glr.2	+	12	2724	c.2599C>T	c.(2599-2601)CAG>TAG	p.Q867*	RASAL2_uc001glq.2_Nonsense_Mutation_p.Q1008*|RASAL2_uc009wxc.2_Nonsense_Mutation_p.Q381*	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1	867					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						TAGTACTGGGCAGGCCCAGAT	0.552													11	25	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	179989506	179989506	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179989506C>A	uc001gnt.2	+	12	2980	c.2597C>A	c.(2596-2598)GCA>GAA	p.A866E	CEP350_uc009wxl.2_Missense_Mutation_p.A865E|CEP350_uc001gnu.2_Missense_Mutation_p.A700E	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	866						centrosome|nucleus|spindle				ovary(4)	4						GTGCAGCAGGCACCTCAAGAA	0.463													40	87	---	---	---	---	PASS
TEDDM1	127670	broad.mit.edu	37	1	182369170	182369170	+	Missense_Mutation	SNP	G	T	T	rs112817733		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182369170G>T	uc001gpe.2	-	1	582	c.451C>A	c.(451-453)CCC>ACC	p.P151T		NM_172000	NP_741997	Q5T9Z0	TEDM1_HUMAN	putative membrane protein HE9	151						integral to membrane				ovary(2)	2						CACATGTTGGGAGCCCACAGC	0.507													12	47	---	---	---	---	PASS
LAMC2	3918	broad.mit.edu	37	1	183191274	183191274	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183191274C>A	uc001gqa.2	+	6	1005	c.691C>A	c.(691-693)CAA>AAA	p.Q231K	LAMC2_uc001gpz.3_Missense_Mutation_p.Q231K|LAMC2_uc010poa.1_5'UTR	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	231	Laminin IV type A.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						TGCAAAGCTCCAATGGTCACA	0.468													26	84	---	---	---	---	PASS
NMNAT2	23057	broad.mit.edu	37	1	183255900	183255900	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183255900G>T	uc001gqc.1	-	5	680	c.345C>A	c.(343-345)TCC>TCA	p.S115S	NMNAT2_uc001gqb.1_Silent_p.S110S|NMNAT2_uc001gqd.2_Silent_p.S10S	NM_015039	NP_055854	Q9BZQ4	NMNA2_HUMAN	nicotinamide mononucleotide adenylyltransferase	115					water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1						TGTTGACATTGGAGAGGATGC	0.502													13	38	---	---	---	---	PASS
NMNAT2	23057	broad.mit.edu	37	1	183255901	183255901	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183255901G>T	uc001gqc.1	-	5	679	c.344C>A	c.(343-345)TCC>TAC	p.S115Y	NMNAT2_uc001gqb.1_Missense_Mutation_p.S110Y|NMNAT2_uc001gqd.2_Missense_Mutation_p.S10Y	NM_015039	NP_055854	Q9BZQ4	NMNA2_HUMAN	nicotinamide mononucleotide adenylyltransferase	115					water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1						GTTGACATTGGAGAGGATGCA	0.502													13	39	---	---	---	---	PASS
C1orf26	54823	broad.mit.edu	37	1	185151152	185151152	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185151152G>T	uc001grg.3	+	7	1215	c.1101G>T	c.(1099-1101)ATG>ATT	p.M367I	C1orf26_uc001grh.3_Missense_Mutation_p.M367I	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN	hypothetical protein LOC54823	367											0						TAATGAGTATGGAAATTGACT	0.388													10	38	---	---	---	---	PASS
IGFN1	91156	broad.mit.edu	37	1	201195181	201195181	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201195181G>T	uc001gwc.2	+	11	2968	c.2196G>T	c.(2194-2196)GTG>GTT	p.V732V	IGFN1_uc001gwb.2_RNA	NM_178275	NP_840059			RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;											ovary(2)|pancreas(1)	3						TCAGGGTGGTGGCCAAGAATG	0.682													14	27	---	---	---	---	PASS
DYRK3	8444	broad.mit.edu	37	1	206821606	206821606	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206821606G>T	uc001hej.2	+	3	1231	c.1063G>T	c.(1063-1065)GAC>TAC	p.D355Y	DYRK3_uc001hek.2_Intron|DYRK3_uc001hei.2_Missense_Mutation_p.D335Y	NM_003582	NP_003573	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	355	Protein kinase.				erythrocyte differentiation	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|central_nervous_system(1)	3	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CAAGGTCATTGACTTTGGGTC	0.463													35	68	---	---	---	---	PASS
YOD1	55432	broad.mit.edu	37	1	207222725	207222725	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207222725G>T	uc001hfe.1	-	2	734	c.687C>A	c.(685-687)TCC>TCA	p.S229S	PFKFB2_uc010psc.1_Intron|YOD1_uc001hff.1_Silent_p.S185S	NM_018566	NP_061036	Q5VVQ6	OTU1_HUMAN	YOD1 OTU deubiquinating enzyme 1 homolog	229	OTU.				cellular amino acid metabolic process|endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein K48-linked deubiquitination|protein K63-linked deubiquitination	intracellular	protein binding|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1	Prostate(682;0.19)					GGTAAAACTTGGACAAAATCG	0.388													63	124	---	---	---	---	PASS
C1orf74	148304	broad.mit.edu	37	1	209956842	209956842	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209956842C>A	uc001hhp.1	-	2	381	c.138G>T	c.(136-138)GTG>GTT	p.V46V		NM_152485	NP_689698	Q96LT6	CA074_HUMAN	hypothetical protein LOC148304	46										skin(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		GTCCCCGGGCCACAGCCAGCA	0.597													7	85	---	---	---	---	PASS
TRAF5	7188	broad.mit.edu	37	1	211527758	211527758	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211527758A>T	uc001hih.2	+	3	285	c.225A>T	c.(223-225)TTA>TTT	p.L75F	TRAF5_uc001hii.2_Missense_Mutation_p.L75F|TRAF5_uc010psx.1_Missense_Mutation_p.L75F|TRAF5_uc010psy.1_Missense_Mutation_p.L75F|TRAF5_uc001hij.2_Missense_Mutation_p.L75F	NM_004619	NP_004610	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	75	RING-type.				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis	CD40 receptor complex|centrosome|internal side of plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(2)|ovary(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		CCAGAGAATTAAACACAGTGC	0.458													9	24	---	---	---	---	PASS
DTL	51514	broad.mit.edu	37	1	212220693	212220693	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212220693C>A	uc009xdc.2	+	5	708	c.394C>A	c.(394-396)CTG>ATG	p.L132M	DTL_uc010ptb.1_Missense_Mutation_p.L90M|DTL_uc001hiz.3_Translation_Start_Site	NM_016448	NP_057532	Q9NZJ0	DTL_HUMAN	denticleless homolog	132	WD 2.				DNA replication|G2/M transition DNA damage checkpoint|protein monoubiquitination|protein polyubiquitination|response to UV|translesion synthesis|ubiquitin-dependent protein catabolic process	centrosome|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|nuclear membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		AGCTGGTGAGCTGATTGGAAC	0.388													50	97	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216251535	216251535	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216251535G>C	uc001hku.1	-	27	5855	c.5468C>G	c.(5467-5469)GCA>GGA	p.A1823G		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1823	Laminin G-like 2.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGACTCCGATGCATGCTTCAT	0.433										HNSCC(13;0.011)			61	114	---	---	---	---	PASS
IARS2	55699	broad.mit.edu	37	1	220275535	220275535	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220275535G>T	uc001hmc.2	+	4	719	c.615G>T	c.(613-615)ATG>ATT	p.M205I		NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN	mitochondrial isoleucine tRNA synthetase	205					isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	GGGGAATAATGGCAGATTGGA	0.308													13	102	---	---	---	---	PASS
TRIM67	440730	broad.mit.edu	37	1	231337116	231337116	+	Silent	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231337116C>T	uc009xfn.1	+	5	1429	c.1387C>T	c.(1387-1389)CTG>TTG	p.L463L		NM_001004342	NP_001004342	Q6ZTA4	TRI67_HUMAN	tripartite motif-containing 67	463	COS.					cytoplasm|cytoskeleton	zinc ion binding			ovary(2)|breast(1)|kidney(1)	4	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				CTCAGATGCTCTGATCAAGCG	0.522													4	8	---	---	---	---	PASS
HADHA	3030	broad.mit.edu	37	2	26462001	26462001	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26462001G>T	uc002rgy.2	-	2	208	c.78C>A	c.(76-78)TGC>TGA	p.C26*	HADHA_uc010yks.1_5'UTR|HADHA_uc010ykt.1_5'UTR	NM_000182	NP_000173	P40939	ECHA_HUMAN	mitochondrial trifunctional protein, alpha	26					fatty acid beta-oxidation	fatty acid beta-oxidation multienzyme complex|mitochondrial nucleoid|nucleolus	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acetyltransferase activity|coenzyme binding|enoyl-CoA hydratase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				NADH(DB00157)	TAAAATTGCGGCATATATAAC	0.269													21	64	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33413798	33413798	+	Silent	SNP	T	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33413798T>A	uc002ros.2	+	7	1581	c.1581T>A	c.(1579-1581)CCT>CCA	p.P527P	LTBP1_uc002rot.2_Silent_p.P201P|LTBP1_uc002rou.2_Silent_p.P201P|LTBP1_uc002rov.2_Silent_p.P201P|LTBP1_uc010ymz.1_Silent_p.P201P|LTBP1_uc010yna.1_Silent_p.P201P	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	527					negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AAGGGCTTCCTGTCCAGAAGA	0.537													23	57	---	---	---	---	PASS
SPTBN1	6711	broad.mit.edu	37	2	54876329	54876329	+	Splice_Site	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54876329C>T	uc002rxu.2	+	25	5451	c.5202_splice	c.e25+2	p.T1734_splice	SPTBN1_uc002rxx.2_Splice_Site_p.T1721_splice	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			CATGTCACGGCAAGTACTTGA	0.557													4	17	---	---	---	---	PASS
PNPT1	87178	broad.mit.edu	37	2	55920888	55920888	+	Missense_Mutation	SNP	G	T	T	rs140022349	by1000genomes	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55920888G>T	uc002rzf.2	-	1	124	c.71C>A	c.(70-72)CCA>CAA	p.P24Q	PNPT1_uc002rzg.2_RNA	NM_033109	NP_149100	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	24					mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding				0			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ATCCCGCCGTGGCAGAAGGAA	0.647													13	38	---	---	---	---	PASS
PCYOX1	51449	broad.mit.edu	37	2	70502272	70502272	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70502272G>T	uc002sgn.3	+	4	742	c.676G>T	c.(676-678)GGC>TGC	p.G226C	PCYOX1_uc010fdo.2_Missense_Mutation_p.G149C|PCYOX1_uc010yqu.1_Missense_Mutation_p.G208C	NM_016297	NP_057381	Q9UHG3	PCYOX_HUMAN	prenylcysteine oxidase 1 precursor	226					prenylated protein catabolic process	lysosome|very-low-density lipoprotein particle	prenylcysteine oxidase activity			central_nervous_system(1)	1						GGTCAATTATGGCCAAAGCAC	0.463													30	81	---	---	---	---	PASS
ELMOD3	84173	broad.mit.edu	37	2	85598601	85598601	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85598601C>T	uc002spf.3	+	11	1188	c.523C>T	c.(523-525)CTC>TTC	p.L175F	ELMOD3_uc010fgg.2_Intron|ELMOD3_uc002spg.3_Missense_Mutation_p.L175F|ELMOD3_uc002sph.3_Missense_Mutation_p.L175F|ELMOD3_uc010ysn.1_Missense_Mutation_p.L175F|ELMOD3_uc010yso.1_RNA|ELMOD3_uc010ysp.1_Intron	NM_001135021	NP_001128493	Q96FG2	ELMD3_HUMAN	ELMO/CED-12 domain containing 3 isoform b	175	ELMO.				phagocytosis	cytoskeleton				ovary(2)	2						TGGCCGAGTCCTCCAGACCAT	0.572													11	24	---	---	---	---	PASS
CAPG	822	broad.mit.edu	37	2	85628387	85628387	+	Silent	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85628387G>C	uc002spl.1	-	5	667	c.417C>G	c.(415-417)CTC>CTG	p.L139L	CAPG_uc002spm.1_Silent_p.L139L|CAPG_uc010ysq.1_Silent_p.L139L|CAPG_uc010fgi.1_Silent_p.L139L|CAPG_uc010fgj.1_Silent_p.L33L	NM_001747	NP_001738	P40121	CAPG_HUMAN	gelsolin-like capping protein	139	Nuclear localization signal (Potential).				barbed-end actin filament capping|protein complex assembly	F-actin capping protein complex|melanosome|nuclear membrane|nucleolus	actin binding				0						TCACCTGGTAGAGTTTCTTGA	0.587													21	54	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90199101	90199101	+	RNA	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90199101G>C	uc010fhm.2	+	24		c.3232G>C								Parts of antibodies, mostly variable regions.																		CAGCGGCAGTGGATCTGGGAC	0.498													45	97	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90199102	90199102	+	RNA	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90199102G>T	uc010fhm.2	+	24		c.3233G>T								Parts of antibodies, mostly variable regions.																		AGCGGCAGTGGATCTGGGACA	0.493													45	98	---	---	---	---	PASS
PROM2	150696	broad.mit.edu	37	2	95944749	95944749	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95944749G>T	uc002suh.1	+	10	1264	c.1131G>T	c.(1129-1131)GTG>GTT	p.V377V	PROM2_uc002sui.2_Silent_p.V377V|PROM2_uc002suj.2_Silent_p.V31V|PROM2_uc002suk.2_Silent_p.V377V|PROM2_uc002sul.2_5'UTR|PROM2_uc002sum.2_5'Flank	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2 precursor	377	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1						AGAAGGCAGTGGCCCAGCAGC	0.642													14	21	---	---	---	---	PASS
SNRNP200	23020	broad.mit.edu	37	2	96950236	96950236	+	Silent	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96950236G>A	uc002svu.2	-	31	4338	c.4252C>T	c.(4252-4254)CTG>TTG	p.L1418L	SNRNP200_uc002svt.2_Silent_p.L28L|SNRNP200_uc010yuj.1_RNA|SNRNP200_uc002svv.1_5'UTR	NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	1418	Helicase ATP-binding 2.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						TTGCCCAGCAGCTTCAGGTCT	0.542													37	63	---	---	---	---	PASS
FOXD4L1	200350	broad.mit.edu	37	2	114256968	114256968	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114256968G>T	uc002tjw.3	+	1	308	c.135G>T	c.(133-135)GAG>GAT	p.E45D		NM_012184	NP_036316	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	45					axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0						aggaggaggaggCGAGCCAGA	0.542													22	37	---	---	---	---	PASS
EN1	2019	broad.mit.edu	37	2	119604348	119604348	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119604348G>T	uc002tlm.2	-	1	1412	c.396C>A	c.(394-396)GCC>GCA	p.A132A		NM_001426	NP_001417	Q05925	HME1_HUMAN	engrailed homeobox 1	132					skeletal system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|lung(1)	2						CGCCTCCTCTGGCCGCCGCAG	0.672													8	10	---	---	---	---	PASS
CLASP1	23332	broad.mit.edu	37	2	122125228	122125228	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122125228G>T	uc002tnc.2	-	34	4212	c.3822C>A	c.(3820-3822)AAC>AAA	p.N1274K	CLASP1_uc010yyv.1_Missense_Mutation_p.N320K|CLASP1_uc002tmz.2_Missense_Mutation_p.N359K|CLASP1_uc002tna.2_Missense_Mutation_p.N320K|CLASP1_uc010yyw.1_RNA|CLASP1_uc002tnb.2_RNA|CLASP1_uc010yyx.1_RNA|CLASP1_uc010yyy.1_RNA|CLASP1_uc010yyz.1_Missense_Mutation_p.N1215K|CLASP1_uc010yza.1_Missense_Mutation_p.N1207K|CLASP1_uc010yzb.1_RNA|CLASP1_uc010yzc.1_RNA|CLASP1_uc002tmy.2_Missense_Mutation_p.N110K|CLASP1_uc002tnf.2_Missense_Mutation_p.N176K	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1	1274	Localization to kinetochores.|Interaction with PHLDB2 and RSN.|Interaction with CLIP2 (By similarity).				axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					TGTCGTAGGTGTTGATGGCAT	0.577													5	67	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128378018	128378018	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128378018C>A	uc002top.2	+	26	3477	c.3424C>A	c.(3424-3426)CCA>ACA	p.P1142T	MYO7B_uc002toq.1_5'UTR|MYO7B_uc002tor.1_5'UTR	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	1142	MyTH4 1.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CGGCTGCTTCCCACCCTCAGA	0.617													10	20	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138169226	138169226	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138169226C>A	uc002tva.1	+	13	2650	c.2650C>A	c.(2650-2652)CTA>ATA	p.L884I	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Missense_Mutation_p.L774I	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		CCTTTACCCTCTAGTGGAGAC	0.413													14	46	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152470912	152470912	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152470912C>A	uc010fnx.2	-	73	10941	c.10750G>T	c.(10750-10752)GCC>TCC	p.A3584S		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	3584	Nebulin 98.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CACTTCTTGGCCAGCACCACC	0.527													39	117	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152470913	152470913	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152470913C>A	uc010fnx.2	-	73	10940	c.10749G>T	c.(10747-10749)CTG>CTT	p.L3583L		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	3583	Nebulin 98.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		ACTTCTTGGCCAGCACCACCC	0.527													41	123	---	---	---	---	PASS
PKP4	8502	broad.mit.edu	37	2	159481410	159481410	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159481410C>A	uc002tzv.2	+	7	884	c.624C>A	c.(622-624)GCC>GCA	p.A208A	PKP4_uc002tzt.1_Silent_p.A60A|PKP4_uc002tzu.2_Silent_p.A208A|PKP4_uc002tzw.2_Silent_p.A208A|PKP4_uc002tzx.2_Intron|PKP4_uc002tzy.1_Intron|PKP4_uc002tzz.1_Silent_p.A206A|PKP4_uc002uaa.2_Silent_p.A60A	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a	208					cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						CCAATCGGGCCATGAGAAGAG	0.453										HNSCC(62;0.18)			21	105	---	---	---	---	PASS
DPP4	1803	broad.mit.edu	37	2	162890069	162890069	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162890069G>A	uc002ubz.2	-	10	1430	c.869C>T	c.(868-870)CCT>CTT	p.P290L	DPP4_uc010fpb.2_5'UTR	NM_001935	NP_001926	P27487	DPP4_HUMAN	dipeptidylpeptidase IV	290	Extracellular (Potential).				cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)	CATAGAAGCAGGAGCAGTGAT	0.408													17	40	---	---	---	---	PASS
DPP4	1803	broad.mit.edu	37	2	162890071	162890071	+	Silent	SNP	A	G	G	rs113302553	byFrequency	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162890071A>G	uc002ubz.2	-	10	1428	c.867T>C	c.(865-867)GCT>GCC	p.A289A	DPP4_uc010fpb.2_5'UTR	NM_001935	NP_001926	P27487	DPP4_HUMAN	dipeptidylpeptidase IV	289	Extracellular (Potential).				cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)	TAGAAGCAGGAGCAGTGATTT	0.403													17	43	---	---	---	---	PASS
GRB14	2888	broad.mit.edu	37	2	165349702	165349702	+	Intron	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165349702G>C	uc002ucl.2	-						GRB14_uc010zcv.1_Intron|GRB14_uc002ucm.2_Intron	NM_004490	NP_004481	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14						blood coagulation|leukocyte migration	cytosol|endosome membrane|Golgi membrane|microsome|plasma membrane	SH3/SH2 adaptor activity			ovary(5)|upper_aerodigestive_tract(1)|lung(1)	7						CCTGCAAAAAGAAAAGCAACA	0.373													12	23	---	---	---	---	PASS
CSRNP3	80034	broad.mit.edu	37	2	166535295	166535295	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166535295G>T	uc002udf.2	+	7	1166	c.790G>T	c.(790-792)GTT>TTT	p.V264F	CSRNP3_uc002udg.2_Missense_Mutation_p.V264F	NM_024969	NP_079245	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	264					apoptosis|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|large_intestine(1)|skin(1)	5						TCCTATCCGTGTTCGGACTCA	0.448													18	45	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168114364	168114364	+	Intron	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168114364C>T	uc002udx.2	+						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc010fpq.2_Intron|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TTCTTTTTGGCAGTTTGGGAA	0.318													12	34	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170012824	170012824	+	Silent	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170012824C>T	uc002ues.2	-	65	12324	c.12111G>A	c.(12109-12111)ACG>ACA	p.T4037T		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4037	EGF-like 15; calcium-binding (Potential).|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CACTCATAGACGTGAAGCCAT	0.438													7	106	---	---	---	---	PASS
TTC30A	92104	broad.mit.edu	37	2	178481602	178481602	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178481602G>T	uc002ulo.2	-	1	2093	c.1828C>A	c.(1828-1830)CAA>AAA	p.Q610K		NM_152275	NP_689488	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	610					cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			ACACATTCTTGAATAACACTG	0.388													11	177	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179451273	179451273	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179451273G>T	uc010zfg.1	-	257	56875	c.56651C>A	c.(56650-56652)CCA>CAA	p.P18884Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P12579Q|TTN_uc010zfi.1_Missense_Mutation_p.P12512Q|TTN_uc010zfj.1_Missense_Mutation_p.P12387Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	19811							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCTTCTCTTGGCAAACTGAC	0.383													22	59	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179530162	179530162	+	Silent	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179530162G>A	uc010zfk.1	-	10	971	c.423C>T	c.(421-423)GTC>GTT	p.V141V	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron			Q8WZ42	TITIN_HUMAN	SubName: Full=Titin; Flags: Fragment;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATTTCAGGGACAACTTCTT	0.358													11	172	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179604342	179604342	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179604342C>A	uc010zfh.1	-	46	13329	c.13105G>T	c.(13105-13107)GTG>TTG	p.V4369L	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.V4302L|TTN_uc010zfj.1_Missense_Mutation_p.V4177L|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTACTTTGCACGTTAAAATAA	0.393													26	44	---	---	---	---	PASS
PDE1A	5136	broad.mit.edu	37	2	183066250	183066250	+	Silent	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183066250G>A	uc002uos.2	-	11	1173	c.1089C>T	c.(1087-1089)CAC>CAT	p.H363H	PDE1A_uc010zfp.1_Silent_p.H259H|PDE1A_uc002uoq.1_Silent_p.H363H|PDE1A_uc010zfq.1_Silent_p.H363H|PDE1A_uc002uor.2_Silent_p.H347H|PDE1A_uc002uou.2_Silent_p.H329H	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2	363	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			TGTCTGCTGCGTGGAGAATCA	0.463													29	58	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185802367	185802367	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185802367G>T	uc002uph.2	+	4	2838	c.2244G>T	c.(2242-2244)ATG>ATT	p.M748I		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	748						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						TGAAACACATGAGTCAGAATC	0.333													13	30	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189901518	189901518	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189901518T>C	uc002uqk.2	-	52	4212	c.3937A>G	c.(3937-3939)ATT>GTT	p.I1313V	COL5A2_uc010frx.2_Missense_Mutation_p.I889V	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	1313	Fibrillar collagen NC1.				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TTAGGATCAATCCAGTATTCA	0.338													10	10	---	---	---	---	PASS
PMS1	5378	broad.mit.edu	37	2	190728610	190728610	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190728610C>A	uc002urh.3	+	10	2527	c.1998C>A	c.(1996-1998)CAC>CAA	p.H666Q	PMS1_uc010zga.1_3'UTR|PMS1_uc010zgb.1_Missense_Mutation_p.H605Q|PMS1_uc002urk.3_Missense_Mutation_p.H627Q|PMS1_uc002uri.3_Intron|PMS1_uc010zgc.1_Missense_Mutation_p.H490Q|PMS1_uc010zgd.1_Missense_Mutation_p.H490Q|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_Missense_Mutation_p.H627Q|PMS1_uc010frz.2_Intron|PMS1_uc002url.2_Intron|PMS1_uc002urm.2_RNA|PMS1_uc002urn.1_Missense_Mutation_p.H334Q	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	666					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			CCCAGAAGCACAAGTTAAAAA	0.373			Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					20	45	---	---	---	---	PASS
FZD7	8324	broad.mit.edu	37	2	202900498	202900498	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202900498C>A	uc002uyw.1	+	1	1189	c.1128C>A	c.(1126-1128)GCC>GCA	p.A376A		NM_003507	NP_003498	O75084	FZD7_HUMAN	frizzled 7 precursor	376	Cytoplasmic (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|mesenchymal to epithelial transition|negative regulation of cell-substrate adhesion|negative regulation of ectodermal cell fate specification|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of phosphorylation|positive regulation of transcription, DNA-dependent|regulation of catenin import into nucleus|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			skin(2)|ovary(1)|breast(1)	4						CCATCGAGGCCAACTCGCAGT	0.642											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	53	---	---	---	---	PASS
CTLA4	1493	broad.mit.edu	37	2	204732710	204732710	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204732710G>T	uc002vak.1	+	1	202	c.45G>T	c.(43-45)CTG>CTT	p.L15L	CTLA4_uc002val.1_Silent_p.L15L|CTLA4_uc010fty.1_Silent_p.L15L|CTLA4_uc010ftz.1_RNA	NM_005214	NP_005205	P16410	CTLA4_HUMAN	cytotoxic T-lymphocyte-associated protein 4	15					B cell receptor signaling pathway|immune response|negative regulation of B cell proliferation|negative regulation of regulatory T cell differentiation|positive regulation of apoptosis|response to DNA damage stimulus|T cell costimulation	clathrin-coated endocytic vesicle|external side of plasma membrane|Golgi apparatus|integral to plasma membrane|perinuclear region of cytoplasm					0					Abatacept(DB01281)	AGCTGAACCTGGCTACCAGGA	0.512													11	26	---	---	---	---	PASS
MDH1B	130752	broad.mit.edu	37	2	207615680	207615680	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207615680C>G	uc002vbs.2	-	6	1085	c.1030G>C	c.(1030-1032)GTT>CTT	p.V344L	MDH1B_uc010ziw.1_Intron|MDH1B_uc010fui.2_Missense_Mutation_p.V344L|MDH1B_uc010fuj.2_Missense_Mutation_p.V246L|MDH1B_uc002vbt.2_Intron	NM_001039845	NP_001034934	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	344					carbohydrate metabolic process|malate metabolic process|tricarboxylic acid cycle		binding|malate dehydrogenase activity			ovary(3)|kidney(1)	4				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		AAGTTTAAAACAGGGCGTGAA	0.333													13	43	---	---	---	---	PASS
USP37	57695	broad.mit.edu	37	2	219360482	219360482	+	Splice_Site	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219360482C>T	uc002vie.2	-	14	1925	c.1472_splice	c.e14+1	p.A491_splice	USP37_uc010fvs.1_Splice_Site_p.A491_splice|USP37_uc010zkf.1_Splice_Site_p.A491_splice|USP37_uc002vif.2_Splice_Site_p.A491_splice|USP37_uc002vig.2_Splice_Site_p.A419_splice	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37						ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		ACACTACTTACGCTTTACAAA	0.328													12	27	---	---	---	---	PASS
DES	1674	broad.mit.edu	37	2	220285264	220285264	+	Silent	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220285264G>A	uc002vll.2	+	4	869	c.783G>A	c.(781-783)GTG>GTA	p.V261V		NM_001927	NP_001918	P17661	DESM_HUMAN	desmin	261	Rod.|Linker 12.				cytoskeleton organization|muscle filament sliding|regulation of heart contraction	cytosol|Z disc	protein binding|structural constituent of cytoskeleton			central_nervous_system(2)	2		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		AGGTCCAGGTGGAGATGGACA	0.582													7	18	---	---	---	---	PASS
ITPR1	3708	broad.mit.edu	37	3	4715954	4715954	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4715954A>C	uc003bqa.2	+	22	2873	c.2525A>C	c.(2524-2526)GAG>GCG	p.E842A	ITPR1_uc010hca.1_Missense_Mutation_p.E827A|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Missense_Mutation_p.E827A	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	842	Cytoplasmic (Potential).				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		GAGTTTGTGGAGGAGTATTTA	0.373													4	1	---	---	---	---	PASS
IRAK2	3656	broad.mit.edu	37	3	10280730	10280730	+	Intron	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10280730C>T	uc003bve.1	+							NM_001570	NP_001561	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2						activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8						GATGGTAAGCCGGAAGTCAGA	0.393													6	8	---	---	---	---	PASS
ARPP21	10777	broad.mit.edu	37	3	35763327	35763327	+	Splice_Site	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35763327G>T	uc003cgb.2	+	14	1489	c.1225_splice	c.e14+1	p.G409_splice	ARPP21_uc003cga.2_Splice_Site_p.G355_splice|ARPP21_uc011axy.1_Splice_Site_p.G375_splice|ARPP21_uc003cgf.2_Splice_Site_p.G210_splice|ARPP21_uc003cgg.2_Splice_Site	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN	cyclic AMP-regulated phosphoprotein, 21 kD							cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3						TCCAAAGCAGGTAGTTAGTAC	0.493													4	5	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38620970	38620970	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38620970A>C	uc003cio.2	-	18	3439	c.3245T>G	c.(3244-3246)GTG>GGG	p.V1082G	SCN5A_uc003cin.2_Missense_Mutation_p.V1081G|SCN5A_uc003cil.3_Missense_Mutation_p.V1082G|SCN5A_uc010hhi.2_Missense_Mutation_p.V1082G|SCN5A_uc010hhk.2_Missense_Mutation_p.V1081G|SCN5A_uc011ayr.1_Intron|SCN5A_uc010hhj.1_Missense_Mutation_p.V692G	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1082					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GCCACCGGACACAGGCTGGGA	0.652													9	2	---	---	---	---	PASS
TCTA	6988	broad.mit.edu	37	3	49449953	49449953	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49449953C>A	uc003cwv.3	+	1	315	c.94C>A	c.(94-96)CAG>AAG	p.Q32K	RHOA_uc010hku.2_5'Flank|RHOA_uc003cwu.2_5'Flank	NM_022171	NP_071503	P57738	TCTA_HUMAN	T-cell leukemia translocation altered	32	Cytoplasmic (Potential).					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GTGGGAGGCGCAGGACATGCG	0.652													18	36	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108133140	108133140	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108133140G>T	uc003dxa.1	-	31	4201	c.4144C>A	c.(4144-4146)CAA>AAA	p.Q1382K		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	1382	Potential.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						ATTCTCCATTGCACCATTTCA	0.468													9	55	---	---	---	---	PASS
DPPA2	151871	broad.mit.edu	37	3	109026974	109026974	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109026974G>T	uc003dxo.2	-	6	810	c.563C>A	c.(562-564)TCA>TAA	p.S188*		NM_138815	NP_620170	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	188						nucleus	nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)	3						TCTTGCCCATGATGCCAACAT	0.453													26	84	---	---	---	---	PASS
DPPA4	55211	broad.mit.edu	37	3	109052821	109052821	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109052821G>T	uc003dxq.3	-	2	129	c.74C>A	c.(73-75)TCG>TAG	p.S25*	DPPA4_uc011bho.1_Nonsense_Mutation_p.S25*|DPPA4_uc011bhp.1_Nonsense_Mutation_p.S25*	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	25						nucleus	protein binding			upper_aerodigestive_tract(1)	1						CTCTTCCCTCGACTTCTCTGT	0.458													11	49	---	---	---	---	PASS
PVRL3	25945	broad.mit.edu	37	3	110852644	110852644	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110852644G>T	uc003dxt.1	+	6	1232	c.1232G>T	c.(1231-1233)GGT>GTT	p.G411V	PVRL3_uc003dxu.1_Intron	NM_015480	NP_056295	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3 precursor	411	Helical; (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane	cell adhesion molecule binding|protein homodimerization activity			upper_aerodigestive_tract(2)	2						AGTGTAGTGGGTGGGGCTCTC	0.428													32	98	---	---	---	---	PASS
RABL3	285282	broad.mit.edu	37	3	120461343	120461343	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120461343C>A	uc003edx.2	-	1	42	c.12G>T	c.(10-12)CTG>CTT	p.L4L	GTF2E1_uc003edy.2_5'Flank|GTF2E1_uc003edz.3_5'Flank	NM_173825	NP_776186	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3	4	Small GTPase-like.				small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)		TCACCCGATCCAGGGACGCCA	0.547													12	38	---	---	---	---	PASS
ADCY5	111	broad.mit.edu	37	3	123166580	123166580	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123166580C>A	uc003egh.1	-	1	813	c.813G>T	c.(811-813)CTG>CTT	p.L271L		NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	271	Helical; (Potential).				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		CCAGCACGGCCAGGTAGGGCA	0.687													8	26	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124397053	124397053	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124397053C>A	uc003ehg.2	+	50	7337	c.7210C>A	c.(7210-7212)CAT>AAT	p.H2404N	KALRN_uc003ehk.2_Missense_Mutation_p.H707N	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	2403					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						ATGTTCATGGCATACTCTACG	0.517													28	88	---	---	---	---	PASS
GP9	2815	broad.mit.edu	37	3	128780703	128780703	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128780703C>A	uc003elm.2	+	3	308	c.121C>A	c.(121-123)CAC>AAC	p.H41N		NM_000174	NP_000165	P14770	GPIX_HUMAN	glycoprotein IX (platelet) precursor	41	Extracellular (Potential).|LRRNT.				blood coagulation, intrinsic pathway|cell adhesion|platelet activation	integral to plasma membrane	protein binding				0					Quinine(DB00468)	CTGCAGGGGCCACGGACTCAC	0.692													3	15	---	---	---	---	PASS
CEP63	80254	broad.mit.edu	37	3	134277097	134277097	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134277097G>T	uc003eqo.1	+	14	2030	c.1581G>T	c.(1579-1581)CTG>CTT	p.L527L	CEP63_uc003eql.1_Intron|CEP63_uc003eqm.2_Intron|CEP63_uc003eqn.1_Intron	NM_025180	NP_079456	Q96MT8	CEP63_HUMAN	centrosomal protein 63 isoform a	527	Potential.				cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding			ovary(1)	1						AATCTCAGCTGGAGATTTCTA	0.343													17	75	---	---	---	---	PASS
NCK1	4690	broad.mit.edu	37	3	136664723	136664723	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136664723G>T	uc003erh.2	+	3	632	c.525G>T	c.(523-525)CTG>CTT	p.L175L	NCK1_uc011bme.1_Silent_p.L111L	NM_006153	NP_006144	P16333	NCK1_HUMAN	NCK adaptor protein 1	175					axon guidance|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of translation|signal complex assembly|T cell activation|T cell receptor signaling pathway	cytosol|endoplasmic reticulum|nucleus	cytoskeletal adaptor activity|receptor binding|receptor signaling complex scaffold activity			pancreas(1)	1						TGGGTTCTCTGTCAGAGAAAT	0.458													39	151	---	---	---	---	PASS
A4GNT	51146	broad.mit.edu	37	3	137843495	137843495	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137843495C>A	uc003ers.2	-	3	836	c.634G>T	c.(634-636)GTT>TTT	p.V212F		NM_016161	NP_057245	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	212	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	acetylglucosaminyltransferase activity|galactosyltransferase activity			central_nervous_system(1)	1						TAGTGTTCAACAAAGTTTTCC	0.473													31	93	---	---	---	---	PASS
TM4SF1	4071	broad.mit.edu	37	3	149095211	149095211	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149095211G>T	uc003exb.1	-	1	358	c.124C>A	c.(124-126)CAC>AAC	p.H42N	TM4SF1_uc003exc.1_5'Flank	NM_014220	NP_055035	P30408	T4S1_HUMAN	transmembrane 4 superfamily member 1	42	Extracellular (Probable).					integral to plasma membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			CGGCTGAGGTGGTTTTCGGAG	0.493													18	25	---	---	---	---	PASS
VEPH1	79674	broad.mit.edu	37	3	157188205	157188205	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157188205C>A	uc003fbj.1	-	3	569	c.252G>T	c.(250-252)GGG>GGT	p.G84G	VEPH1_uc003fbk.1_Silent_p.G84G|VEPH1_uc010hvu.1_Silent_p.G84G|VEPH1_uc003fbm.2_Silent_p.G84G|VEPH1_uc003fbn.2_Silent_p.G84G	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1	84						plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			AGTCCCAGAGCCCCACAAGGG	0.453													7	139	---	---	---	---	PASS
PEX5L	51555	broad.mit.edu	37	3	179592165	179592165	+	Missense_Mutation	SNP	C	T	T	rs146906651		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179592165C>T	uc003fki.1	-	7	806	c.676G>A	c.(676-678)GCC>ACC	p.A226T	PEX5L_uc011bqd.1_Missense_Mutation_p.A183T|PEX5L_uc011bqe.1_Missense_Mutation_p.A34T|PEX5L_uc011bqf.1_Missense_Mutation_p.A118T|PEX5L_uc003fkj.1_Missense_Mutation_p.A191T|PEX5L_uc010hxd.1_Missense_Mutation_p.A224T|PEX5L_uc011bqg.1_Missense_Mutation_p.A202T|PEX5L_uc011bqh.1_Missense_Mutation_p.A167T	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	226			A -> T (in a colorectal cancer sample; somatic mutation).		protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding	p.A226T(1)		ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			GAGTTGAGGGCGCTTTTTCCA	0.393													11	60	---	---	---	---	PASS
APOD	347	broad.mit.edu	37	3	195295819	195295819	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195295819G>T	uc003fur.2	-	5	884	c.522C>A	c.(520-522)GTC>GTA	p.V174V		NM_001647	NP_001638	P05090	APOD_HUMAN	apolipoprotein D precursor	174					lipid metabolic process	extracellular space	lipid binding|lipid transporter activity|protein binding			ovary(2)	2	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		TCATTTTCTTGACATCAATGT	0.458													7	144	---	---	---	---	PASS
MFI2	4241	broad.mit.edu	37	3	196743245	196743245	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196743245G>T	uc003fxk.3	-							NM_005929	NP_005920	P08582	TRFM_HUMAN	melanoma-associated antigen p97 isoform 1						cellular iron ion homeostasis|iron ion transport	anchored to membrane|extracellular region|integral to plasma membrane	ferric iron binding|protein binding				0	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		CAGACGCTGTGTGTCAAGGGG	0.577													23	92	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46066551	46066551	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46066551G>T	uc003gxb.2	-							NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		CTATTTAGATGGAAAGAAAAG	0.289													3	44	---	---	---	---	PASS
GABRB1	2560	broad.mit.edu	37	4	47163480	47163480	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47163480G>T	uc003gxh.2	+	4	829	c.455G>T	c.(454-456)GGA>GTA	p.G152V	GABRB1_uc011bze.1_Missense_Mutation_p.G82V	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	152	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	GTTCTCTATGGACTCCGGTAA	0.388													34	26	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47584003	47584003	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47584003C>G	uc003gxk.1	+	21	3839	c.3675C>G	c.(3673-3675)ATC>ATG	p.I1225M	ATP10D_uc003gxl.1_Missense_Mutation_p.I473M	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1225	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						ATACTGACATCTTTGCATTTG	0.463													9	117	---	---	---	---	PASS
AASDH	132949	broad.mit.edu	37	4	57204811	57204811	+	Silent	SNP	T	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57204811T>G	uc003hbn.2	-	15	3207	c.3054A>C	c.(3052-3054)TCA>TCC	p.S1018S	AASDH_uc010ihb.2_Silent_p.S533S|AASDH_uc011caa.1_3'UTR|AASDH_uc003hbo.2_Silent_p.S918S|AASDH_uc011cab.1_Silent_p.S533S|AASDH_uc010ihc.2_3'UTR	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	1018					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				CATAGACCCTTGAAGTAGTTT	0.408													18	43	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62449388	62449388	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62449388G>T	uc010ihh.2	+						LPHN3_uc003hcq.3_Intron|LPHN3_uc010ihg.1_Intron	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						ATTAGTTCATGTCCCTTCAGT	0.368													50	63	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114275283	114275283	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114275283G>A	uc003ibe.3	+	38	5609	c.5509G>A	c.(5509-5511)GCA>ACA	p.A1837T	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_5'Flank|ANK2_uc011cgb.1_Missense_Mutation_p.A1852T	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	1804	Repeat A.|Repeat-rich region.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TTCCTCTTCCGCAAAAACTGA	0.507													4	84	---	---	---	---	PASS
SYNPO2	171024	broad.mit.edu	37	4	119948592	119948592	+	Silent	SNP	A	G	G	rs137938917	by1000genomes	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119948592A>G	uc003icm.3	+	3	1264	c.1068A>G	c.(1066-1068)GCA>GCG	p.A356A	SYNPO2_uc010ina.2_Silent_p.A356A|SYNPO2_uc010inb.2_Silent_p.A356A|SYNPO2_uc011cgh.1_Intron|SYNPO2_uc010inc.2_Silent_p.A284A	NM_001128933	NP_001122405	Q9UMS6	SYNP2_HUMAN	synaptopodin 2 isoform b	356						nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2						CGCGGCATGCACGTAAGTTCT	0.502													10	8	---	---	---	---	PASS
FGF2	2247	broad.mit.edu	37	4	123797552	123797552	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123797552G>C	uc003iev.1	+	2	722	c.654G>C	c.(652-654)ATG>ATC	p.M218I		NM_002006	NP_001997	P09038	FGF2_HUMAN	fibroblast growth factor 2	218					activation of MAPK activity|branching involved in ureteric bud morphogenesis|cell migration involved in sprouting angiogenesis|chemotaxis|chondroblast differentiation|embryonic morphogenesis|fibroblast growth factor receptor signaling pathway|inositol phosphate biosynthetic process|insulin receptor signaling pathway|negative regulation of blood vessel endothelial cell migration|negative regulation of cell death|organ morphogenesis|phosphatidylinositol biosynthetic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of cardiac muscle cell proliferation|positive regulation of cell division|positive regulation of cell fate specification|positive regulation of ERK1 and ERK2 cascade|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of phospholipase C activity|Ras protein signal transduction|release of sequestered calcium ion into cytosol|wound healing	extracellular space	fibroblast growth factor receptor binding|growth factor activity|heparin binding|ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|lung(1)|central_nervous_system(1)	3					Pentosan Polysulfate(DB00686)	ACCTGGCTATGAAGGAAGATG	0.363													9	10	---	---	---	---	PASS
NUDT6	11162	broad.mit.edu	37	4	123838817	123838817	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123838817C>A	uc003iew.2	-	2	313	c.281G>T	c.(280-282)TGG>TTG	p.W94L	NUDT6_uc003iex.2_5'UTR	NM_007083	NP_009014	P53370	NUDT6_HUMAN	nudix-type motif 6 isoform a	94						mitochondrion|nucleus	growth factor activity|hydrolase activity				0						AATGTGCAGCCATACAGCTGT	0.448													9	15	---	---	---	---	PASS
FGA	2243	broad.mit.edu	37	4	155508748	155508748	+	Silent	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155508748C>T	uc003iod.1	-	4	484	c.426G>A	c.(424-426)AAG>AAA	p.K142K	FGA_uc003ioe.1_Silent_p.K142K|FGA_uc003iof.1_Silent_p.K142K	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	142	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TGACTTTGCGCTTCAGGACTT	0.413													26	37	---	---	---	---	PASS
NAF1	92345	broad.mit.edu	37	4	164087748	164087748	+	Silent	SNP	T	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164087748T>C	uc003iqj.2	-	1	326	c.132A>G	c.(130-132)CTA>CTG	p.L44L	NAF1_uc010iqw.1_Silent_p.L44L|NAF1_uc003iqk.2_RNA	NM_138386	NP_612395	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 homolog isoform a	44					rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding			ovary(2)	2	all_hematologic(180;0.166)	Prostate(90;0.109)				CAAACGACTGTAGCGGCGGCT	0.662													6	3	---	---	---	---	PASS
GPM6A	2823	broad.mit.edu	37	4	176594915	176594915	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176594915C>A	uc003iuf.2	-	3	1107	c.303G>T	c.(301-303)GTG>GTT	p.V101V	GPM6A_uc011ckj.1_Silent_p.V94V|GPM6A_uc003iug.2_Silent_p.V101V|GPM6A_uc003iuh.2_Silent_p.V90V	NM_201591	NP_963885	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 2	101	Helical; (Potential).					cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		AGAAACCTTCCACCATCAGCA	0.423													18	13	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187517903	187517903	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187517903G>T	uc003izf.2	-	25	12979	c.12791C>A	c.(12790-12792)TCA>TAA	p.S4264*	FAT1_uc010isn.2_5'Flank|FAT1_uc003ize.2_Nonsense_Mutation_p.S155*	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	4264	Cytoplasmic (Potential).				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						ATTGTTTCTTGAGTCACTTGG	0.478										HNSCC(5;0.00058)			10	11	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187538166	187538166	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187538166C>A	uc003izf.2	-	11	9256	c.9068G>T	c.(9067-9069)TGT>TTT	p.C3023F		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	3023	Extracellular (Potential).|Cadherin 27.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TACCTTTTCACAAACTGGACT	0.393										HNSCC(5;0.00058)			23	18	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187584459	187584459	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187584459T>A	uc003izf.2	-	3	3762	c.3574A>T	c.(3574-3576)AAA>TAA	p.K1192*		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	1192	Extracellular (Potential).|Cadherin 10.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						ATACCTGTTTTAGGATGTATT	0.224										HNSCC(5;0.00058)			9	8	---	---	---	---	PASS
KIAA0947	23379	broad.mit.edu	37	5	5464632	5464632	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5464632G>T	uc003jdm.3	+	13	5407	c.5185G>T	c.(5185-5187)GGC>TGC	p.G1729C		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1729	Pro-rich.									ovary(1)|central_nervous_system(1)	2						TCCTGTGCCTGGCCGACTCCC	0.582													9	27	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11082905	11082905	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11082905G>T	uc003jfa.1	-	16	2836	c.2691C>A	c.(2689-2691)CTC>CTA	p.L897L	CTNND2_uc010itt.2_Silent_p.L806L|CTNND2_uc011cmy.1_Silent_p.L560L|CTNND2_uc011cmz.1_Silent_p.L464L|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Silent_p.L489L	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	897	ARM 8.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						GCAGCTCCACGAGGATGGGCA	0.552													22	40	---	---	---	---	PASS
TRIO	7204	broad.mit.edu	37	5	14331006	14331006	+	Silent	SNP	A	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14331006A>G	uc003jff.2	+	10	1857	c.1851A>G	c.(1849-1851)GCA>GCG	p.A617A	TRIO_uc003jfg.2_RNA|TRIO_uc011cna.1_Silent_p.A568A|TRIO_uc003jfh.1_Silent_p.A266A	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	617	Spectrin 2.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					AAGAAGTGGCACAGGTAAAAC	0.398													32	79	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19483489	19483489	+	Silent	SNP	A	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19483489A>G	uc003jgc.2	-	11	2180	c.1803T>C	c.(1801-1803)CAT>CAC	p.H601H	CDH18_uc003jgd.2_Silent_p.H601H|CDH18_uc011cnm.1_Missense_Mutation_p.M565T	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	601	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AGGCTTCTGCATGGCAGGTCC	0.517													9	14	---	---	---	---	PASS
WDR70	55100	broad.mit.edu	37	5	37443371	37443371	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37443371G>T	uc003jkv.2	+	7	641	c.583G>T	c.(583-585)GCC>TCC	p.A195S	WDR70_uc010iva.1_Missense_Mutation_p.A195S	NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	WD repeat domain 70	195	WD 1.									ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCCCTCAGGTGCCCGTTTGGT	0.413													11	33	---	---	---	---	PASS
OSMR	9180	broad.mit.edu	37	5	38919142	38919142	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38919142C>A	uc003jln.1	+	11	1930	c.1563C>A	c.(1561-1563)GTC>GTA	p.V521V	OSMR_uc011cpj.1_5'UTR	NM_003999	NP_003990	Q99650	OSMR_HUMAN	oncostatin M receptor precursor	521	Fibronectin type-III 2.|Extracellular (Potential).				cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_lung(31;0.000365)					CTGTAATAGTCATCTCTGCAG	0.398													10	44	---	---	---	---	PASS
ITGA2	3673	broad.mit.edu	37	5	52355737	52355737	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52355737G>T	uc003joy.2	+	11	1350	c.1207G>T	c.(1207-1209)GGC>TGC	p.G403C	ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Missense_Mutation_p.G327C|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	NM_002203	NP_002194	P17301	ITA2_HUMAN	integrin alpha 2 precursor	403	Extracellular (Potential).|FG-GAP 3.				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity			lung(1)	1		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				GGGAGCTTTTGGCTGGAGTGG	0.398													6	22	---	---	---	---	PASS
SV2C	22987	broad.mit.edu	37	5	75427817	75427817	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75427817G>T	uc003kei.1	+	2	376	c.242G>T	c.(241-243)GGG>GTG	p.G81V		NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	81	Cytoplasmic (Potential).				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		GCCACTGAGGGGCATGATGAA	0.527													9	12	---	---	---	---	PASS
RASA1	5921	broad.mit.edu	37	5	86672323	86672323	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86672323C>T	uc003kiw.2	+	16	2243	c.2125C>T	c.(2125-2127)CGA>TGA	p.R709*	RASA1_uc010jav.2_RNA|RASA1_uc003kix.2_Nonsense_Mutation_p.R532*|RASA1_uc011ctv.1_Nonsense_Mutation_p.R542*|RASA1_uc011ctw.1_Nonsense_Mutation_p.R543*|RASA1_uc010jaw.2_Nonsense_Mutation_p.R531*	NM_002890	NP_002881	P20936	RASA1_HUMAN	RAS p21 protein activator 1 isoform 1	709					cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding			upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		CCTGCGTGTTCGAGCACGATA	0.398													29	20	---	---	---	---	PASS
BRD8	10902	broad.mit.edu	37	5	137514307	137514307	+	5'UTR	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137514307G>T	uc003lcf.1	-	1					BRD8_uc003lcc.1_5'Flank|BRD8_uc003lcg.2_5'UTR|BRD8_uc003lci.2_5'UTR|BRD8_uc003lch.2_5'UTR|BRD8_uc011cym.1_5'UTR|BRD8_uc010jer.1_5'Flank|BRD8_uc011cyn.1_5'UTR|BRD8_uc010jes.1_5'UTR|KIF20A_uc003lcj.2_5'Flank|KIF20A_uc011cyo.1_5'Flank	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2						cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TCGCCATCTTGGCCCCGAAGT	0.557													23	33	---	---	---	---	PASS
HARS	3035	broad.mit.edu	37	5	140056393	140056393	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140056393G>T	uc003lgv.2	-	10	1122	c.1040C>A	c.(1039-1041)GCA>GAA	p.A347E	HARS_uc003lgu.2_Missense_Mutation_p.A278E|HARS_uc011czm.1_Missense_Mutation_p.A307E|HARS_uc003lgw.2_Missense_Mutation_p.A327E|HARS_uc011czn.1_Missense_Mutation_p.A287E|HARS_uc010jfu.2_Missense_Mutation_p.A347E|HARS_uc011czo.1_Missense_Mutation_p.A273E|HARS_uc011czp.1_Missense_Mutation_p.A233E|HARS_uc011czq.1_Missense_Mutation_p.A237E	NM_002109	NP_002100	P12081	SYHC_HUMAN	histidyl-tRNA synthetase	347				A -> E (in Ref. 2; CAA28956).	histidyl-tRNA aminoacylation	cytosol	ATP binding|histidine-tRNA ligase activity			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		L-Histidine(DB00117)	CTCTTCCCCTGCCTGGGCTGG	0.592													33	31	---	---	---	---	PASS
PCDHB11	56125	broad.mit.edu	37	5	140580574	140580574	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140580574G>T	uc003liy.2	+	1	1227	c.1227G>T	c.(1225-1227)CTG>CTT	p.L409L	PCDHB11_uc011daj.1_Silent_p.L44L	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11 precursor	409	Extracellular (Potential).|Cadherin 4.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGAGACCACTGGACAGAGAGA	0.488													13	43	---	---	---	---	PASS
PCDHGB5	56101	broad.mit.edu	37	5	140778631	140778631	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140778631A>G	uc003lkf.1	+	1	937	c.937A>G	c.(937-939)ATG>GTG	p.M313V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Missense_Mutation_p.M313V	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	protocadherin gamma subfamily B, 5 isoform 1	313	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAATATTCAATGGTTGTAGA	0.388													50	53	---	---	---	---	PASS
SPINK5	11005	broad.mit.edu	37	5	147498010	147498010	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147498010C>T	uc003lox.2	+	23	2196	c.2123C>T	c.(2122-2124)GCT>GTT	p.A708V	SPINK5_uc010jgs.1_Missense_Mutation_p.A680V|SPINK5_uc010jgr.2_Missense_Mutation_p.A689V|SPINK5_uc003low.2_Missense_Mutation_p.A708V|SPINK5_uc003loy.2_Missense_Mutation_p.A708V	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform	708	Kazal-like 11.				anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGAATGTGCTGAGTATCGG	0.418													3	46	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150946862	150946862	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150946862C>T	uc003lue.3	-	1	1644	c.1631G>A	c.(1630-1632)CGG>CAG	p.R544Q	GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Missense_Mutation_p.R544Q	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	544	Cadherin 4.|Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCCTTCTCCCGGCGAAAAGG	0.478													28	20	---	---	---	---	PASS
OR2Y1	134083	broad.mit.edu	37	5	180166564	180166564	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180166564G>T	uc003mmf.1	-	1	495	c.495C>A	c.(493-495)GCC>GCA	p.A165A		NM_001001657	NP_001001657	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGAGAGGCATGGCCATTGCGA	0.547													4	19	---	---	---	---	PASS
BTNL3	10917	broad.mit.edu	37	5	180419856	180419856	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180419856G>T	uc003mmr.2	+	2	221	c.93G>T	c.(91-93)TTG>TTT	p.L31F		NM_197975	NP_932079	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3 precursor	31	Extracellular (Potential).				lipid metabolic process	integral to membrane					0	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			TCCAGGCCTTGGTGGGGGAGG	0.542													5	47	---	---	---	---	PASS
MYLK4	340156	broad.mit.edu	37	6	2679591	2679591	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2679591G>T	uc003mty.3	-	9	1107	c.810C>A	c.(808-810)CTC>CTA	p.L270L	MYLK4_uc003mtx.3_5'UTR	NM_001012418	NP_001012418	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	270	Protein kinase.						ATP binding|protein serine/threonine kinase activity			breast(3)|ovary(1)	4	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				CTTCAGGGGCGAGAAATTCTG	0.453													51	131	---	---	---	---	PASS
ZSCAN16	80345	broad.mit.edu	37	6	28094583	28094583	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28094583G>T	uc003nkm.2	+	3	510	c.410G>T	c.(409-411)CGG>CTG	p.R137L	uc010jqw.1_Intron|uc003nkk.1_Intron|uc003nkl.1_Intron|ZSCAN16_uc011dky.1_Missense_Mutation_p.R137L	NM_025231	NP_079507	Q9H4T2	ZSC16_HUMAN	zinc finger and SCAN domain containing 16	137			R -> Q (in a colorectal cancer sample; somatic mutation).		viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.R137Q(1)		large_intestine(1)	1						TCAGAAAGACGGGACATACTC	0.453													3	14	---	---	---	---	PASS
ZFP57	346171	broad.mit.edu	37	6	29640440	29640440	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29640440A>T	uc011dlw.1	-	4	1599	c.1448T>A	c.(1447-1449)CTT>CAT	p.L483H	ZFP57_uc003nnl.3_Missense_Mutation_p.L463H	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN	zinc finger protein 57 homolog	399					DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5						AGAGAAGCCAAGCCACTGGCC	0.572													22	31	---	---	---	---	PASS
C6orf15	29113	broad.mit.edu	37	6	31079659	31079659	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31079659G>T	uc003nsk.1	-	2	477	c.477C>A	c.(475-477)GCC>GCA	p.A159A	PSORS1C1_uc003nsl.1_5'Flank|PSORS1C1_uc010jsj.1_5'Flank	NM_014070	NP_054789	Q6UXA7	CF015_HUMAN	STG protein precursor	159											0						AGAGGCCTGTGGCATCGGGAG	0.627													18	23	---	---	---	---	PASS
TAP2	6891	broad.mit.edu	37	6	32805735	32805735	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32805735G>T	uc003occ.2	-	1	307	c.276C>A	c.(274-276)GCC>GCA	p.A92A	TAP2_uc011dqf.1_Silent_p.A92A|TAP2_uc003ocb.1_Silent_p.A92A|TAP2_uc003ocd.2_Silent_p.A92A	NM_018833	NP_061313	Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family	92	Lumenal (Potential).				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding				0						AAGCGACTCTGGCTGGGGGAG	0.687													12	34	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33146095	33146095	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33146095G>C	uc003ocx.1	-	20	2036	c.1808C>G	c.(1807-1809)CCT>CGT	p.P603R	COL11A2_uc010jul.1_5'Flank|COL11A2_uc003ocy.1_Missense_Mutation_p.P517R|COL11A2_uc003ocz.1_Missense_Mutation_p.P496R	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	603	Triple-helical region.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						CGACTCTCCAGGCAGCCCTCG	0.612													16	37	---	---	---	---	PASS
TAPBP	6892	broad.mit.edu	37	6	33281789	33281789	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33281789C>A	uc003odx.1	-	1	201	c.30G>T	c.(28-30)GTG>GTT	p.V10V	TAPBP_uc010jus.1_Silent_p.V10V|TAPBP_uc003ody.2_Silent_p.V10V|TAPBP_uc003odz.2_Silent_p.V10V|TAPBP_uc010jut.1_Silent_p.V10V|TAPBP_uc011drc.1_Silent_p.V10V	NM_003190	NP_003181	O15533	TPSN_HUMAN	tapasin isoform 1 precursor	10					antigen processing and presentation of endogenous peptide antigen via MHC class I|immune response|peptide antigen stabilization|protein complex assembly|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|MHC class I peptide loading complex|microsome	MHC class I protein binding|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|unfolded protein binding			ovary(1)	1						CACCCAAAGCCACAGCGAGGA	0.627													18	36	---	---	---	---	PASS
PIM1	5292	broad.mit.edu	37	6	37138631	37138631	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37138631C>A	uc003onk.2	+	2	595	c.165C>A	c.(163-165)GGC>GGA	p.G55G	PIM1_uc011dtw.1_5'Flank	NM_002648	NP_002639	P11309	PIM1_HUMAN	non-specific serine/threonine protein kinase	146	Protein kinase.				cell cycle|cell proliferation|multicellular organismal development|negative regulation of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|protein autophosphorylation	cytoplasm|nucleus|plasma membrane	ATP binding|manganese ion binding|protein binding|protein binding|protein serine/threonine kinase activity|transcription factor binding			large_intestine(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	TCTACTCAGGCATCCGCGTCT	0.517			T	BCL6	NHL								4	17	---	---	---	---	PASS
KCNK16	83795	broad.mit.edu	37	6	39285661	39285661	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39285661G>T	uc003ooq.2	-	3	410	c.396C>A	c.(394-396)GGC>GGA	p.G132G	KCNK16_uc003oor.3_Silent_p.G132G|KCNK16_uc010jwy.2_Silent_p.G132G|KCNK16_uc011dtz.1_Silent_p.G132G	NM_032115	NP_115491	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	132	Helical; (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(1)	3						TAAGCGGGATGCCCAACAGGG	0.602													6	11	---	---	---	---	PASS
PTK7	5754	broad.mit.edu	37	6	43126659	43126659	+	Silent	SNP	A	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43126659A>G	uc003oub.1	+	18	3024	c.2826A>G	c.(2824-2826)AGA>AGG	p.R942R	PTK7_uc003ouc.1_Silent_p.R886R|PTK7_uc003oud.1_Silent_p.R902R|PTK7_uc003oue.1_Silent_p.R812R|PTK7_uc003ouf.1_RNA|PTK7_uc003oug.1_RNA|PTK7_uc011dve.1_Silent_p.R950R|PTK7_uc010jyj.1_Silent_p.R268R|PTK7_uc003ouh.1_5'Flank	NM_002821	NP_002812	Q13308	PTK7_HUMAN	PTK7 protein tyrosine kinase 7 isoform a	942	Cytoplasmic (Potential).|Protein kinase; inactive.|Interaction with CTNNB1.				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			GTGCCCAGAGACAAGTGAAGG	0.592													10	29	---	---	---	---	PASS
AARS2	57505	broad.mit.edu	37	6	44272023	44272023	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44272023G>T	uc010jza.1	-	14	1905	c.1902C>A	c.(1900-1902)GCC>GCA	p.A634A	SPATS1_uc003oxg.2_Intron|TMEM151B_uc003oxf.2_Intron	NM_020745	NP_065796	Q5JTZ9	SYAM_HUMAN	alanyl-tRNA synthetase 2, mitochondrial	634					alanyl-tRNA aminoacylation	mitochondrion	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			ovary(1)	1	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		L-Alanine(DB00160)	GCAGGTGGGTGGCCGTATGCT	0.627											OREG0017473	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	53	---	---	---	---	PASS
COL21A1	81578	broad.mit.edu	37	6	55924040	55924040	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55924040C>A	uc003pcs.2	-	29	2841	c.2609G>T	c.(2608-2610)GGC>GTC	p.G870V	COL21A1_uc010jzz.2_Missense_Mutation_p.G255V|COL21A1_uc011dxg.1_Missense_Mutation_p.G243V|COL21A1_uc011dxh.1_Missense_Mutation_p.G221V|COL21A1_uc003pcr.2_Missense_Mutation_p.G227V	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor	870	Collagen-like 6.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TCCTGGTAGGCCTGCAGGGTG	0.433													4	22	---	---	---	---	PASS
ZNF451	26036	broad.mit.edu	37	6	57012772	57012772	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57012772G>C	uc003pdm.1	+	10	2113	c.1889G>C	c.(1888-1890)AGC>ACC	p.S630T	ZNF451_uc003pdl.2_Missense_Mutation_p.S630T|ZNF451_uc003pdn.1_Missense_Mutation_p.S630T|uc003pdq.1_Intron|ZNF451_uc003pdk.1_Missense_Mutation_p.S630T	NM_001031623	NP_001026794	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451 isoform 1	630	C2H2-type 7; atypical.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TCTTTGGCAAGCCACAAGTTT	0.423													32	61	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90435040	90435040	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90435040C>A	uc003pnn.1	-	38	5664	c.5548G>T	c.(5548-5550)GAG>TAG	p.E1850*		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	1850					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ATTCCTAACTCAGGCACATAG	0.433													16	47	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90504480	90504480	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90504480G>C	uc003pnn.1	-	3	486	c.370C>G	c.(370-372)CAA>GAA	p.Q124E	MDN1_uc003pnp.1_Missense_Mutation_p.Q124E	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	124					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AAAAGTCTTTGAAAGACTGGG	0.353													8	64	---	---	---	---	PASS
C6orf167	253714	broad.mit.edu	37	6	97681743	97681743	+	Silent	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97681743C>T	uc003ppb.2	-	12	1562	c.1296G>A	c.(1294-1296)AAG>AAA	p.K432K	C6orf167_uc011eaf.1_Intron|C6orf167_uc010kcn.1_Silent_p.K206K|C6orf167_uc010kco.1_Silent_p.K168K	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714	432					double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		TCACCAGGTTCTTACTATAAT	0.308													21	51	---	---	---	---	PASS
FYN	2534	broad.mit.edu	37	6	111995730	111995730	+	Silent	SNP	C	A	A	rs142448026		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111995730C>A	uc003pvj.2	-	12	1717	c.1377G>T	c.(1375-1377)CTG>CTT	p.L459L	FYN_uc003pvi.2_Silent_p.L404L|FYN_uc003pvk.2_Silent_p.L459L|FYN_uc003pvh.2_Silent_p.L456L	NM_002037	NP_002028	P06241	FYN_HUMAN	protein-tyrosine kinase fyn isoform a	459	Protein kinase.				axon guidance|calcium ion transport|feeding behavior|interspecies interaction between organisms|intracellular protein kinase cascade|learning|leukocyte migration|platelet activation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|endosome|plasma membrane	ATP binding|glycoprotein binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|central_nervous_system(1)|skin(1)	7		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	CTTTGGTGACCAGCTCTGTGA	0.522													40	113	---	---	---	---	PASS
FYN	2534	broad.mit.edu	37	6	111995731	111995731	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111995731A>G	uc003pvj.2	-	12	1716	c.1376T>C	c.(1375-1377)CTG>CCG	p.L459P	FYN_uc003pvi.2_Missense_Mutation_p.L404P|FYN_uc003pvk.2_Missense_Mutation_p.L459P|FYN_uc003pvh.2_Missense_Mutation_p.L456P	NM_002037	NP_002028	P06241	FYN_HUMAN	protein-tyrosine kinase fyn isoform a	459	Protein kinase.				axon guidance|calcium ion transport|feeding behavior|interspecies interaction between organisms|intracellular protein kinase cascade|learning|leukocyte migration|platelet activation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|endosome|plasma membrane	ATP binding|glycoprotein binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|central_nervous_system(1)|skin(1)	7		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	TTTGGTGACCAGCTCTGTGAG	0.522													39	113	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117622242	117622242	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117622242T>A	uc003pxp.1	-	42	6827	c.6628A>T	c.(6628-6630)AGA>TGA	p.R2210*	ROS1_uc011ebi.1_RNA	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	2210	Protein kinase.|Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TCCTGAATTCTATGAAAAGTA	0.363			T	GOPC|ROS1	glioblastoma|NSCLC								29	82	---	---	---	---	PASS
TAAR1	134864	broad.mit.edu	37	6	132967003	132967003	+	Missense_Mutation	SNP	G	C	C	rs149785438		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132967003G>C	uc003qdm.1	-	1	140	c.140C>G	c.(139-141)TCT>TGT	p.S47C		NM_138327	NP_612200	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	47	Cytoplasmic (Potential).					plasma membrane					0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)	GTGTGATATAGAAACAATAAC	0.423													32	101	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	145119013	145119013	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145119013G>T	uc003qkt.2	+	63	9224	c.9132G>T	c.(9130-9132)TTG>TTT	p.L3044F		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	3044	Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GGATGCATTTGGAACCACAGT	0.373													18	41	---	---	---	---	PASS
FNDC1	84624	broad.mit.edu	37	6	159653965	159653965	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159653965G>T	uc010kjv.2	+	11	2621	c.2421G>T	c.(2419-2421)ACG>ACT	p.T807T	FNDC1_uc010kjw.1_Silent_p.T692T	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	807						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CGGCCCAGACGCTGCGGGCCC	0.647													3	9	---	---	---	---	PASS
TNRC18	84629	broad.mit.edu	37	7	5352366	5352366	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5352366T>A	uc003soi.3	-	27	8505	c.8156A>T	c.(8155-8157)AAG>ATG	p.K2719M		NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2719							DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGGCGTCTTCTTGCCTGGGGA	0.756													8	7	---	---	---	---	PASS
HDAC9	9734	broad.mit.edu	37	7	18788634	18788634	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18788634C>T	uc003suh.2	+	13	1948	c.1907C>T	c.(1906-1908)GCC>GTC	p.A636V	HDAC9_uc003sue.2_Missense_Mutation_p.A636V|HDAC9_uc011jyd.1_Missense_Mutation_p.A636V|HDAC9_uc003sui.2_Missense_Mutation_p.A639V|HDAC9_uc003suj.2_Missense_Mutation_p.A595V|HDAC9_uc003sua.1_Missense_Mutation_p.A614V|HDAC9_uc010kue.1_Missense_Mutation_p.A291V	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	636	Histone deacetylase.				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	AAAGGAATTGCCTATGACCCC	0.423													12	15	---	---	---	---	PASS
FKBP14	55033	broad.mit.edu	37	7	30066010	30066010	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30066010G>T	uc003tal.1	-	1	259	c.115C>A	c.(115-117)CAT>AAT	p.H39N	PLEKHA8_uc003tao.2_5'Flank|PLEKHA8_uc003tap.1_5'Flank|FKBP14_uc010kvq.1_RNA|PLEKHA8_uc003tam.1_5'Flank|PLEKHA8_uc003tan.2_5'Flank	NM_017946	NP_060416	Q9NWM8	FKB14_HUMAN	FK506 binding protein 14 precursor	39					protein folding	endoplasmic reticulum lumen|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0						GTCTTGCGATGGCAGATGAAT	0.468													21	57	---	---	---	---	PASS
NPC1L1	29881	broad.mit.edu	37	7	44560416	44560416	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44560416G>T	uc003tlb.2	-	14	3140	c.3084C>A	c.(3082-3084)GGC>GGA	p.G1028G	NPC1L1_uc003tlc.2_Silent_p.G1028G|NPC1L1_uc011kbw.1_Silent_p.G982G|NPC1L1_uc003tla.2_Silent_p.G31G	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN	Niemann-Pick C1-like protein 1 isoform 1	1028	Cytoplasmic (Potential).				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5					Ezetimibe(DB00973)	ATGCTGCCAGGCCGCTGCAAG	0.577													30	45	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48319311	48319311	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48319311C>A	uc003toq.2	+	18	8545	c.8520C>A	c.(8518-8520)TCC>TCA	p.S2840S	ABCA13_uc010kys.1_5'Flank	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	2840					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						GGATAACTTCCACAAGAACTT	0.353													39	58	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48338050	48338050	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48338050A>G	uc003toq.2	+	23	9312	c.9287A>G	c.(9286-9288)CAT>CGT	p.H3096R	ABCA13_uc010kys.1_Missense_Mutation_p.H170R	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3096					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						GAGACTATCCATAGCATTCTA	0.418													15	32	---	---	---	---	PASS
TPST1	8460	broad.mit.edu	37	7	65705968	65705968	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65705968G>T	uc003tuw.2	+	2	908	c.556G>T	c.(556-558)GGC>TGC	p.G186C	TPST1_uc010kzy.2_Intron|TPST1_uc010kzz.2_Missense_Mutation_p.G186C|TPST1_uc010laa.2_Missense_Mutation_p.G186C	NM_003596	NP_003587	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	186	Lumenal (Potential).				inflammatory response|peptidyl-tyrosine sulfation	Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity				0						GGTCCGAGATGGCCGGGCATC	0.398													25	52	---	---	---	---	PASS
POM121C	100101267	broad.mit.edu	37	7	75051285	75051285	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75051285G>T	uc003udk.3	-	13	3135	c.2250C>A	c.(2248-2250)TCC>TCA	p.S750S		NM_001099415	NP_001092885	A8CG34	P121C_HUMAN	POM121 membrane glycoprotein (rat)-like	992	Pore side (Potential).				mRNA transport|protein transport|transmembrane transport	endoplasmic reticulum membrane|nuclear membrane|nuclear pore	protein binding				0						TCTTGATCGTGGACGCAGGTG	0.632													7	21	---	---	---	---	PASS
HIP1	3092	broad.mit.edu	37	7	75171269	75171269	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75171269G>T	uc003uds.1	-	29	2962	c.2921C>A	c.(2920-2922)ACA>AAA	p.T974K	HIP1_uc011kfz.1_Missense_Mutation_p.T800K	NM_005338	NP_005329	O00291	HIP1_HUMAN	huntingtin interacting protein 1	974	I/LWEQ.				activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						TTTGATCTGTGTCAGCGTCAT	0.468			T	PDGFRB	CMML								7	98	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82764257	82764257	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82764257G>T	uc003uhx.2	-	3	2898	c.2609C>A	c.(2608-2610)CCA>CAA	p.P870Q	PCLO_uc003uhv.2_Missense_Mutation_p.P870Q	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	816	Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TTTTGGCATTGGCTTGGCATC	0.517													67	143	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86468253	86468253	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86468253G>A	uc003uid.2	+	4	2522	c.1423G>A	c.(1423-1425)GGT>AGT	p.G475S	GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Missense_Mutation_p.G347S|GRM3_uc010leh.2_Missense_Mutation_p.G67S	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	475	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	CCAAAATGTAGGTGGAAAGTA	0.443													14	13	---	---	---	---	PASS
GJC3	349149	broad.mit.edu	37	7	99526808	99526808	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99526808C>A	uc011kjd.1	-	1	436	c.436G>T	c.(436-438)GTC>TTC	p.V146F		NM_181538	NP_853516	Q8NFK1	CXG3_HUMAN	gap junction protein, gamma 3, 30.2kDa	146	Helical; (Potential).					connexon complex|integral to membrane				ovary(1)	1	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					CCCTCCAGGACAAGCCGAGCC	0.617													26	61	---	---	---	---	PASS
STAG3	10734	broad.mit.edu	37	7	99786584	99786584	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99786584C>A	uc003utx.1	+	7	815	c.660C>A	c.(658-660)CTC>CTA	p.L220L	STAG3_uc010lgs.1_Silent_p.L8L|STAG3_uc011kjk.1_Silent_p.L162L	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3	220					chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCTCCCTGCTCACTGGCCTCT	0.527													18	62	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100552385	100552385	+	RNA	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100552385C>T	uc003uxk.1	+	1		c.1636C>T			uc003uxl.1_Missense_Mutation_p.T279I					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		ACTACTCTTACTACATATATG	0.473													71	202	---	---	---	---	PASS
C7orf52	375607	broad.mit.edu	37	7	100817922	100817922	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100817922A>G	uc003uxy.1	-	2	406	c.167T>C	c.(166-168)GTG>GCG	p.V56A	C7orf52_uc003uxz.1_Missense_Mutation_p.V56A|C7orf52_uc003uya.1_Missense_Mutation_p.V56A|C7orf52_uc003uyb.1_Missense_Mutation_p.V56A	NM_198571	NP_940973	Q8N8M0	CG052_HUMAN	hypothetical protein LOC375607	56	N-acetyltransferase.						N-acetyltransferase activity			ovary(1)	1	Lung NSC(181;0.168)|all_lung(186;0.215)					CGTGGCCACCACGAAGTCCAA	0.662													9	51	---	---	---	---	PASS
RINT1	60561	broad.mit.edu	37	7	105177043	105177043	+	Silent	SNP	T	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105177043T>C	uc003vda.1	+	3	351	c.120T>C	c.(118-120)AGT>AGC	p.S40S	RINT1_uc010ljj.1_5'UTR	NM_021930	NP_068749	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	40					cell cycle|G2/M transition DNA damage checkpoint|protein transport|vesicle-mediated transport	endoplasmic reticulum membrane	protein binding			ovary(3)|central_nervous_system(1)	4						TTATTGGAAGTAAACAAGTCA	0.318													5	138	---	---	---	---	PASS
COG5	10466	broad.mit.edu	37	7	107002556	107002556	+	Splice_Site	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107002556C>A	uc003ved.2	-	10	1567	c.1042_splice	c.e10-1	p.V348_splice	COG5_uc003vec.2_Splice_Site_p.V348_splice|COG5_uc003vee.2_Splice_Site_p.V348_splice	NM_181733	NP_859422	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4						GATGTTGTACCTTAAATGAAA	0.318													6	16	---	---	---	---	PASS
LAMB4	22798	broad.mit.edu	37	7	107746981	107746981	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107746981C>T	uc010ljo.1	-	7	712	c.628G>A	c.(628-630)GAA>AAA	p.E210K	LAMB4_uc003vey.2_Missense_Mutation_p.E210K	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	210	Laminin N-terminal.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						TAAGGGTTTTCAATTTCAAAA	0.289													11	24	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120780971	120780971	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120780971A>T	uc003vjq.3	+	15	2237	c.1790A>T	c.(1789-1791)TAC>TTC	p.Y597F	C7orf58_uc003vjs.3_Missense_Mutation_p.Y597F|C7orf58_uc003vjt.3_Missense_Mutation_p.Y377F	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	597						endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					AAAGATTATTACTGTGAAGTC	0.413													15	32	---	---	---	---	PASS
CPA1	1357	broad.mit.edu	37	7	130021492	130021492	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130021492G>T	uc003vpx.2	+	3	241	c.169G>T	c.(169-171)GCC>TCC	p.A57S	CPA1_uc011kpf.1_Intron|CPA1_uc003vpw.2_Missense_Mutation_p.A57S	NM_001868	NP_001859	P15085	CBPA1_HUMAN	carboxypeptidase A1 precursor	57					proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)	1	Melanoma(18;0.0435)					GCGGGGGCCTGCCCACCCTGG	0.667													4	31	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131853253	131853253	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131853253G>T	uc003vra.3	-	22	4325	c.4096C>A	c.(4096-4098)CTG>ATG	p.L1366M		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1366	Cytoplasmic (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						ATGAAGGACAGCAGGAACACC	0.602													20	21	---	---	---	---	PASS
DGKI	9162	broad.mit.edu	37	7	137270076	137270076	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137270076G>T	uc003vtt.2	-	14	1443	c.1442C>A	c.(1441-1443)CCT>CAT	p.P481H	DGKI_uc003vtu.2_Missense_Mutation_p.P181H	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	481	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						CTTAGAAACAGGTTCATCAGT	0.478													21	43	---	---	---	---	PASS
DGKI	9162	broad.mit.edu	37	7	137304674	137304674	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137304674C>A	uc003vtt.2	-	8	890	c.889G>T	c.(889-891)GTG>TTG	p.V297L	DGKI_uc003vtu.2_5'UTR	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	297	Phorbol-ester/DAG-type 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						AAGCAGGTCACCTTATTGTGA	0.408													29	52	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146829579	146829579	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146829579G>T	uc003weu.1	+	8	1842	c.1326G>T	c.(1324-1326)ATG>ATT	p.M442I		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	442	Extracellular (Potential).|Laminin G-like 2.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			AGACCAAGATGAGCCAAATCG	0.403										HNSCC(39;0.1)			20	45	---	---	---	---	PASS
TMEM176B	28959	broad.mit.edu	37	7	150493603	150493603	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150493603G>T	uc003wht.3	-	2	221	c.55C>A	c.(55-57)CAG>AAG	p.Q19K	TMEM176B_uc003whu.3_Missense_Mutation_p.Q19K|TMEM176B_uc003whv.3_Missense_Mutation_p.Q19K|TMEM176B_uc003whw.3_Missense_Mutation_p.Q19K	NM_001101313	NP_001094783	Q3YBM2	T176B_HUMAN	transmembrane protein 176B isoform a	19					cell differentiation|organ morphogenesis	integral to membrane|nuclear membrane				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGGGTGGGCTGGGATGGCCTA	0.522													9	40	---	---	---	---	PASS
BMP1	649	broad.mit.edu	37	8	22056554	22056554	+	Intron	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22056554C>T	uc003xbg.2	+						BMP1_uc003xba.2_Silent_p.D709D|BMP1_uc003xbb.2_Intron|BMP1_uc003xbe.2_Intron|BMP1_uc003xbc.2_Intron|BMP1_uc003xbd.2_Intron|BMP1_uc003xbf.2_Intron|BMP1_uc011kzc.1_Intron|BMP1_uc003xbh.2_Intron|BMP1_uc003xbi.2_Intron	NM_006129	NP_006120	P13497	BMP1_HUMAN	bone morphogenetic protein 1 isoform 3						cartilage condensation|cell differentiation|lipid metabolic process|lipoprotein metabolic process|ossification|positive regulation of cartilage development|proteolysis	extracellular space	calcium ion binding|cytokine activity|growth factor activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|breast(1)	3				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		GGGCAGGGGACCGACACTCAC	0.602													8	35	---	---	---	---	PASS
C8orf58	541565	broad.mit.edu	37	8	22458472	22458472	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22458472G>T	uc003xce.2	+	2	230	c.118G>T	c.(118-120)GCC>TCC	p.A40S	C8orf58_uc011kzl.1_Missense_Mutation_p.A40S|C8orf58_uc003xcf.2_Missense_Mutation_p.A40S	NM_001013842	NP_001013864	Q8NAV2	CH058_HUMAN	hypothetical protein LOC541565	40										skin(1)	1		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00563)|Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		CCCCGACGCTGCCCACGGGTG	0.632													16	8	---	---	---	---	PASS
FZD3	7976	broad.mit.edu	37	8	28385175	28385175	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28385175G>T	uc003xgx.2	+	5	1376	c.898G>T	c.(898-900)GGC>TGC	p.G300C	FZD3_uc010lvb.2_Missense_Mutation_p.G300C	NM_017412	NP_059108	Q9NPG1	FZD3_HUMAN	frizzled 3 precursor	300	Helical; Name=3; (Potential).				canonical Wnt receptor signaling pathway|cell proliferation in midbrain|commissural neuron axon guidance|establishment of planar polarity|facial nucleus development|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|inner ear morphogenesis|neural tube closure|vasculature development	apical part of cell|axon|cytoplasm|dendrite|integral to membrane|neuron projection membrane|neuronal cell body|presynaptic active zone	G-protein coupled receptor activity|PDZ domain binding|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		TACTATGGCTGGCAGTGTATG	0.413													14	79	---	---	---	---	PASS
UBXN8	7993	broad.mit.edu	37	8	30623785	30623785	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30623785C>A	uc003xii.2	+	10	705	c.688C>A	c.(688-690)CTA>ATA	p.L230I	UBXN8_uc010lvi.2_3'UTR|UBXN8_uc011lbb.1_RNA|UBXN8_uc003xij.2_RNA	NM_005671	NP_005662	O00124	UBXN8_HUMAN	reproduction 8	230	UBX.				single fertilization						0						CCACATATCTCTATACAGCCT	0.458													12	29	---	---	---	---	PASS
PURG	29942	broad.mit.edu	37	8	30889972	30889972	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30889972C>A	uc003xin.2	-	1	346	c.327G>T	c.(325-327)CTG>CTT	p.L109L	WRN_uc003xio.3_5'Flank|PURG_uc003xim.1_Silent_p.L109L	NM_013357	NP_037489	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G isoform A	109	By similarity.					nucleus	DNA binding				0				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		CTGCCACAGACAGGGAGAGGG	0.577													15	63	---	---	---	---	PASS
STAR	6770	broad.mit.edu	37	8	38005748	38005748	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38005748G>C	uc003xkv.1	-	3	540	c.276C>G	c.(274-276)AAC>AAG	p.N92K	STAR_uc010lwc.1_Missense_Mutation_p.N54K	NM_001007243	NP_001007244	P49675	STAR_HUMAN	steroidogenic acute regulatory protein isoform	92	START.				C21-steroid hormone biosynthetic process	mitochondrial intermembrane space	cholesterol transporter activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.0151)|Lung NSC(58;0.0295)		READ - Rectum adenocarcinoma(644;0.188)		AGCCCTCTTGGTTGCTAAGGA	0.582													10	21	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38175466	38175466	+	Intron	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38175466C>T	uc003xli.2	-						WHSC1L1_uc011lbm.1_Intron|WHSC1L1_uc010lwe.2_Intron|WHSC1L1_uc003xlj.2_3'UTR	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long						cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TGAAATTGTACAGGAATCTCA	0.493			T	NUP98	AML								10	31	---	---	---	---	PASS
ADAM2	2515	broad.mit.edu	37	8	39613342	39613342	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39613342T>A	uc003xnj.2	-	16	1777	c.1702A>T	c.(1702-1704)AGT>TGT	p.S568C	ADAM2_uc003xnk.2_Missense_Mutation_p.S549C|ADAM2_uc011lck.1_Intron|ADAM2_uc003xnl.2_Splice_Site_p.D412_splice	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein	568	Extracellular (Potential).|Cys-rich.				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		AGATGTCCACTTATGTTGGCA	0.348													41	47	---	---	---	---	PASS
SFRP1	6422	broad.mit.edu	37	8	41166484	41166484	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41166484C>A	uc003xnt.2	-	1	497	c.195G>T	c.(193-195)CTG>CTT	p.L65L		NM_003012	NP_003003	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1 precursor	65	FZ.				brain development|canonical Wnt receptor signaling pathway|cellular response to BMP stimulus|cellular response to estradiol stimulus|cellular response to fibroblast growth factor stimulus|cellular response to heparin|cellular response to hypoxia|cellular response to interleukin-1|cellular response to prostaglandin E stimulus|cellular response to starvation|cellular response to transforming growth factor beta stimulus|cellular response to tumor necrosis factor|cellular response to vitamin D|DNA fragmentation involved in apoptotic nuclear change|dorsal/ventral axis specification|hemopoietic progenitor cell differentiation|hemopoietic stem cell differentiation|menstrual cycle phase|negative regulation of androgen receptor signaling pathway|negative regulation of B cell differentiation|negative regulation of bone remodeling|negative regulation of canonical Wnt receptor signaling pathway involved in controlling type B pancreatic cell proliferation|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cysteine-type endopeptidase activity|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast apoptosis|negative regulation of fibroblast proliferation|negative regulation of insulin secretion|negative regulation of ossification|negative regulation of osteoblast proliferation|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|osteoblast differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell growth|positive regulation of epithelial cell proliferation|positive regulation of fat cell differentiation|positive regulation of fibroblast apoptosis|positive regulation of focal adhesion assembly|positive regulation of non-canonical Wnt receptor signaling pathway|positive regulation of Rac GTPase activity|positive regulation of smoothened signaling pathway|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|regulation of angiogenesis|regulation of cell cycle process|response to drug|response to organic cyclic compound|vasculature development	cell surface|cytosol|extracellular space|plasma membrane|proteinaceous extracellular matrix	cysteine-type endopeptidase activity|drug binding|frizzled binding|heparin binding|identical protein binding|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			GGCACAGCCGCAGGTCCGCGG	0.642													11	11	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41519387	41519387	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41519387C>A	uc003xok.2	-	41	5635	c.5551G>T	c.(5551-5553)GTA>TTA	p.V1851L	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Intron|ANK1_uc003xoi.2_Intron|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Missense_Mutation_p.V1689L|ANK1_uc003xom.2_Intron|ANK1_uc011lcl.1_Intron|ANK1_uc003xod.2_Intron|ANK1_uc003xoc.2_Missense_Mutation_p.V126L|ANK1_uc003xof.2_Intron|MIR486_hsa-mir-486|MI0002470_5'Flank	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	1851	55 kDa regulatory domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GGCCCCTCTACAGTCACCTCC	0.582													16	42	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52321195	52321195	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52321195C>A	uc003xqu.3	-	17	3090	c.2989G>T	c.(2989-2991)GTT>TTT	p.V997F	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	997					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TCCTGGTAAACCGTGTTTCCC	0.632													6	6	---	---	---	---	PASS
CYP7B1	9420	broad.mit.edu	37	8	65527693	65527693	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65527693G>T	uc003xvj.2	-	4	1151	c.947C>A	c.(946-948)GCA>GAA	p.A316E		NM_004820	NP_004811	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B,	316					bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				ACGCACTGCTGCCATAGCTTC	0.488													18	34	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72984099	72984099	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72984099C>A	uc003xza.2	-	2	290	c.115G>T	c.(115-117)GTT>TTT	p.V39F		NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	39	Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	CCTTCAAAAACCACCTAGAGG	0.318													10	39	---	---	---	---	PASS
STAU2	27067	broad.mit.edu	37	8	74464340	74464340	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74464340G>T	uc003xzm.2	-	13	1673	c.1437C>A	c.(1435-1437)GCC>GCA	p.A479A	STAU2_uc011lfg.1_Silent_p.A307A|STAU2_uc003xzn.2_Silent_p.A447A|STAU2_uc011lfh.1_Silent_p.A375A|STAU2_uc003xzo.2_Silent_p.A479A|STAU2_uc003xzp.2_Silent_p.A447A|STAU2_uc011lfi.1_Silent_p.A441A|STAU2_uc003xzq.2_Silent_p.A259A|STAU2_uc010lzk.2_Silent_p.A447A|STAU2_uc010lzl.1_Silent_p.A307A	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e	479	Required for dendritic transport (By similarity).				transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			TTAAACCTATGGCTTCAGCTG	0.408													31	85	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113988090	113988090	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113988090C>A	uc003ynu.2	-	7	1477	c.1318G>T	c.(1318-1320)GAG>TAG	p.E440*	CSMD3_uc003ynt.2_Nonsense_Mutation_p.E400*|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	440	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ACTGCAAGCTCTTTAGTTCTT	0.413										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			38	103	---	---	---	---	PASS
ENPP2	5168	broad.mit.edu	37	8	120628554	120628554	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120628554T>C	uc003yot.1	-	8	814	c.728A>G	c.(727-729)CAT>CGT	p.H243R	ENPP2_uc003yos.1_Missense_Mutation_p.H243R|ENPP2_uc010mdd.1_Missense_Mutation_p.H243R	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	243					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CCCTCGCAGATGAAAAGTGGC	0.363													14	39	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139323168	139323168	+	Intron	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139323168G>A	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TAATACCTAAGAAAAGAGAAG	0.463										HNSCC(54;0.14)			9	47	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139674273	139674273	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139674273G>T	uc003yvd.2	-	43	3687	c.3240C>A	c.(3238-3240)GAC>GAA	p.D1080E	COL22A1_uc011ljo.1_Missense_Mutation_p.D360E	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1080	Pro-rich.|Gly-rich.|Collagen-like 9.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTGTACTTACGTCCCGGCCGG	0.552										HNSCC(7;0.00092)			21	56	---	---	---	---	PASS
PTK2	5747	broad.mit.edu	37	8	141675018	141675018	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141675018C>T	uc003yvu.2	-	31	3174	c.2944G>A	c.(2944-2946)GAG>AAG	p.E982K	PTK2_uc011ljp.1_Missense_Mutation_p.E290K|PTK2_uc003yvo.2_Missense_Mutation_p.E610K|PTK2_uc011ljq.1_Missense_Mutation_p.E680K|PTK2_uc003yvp.2_Missense_Mutation_p.E650K|PTK2_uc003yvq.2_Missense_Mutation_p.E487K|PTK2_uc003yvr.2_Missense_Mutation_p.E925K|PTK2_uc003yvs.2_Missense_Mutation_p.E936K|PTK2_uc003yvt.2_Missense_Mutation_p.E1004K|PTK2_uc003yvv.2_Missense_Mutation_p.E885K|PTK2_uc011ljr.1_Missense_Mutation_p.E995K	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a	982	Interaction with TGFB1I1.|Interaction with RGNEF (By similarity).				axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TGCCCTACCTCTCGGTGGGTG	0.577													9	11	---	---	---	---	PASS
RECQL4	9401	broad.mit.edu	37	8	145739739	145739739	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145739739G>A	uc003zdj.2	-	11	1744	c.1712C>T	c.(1711-1713)GCA>GTA	p.A571V		NM_004260	NP_004251	O94761	RECQ4_HUMAN	RecQ protein-like 4	571	Helicase ATP-binding.				DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			breast(2)|lung(1)|skin(1)	4	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TACCTGGGCTGCCCGAATCTG	0.657			N|F|S			osteosarcoma|skin basal and sqamous cell		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	RAPADILINO_syndrome|Rothmund-Thomson_syndrome|Baller-Gerold_syndrome				4	12	---	---	---	---	PASS
RFX3	5991	broad.mit.edu	37	9	3263017	3263017	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3263017G>T	uc003zhr.2	-	14	1835	c.1523C>A	c.(1522-1524)GCA>GAA	p.A508E	RFX3_uc010mhd.2_Missense_Mutation_p.A508E|RFX3_uc003zhs.1_Missense_Mutation_p.A508E	NM_134428	NP_602304	P48380	RFX3_HUMAN	regulatory factor X3 isoform b	508					cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		TGCACGAGCTGCCTGGGCCAG	0.493													17	34	---	---	---	---	PASS
CDC37L1	55664	broad.mit.edu	37	9	4685026	4685026	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4685026C>A	uc003zio.2	+	2	492	c.282C>A	c.(280-282)GCC>GCA	p.A94A		NM_017913	NP_060383	Q7L3B6	CD37L_HUMAN	cell division cycle 37 homolog (S.	94	Potential.|Self-association.					cytoplasm					0	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0318)		AGGAGCATGCCAAAGCACAAA	0.468													25	31	---	---	---	---	PASS
C9orf128	392307	broad.mit.edu	37	9	35821515	35821515	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35821515G>T	uc010mlc.2	-						C9orf128_uc003zyj.2_RNA|C9orf128_uc011lpg.1_Intron	NM_001012446	NP_001012448	A6H8Z2	CI128_HUMAN	hypothetical protein LOC392307												0	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			ATTGCCTGTAGTGCCAGTGCC	0.493													11	26	---	---	---	---	PASS
ALDH1A1	216	broad.mit.edu	37	9	75526976	75526976	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75526976G>T	uc004ajd.2	-	10	1151	c.1098C>A	c.(1096-1098)GCC>GCA	p.A366A	ALDH1A1_uc011lsh.1_Silent_p.A287A|ALDH1A1_uc011lsg.1_Silent_p.A192A	NM_000689	NP_000680	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1A1	366					cellular aldehyde metabolic process|ethanol oxidation|xenobiotic metabolic process	cytosol	aldehyde dehydrogenase (NAD) activity|androgen binding|Ras GTPase activator activity|retinal dehydrogenase activity			ovary(3)|lung(1)	4					NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	ATTCCAGTTTGGCCCCTTCTT	0.413													5	76	---	---	---	---	PASS
GNA14	9630	broad.mit.edu	37	9	80049351	80049351	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80049351G>T	uc004aku.2	-	3	920	c.397C>A	c.(397-399)CAA>AAA	p.Q133K		NM_004297	NP_004288	O95837	GNA14_HUMAN	G alpha 14	133					activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(2)	2						CCTGGATCTTGCCAGAGCTGC	0.562											OREG0019263	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	24	---	---	---	---	PASS
PTPDC1	138639	broad.mit.edu	37	9	96859732	96859732	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96859732C>A	uc004auf.1	+	7	1062	c.722C>A	c.(721-723)ACT>AAT	p.T241N	PTPDC1_uc004aug.1_Missense_Mutation_p.T241N|PTPDC1_uc004auh.1_Missense_Mutation_p.T293N|PTPDC1_uc010mrj.1_Missense_Mutation_p.T295N|PTPDC1_uc010mri.1_Missense_Mutation_p.T293N	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	241							protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1						AGGGAATTTACTCAGTTTCTA	0.453													9	86	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101763244	101763244	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101763244G>T	uc004azb.1	+							NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor						angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				GTGAGTAGATGGTAAATTTCA	0.458											OREG0019364	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	17	---	---	---	---	PASS
RAB14	51552	broad.mit.edu	37	9	123945598	123945598	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123945598C>A	uc004blc.2	-	6	886	c.430G>T	c.(430-432)GAA>TAA	p.E144*		NM_016322	NP_057406	P61106	RAB14_HUMAN	GTPase Rab14	144					embryo development|fibroblast growth factor receptor signaling pathway|Golgi to endosome transport|neurotransmitter secretion|protein transport|small GTPase mediated signal transduction	cytosol|early endosome membrane|Golgi membrane|Golgi stack|late endosome|lysosome|membrane fraction|nuclear outer membrane-endoplasmic reticulum membrane network|perinuclear region of cytoplasm|rough endoplasmic reticulum|trans-Golgi network transport vesicle	GDP binding|GTP binding|GTPase activity				0						CCATTTTCTTCAGCAAACTGT	0.333													27	61	---	---	---	---	PASS
OR1J4	26219	broad.mit.edu	37	9	125281491	125281491	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125281491G>T	uc011lyw.1	+	1	72	c.72G>T	c.(70-72)CAG>CAT	p.Q24H		NM_001004452	NP_001004452	Q8NGS1	OR1J4_HUMAN	olfactory receptor, family 1, subfamily J,	24	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CAGAGCAGCAGGCTGTGTTCT	0.557													28	66	---	---	---	---	PASS
PTGES2	80142	broad.mit.edu	37	9	130885221	130885221	+	Silent	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130885221G>C	uc004bti.2	-	5	1357	c.879C>G	c.(877-879)CTC>CTG	p.L293L	PTGES2_uc004btj.2_RNA|PTGES2_uc004btk.2_Silent_p.L102L|PTGES2_uc004btl.2_Silent_p.L102L|PTGES2_uc004btm.2_RNA	NM_025072	NP_079348	Q9H7Z7	PGES2_HUMAN	prostaglandin E synthase 2	293	GST C-terminal.|Cytoplasmic (Potential).				cell redox homeostasis|prostaglandin biosynthetic process	Golgi membrane|integral to membrane|mitochondrion|perinuclear region of cytoplasm	electron carrier activity|prostaglandin-E synthase activity|protein binding|protein disulfide oxidoreductase activity				0						GCCTGCTCTTGAGTCGCTTGC	0.627													5	28	---	---	---	---	PASS
FCN2	2220	broad.mit.edu	37	9	137772699	137772699	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137772699G>T	uc004cfg.1	+	1	42	c.32G>T	c.(31-33)GGC>GTC	p.G11V	FCN2_uc004cfh.1_Missense_Mutation_p.G11V	NM_004108	NP_004099	Q15485	FCN2_HUMAN	ficolin 2 isoform a precursor	11					complement activation, lectin pathway|opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|calcium-dependent protein binding|receptor binding|sugar binding			large_intestine(1)	1		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)		GGGGTCCTGGGCGCTGCCACC	0.617													4	15	---	---	---	---	PASS
UPF2	26019	broad.mit.edu	37	10	12070784	12070784	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12070784T>C	uc001ila.2	-	2	1579	c.1105A>G	c.(1105-1107)AGG>GGG	p.R369G	UPF2_uc001ilb.2_Missense_Mutation_p.R369G|UPF2_uc001ilc.2_Missense_Mutation_p.R369G|UPF2_uc009xiz.1_Missense_Mutation_p.R369G	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog	369	MIF4G 1.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				CTGTGGTCCCTTTTCAGGTGT	0.373													3	77	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15647751	15647751	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15647751C>A	uc001ioc.1	-	19	1942	c.1942G>T	c.(1942-1944)GTT>TTT	p.V648F	ITGA8_uc010qcb.1_Missense_Mutation_p.V633F	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	648	Extracellular (Potential).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						AAGTCAGGAACACACAGATTG	0.388													12	39	---	---	---	---	PASS
KIAA1217	56243	broad.mit.edu	37	10	24790396	24790396	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24790396C>A	uc001iru.3	+	9	2326	c.1923C>A	c.(1921-1923)GCC>GCA	p.A641A	KIAA1217_uc001irs.2_Silent_p.A561A|KIAA1217_uc001irt.3_Silent_p.A606A|KIAA1217_uc010qcy.1_Silent_p.A606A|KIAA1217_uc010qcz.1_Silent_p.A606A|KIAA1217_uc001irv.1_Silent_p.A456A|KIAA1217_uc010qda.1_RNA|KIAA1217_uc001irw.2_Silent_p.A324A|KIAA1217_uc001irz.2_Silent_p.A324A|KIAA1217_uc001irx.2_Silent_p.A324A|KIAA1217_uc001iry.2_Silent_p.A324A	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	641					embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						GCACCTCAGCCATCCACATGA	0.622													8	34	---	---	---	---	PASS
GAD2	2572	broad.mit.edu	37	10	26558081	26558081	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26558081G>T	uc001isp.2	+	9	1457	c.954G>T	c.(952-954)AGG>AGT	p.R318S	GAD2_uc001isq.2_Missense_Mutation_p.R318S	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2	318					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	TTGAAAGAAGGATTCTTGAAG	0.368													19	36	---	---	---	---	PASS
ZNF248	57209	broad.mit.edu	37	10	38121037	38121037	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38121037C>A	uc001izd.1	-	6	1745	c.1246G>T	c.(1246-1248)GCC>TCC	p.A416S	ZNF248_uc009xmc.2_Intron|ZNF248_uc001izb.2_Intron|ZNF248_uc001izc.2_Intron|ZNF248_uc010qeu.1_Missense_Mutation_p.A416S	NM_021045	NP_066383	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	416	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TGGCAAAAGGCTTTCCCACAT	0.443													38	87	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49395304	49395304	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49395304C>A	uc001jgi.2	-	17	2304	c.2197G>T	c.(2197-2199)GCC>TCC	p.A733S	FRMPD2_uc001jgh.2_Missense_Mutation_p.A701S|FRMPD2_uc001jgj.2_Missense_Mutation_p.A711S	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	733					tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		ATCACACAGGCACTCTTCAGC	0.572													5	9	---	---	---	---	PASS
COL13A1	1305	broad.mit.edu	37	10	71697401	71697401	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71697401G>T	uc001jpr.1	+	32	2311	c.1775G>T	c.(1774-1776)GGA>GTA	p.G592V	COL13A1_uc001jqj.1_Missense_Mutation_p.G577V|COL13A1_uc001jps.1_Missense_Mutation_p.G563V|COL13A1_uc001jpt.1_Missense_Mutation_p.G551V|COL13A1_uc001jpu.1_Missense_Mutation_p.G573V|COL13A1_uc001jpv.1_Missense_Mutation_p.G578V|COL13A1_uc001jpx.1_Missense_Mutation_p.G555V|COL13A1_uc001jpw.1_Missense_Mutation_p.G539V|COL13A1_uc001jpy.1_Missense_Mutation_p.G530V|COL13A1_uc001jpz.1_Missense_Mutation_p.G535V|COL13A1_uc001jqa.1_Missense_Mutation_p.G532V|COL13A1_uc001jqc.1_Missense_Mutation_p.G577V|COL13A1_uc001jqb.1_Missense_Mutation_p.G526V|COL13A1_uc001jql.2_Missense_Mutation_p.G592V|COL13A1_uc001jqd.1_Missense_Mutation_p.G580V|COL13A1_uc001jqe.1_Missense_Mutation_p.G575V|COL13A1_uc001jqf.1_Missense_Mutation_p.G573V|COL13A1_uc001jqg.1_Missense_Mutation_p.G570V|COL13A1_uc001jqh.1_Missense_Mutation_p.G592V|COL13A1_uc001jqi.1_Missense_Mutation_p.G578V|COL13A1_uc010qjf.1_Missense_Mutation_p.G367V	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1	592	Extracellular (Potential).|Triple-helical region 3 (COL3).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	GGGGAAGCAGGACTAGATGGA	0.562													6	16	---	---	---	---	PASS
ADAMTS14	140766	broad.mit.edu	37	10	72434586	72434586	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72434586G>T	uc001jrh.2	+	2	357	c.357G>T	c.(355-357)TTG>TTT	p.L119F	ADAMTS14_uc001jrg.2_Missense_Mutation_p.L119F	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	119					collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						AACTGCACTTGCGCCTGCGGC	0.627													10	22	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73560461	73560461	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73560461C>A	uc001jrx.3	+	51	7808	c.7431C>A	c.(7429-7431)GCC>GCA	p.A2477A	CDH23_uc001jsg.3_Silent_p.A237A|CDH23_uc001jsh.3_Silent_p.A237A|CDH23_uc001jsi.3_Silent_p.A237A	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	2477	Cadherin 23.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CTGCCTTGGCCAAAGACAACC	0.562													3	10	---	---	---	---	PASS
ASCC1	51008	broad.mit.edu	37	10	73970533	73970533	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73970533G>T	uc001jst.1	-	3	277	c.169C>A	c.(169-171)CAA>AAA	p.Q57K	ASCC1_uc001jss.1_Missense_Mutation_p.Q57K|ASCC1_uc001jsu.1_Missense_Mutation_p.Q57K|ASCC1_uc010qju.1_Missense_Mutation_p.Q78K			Q8N9N2	ASCC1_HUMAN	RecName: Full=Activating signal cointegrator 1 complex subunit 1; AltName: Full=ASC-1 complex subunit p50; AltName: Full=Trip4 complex subunit p50;	57					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	RNA binding				0						CGGAATCCTTGTGGGGTCTGC	0.522													12	21	---	---	---	---	PASS
VCL	7414	broad.mit.edu	37	10	75855548	75855548	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75855548G>T	uc001jwd.2	+	12	1772	c.1678G>T	c.(1678-1680)GCC>TCC	p.A560S	VCL_uc009xrr.2_Missense_Mutation_p.A309S|VCL_uc010qky.1_Missense_Mutation_p.A467S|VCL_uc001jwe.2_Missense_Mutation_p.A560S|VCL_uc010qkz.1_Intron	NM_014000	NP_054706	P18206	VINC_HUMAN	vinculin isoform meta-VCL	560	N-terminal globular head.|3.|3 X 112 AA tandem repeats.				adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)					TGACCTGGCTGCCAGAGGGGA	0.527													24	56	---	---	---	---	PASS
SH2D4B	387694	broad.mit.edu	37	10	82363454	82363454	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82363454A>T	uc001kck.1	+	5	1193	c.763A>T	c.(763-765)ATG>TTG	p.M255L	SH2D4B_uc001kcl.1_Missense_Mutation_p.M206L|SH2D4B_uc001kcm.1_Missense_Mutation_p.M1L	NM_207372	NP_997255	Q5SQS7	SH24B_HUMAN	SH2 domain containing 4B isoform 1	254											0			Colorectal(32;0.229)			CCTCAGCTCCATGTTCCGGGA	0.682													3	4	---	---	---	---	PASS
ACTA2	59	broad.mit.edu	37	10	90749251	90749251	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90749251G>T	uc001kfq.2	-						FAS_uc010qna.1_RNA|FAS_uc001kfr.2_5'Flank|FAS_uc001kfs.2_5'Flank|FAS_uc001kft.2_5'Flank|FAS_uc010qnb.1_5'Flank|FAS_uc010qnc.1_5'Flank|FAS_uc001kfw.2_5'Flank|FAS_uc010qnd.1_5'Flank|FAS_uc010qne.1_5'Flank|FAS_uc009xtp.2_5'Flank	NM_001141945	NP_001135417	P62736	ACTA_HUMAN	alpha 2 actin						response to virus	cytosol	ATP binding				0		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		gcacaaggctggcacgcccag	0.035													18	36	---	---	---	---	PASS
FAS	355	broad.mit.edu	37	10	90770326	90770326	+	Silent	SNP	A	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90770326A>T	uc001kfr.2	+	5	820	c.474A>T	c.(472-474)ACA>ACT	p.T158T	FAS_uc010qna.1_RNA|FAS_uc001kfs.2_Silent_p.T158T|FAS_uc001kft.2_Silent_p.T158T|FAS_uc010qnb.1_RNA|FAS_uc010qnc.1_RNA|FAS_uc001kfw.2_Missense_Mutation_p.H122L|FAS_uc010qnd.1_RNA|FAS_uc010qne.1_RNA|FAS_uc009xtp.2_RNA	NM_000043	NP_000034	P25445	TNR6_HUMAN	tumor necrosis factor receptor superfamily,	158	TNFR-Cys 3.|Extracellular (Potential).				activation of caspase activity|activation of pro-apoptotic gene products|anti-apoptosis|cellular response to mechanical stimulus|positive regulation of necrotic cell death	cytosol|extracellular region|integral to membrane|soluble fraction	identical protein binding|kinase binding			upper_aerodigestive_tract(1)|breast(1)	2		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)		AGGAATGCACACTCACCAGCA	0.363									Autoimmune_Lymphoproliferative_syndrome_type_I				19	30	---	---	---	---	PASS
MMS19	64210	broad.mit.edu	37	10	99236508	99236508	+	Intron	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99236508C>A	uc001kns.3	-						MMS19_uc009xvt.2_Intron|MMS19_uc001knr.2_Intron|MMS19_uc010qox.1_Intron|MMS19_uc001knt.2_Intron|MMS19_uc001knu.1_Intron	NM_022362	NP_071757	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog						chromosome segregation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|response to hormone stimulus|transcription, DNA-dependent|two-component signal transduction system (phosphorelay)	cytoplasm|holo TFIIH complex|MMXD complex	estrogen receptor binding|protein binding, bridging|receptor signaling complex scaffold activity|transcription coactivator activity				0		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		GGTCCTGTGGCAACAGAGAAA	0.398								Direct_reversal_of_damage|NER					4	11	---	---	---	---	PASS
PSD	5662	broad.mit.edu	37	10	104170857	104170857	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104170857C>A	uc001kvg.1	-	9	2486	c.1959G>T	c.(1957-1959)CTG>CTT	p.L653L	PSD_uc001kvf.1_5'Flank|PSD_uc001kvh.1_Silent_p.L274L|PSD_uc009xxd.1_Silent_p.L653L	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	653	SEC7.				regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		GCGCACAGGTCAGCGTGTGGG	0.632													8	30	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	106927081	106927081	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106927081C>A	uc001kyi.1	+	13	2102	c.1875C>A	c.(1873-1875)CAC>CAA	p.H625Q		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	625	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CCATGAAACACACACCTCTGC	0.403													8	23	---	---	---	---	PASS
BAG3	9531	broad.mit.edu	37	10	121436371	121436371	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121436371G>T	uc001lem.2	+	4	1611	c.1305G>T	c.(1303-1305)CTG>CTT	p.L435L	BAG3_uc001lel.2_Silent_p.L434L	NM_004281	NP_004272	O95817	BAG3_HUMAN	BCL2-associated athanogene 3	435	BAG.				anti-apoptosis|apoptosis|protein folding	cytosol				ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)		TACAGGGGCTGGAGCAGGCTG	0.517													4	24	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124358338	124358338	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124358338G>T	uc001lgk.1	+	26	3111	c.3005G>T	c.(3004-3006)TGT>TTT	p.C1002F	DMBT1_uc001lgl.1_Missense_Mutation_p.C992F|DMBT1_uc001lgm.1_Missense_Mutation_p.C503F|DMBT1_uc009xzz.1_Missense_Mutation_p.C1002F|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yab.1_5'UTR	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1002	SRCR 8.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GGTGACAGGTGTCAGGGCCGA	0.557													15	294	---	---	---	---	PASS
KNDC1	85442	broad.mit.edu	37	10	135020657	135020657	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135020657G>C	uc001llz.1	+	20	3597	c.3596G>C	c.(3595-3597)CGC>CCC	p.R1199P	KNDC1_uc001lma.1_3'UTR	NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)	1199					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TACGCGGAACGCTGGGGCCTG	0.682													5	9	---	---	---	---	PASS
MTG1	92170	broad.mit.edu	37	10	135209741	135209741	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135209741G>C	uc001lnd.2	+	3	356	c.252G>C	c.(250-252)AAG>AAC	p.K84N	MTG1_uc010qve.1_5'UTR	NM_138384	NP_612393	Q9BT17	MTG1_HUMAN	GTP_binding protein precursor	84	GTP (By similarity).					mitochondrion	GTP binding|protein binding			skin(1)	1		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		TCCTCAACAAGATGGACTTGG	0.502													4	129	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1017439	1017439	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1017439C>A	uc001lsw.2	-	31	5413	c.5362G>T	c.(5362-5364)GCC>TCC	p.A1788S		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1788	Thr-rich.|2.|Approximate repeats.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTGCTGGTGGCCGACGTGGTG	0.592													39	346	---	---	---	---	PASS
KRTAP5-3	387266	broad.mit.edu	37	11	1629521	1629521	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1629521C>A	uc001ltw.1	-	1	173	c.95G>T	c.(94-96)GGC>GTC	p.G32V		NM_001012708	NP_001012726	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	32						keratin filament				ovary(2)	2		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		GCAGCCGGAGCCACAGCCCCC	0.672													5	104	---	---	---	---	PASS
IGF2	3481	broad.mit.edu	37	11	2154297	2154297	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2154297G>C	uc009yde.2	-	4	566	c.463C>G	c.(463-465)CAC>GAC	p.H155D	IGF2_uc001lvf.2_RNA|IGF2_uc001lvg.2_Missense_Mutation_p.H155D|IGF2_uc009ydf.2_Missense_Mutation_p.H211D|IGF2_uc001lvh.2_Missense_Mutation_p.H155D|INS-IGF2_uc001lvi.2_RNA	NM_001007139	NP_001007140	P01344	IGF2_HUMAN	insulin-like growth factor 2 isoform 1	155					glucose metabolic process|ossification|phosphatidylinositol 3-kinase cascade involved in insulin receptor signaling|positive regulation of activated T cell proliferation|positive regulation of cell division|positive regulation of glycogen (starch) synthase activity|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|skeletal system development	extracellular space	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|protein serine/threonine kinase activator activity|receptor activator activity			central_nervous_system(1)	1		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		AGGGGACGGTGACGTTTGGCC	0.692													24	43	---	---	---	---	PASS
TSSC4	10078	broad.mit.edu	37	11	2424345	2424345	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2424345G>A	uc001lwj.2	+	4	843	c.482G>A	c.(481-483)CGC>CAC	p.R161H	TSSC4_uc001lwi.2_Missense_Mutation_p.R97H|TSSC4_uc001lwk.2_Missense_Mutation_p.R161H|TSSC4_uc001lwl.2_Missense_Mutation_p.R161H	NM_005706	NP_005697	Q9Y5U2	TSSC4_HUMAN	tumor suppressing subtransferable candidate 4	161											0		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.00145)|LUSC - Lung squamous cell carcinoma(625;0.19)		CACCCCGAGCGCTGGACCAAG	0.692													10	14	---	---	---	---	PASS
STIM1	6786	broad.mit.edu	37	11	4104115	4104115	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4104115G>T	uc001lyv.2	+	9	1709	c.1141G>T	c.(1141-1143)GAG>TAG	p.E381*	STIM1_uc009yef.2_Nonsense_Mutation_p.E381*|STIM1_uc009yeg.2_Nonsense_Mutation_p.E208*	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor	381	Cytoplasmic (Potential).|Potential.				activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		TTTGCAGGCTGAGAAGATAAA	0.478													13	28	---	---	---	---	PASS
OR52K1	390036	broad.mit.edu	37	11	4510283	4510283	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4510283C>A	uc001lza.1	+	1	153	c.153C>A	c.(151-153)ATC>ATA	p.I51I		NM_001005171	NP_001005171	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K,	51	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		TCTTCATTATCCAGGCTGATG	0.498													34	63	---	---	---	---	PASS
OR51B5	282763	broad.mit.edu	37	11	5364168	5364168	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5364168T>A	uc001map.1	-	1	587	c.587A>T	c.(586-588)TAC>TTC	p.Y196F	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_001005567	NP_001005567	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B,	196	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACAGCTGGGTACAGTCGGTT	0.428													28	56	---	---	---	---	PASS
OR56A3	390083	broad.mit.edu	37	11	5969290	5969290	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5969290G>T	uc010qzt.1	+	1	714	c.714G>T	c.(712-714)GTG>GTT	p.V238V		NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A,	238	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGGTGCCGTGGCAAAGGCCC	0.522													38	101	---	---	---	---	PASS
OR52B2	255725	broad.mit.edu	37	11	6191304	6191304	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6191304C>A	uc010qzy.1	-	1	253	c.253G>T	c.(253-255)GCC>TCC	p.A85S		NM_001004052	NP_001004052	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAAAAGATGGCTAGGGCCTTG	0.488													19	56	---	---	---	---	PASS
OR10A5	144124	broad.mit.edu	37	11	6867383	6867383	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6867383C>A	uc001met.1	+	1	470	c.470C>A	c.(469-471)GCT>GAT	p.A157D		NM_178168	NP_835462	Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A,	157	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TTTCCTGTAGCTACTGTGCAG	0.537													30	102	---	---	---	---	PASS
ST5	6764	broad.mit.edu	37	11	8751621	8751621	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8751621G>T	uc001mgt.2	-	3	1402	c.1216C>A	c.(1216-1218)CCC>ACC	p.P406T	ST5_uc009yfr.2_Intron|ST5_uc001mgu.2_Intron|ST5_uc001mgv.2_Missense_Mutation_p.P406T|ST5_uc010rbq.1_Intron|ST5_uc001mgw.1_Missense_Mutation_p.P406T	NM_213618	NP_998783	P78524	ST5_HUMAN	suppression of tumorigenicity 5 isoform 1	406	Pro-rich.|Interaction with ABL1.				positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CCATTACTGGGCTTACTCTTG	0.607													51	118	---	---	---	---	PASS
SLC6A5	9152	broad.mit.edu	37	11	20668449	20668449	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20668449G>T	uc001mqd.2	+	14	2312	c.2039G>T	c.(2038-2040)TGC>TTC	p.C680F	SLC6A5_uc009yic.2_Missense_Mutation_p.C445F	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter	680	Helical; Name=11; (Potential).				synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	TGGAAAGTCTGCTGGGCATTT	0.403													27	49	---	---	---	---	PASS
SLC17A6	57084	broad.mit.edu	37	11	22399257	22399257	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22399257A>T	uc001mqk.2	+	12	2133	c.1720A>T	c.(1720-1722)AGC>TGC	p.S574C		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	574	Cytoplasmic (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						AGACTCACATAGCTATAAGGA	0.353													16	16	---	---	---	---	PASS
NAT10	55226	broad.mit.edu	37	11	34145879	34145879	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34145879C>A	uc001mvk.2	+	11	1283	c.1039C>A	c.(1039-1041)CTA>ATA	p.L347I	NAT10_uc010ren.1_Missense_Mutation_p.L275I	NM_024662	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 isoform a	347						nucleolus	ATP binding|N-acetyltransferase activity|protein binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				TATCCAGTCTCTAAATCCTGA	0.393													11	38	---	---	---	---	PASS
KBTBD4	55709	broad.mit.edu	37	11	47594781	47594781	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47594781C>A	uc001nfx.2	-	4	1429	c.1258G>T	c.(1258-1260)GCA>TCA	p.A420S	PTPMT1_uc001nfs.3_3'UTR|PTPMT1_uc001nfv.3_3'UTR|PTPMT1_uc009ylt.2_3'UTR|PTPMT1_uc001nfu.3_3'UTR|NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_Missense_Mutation_p.A445S|KBTBD4_uc001nfz.2_Missense_Mutation_p.A436S|KBTBD4_uc001nfy.2_Missense_Mutation_p.A420S	NM_016506	NP_057590	Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	420	Kelch 4.									ovary(1)|central_nervous_system(1)	2						ATGCGGCCTGCAAAGGGCAGC	0.527													20	53	---	---	---	---	PASS
BSCL2	26580	broad.mit.edu	37	11	62469965	62469965	+	Missense_Mutation	SNP	G	A	A	rs137852973		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62469965G>A	uc001nuo.1	-	3	693	c.269C>T	c.(268-270)TCG>TTG	p.S90L	BSCL2_uc009yoc.1_Missense_Mutation_p.S90L|BSCL2_uc001nup.2_Missense_Mutation_p.S90L|BSCL2_uc001nuq.1_Missense_Mutation_p.S90L|BSCL2_uc001nur.3_Missense_Mutation_p.S154L|BSCL2_uc009yod.2_Missense_Mutation_p.S154L|BSCL2_uc001nut.3_Missense_Mutation_p.S154L|HNRNPUL2_uc001nuu.1_RNA	NM_032667	NP_116056	Q96G97	BSCL2_HUMAN	seipin isoform 2	90	Lumenal (Potential).		S -> L (in SPG17 and DSMAV).		cell death	integral to endoplasmic reticulum membrane					0						CTTAGTCAGCGAGACATTGGC	0.473													3	14	---	---	---	---	PASS
STX5	6811	broad.mit.edu	37	11	62591738	62591738	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62591738C>G	uc001nvh.2	-	10	962	c.808G>C	c.(808-810)GCA>CCA	p.A270P	STX5_uc010rmi.1_Missense_Mutation_p.A174P|STX5_uc009yoh.2_RNA|STX5_uc001nvi.2_Missense_Mutation_p.A216P|STX5_uc010rmj.1_Missense_Mutation_p.A270P|STX5_uc001nvj.2_Missense_Mutation_p.A85P	NM_003164	NP_003155	Q13190	STX5_HUMAN	syntaxin 5	270	t-SNARE coiled-coil homology.|Cytoplasmic (Potential).				intracellular protein transport|retrograde transport, endosome to Golgi|vesicle targeting	ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|nucleus|SNARE complex	protein N-terminus binding|SNAP receptor activity			ovary(1)|breast(1)	2						ATGGTGTCTGCCCGACTCTGG	0.498													15	62	---	---	---	---	PASS
RTN3	10313	broad.mit.edu	37	11	63517542	63517542	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63517542G>T	uc001nxq.2	+	4	2797	c.2610G>T	c.(2608-2610)CTG>CTT	p.L870L	RTN3_uc001nxo.2_Silent_p.L74L|RTN3_uc001nxm.2_Silent_p.L93L|RTN3_uc001nxn.2_Silent_p.L851L|RTN3_uc001nxp.2_Silent_p.L74L|RTN3_uc009yov.2_Silent_p.L758L|RTN3_uc010rmt.1_RNA|RTN3_uc010rmu.1_Silent_p.L74L	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b	870	Helical; (Potential).|Reticulon.				apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						TGCTTTCCCTGGCAGCTTTCA	0.473													9	10	---	---	---	---	PASS
PPP2R5B	5526	broad.mit.edu	37	11	64695367	64695367	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64695367C>A	uc001oby.2	+	4	1075	c.490C>A	c.(490-492)CAC>AAC	p.H164N	PPP2R5B_uc001obz.2_Missense_Mutation_p.H164N	NM_006244	NP_006235	Q15173	2A5B_HUMAN	beta isoform of regulatory subunit B56, protein	164					signal transduction	cytoplasm|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(2)	2						TTCGTGGCCACACCTGCAGGT	0.537													16	29	---	---	---	---	PASS
NAALADL1	10004	broad.mit.edu	37	11	64813812	64813812	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64813812C>A	uc001ocn.2	-	15	1720	c.1704G>T	c.(1702-1704)GTG>GTT	p.V568V	NAALADL1_uc010rnw.1_Silent_p.V44V|NAALADL1_uc009ypz.2_RNA	NM_005468	NP_005459	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic	568	NAALADase.|Extracellular (Potential).				proteolysis	apical plasma membrane|integral to membrane	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity				0						CTGTCCGGGCCACAGCCTGAT	0.612													10	18	---	---	---	---	PASS
CHKA	1119	broad.mit.edu	37	11	67864490	67864490	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67864490T>A	uc001onj.2	-	2	672	c.458A>T	c.(457-459)CAG>CTG	p.Q153L	CHKA_uc001onk.2_Missense_Mutation_p.Q153L	NM_001277	NP_001268	P35790	CHKA_HUMAN	choline kinase alpha isoform a	153					lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)	ACTCACCATCTGCAAAATCGC	0.473													8	20	---	---	---	---	PASS
SUV420H1	51111	broad.mit.edu	37	11	67925195	67925195	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67925195G>T	uc001onm.1	-	11	2874	c.2618C>A	c.(2617-2619)TCA>TAA	p.S873*	SUV420H1_uc009yse.1_Nonsense_Mutation_p.S459*|SUV420H1_uc001onn.1_Nonsense_Mutation_p.S701*|SUV420H1_uc009ysf.2_Nonsense_Mutation_p.S633*	NM_017635	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 isoform	873					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(2)|kidney(1)	3						TCTTCTCCTTGAAGAAATGTC	0.358													13	44	---	---	---	---	PASS
UCP2	7351	broad.mit.edu	37	11	73688003	73688003	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73688003C>A	uc001oup.1	-	5	777	c.397G>T	c.(397-399)GTG>TTG	p.V133L	UCP2_uc001ouq.1_Missense_Mutation_p.V133L	NM_003355	NP_003346	P55851	UCP2_HUMAN	uncoupling protein 2	133	Solcar 2.|Helical; Name=3; (Potential).				proton transport|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding				0	Breast(11;0.000112)					GGCTGGGCCACAGCCACAGCC	0.637													25	61	---	---	---	---	PASS
C11orf30	56946	broad.mit.edu	37	11	76234316	76234316	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76234316C>A	uc001oxl.2	+	12	1945	c.1802C>A	c.(1801-1803)ACA>AAA	p.T601K	C11orf30_uc001oxm.2_Missense_Mutation_p.T517K|C11orf30_uc010rsb.1_Missense_Mutation_p.T616K|C11orf30_uc010rsc.1_Missense_Mutation_p.T616K|C11orf30_uc001oxn.2_Missense_Mutation_p.T602K|C11orf30_uc010rsd.1_Missense_Mutation_p.T615K	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein	601	Thr-rich.				chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6						AATGTTGTCACAACGTTGCTA	0.418													6	59	---	---	---	---	PASS
MYO7A	4647	broad.mit.edu	37	11	76893462	76893462	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76893462G>T	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						TGCGCGCTCTGCCCCAGGCAG	0.617													7	14	---	---	---	---	PASS
ZW10	9183	broad.mit.edu	37	11	113630951	113630951	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113630951C>A	uc001poe.2	-	5	597	c.560G>T	c.(559-561)TGG>TTG	p.W187L	ZW10_uc009yyv.2_RNA	NM_004724	NP_004715	O43264	ZW10_HUMAN	centromere/kinetochore protein zw10	187	Interaction with RINT1.				cell division|ER to Golgi vesicle-mediated transport|establishment of mitotic spindle orientation|meiosis|mitotic cell cycle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|protein complex assembly|protein localization to kinetochore|protein transport|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|endoplasmic reticulum membrane|kinetochore microtubule|nucleus|spindle pole	centromeric DNA binding|protein binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		TGGGAACTTCCATACAATCAG	0.398													20	46	---	---	---	---	PASS
VWA5A	4013	broad.mit.edu	37	11	124006897	124006897	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124006897A>T	uc001pzu.2	+	13	1630	c.1421A>T	c.(1420-1422)CAT>CTT	p.H474L	VWA5A_uc001pzt.2_Missense_Mutation_p.H474L	NM_001130142	NP_001123614	O00534	VMA5A_HUMAN	BCSC-1 isoform 1	474										upper_aerodigestive_tract(1)|ovary(1)	2						CTGAGCTGGCATTTGCCTCCT	0.493													56	98	---	---	---	---	PASS
OR8B12	219858	broad.mit.edu	37	11	124412838	124412838	+	Missense_Mutation	SNP	C	G	G	rs61747005	byFrequency	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124412838C>G	uc010sam.1	-	1	713	c.713G>C	c.(712-714)AGT>ACT	p.S238T		NM_001005195	NP_001005195	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B,	238	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		ACTGCAAGTACTAAAGGCTTT	0.448													10	13	---	---	---	---	PASS
SLC37A2	219855	broad.mit.edu	37	11	124950581	124950581	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124950581G>A	uc001qbn.2	+	7	850	c.599G>A	c.(598-600)GGC>GAC	p.G200D	SLC37A2_uc010sau.1_Missense_Mutation_p.G200D|SLC37A2_uc010sav.1_5'Flank|SLC37A2_uc001qbp.2_5'Flank	NM_001145290	NP_001138762	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glycerol-3-phosphate	200	Helical; (Potential).				carbohydrate transport|transmembrane transport	integral to membrane				ovary(2)	2	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		CTGATCGCCGGCATCTGGGTG	0.592													3	45	---	---	---	---	PASS
KCNJ1	3758	broad.mit.edu	37	11	128710080	128710080	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128710080C>T	uc001qeo.1	-	2	167	c.116G>A	c.(115-117)AGA>AAA	p.R39K	KCNJ1_uc001qep.1_Missense_Mutation_p.R20K|KCNJ1_uc001qeq.1_Missense_Mutation_p.R20K|KCNJ1_uc001qer.1_Missense_Mutation_p.R20K|KCNJ1_uc001qes.1_Missense_Mutation_p.R20K	NM_000220	NP_000211	P48048	IRK1_HUMAN	potassium inwardly-rectifying channel J1 isoform	39	Cytoplasmic (By similarity).				excretion	voltage-gated potassium channel complex	ATP binding|inward rectifier potassium channel activity			ovary(3)|breast(1)	4	all_hematologic(175;0.0641)	all_lung(97;4.89e-06)|Lung NSC(97;9.34e-06)|Breast(109;0.00123)|all_hematologic(192;0.00793)|Renal(330;0.0112)|all_neural(223;0.0189)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;4.05e-06)|LUSC - Lung squamous cell carcinoma(976;0.008)|Lung(977;0.00942)	Acetohexamide(DB00414)|Chlorpropamide(DB00672)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glycodiazine(DB01382)|Minoxidil(DB00350)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolazamide(DB00839)|Tolbutamide(DB01124)	TAGCCTTGCTCTTTGCCGAGA	0.428													30	93	---	---	---	---	PASS
IGSF9B	22997	broad.mit.edu	37	11	133807266	133807266	+	Intron	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133807266C>A	uc001qgx.3	-						IGSF9B_uc001qgy.1_Intron	NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B							integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GGAAATGGCTCCTACCTTGGA	0.627													7	9	---	---	---	---	PASS
GLB1L2	89944	broad.mit.edu	37	11	134212652	134212652	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134212652G>T	uc001qhp.2	+	2	279	c.91G>T	c.(91-93)GAC>TAC	p.D31Y		NM_138342	NP_612351	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2 precursor	31					carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(1)|pancreas(1)|skin(1)	3	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		TTCCAGGCTGGACTGGAGCAC	0.617													13	36	---	---	---	---	PASS
IQSEC3	440073	broad.mit.edu	37	12	247966	247966	+	Silent	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:247966G>C	uc001qhw.1	+	1	534	c.528G>C	c.(526-528)GGG>GGC	p.G176G	IQSEC3_uc001qhu.1_Silent_p.G176G|IQSEC3_uc001qht.1_Silent_p.G261G|uc001qhv.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	479					regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		CCCACAGCGGGACCCTCATGA	0.488													5	15	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	9009811	9009811	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9009811C>G	uc001quz.3	+	24	2998	c.2900C>G	c.(2899-2901)CCC>CGC	p.P967R	A2ML1_uc001qva.1_Missense_Mutation_p.P547R|A2ML1_uc010sgm.1_Missense_Mutation_p.P467R	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor	811						extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						GTGCAGATGCCCAGTGGCTGT	0.547													27	50	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13715977	13715977	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13715977G>T	uc001rbt.2	-	13	4374	c.4195C>A	c.(4195-4197)CAT>AAT	p.H1399N		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	1399	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TTGCTGCCATGGAGCAAGCAC	0.627													12	36	---	---	---	---	PASS
TM7SF3	51768	broad.mit.edu	37	12	27148349	27148349	+	Intron	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27148349C>A	uc010sjl.1	-							NM_016551	NP_057635	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3 precursor							integral to membrane|plasma membrane				upper_aerodigestive_tract(2)	2	Colorectal(261;0.0847)					CCTCTAAAGTCAACCAACAAA	0.433													4	13	---	---	---	---	PASS
CCDC91	55297	broad.mit.edu	37	12	28458699	28458699	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28458699C>G	uc001riq.2	+	3	243	c.227C>G	c.(226-228)GCA>GGA	p.A76G	CCDC91_uc001rio.2_Missense_Mutation_p.A46G|CCDC91_uc009zjk.2_RNA|CCDC91_uc001rip.1_Missense_Mutation_p.A76G|CCDC91_uc001rir.2_5'UTR|CCDC91_uc009zjl.2_5'Flank	NM_018318	NP_060788	Q7Z6B0	CCD91_HUMAN	GGA binding partner	76					protein transport	Golgi apparatus|membrane				central_nervous_system(1)	1	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					AATACACATGCAGCAAATAGC	0.383													46	96	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40761490	40761490	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40761490G>T	uc001rmg.3	+	51	7628	c.7507G>T	c.(7507-7509)GAA>TAA	p.E2503*	LRRK2_uc009zjw.2_Nonsense_Mutation_p.E1341*|LRRK2_uc001rmi.2_3'UTR	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2503					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TCTTCCACATGAAGTGCAAAA	0.313													13	37	---	---	---	---	PASS
ARID2	196528	broad.mit.edu	37	12	46244156	46244156	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46244156G>T	uc001ros.1	+	15	2250	c.2250G>T	c.(2248-2250)GGG>GGT	p.G750G	ARID2_uc001ror.2_Silent_p.G750G|ARID2_uc009zkg.1_Silent_p.G206G|ARID2_uc009zkh.1_Silent_p.G377G|ARID2_uc001rou.1_Silent_p.G84G	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	750					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		ATAGTACAGGGCCACAACCTG	0.463													3	57	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48393728	48393728	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48393728C>A	uc001rqu.2	-	2	447	c.266G>T	c.(265-267)TGC>TTC	p.C89F	COL2A1_uc001rqv.2_Intron	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	89	VWFC.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GTCAGTTGGGCAGATGGGGCA	0.493													11	36	---	---	---	---	PASS
PRPH	5630	broad.mit.edu	37	12	49691238	49691238	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49691238G>T	uc001rtu.2	+	6	1170	c.1095G>T	c.(1093-1095)CTG>CTT	p.L365L		NM_006262	NP_006253	P41219	PERI_HUMAN	peripherin	365	Coil 2.|Rod.						structural molecule activity				0						AGGAGGAGCTGCGACAGCTAA	0.652											OREG0021790	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	7	---	---	---	---	PASS
DNAJC22	79962	broad.mit.edu	37	12	49743486	49743486	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49743486G>T	uc001rua.2	+	2	1232	c.831G>T	c.(829-831)CTG>CTT	p.L277L	DNAJC22_uc001rub.2_Silent_p.L277L	NM_024902	NP_079178	Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	277	J.				protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			ovary(1)	1						AGCGTCAGCTGGCTTACCAGG	0.537													8	76	---	---	---	---	PASS
TMPRSS12	283471	broad.mit.edu	37	12	51281183	51281183	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51281183T>G	uc001rwx.3	+	5	981	c.934T>G	c.(934-936)TGG>GGG	p.W312G	TMPRSS12_uc001rwy.2_3'UTR	NM_182559	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane protease, serine 12 precursor	312	Peptidase S1.|Extracellular (Potential).				proteolysis	integral to membrane	serine-type endopeptidase activity				0						CTACCAAAAGTGGCTGACAGA	0.393													34	50	---	---	---	---	PASS
KRT82	3888	broad.mit.edu	37	12	52788838	52788838	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52788838C>A	uc001sai.1	-	9	1578	c.1463G>T	c.(1462-1464)GGG>GTG	p.G488V		NM_033033	NP_149022	Q9NSB4	KRT82_HUMAN	keratin 82	488	Tail.					keratin filament	protein binding|structural constituent of epidermis			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.193)		GCTCAGTAGCCCCTGGGGCTC	0.637													17	23	---	---	---	---	PASS
KRT74	121391	broad.mit.edu	37	12	52967271	52967271	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52967271C>A	uc001sap.1	-	1	339	c.291G>T	c.(289-291)GTG>GTT	p.V97V		NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN	keratin 6 irs4	97	Head.|Gly-rich.					keratin filament	structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.191)		GCCCCAGGGCCACACTGCCAA	0.647													12	47	---	---	---	---	PASS
KRT2	3849	broad.mit.edu	37	12	53045530	53045530	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53045530C>A	uc001sat.2	-	1	430	c.397G>T	c.(397-399)GGA>TGA	p.G133*		NM_000423	NP_000414	P35908	K22E_HUMAN	keratin 2	133	Head.				keratinization|keratinocyte activation|keratinocyte migration|keratinocyte proliferation	Golgi apparatus|keratin filament	protein binding|structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.19)		CCTAAacctccaacaccacca	0.279													5	19	---	---	---	---	PASS
ITGB7	3695	broad.mit.edu	37	12	53585733	53585733	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53585733C>A	uc009zmv.2	-	14	2297	c.2226G>T	c.(2224-2226)CTG>CTT	p.L742L	ITGB7_uc001scc.2_Silent_p.L742L|ITGB7_uc010snz.1_RNA	NM_000889	NP_000880	P26010	ITB7_HUMAN	integrin, beta 7 precursor	742	Helical; (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|regulation of immune response	integrin complex	identical protein binding|metal ion binding|receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|breast(1)	8						AAGCCAGGACCAGCCCCAGCC	0.587													4	24	---	---	---	---	PASS
MIP	4284	broad.mit.edu	37	12	56848109	56848109	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56848109C>A	uc001slh.2	-	1	321	c.289G>T	c.(289-291)GCT>TCT	p.A97S		NM_012064	NP_036196	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	97	Helical; (By similarity).				response to stimulus|visual perception	gap junction|integral to plasma membrane	structural constituent of eye lens			skin(1)	1						CCAGCCACAGCTCCCAGGAGC	0.587													4	53	---	---	---	---	PASS
STAT6	6778	broad.mit.edu	37	12	57500134	57500134	+	Intron	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57500134G>C	uc009zpe.2	-						STAT6_uc009zpf.2_Intron|STAT6_uc001sna.2_Intron|STAT6_uc010srb.1_Intron|STAT6_uc010src.1_Intron|STAT6_uc010srd.1_Intron|STAT6_uc009zpg.2_Intron	NM_003153	NP_003144	P42226	STAT6_HUMAN	signal transducer and activator of transcription						regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(2)|lung(1)|skin(1)	4						TATGGGCAGAGAGGGGCCTGA	0.597													13	32	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57562984	57562984	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57562984G>T	uc001snd.2	+	20	3523	c.3057G>T	c.(3055-3057)CAG>CAT	p.Q1019H	LRP1_uc009zpi.1_RNA	NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	1019	LDL-receptor class A 7.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTAGCACCCAGTTCAAGTGCA	0.597													8	49	---	---	---	---	PASS
AGAP2	116986	broad.mit.edu	37	12	58122159	58122159	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58122159G>T	uc001spq.2	-	14	2559	c.2559C>A	c.(2557-2559)GCC>GCA	p.A853A	AGAP2_uc001spo.1_5'Flank|AGAP2_uc001spp.2_Silent_p.A852A|AGAP2_uc001spr.2_Intron	NM_001122772	NP_001116244	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-L	853	PH.				axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						TTTTGCGCTTGGCTGGTTTCC	0.274													3	14	---	---	---	---	PASS
TMCC3	57458	broad.mit.edu	37	12	94975615	94975615	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94975615C>A	uc001tdj.2	-	2	896	c.778G>T	c.(778-780)GGC>TGC	p.G260C	TMCC3_uc001tdi.2_Missense_Mutation_p.G229C	NM_020698	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	260						integral to membrane				ovary(1)|skin(1)	2						CCTGACGTGCCACTCGAACAT	0.597													14	40	---	---	---	---	PASS
GOLGA2B	55592	broad.mit.edu	37	12	100551470	100551470	+	Silent	SNP	T	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100551470T>A	uc001tgs.2	-	4	570	c.126A>T	c.(124-126)GCA>GCT	p.A42A	GOLGA2B_uc001tgt.2_RNA|GOLGA2B_uc001tgu.2_Silent_p.A42A|uc001tgx.2_5'Flank	NM_017600	NP_060070			golgi autoantigen, golgin subfamily a, 2-like 1												0						CACATAGCCGTGCCTGCTCCT	0.597													8	23	---	---	---	---	PASS
CHST11	50515	broad.mit.edu	37	12	105150891	105150891	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105150891G>T	uc001tkx.1	+	4	660	c.369G>T	c.(367-369)GTG>GTT	p.V123V	CHST11_uc001tky.2_Silent_p.V118V|uc001tkz.2_5'Flank	NM_018413	NP_060883	Q9NPF2	CHSTB_HUMAN	carbohydrate sulfotransferase 11	123	Lumenal (Potential).				chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0						ACTGCTACGTGCCCAAGGTGG	0.632													11	20	---	---	---	---	PASS
CCDC63	160762	broad.mit.edu	37	12	111336788	111336788	+	Missense_Mutation	SNP	G	C	C	rs116589141	by1000genomes	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111336788G>C	uc001trv.1	+	10	1396	c.1201G>C	c.(1201-1203)GGG>CGG	p.G401R	CCDC63_uc010sye.1_Missense_Mutation_p.G361R|CCDC63_uc001trw.1_Missense_Mutation_p.G316R	NM_152591	NP_689804	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	401	Potential.									skin(6)|ovary(1)|pancreas(1)	8						GAGCAAGTACGGGGAGGTCAG	0.512													8	29	---	---	---	---	PASS
CCDC63	160762	broad.mit.edu	37	12	111342571	111342571	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111342571C>A	uc001trv.1	+	11	1717	c.1522C>A	c.(1522-1524)CCC>ACC	p.P508T	CCDC63_uc010sye.1_Missense_Mutation_p.P468T|CCDC63_uc001trw.1_Missense_Mutation_p.P423T	NM_152591	NP_689804	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	508										skin(6)|ovary(1)|pancreas(1)	8						GGGGGCTGACCCCTTCAGCGA	0.592													21	45	---	---	---	---	PASS
TBX3	6926	broad.mit.edu	37	12	115114251	115114251	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115114251C>A	uc001tvt.1	-	6	1930	c.966G>T	c.(964-966)ATG>ATT	p.M322I	TBX3_uc001tvu.1_Missense_Mutation_p.M302I	NM_016569	NP_057653	O15119	TBX3_HUMAN	T-box 3 protein isoform 2	322					anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	sequence-specific DNA binding			ovary(2)|skin(1)	3	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CAAACACCCTCATGGACTGCA	0.483													23	58	---	---	---	---	PASS
KSR2	283455	broad.mit.edu	37	12	118199236	118199236	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118199236G>A	uc001two.2	-	4	534	c.479C>T	c.(478-480)CCG>CTG	p.P160L		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	189	Pro-rich.				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity	p.C160C(1)		lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCGGATCCACGGGGTGGGCTC	0.637													12	33	---	---	---	---	PASS
SIRT4	23409	broad.mit.edu	37	12	120741815	120741815	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120741815A>G	uc001tyc.2	+	2	471	c.451A>G	c.(451-453)AAG>GAG	p.K151E		NM_012240	NP_036372	Q9Y6E7	SIRT4_HUMAN	sirtuin 4	151	Deacetylase sirtuin-type.				chromatin silencing|negative regulation of insulin secretion|protein ADP-ribosylation|protein deacetylation	mitochondrial matrix	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides|NAD+ ADP-ribosyltransferase activity|NAD+ binding|protein binding|zinc ion binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTTGCACACCAAGGCGGGGAG	0.567													9	27	---	---	---	---	PASS
TMEM132B	114795	broad.mit.edu	37	12	126138253	126138253	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126138253G>T	uc001uhe.1	+	9	2242	c.2234G>T	c.(2233-2235)TGG>TTG	p.W745L	TMEM132B_uc001uhf.1_Missense_Mutation_p.W257L	NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	745	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GAGTCCAAATGGCCAATTGTG	0.423													19	53	---	---	---	---	PASS
DDX51	317781	broad.mit.edu	37	12	132625014	132625014	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132625014G>T	uc001ujy.3	-	11	1666	c.1627C>A	c.(1627-1629)CAG>AAG	p.Q543K		NM_175066	NP_778236	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	543	Helicase C-terminal.				rRNA processing	nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			lung(1)|pancreas(1)	2	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		ATCCTCCTCTGGCCAGGCCCG	0.622													16	39	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32930590	32930590	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32930590C>A	uc001uub.1	+	15	7688	c.7461C>A	c.(7459-7461)GCC>GCA	p.A2487A		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	2487	Interaction with FANCD2.				cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTCAGAATGCCAGAGATATAC	0.328			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			26	68	---	---	---	---	PASS
RCBTB2	1102	broad.mit.edu	37	13	49085987	49085987	+	Silent	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49085987G>A	uc001vch.2	-	9	1073	c.702C>T	c.(700-702)AAC>AAT	p.N234N	RCBTB2_uc010tgg.1_Silent_p.N239N|RCBTB2_uc001vci.2_Silent_p.N210N|RCBTB2_uc010tgh.1_Missense_Mutation_p.T8M|RCBTB2_uc001vcj.2_Silent_p.N238N|RCBTB2_uc010acv.1_RNA|RCBTB2_uc010tgi.1_Silent_p.N210N	NM_001268	NP_001259	O95199	RCBT2_HUMAN	regulator of chromosome condensation and BTB	234	RCC1 4.						Ran guanyl-nucleotide exchange factor activity			ovary(2)|lung(2)|skin(1)	5		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		CAAGCTGCCCGTTTCCGTTGT	0.532													3	28	---	---	---	---	PASS
PCDH8	5100	broad.mit.edu	37	13	53422390	53422390	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53422390G>T	uc001vhi.2	-	1	385	c.182C>A	c.(181-183)ACA>AAA	p.T61K	PCDH8_uc001vhj.2_Missense_Mutation_p.T61K	NM_002590	NP_002581	O95206	PCDH8_HUMAN	protocadherin 8 isoform 1 precursor	61	Extracellular (Potential).|Cadherin 1.				cell-cell signaling|homophilic cell adhesion	cell junction|dendrite|integral to plasma membrane|postsynaptic membrane|presynaptic membrane	calcium ion binding			breast(1)	1		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		GCGGAAGCTTGTGTCACCCGA	0.637													33	38	---	---	---	---	PASS
C14orf93	60686	broad.mit.edu	37	14	23457227	23457227	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23457227G>T	uc001wib.1	-						C14orf93_uc001wic.1_Intron|C14orf93_uc001wid.1_Intron|C14orf93_uc001wig.2_Intron|C14orf93_uc001wih.2_Intron|C14orf93_uc001wie.2_Intron|C14orf93_uc001wia.3_Intron|C14orf93_uc001wif.2_Intron	NM_021944	NP_068763	Q9H972	CN093_HUMAN	hypothetical protein LOC60686 precursor							extracellular region				ovary(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		ACAGGCTCCTGGCGGGGAGGG	0.537													19	31	---	---	---	---	PASS
KLHDC2	23588	broad.mit.edu	37	14	50246968	50246968	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50246968C>A	uc001wwx.2	+	9	1211	c.811C>A	c.(811-813)CAC>AAC	p.H271N	SDCCAG1_uc010anj.1_Intron|KLHDC2_uc001wwy.2_Missense_Mutation_p.H271N|KLHDC2_uc010anp.2_Missense_Mutation_p.H271N	NM_014315	NP_055130	Q9Y2U9	KLDC2_HUMAN	kelch domain containing 2	271	Kelch 4.					nucleus	protein binding			ovary(1)	1	all_epithelial(31;0.000959)|Breast(41;0.0117)					TCGATCTTGGCACTCACTAAC	0.348													23	96	---	---	---	---	PASS
ATP5S	27109	broad.mit.edu	37	14	50789330	50789330	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50789330G>T	uc001wxw.1	+	3	946	c.254G>T	c.(253-255)TGG>TTG	p.W85L	ATP5S_uc001wxv.2_Missense_Mutation_p.W85L|ATP5S_uc001wxx.1_Missense_Mutation_p.W85L|ATP5S_uc010ant.1_Missense_Mutation_p.W57L	NM_001003803	NP_001003803	Q99766	ATP5S_HUMAN	ATP synthase, H+ transporting, mitochondrial F0	85					ATP biosynthetic process	mitochondrial inner membrane|proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity			ovary(1)|skin(1)	2	all_epithelial(31;0.000636)|Breast(41;0.0102)			OV - Ovarian serous cystadenocarcinoma(311;0.0685)		CAGGAGAGGTGGCAGAAGGAC	0.557													24	45	---	---	---	---	PASS
SIX4	51804	broad.mit.edu	37	14	61190688	61190688	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61190688C>A	uc001xfc.2	-	1	105	c.105G>T	c.(103-105)GTG>GTT	p.V35V	SIX4_uc010app.1_Silent_p.V27V	NM_017420	NP_059116	Q9UIU6	SIX4_HUMAN	sine oculis homeobox homolog 4	35						nucleus				breast(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		CGCCCCCCGCCACTTCTCGGT	0.716													9	35	---	---	---	---	PASS
TMEM30B	161291	broad.mit.edu	37	14	61747089	61747089	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61747089C>A	uc001xfl.2	-	1	1442	c.777G>T	c.(775-777)CTG>CTT	p.L259L	PRKCH_uc010tsa.1_Intron|TMEM30B_uc010apr.1_RNA	NM_001017970	NP_001017970	Q3MIR4	CC50B_HUMAN	transmembrane protein 30B	259						integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(108;0.107)|BRCA - Breast invasive adenocarcinoma(234;0.181)		GGAACGTGGGCAGCGCCGCCG	0.672													6	25	---	---	---	---	PASS
PAPLN	89932	broad.mit.edu	37	14	73718255	73718255	+	Silent	SNP	T	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73718255T>C	uc010ttx.1	+	7	814	c.651T>C	c.(649-651)GCT>GCC	p.A217A	PAPLN_uc001xnw.3_Intron|PAPLN_uc010arl.2_RNA|PAPLN_uc010ttw.1_Intron|PAPLN_uc010tty.1_Silent_p.A217A	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	217						proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		ACGAGGCTGCTGCCAGCAGGA	0.632													21	32	---	---	---	---	PASS
PAPLN	89932	broad.mit.edu	37	14	73727902	73727902	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73727902G>T	uc010ttx.1	+	17	2308	c.2145G>T	c.(2143-2145)GAG>GAT	p.E715D	PAPLN_uc001xnw.3_Missense_Mutation_p.E688D|PAPLN_uc010arl.2_RNA|PAPLN_uc010ttw.1_RNA|PAPLN_uc010tty.1_Missense_Mutation_p.E715D|PAPLN_uc010arm.2_5'UTR|PAPLN_uc010arn.2_5'Flank	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	715						proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		AGCAGAATGAGCCCAGTGAGT	0.627													13	40	---	---	---	---	PASS
UBR7	55148	broad.mit.edu	37	14	93686640	93686640	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93686640G>T	uc001ybm.3	+	9	1242	c.1006G>T	c.(1006-1008)GAC>TAC	p.D336Y	UBR7_uc001ybn.3_Missense_Mutation_p.D260Y|UBR7_uc010auq.2_Missense_Mutation_p.D185Y	NM_175748	NP_786924	Q8N806	UBR7_HUMAN	ubiquitin protein ligase E3 component n-recognin	336							ubiquitin-protein ligase activity|zinc ion binding				0						AGATGAATACGACACAGTTCT	0.403													32	58	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102484926	102484926	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102484926C>A	uc001yks.2	+	41	8480	c.8316C>A	c.(8314-8316)GCC>GCA	p.A2772A	DYNC1H1_uc001ykt.1_Silent_p.A263A	NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	2772	AAA 3 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						TCACTGCTGCCATGGTGGAGT	0.512													4	27	---	---	---	---	PASS
WDR20	91833	broad.mit.edu	37	14	102606387	102606387	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102606387C>A	uc001ykz.2	+	1	176	c.127C>A	c.(127-129)CAG>AAG	p.Q43K	WDR20_uc001yky.1_5'UTR|WDR20_uc001yla.2_5'UTR|WDR20_uc001ylb.2_Missense_Mutation_p.Q43K|WDR20_uc010txu.1_Missense_Mutation_p.Q43K|WDR20_uc001ylc.2_Missense_Mutation_p.Q43K|WDR20_uc001yld.2_Missense_Mutation_p.Q43K|WDR20_uc001yle.2_Missense_Mutation_p.Q43K|WDR20_uc001ylf.2_Missense_Mutation_p.Q43K|HSP90AA1_uc001ykv.3_5'Flank	NM_144574	NP_653175	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20 isoform 2	43											0						CTTCAACTCGCAGGGATCCAA	0.592													18	44	---	---	---	---	PASS
WDR20	91833	broad.mit.edu	37	14	102675626	102675626	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102675626C>A	uc001ykz.2	+	3	1168	c.1119C>A	c.(1117-1119)GGC>GGA	p.G373G	WDR20_uc001yky.1_Silent_p.G116G|WDR20_uc001yla.2_Silent_p.G249G|WDR20_uc001ylb.2_Silent_p.G312G|WDR20_uc010txu.1_Silent_p.G404G|WDR20_uc001ylc.2_Intron|WDR20_uc001yld.2_Silent_p.G373G|WDR20_uc001yle.2_Silent_p.G312G|WDR20_uc001ylf.2_Silent_p.G385G	NM_144574	NP_653175	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20 isoform 2	373	WD 4.										0						GTTCCGTGGGCCAGGACACAC	0.507											OREG0022939	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	34	---	---	---	---	PASS
EIF5	1983	broad.mit.edu	37	14	103805111	103805111	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103805111G>T	uc001ymq.2	+	8	1147	c.625G>T	c.(625-627)GAG>TAG	p.E209*	EIF5_uc001ymr.2_Nonsense_Mutation_p.E209*|EIF5_uc001yms.2_Nonsense_Mutation_p.E209*|EIF5_uc001ymt.2_Nonsense_Mutation_p.E209*|EIF5_uc001ymu.2_Nonsense_Mutation_p.E209*	NM_001969	NP_001960	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	209					regulation of translational initiation|RNA metabolic process	cytosol	GTP binding|GTPase activity|translation initiation factor activity			pancreas(1)|breast(1)|skin(1)	3		Melanoma(154;0.155)	Epithelial(46;0.182)			AGATACAACTGAGGAAGCTCA	0.408													22	40	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106866535	106866535	+	RNA	SNP	A	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106866535A>G	uc010tyt.1	-	281		c.11696T>C								Parts of antibodies, mostly variable regions.												0						AGTATGTGCTACCACCACTAA	0.532													33	86	---	---	---	---	PASS
SNORD115-20	100033460	broad.mit.edu	37	15	25470407	25470407	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25470407G>T	uc001yzq.1	+						SNORD115-26_uc001yzw.1_Intron|SNORD115-30_uc001yzy.1_RNA|SNORD115-31_uc001yzz.1_5'Flank	NR_003313				Homo sapiens small nucleolar RNA, C/D box 115-15 (SNORD115-15), non-coding RNA.												0						TAAAAATCATGCTCAATAGGA	0.498													49	126	---	---	---	---	PASS
GPR176	11245	broad.mit.edu	37	15	40094103	40094103	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40094103G>T	uc001zkj.1	-	3	1644	c.778C>A	c.(778-780)CGG>AGG	p.R260R	GPR176_uc010uck.1_Silent_p.R200R	NM_007223	NP_009154	Q14439	GP176_HUMAN	G protein-coupled receptor 176	260	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)		TCGGCCTCCCGCTGGGAGGCA	0.592											OREG0023053	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	36	---	---	---	---	PASS
BUB1B	701	broad.mit.edu	37	15	40509756	40509756	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40509756C>A	uc001zkx.3	+	21	2950	c.2738C>A	c.(2737-2739)TCC>TAC	p.S913Y	PAK6_uc010bbl.2_5'UTR|PAK6_uc010bbm.2_5'UTR	NM_001211	NP_001202	O60566	BUB1B_HUMAN	budding uninhibited by benzimidazoles 1 beta	913	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|kidney(1)	4		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		GTGGACTTTTCCTACAGTGTT	0.433			Mis|N|F|S			rhabdomyosarcoma			Mosaic_Variegated_Aneuploidy_Syndrome				5	258	---	---	---	---	PASS
GANC	2595	broad.mit.edu	37	15	42621565	42621565	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42621565C>A	uc001zpi.2	+	14	1876	c.1562C>A	c.(1561-1563)CCA>CAA	p.P521Q		NM_198141	NP_937784	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C	521					carbohydrate metabolic process		carbohydrate binding|maltose alpha-glucosidase activity			central_nervous_system(2)	2		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)		TTTAGAGGGCCAGAGCAAACC	0.438													43	71	---	---	---	---	PASS
TGM5	9333	broad.mit.edu	37	15	43527059	43527059	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43527059G>A	uc001zrd.1	-	11	1791	c.1783C>T	c.(1783-1785)CGC>TGC	p.R595C	TGM5_uc001zrc.1_Missense_Mutation_p.R252C|TGM5_uc001zre.1_Missense_Mutation_p.R513C	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1	595					epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	GCACTGATGCGGATCAGCTTG	0.463													17	59	---	---	---	---	PASS
TUBGCP4	27229	broad.mit.edu	37	15	43690301	43690301	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43690301G>T	uc001zro.2	+	13	1585	c.1345G>T	c.(1345-1347)GGC>TGC	p.G449C	TUBGCP4_uc001zrn.2_Missense_Mutation_p.G448C|TUBGCP4_uc010bdh.2_RNA	NM_014444	NP_055259	Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4	449					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	structural constituent of cytoskeleton			ovary(3)	3		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		CCCTGCATCTGGCTGGGCAGC	0.473													5	154	---	---	---	---	PASS
MYO5A	4644	broad.mit.edu	37	15	52622577	52622577	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52622577G>A	uc002aby.2	-	34	4697	c.4453C>T	c.(4453-4455)CAA>TAA	p.Q1485*	MYO5A_uc002abx.3_Nonsense_Mutation_p.Q1458*|MYO5A_uc010ugd.1_Nonsense_Mutation_p.Q207*|MYO5A_uc002abz.1_RNA	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1	1485					actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		ACAAGTTTTTGCTCATCCTCC	0.423													7	218	---	---	---	---	PASS
LIPC	3990	broad.mit.edu	37	15	58855731	58855731	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58855731G>T	uc010bga.1	+	10	1805	c.1197G>T	c.(1195-1197)ACG>ACT	p.T399T	LIPC_uc010bfz.1_Silent_p.T399T|LIPC_uc002afa.1_Silent_p.T399T|LIPC_uc010bgb.1_Silent_p.T297T|LIPC_uc010ugy.1_Silent_p.T338T	NM_000236	NP_000227	P11150	LIPC_HUMAN	lipase C precursor	399	PLAT.				cholesterol homeostasis|chylomicron remnant clearance|fatty acid biosynthetic process|high-density lipoprotein particle remodeling|intermediate-density lipoprotein particle remodeling|low-density lipoprotein particle remodeling|phosphatidylcholine catabolic process|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle	apolipoprotein binding|heparin binding|low-density lipoprotein particle binding|phospholipase activity|triglyceride lipase activity			ovary(1)	1		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		GTAATAAAACGTATTCCTTTC	0.443													17	31	---	---	---	---	PASS
FOXB1	27023	broad.mit.edu	37	15	60298080	60298080	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60298080C>A	uc002agj.1	+	2	1397	c.918C>A	c.(916-918)GCC>GCA	p.A306A	FOXB1_uc010bgh.1_Intron	NM_012182	NP_036314	Q99853	FOXB1_HUMAN	forkhead box B1	306					axon target recognition|cell migration in diencephalon|epithelial cell differentiation involved in mammary gland alveolus development|floor plate development|hypothalamus cell migration|inferior colliculus development|lactation|mammillothalamic axonal tract development|negative regulation of neuron apoptosis|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|telencephalon cell migration|visual learning	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|central_nervous_system(1)	2						GCAGCCCCGCCACCCCCAGCG	0.711													4	7	---	---	---	---	PASS
DENND4A	10260	broad.mit.edu	37	15	66048743	66048743	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66048743C>A	uc002aph.2	-	3	424	c.46G>T	c.(46-48)GCA>TCA	p.A16S	DENND4A_uc002api.2_Missense_Mutation_p.A16S|DENND4A_uc002apj.3_Missense_Mutation_p.A16S|DENND4A_uc010ujj.1_Missense_Mutation_p.A16S	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2	16					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						GTTAATCCTGCTACAACAAAG	0.373													10	38	---	---	---	---	PASS
DIS3L	115752	broad.mit.edu	37	15	66615210	66615210	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66615210C>A	uc010ujm.1	+	10	1527	c.1512C>A	c.(1510-1512)CAC>CAA	p.H504Q	DIS3L_uc010ujl.1_Missense_Mutation_p.H134Q|DIS3L_uc002app.2_Missense_Mutation_p.H421Q|DIS3L_uc002apq.2_Missense_Mutation_p.H504Q|DIS3L_uc010bho.2_Missense_Mutation_p.H370Q	NM_001143688	NP_001137160	Q8TF46	DI3L1_HUMAN	DIS3 mitotic control homolog (S.	504					rRNA catabolic process	cytoplasm|exosome (RNase complex)	exonuclease activity|protein binding|ribonuclease activity|RNA binding			ovary(2)	2						TTGGGGTCCACATCGCAGATG	0.418													18	34	---	---	---	---	PASS
SIN3A	25942	broad.mit.edu	37	15	75702220	75702220	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75702220C>A	uc002bai.2	-	8	1533	c.1274G>T	c.(1273-1275)TGC>TTC	p.C425F	SIN3A_uc002baj.2_Missense_Mutation_p.C425F|SIN3A_uc010uml.1_Missense_Mutation_p.C425F	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A	425	Interaction with REST (By similarity).				blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						GCGGATCTGGCAGCCATTCTG	0.507													6	103	---	---	---	---	PASS
CSPG4	1464	broad.mit.edu	37	15	75982089	75982089	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75982089C>A	uc002baw.2	-	3	1410	c.1317G>T	c.(1315-1317)GTG>GTT	p.V439V		NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor	439	Extracellular (Potential).|CSPG 1.|Globular or compact configuration stabilized by disulfide bonds.|Neurite growth inhibition (By similarity).				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3						CCCCCTCGGCCACCACCAGTG	0.637													10	36	---	---	---	---	PASS
SLC28A1	9154	broad.mit.edu	37	15	85486718	85486718	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85486718G>T	uc002blg.2	+	16	1826	c.1624G>T	c.(1624-1626)GCC>TCC	p.A542S	SLC28A1_uc010bnb.2_Missense_Mutation_p.A542S|SLC28A1_uc010upe.1_Missense_Mutation_p.A376S|SLC28A1_uc010upf.1_Missense_Mutation_p.A542S|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1	542	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CTGTGGATTTGCCAATTTCAG	0.552													6	37	---	---	---	---	PASS
NTRK3	4916	broad.mit.edu	37	15	88678528	88678528	+	Silent	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88678528C>T	uc002bme.1	-	9	1170	c.1008G>A	c.(1006-1008)CTG>CTA	p.L336L	NTRK3_uc002bmh.2_Silent_p.L336L|NTRK3_uc002bmf.1_Silent_p.L336L|NTRK3_uc010upl.1_Silent_p.L238L|NTRK3_uc010bnh.1_Silent_p.L336L|NTRK3_uc002bmg.2_Silent_p.L336L	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	336	Ig-like C2-type 2.|Extracellular (Potential).		L -> Q (in a lung adenocarcinoma sample; somatic mutation).		transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	p.L336Q(2)	ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			GCCCATTGTGCAGCCAGTGCA	0.607			T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			13	45	---	---	---	---	PASS
DET1	55070	broad.mit.edu	37	15	89074248	89074248	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89074248G>A	uc002bmr.2	-	2	841	c.689C>T	c.(688-690)GCC>GTC	p.A230V	DET1_uc002bmp.3_RNA|DET1_uc010bnk.2_RNA|DET1_uc002bmq.2_Missense_Mutation_p.A241V	NM_001144074	NP_001137546	Q7L5Y6	DET1_HUMAN	de-etiolated 1 isoform 2	230						nucleus				lung(1)|pancreas(1)	2	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			AGACAAGATGGCCAGGATGTT	0.498													12	24	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89401694	89401694	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89401694G>T	uc010upo.1	+	12	6252	c.5878G>T	c.(5878-5880)GGC>TGC	p.G1960C	ACAN_uc010upp.1_Missense_Mutation_p.G1960C|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	1960					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGGGCCTTCTGGCATTTTAGA	0.517													5	49	---	---	---	---	PASS
IDH2	3418	broad.mit.edu	37	15	90631588	90631588	+	Intron	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90631588C>A	uc002box.2	-						IDH2_uc010uqb.1_Intron|IDH2_uc010uqc.1_Intron|IDH2_uc010bnu.2_Intron	NM_002168	NP_002159	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+),						2-oxoglutarate metabolic process|glyoxylate cycle|isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding			haematopoietic_and_lymphoid_tissue(621)|central_nervous_system(80)|bone(7)|skin(3)	711	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			AAGCCAGCCTCACCTCGTCGG	0.428			M		GBM								44	72	---	---	---	---	PASS
PRC1	9055	broad.mit.edu	37	15	91524153	91524153	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91524153G>T	uc002bqm.2	-	6	940	c.783C>A	c.(781-783)GCC>GCA	p.A261A	PRC1_uc002bqn.2_Silent_p.A261A|PRC1_uc002bqo.2_Silent_p.A261A|PRC1_uc010uqs.1_Silent_p.A220A	NM_003981	NP_003972	O43663	PRC1_HUMAN	protein regulator of cytokinesis 1 isoform 1	261	Potential.|Dimerization.				cytokinesis|mitotic spindle elongation	cytoplasm|nucleus|spindle microtubule|spindle pole	protein binding			ovary(1)|skin(1)	2	Lung NSC(78;0.0987)|all_lung(78;0.175)					ACATAATGGTGGCCACAGCTT	0.488													18	54	---	---	---	---	PASS
LRRK1	79705	broad.mit.edu	37	15	101597159	101597159	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101597159C>A	uc002bwr.2	+	28	4750	c.4431C>A	c.(4429-4431)TCC>TCA	p.S1477S	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	1477	Protein kinase.				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AGAAGCTGTCCAAGGGCATCC	0.592													27	57	---	---	---	---	PASS
TARSL2	123283	broad.mit.edu	37	15	102255120	102255120	+	Silent	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102255120G>A	uc002bxm.2	-	4	668	c.613C>T	c.(613-615)CTG>TTG	p.L205L	TARSL2_uc010usi.1_RNA	NM_152334	NP_689547	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	205					threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity			ovary(2)	2	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AGGTCCCACAGTTCACCATTG	0.443													29	62	---	---	---	---	PASS
WDR90	197335	broad.mit.edu	37	16	703577	703577	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:703577C>A	uc002cii.1	+	12	1340	c.1286C>A	c.(1285-1287)GCA>GAA	p.A429E	WDR90_uc002cig.1_Missense_Mutation_p.A429E|WDR90_uc002cih.1_Missense_Mutation_p.A430E|WDR90_uc002cij.1_RNA|WDR90_uc002cik.1_5'Flank	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	429	WD 1.									ovary(1)	1		Hepatocellular(780;0.0218)				TCGGCCCAGGCAAGGGCCCCT	0.647													25	51	---	---	---	---	PASS
FBXL16	146330	broad.mit.edu	37	16	745747	745747	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:745747C>A	uc002cjc.2	-	4	1013	c.810G>T	c.(808-810)CTG>CTT	p.L270L	FBXL16_uc002cja.2_5'Flank|FBXL16_uc002cjb.2_Silent_p.L58L	NM_153350	NP_699181	Q8N461	FXL16_HUMAN	F-box and leucine-rich repeat protein 16	270	LRR 2.										0		Hepatocellular(780;0.0218)				TCAGCTCCGCCAGGTTGGGCA	0.692													8	17	---	---	---	---	PASS
FBXL16	146330	broad.mit.edu	37	16	747007	747007	+	Missense_Mutation	SNP	G	T	T	rs11555893		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:747007G>T	uc002cjc.2	-	3	602	c.399C>A	c.(397-399)TTC>TTA	p.F133L	FBXL16_uc002cja.2_5'Flank|FBXL16_uc002cjb.2_5'Flank	NM_153350	NP_699181	Q8N461	FXL16_HUMAN	F-box and leucine-rich repeat protein 16	133	F-box.										0		Hepatocellular(780;0.0218)				GGCCTGCCCAGAACTTGGGCT	0.617													11	20	---	---	---	---	PASS
CCDC78	124093	broad.mit.edu	37	16	775523	775523	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:775523G>T	uc002cjg.2	-	4	431	c.325C>A	c.(325-327)CAG>AAG	p.Q109K	CCDC78_uc002cjf.2_5'Flank|CCDC78_uc002cji.3_Missense_Mutation_p.Q183K|CCDC78_uc002cjj.3_Intron|CCDC78_uc002cjh.2_5'UTR|CCDC78_uc010uuo.1_Missense_Mutation_p.Q109K|CCDC78_uc002cjk.2_Missense_Mutation_p.Q109K|HAGHL_uc002cjl.1_5'Flank|HAGHL_uc002cjm.1_5'Flank|HAGHL_uc002cjn.1_5'Flank|HAGHL_uc002cjo.1_5'Flank|HAGHL_uc010uup.1_5'Flank	NM_001031737	NP_001026907	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78	109										central_nervous_system(1)	1		Hepatocellular(780;0.0218)				GCACAGCCCTGGCTGGTGCCA	0.652													14	27	---	---	---	---	PASS
SOX8	30812	broad.mit.edu	37	16	1034912	1034912	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1034912G>T	uc002ckn.2	+	3	982	c.867G>T	c.(865-867)CTG>CTT	p.L289L		NM_014587	NP_055402	P57073	SOX8_HUMAN	SRY (sex determining region Y)-box 8	289					adipose tissue development|enteric nervous system development|fat cell differentiation|in utero embryonic development|metanephric nephron tubule formation|morphogenesis of a branching epithelium|negative regulation of apoptosis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|neural crest cell migration|oligodendrocyte differentiation|osteoblast differentiation|peripheral nervous system development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of gliogenesis|positive regulation of osteoblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone levels|renal vesicle induction|retinal rod cell differentiation|Sertoli cell development|signal transduction|spermatogenesis|ureter morphogenesis	cytoplasm|nucleus				central_nervous_system(1)|skin(1)	2		Hepatocellular(780;0.00308)				ACCAGTACCTGCCCCTGGGCG	0.687													4	11	---	---	---	---	PASS
CACNA1H	8912	broad.mit.edu	37	16	1250467	1250467	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1250467A>C	uc002cks.2	+	7	1263	c.1015A>C	c.(1015-1017)AAC>CAC	p.N339H	CACNA1H_uc002ckt.2_Missense_Mutation_p.N339H	NM_021098	NP_066921	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type,	339	Extracellular (Potential).|I.				aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(2)	2		Hepatocellular(780;0.00369)			Flunarizine(DB04841)|Mibefradil(DB01388)	CGCCTGCATCAACTGGAACCA	0.662													5	20	---	---	---	---	PASS
TELO2	9894	broad.mit.edu	37	16	1545603	1545603	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1545603G>A	uc002cly.2	+	3	883	c.592G>A	c.(592-594)GCG>ACG	p.A198T	TELO2_uc010uvg.1_Missense_Mutation_p.A198T	NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog	198						chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)				GGTGCTGCAGGCGGTTGTGGA	0.662													20	36	---	---	---	---	PASS
ABCA3	21	broad.mit.edu	37	16	2331439	2331439	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2331439C>A	uc002cpy.1	-	27	4819	c.4107G>T	c.(4105-4107)CTG>CTT	p.L1369L	ABCA3_uc010bsk.1_Silent_p.L1311L	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	1369					response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)				GACTGGGGGCCAGGATGCGGG	0.567													5	45	---	---	---	---	PASS
PRSS22	64063	broad.mit.edu	37	16	2905791	2905791	+	Missense_Mutation	SNP	C	A	A	rs146582104		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2905791C>A	uc002cry.1	-	4	409	c.343G>T	c.(343-345)GGC>TGC	p.G115C	PRSS22_uc002crz.1_Intron	NM_022119	NP_071402	Q9GZN4	BSSP4_HUMAN	protease, serine, 22 precursor	115	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			central_nervous_system(1)	1						GACCGAGAGCCAGGGTTCCCC	0.612													4	17	---	---	---	---	PASS
BTBD12	84464	broad.mit.edu	37	16	3640826	3640826	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3640826G>T	uc002cvp.2	-	12	3440	c.2813C>A	c.(2812-2814)GCA>GAA	p.A938E		NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	938	Interaction with PLK1 and TERF2-TERF2IP.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						TGCTCCCCGTGCCCCTGAGTG	0.662								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				22	69	---	---	---	---	PASS
CLEC16A	23274	broad.mit.edu	37	16	11066808	11066808	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11066808C>A	uc002dao.2	+	7	848	c.618C>A	c.(616-618)GCC>GCA	p.A206A	CLEC16A_uc002dan.3_Silent_p.A204A	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A	206										ovary(1)|central_nervous_system(1)	2						ATAACCAGGCCATGCTGCACT	0.393													6	15	---	---	---	---	PASS
RUNDC2A	84127	broad.mit.edu	37	16	12146003	12146003	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12146003G>T	uc002dbw.1	+	8	1110	c.1048G>T	c.(1048-1050)GTG>TTG	p.V350L	SNX29_uc002dby.3_5'Flank	NM_032167	NP_115543	Q9HA26	RUN2A_HUMAN	RUN domain containing 2A	350										ovary(1)	1						TGATGAAGATGTGGATGAAAA	0.448			T	CIITA	PMBL|Hodgkin Lymphona|								15	59	---	---	---	---	PASS
ACSM2A	123876	broad.mit.edu	37	16	20486771	20486771	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20486771G>T	uc010bwe.2	+						ACSM2A_uc010vax.1_Intron|ACSM2A_uc002dhf.3_Intron|ACSM2A_uc002dhg.3_Intron|ACSM2A_uc010vay.1_Intron|ACSM2A_uc002dhh.3_5'Flank	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						CAGGTGATGGGGCTTTGAGGA	0.502													15	38	---	---	---	---	PASS
OTOA	146183	broad.mit.edu	37	16	21728314	21728314	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21728314G>T	uc002djh.2	+	14	1576	c.1575G>T	c.(1573-1575)AGG>AGT	p.R525S	uc002diq.3_Intron|OTOA_uc010vbj.1_Missense_Mutation_p.R446S|OTOA_uc002dji.2_Missense_Mutation_p.R201S|OTOA_uc010vbk.1_Missense_Mutation_p.R173S	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1	539					sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		ATTTAAGGAGGCAACCTGGAT	0.473													30	72	---	---	---	---	PASS
ERN2	10595	broad.mit.edu	37	16	23716314	23716314	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23716314C>A	uc002dma.3	-	8	1057	c.888G>T	c.(886-888)CTG>CTT	p.L296L	ERN2_uc010bxp.2_Silent_p.L296L|ERN2_uc010bxq.1_Silent_p.L104L	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2	248	Lumenal (Potential).				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TGTCTCGAGCCAGCGTGAGAT	0.667													19	34	---	---	---	---	PASS
SULT1A2	6799	broad.mit.edu	37	16	28604827	28604827	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28604827C>A	uc002dqg.1	-	5	786	c.435G>T	c.(433-435)ATG>ATT	p.M145I	uc010vct.1_Intron|SULT1A2_uc002dqh.1_Missense_Mutation_p.M145I	NM_177528	NP_803564	P50226	ST1A2_HUMAN	sulfotransferase family, cytosolic, 1A,	145					3'-phosphoadenosine 5'-phosphosulfate metabolic process|amine biosynthetic process|catecholamine metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity|flavonol 3-sulfotransferase activity				0						ACACTTTGGCCATGTGGTAGA	0.557													15	20	---	---	---	---	PASS
NFATC2IP	84901	broad.mit.edu	37	16	28965898	28965898	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28965898C>A	uc002dru.2	+	3	488	c.473C>A	c.(472-474)GCA>GAA	p.A158E	uc010vct.1_Intron|NFATC2IP_uc002drt.2_Intron	NM_032815	NP_116204	Q8NCF5	NF2IP_HUMAN	nuclear factor of activated T-cells,	158						cytoplasm|nucleus				ovary(1)	1						GCAGAGCTGGCAGATTCGAGT	0.527													44	115	---	---	---	---	PASS
FAM57B	83723	broad.mit.edu	37	16	30038080	30038080	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30038080G>T	uc002dvt.2	-	3	632	c.294C>A	c.(292-294)CAC>CAA	p.H98Q	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|FAM57B_uc002dvu.2_Missense_Mutation_p.H48Q	NM_031478	NP_113666	Q71RH2	FA57B_HUMAN	hypothetical protein LOC83723	98	TLC.					endoplasmic reticulum|integral to membrane					0						CCTGGTGCTTGTGCCAGTGAC	0.597													6	26	---	---	---	---	PASS
CD2BP2	10421	broad.mit.edu	37	16	30364605	30364605	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30364605G>T	uc002dxr.2	-	5	1065	c.812C>A	c.(811-813)GCA>GAA	p.A271E	CD2BP2_uc002dxs.2_Missense_Mutation_p.A271E	NM_006110	NP_006101	O95400	CD2B2_HUMAN	CD2 antigen (cytoplasmic tail) binding protein	271					assembly of spliceosomal tri-snRNP	cytoplasm|nucleoplasm|U5 snRNP	protein binding|ribonucleoprotein binding			ovary(1)	1						CCGCGACTCTGCTTCTAAAAT	0.572													11	45	---	---	---	---	PASS
SEPT1	1731	broad.mit.edu	37	16	30389812	30389812	+	Silent	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30389812C>T	uc002dxy.2	-	12	1234	c.1047G>A	c.(1045-1047)AAG>AAA	p.K349K	SEPT1_uc002dxw.2_RNA|SEPT1_uc002dxx.2_Silent_p.K174K	NM_052838	NP_443070	Q8WYJ6	SEPT1_HUMAN	septin 1	349					cell cycle|cell division	microtubule organizing center|septin complex	GTP binding|protein binding			ovary(1)	1			Colorectal(24;0.193)			GGGCCTGCATCTTCTCCAGCA	0.687													3	11	---	---	---	---	PASS
PRSS53	339105	broad.mit.edu	37	16	31105680	31105680	+	Intron	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31105680G>A	uc002ear.2	-						VKORC1_uc002eas.2_Intron|VKORC1_uc002eat.2_Intron|VKORC1_uc002eau.2_Intron	NM_001039503	NP_001034592	Q2L4Q9	PRS53_HUMAN	polyserase 3 precursor						proteolysis	extracellular region	serine-type endopeptidase activity				0						CCAGTCCCCAGCACTGTCTGG	0.592													24	53	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	33647476	33647476	+	RNA	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33647476G>T	uc010vga.1	-	1		c.67C>A								Homo sapiens IGH mRNA for immunoglobulin heavy chain VHDJ region, partial cds, clone:kh0002h.																		CCAGAGTCTGGACAGGACAGT	0.572													44	94	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49764887	49764887	+	Intron	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49764887C>A	uc002efs.2	-							NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423						cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				GGCCTCCTGCCAACAGGAAGA	0.478													21	99	---	---	---	---	PASS
PDP2	57546	broad.mit.edu	37	16	66918303	66918303	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66918303G>T	uc002eqk.1	+	2	278	c.116G>T	c.(115-117)TGG>TTG	p.W39L		NM_020786	NP_065837	Q9P2J9	PDP2_HUMAN	pyruvate dehydrogenase phosphatase isoenzyme 2	39					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity|metal ion binding			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		AAATTAAAATGGAGGCTCTTT	0.453													34	77	---	---	---	---	PASS
LRRC29	26231	broad.mit.edu	37	16	67241850	67241850	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67241850G>T	uc002esd.2	-	3	1326	c.429C>A	c.(427-429)GGC>GGA	p.G143G	LRRC29_uc002ese.2_Silent_p.G143G|LRRC29_uc002esf.2_Silent_p.G143G|LRRC29_uc002esg.2_Silent_p.G143G	NM_012163	NP_036295	Q8WV35	LRC29_HUMAN	F-box and leucine-rich repeat protein 9	143	F-box.|LRR 5.										0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		CCTGGGCCCAGCCCTTGTCAC	0.607													20	21	---	---	---	---	PASS
GFOD2	81577	broad.mit.edu	37	16	67709359	67709359	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67709359G>T	uc002eub.2	-	3	1152	c.857C>A	c.(856-858)GCA>GAA	p.A286E	GFOD2_uc002eua.1_RNA|GFOD2_uc002euc.2_Missense_Mutation_p.A181E	NM_030819	NP_110446	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain	286						proteinaceous extracellular matrix	binding|oxidoreductase activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		TGCGCCCACTGCCAGCGAGTC	0.652													8	30	---	---	---	---	PASS
RANBP10	57610	broad.mit.edu	37	16	67760357	67760357	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67760357C>A	uc002eud.2	-	14	1953	c.1837G>T	c.(1837-1839)GCC>TCC	p.A613S	RANBP10_uc010ceo.2_Missense_Mutation_p.A384S|RANBP10_uc010vju.1_Missense_Mutation_p.A587S|RANBP10_uc010vjv.1_Missense_Mutation_p.A526S	NM_020850	NP_065901	Q6VN20	RBP10_HUMAN	RAN binding protein 10	613										ovary(1)	1		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		TCAACTCTGGCAAAGGAGCAA	0.637													4	10	---	---	---	---	PASS
EDC4	23644	broad.mit.edu	37	16	67917564	67917564	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67917564C>T	uc002eur.2	+	28	4109	c.3943C>T	c.(3943-3945)CAG>TAG	p.Q1315*	EDC4_uc010cer.2_Nonsense_Mutation_p.Q934*|EDC4_uc002eus.2_Nonsense_Mutation_p.Q1045*|EDC4_uc002eut.1_3'UTR|NRN1L_uc002euu.2_5'Flank	NM_014329	NP_055144	Q6P2E9	EDC4_HUMAN	autoantigen RCD8	1315					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|central_nervous_system(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CCCGCTCTCCCAGCCTGTGCT	0.602											OREG0023890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	58	120	---	---	---	---	PASS
ZNF821	55565	broad.mit.edu	37	16	71898838	71898838	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71898838G>C	uc010vmj.1	-	4	656	c.280C>G	c.(280-282)CCT>GCT	p.P94A	ATXN1L_uc010vmi.1_Intron|ZNF821_uc002fbe.2_5'UTR|ZNF821_uc002fbf.2_Missense_Mutation_p.P52A|ZNF821_uc002fbg.3_Intron|ZNF821_uc002fbh.3_Missense_Mutation_p.P52A|ZNF821_uc002fbi.3_5'UTR	NM_017530	NP_060000	O75541	ZN821_HUMAN	zinc finger protein 821	94					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CCACCAACAGGCTGTTCTGTA	0.532													5	100	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72832356	72832356	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72832356C>A	uc002fck.2	-	9	4898	c.4225G>T	c.(4225-4227)GCC>TCC	p.A1409S	ZFHX3_uc002fcl.2_Missense_Mutation_p.A495S	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	1409	C2H2-type 13.				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				GTCTTGAAGGCCAGGCTACAC	0.502													15	49	---	---	---	---	PASS
WDR59	79726	broad.mit.edu	37	16	74937894	74937894	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74937894C>A	uc002fdh.1	-	18	1919	c.1817G>T	c.(1816-1818)CGC>CTC	p.R606L	WDR59_uc002fdf.1_Missense_Mutation_p.R51L|WDR59_uc002fdg.1_Missense_Mutation_p.R198L	NM_030581	NP_085058	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	606										ovary(1)|breast(1)	2						TTTCTCGCTGCGAGTGGGGCT	0.547													4	13	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76482851	76482851	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76482851G>T	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						ATTATGAGGTGTGATGGTTAT	0.383													3	10	---	---	---	---	PASS
CENPN	55839	broad.mit.edu	37	16	81045548	81045548	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81045548G>A	uc002ffx.2	+	2	794	c.4G>A	c.(4-6)GAT>AAT	p.D2N	CENPN_uc002ffw.3_Missense_Mutation_p.D2N|CENPN_uc010vnl.1_Missense_Mutation_p.D2N|CENPN_uc010vnm.1_Missense_Mutation_p.D2N|CENPN_uc002ffy.3_Missense_Mutation_p.D2N	NM_001100624	NP_001094094	Q96H22	CENPN_HUMAN	centromere protein N isoform 2	2					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm					0						CAAAGAGATGGATGAGACTGT	0.358													18	29	---	---	---	---	PASS
SDR42E1	93517	broad.mit.edu	37	16	82033639	82033639	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82033639G>T	uc002fgu.2	-	3	387	c.259C>A	c.(259-261)CGG>AGG	p.R87R		NM_145168	NP_660151	Q8WUS8	D42E1_HUMAN	short chain dehydrogenase/reductase family 42E,	87					steroid biosynthetic process	integral to membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding				0						AGTTGCTCCCGCCCTGACATA	0.498													24	49	---	---	---	---	PASS
RPL13	6137	broad.mit.edu	37	16	89627829	89627829	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89627829G>T	uc002fnm.1	+						RPL13_uc010vpj.1_Intron|RPL13_uc002fnn.1_Intron|RPL13_uc002fno.1_Intron|SNORD68_uc010cim.1_5'Flank	NM_000977	NP_000968	P26373	RL13_HUMAN	ribosomal protein L13						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic ribosome	protein binding|RNA binding|structural constituent of ribosome				0		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		CCCCTCTGTTGGCCTCAGTCG	0.592													13	29	---	---	---	---	PASS
YWHAE	7531	broad.mit.edu	37	17	1303366	1303366	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1303366C>A	uc002fsj.2	-	1	191	c.39G>T	c.(37-39)CTG>CTT	p.L13L	YWHAE_uc002fsk.2_5'UTR|YWHAE_uc010vqh.1_RNA|YWHAE_uc010vqi.1_RNA	NM_006761	NP_006752	P62258	1433E_HUMAN	tyrosine 3/tryptophan 5 -monooxygenase	13					apoptosis|G2/M transition of mitotic cell cycle|induction of apoptosis by extracellular signals|interspecies interaction between organisms|intracellular signal transduction|nerve growth factor receptor signaling pathway	cytosol|melanosome	histone deacetylase binding|phosphoserine binding			lung(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		CCTGCTCGGCCAGCTTCGCCT	0.657													19	18	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1577070	1577070	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1577070C>A	uc002fte.2	-	22	3530	c.3416G>T	c.(3415-3417)CGC>CTC	p.R1139L		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	1139						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GAGGCGCATGCGGGCATCTCG	0.517													12	56	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7727540	7727540	+	Missense_Mutation	SNP	G	T	T	rs147571735	byFrequency	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7727540G>T	uc002giu.1	+	75	11594	c.11580G>T	c.(11578-11580)ATG>ATT	p.M3860I	DNAH2_uc010cnm.1_Missense_Mutation_p.M798I	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	3860	AAA 6 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				ACATGGGCATGGCCCAGCGCT	0.657													23	12	---	---	---	---	PASS
MFSD6L	162387	broad.mit.edu	37	17	8701217	8701217	+	Missense_Mutation	SNP	C	T	T	rs143056359	byFrequency	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8701217C>T	uc002glp.1	-	1	1370	c.1222G>A	c.(1222-1224)GCC>ACC	p.A408T		NM_152599	NP_689812	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing	408	Helical; (Potential).					integral to membrane				central_nervous_system(1)	1						AAGCTGAGGGCGACCGAGAAA	0.562													23	68	---	---	---	---	PASS
FLII	2314	broad.mit.edu	37	17	18148710	18148710	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18148710C>G	uc002gsr.1	-	29	3684	c.3633G>C	c.(3631-3633)CAG>CAC	p.Q1211H	FLII_uc002gsq.1_Missense_Mutation_p.Q1082H|FLII_uc010cpy.1_Missense_Mutation_p.Q1200H|FLII_uc010vxn.1_Missense_Mutation_p.Q1180H|FLII_uc010vxo.1_Missense_Mutation_p.Q1156H	NM_002018	NP_002009	Q13045	FLII_HUMAN	flightless I homolog	1211	Gelsolin-like 5.				multicellular organismal development|muscle contraction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	actin binding			central_nervous_system(1)|skin(1)	2	all_neural(463;0.228)					CCTGGCTAGTCTGGGTCCCCA	0.642													6	56	---	---	---	---	PASS
MAPK7	5598	broad.mit.edu	37	17	19286527	19286527	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19286527G>T	uc002gvn.2	+	7	2820	c.2434G>T	c.(2434-2436)GAC>TAC	p.D812Y	MAPK7_uc002gvo.2_Missense_Mutation_p.D673Y|MAPK7_uc002gvq.2_Missense_Mutation_p.D812Y|MAPK7_uc002gvp.2_Missense_Mutation_p.D812Y|uc010vyt.1_5'Flank	NM_139033	NP_620602	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7 isoform 1	812					cell cycle|cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|protein binding			central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					TGACCTGCCTGACCTCCAGGA	0.597													7	24	---	---	---	---	PASS
ALDH3A1	218	broad.mit.edu	37	17	19648346	19648346	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19648346G>T	uc010cqu.2	-	1	427	c.97C>A	c.(97-99)CTG>ATG	p.L33M	ALDH3A1_uc010vzd.1_Missense_Mutation_p.L33M|ALDH3A1_uc002gwj.2_Missense_Mutation_p.L33M|ALDH3A1_uc010cqv.2_Missense_Mutation_p.L33M|ALDH3A1_uc002gwk.2_Intron|ALDH3A1_uc002gwl.1_5'Flank	NM_001135168	NP_001128640	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3A1	33					cellular aldehyde metabolic process	cytosol|endoplasmic reticulum	alcohol dehydrogenase (NADP+) activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase			ovary(1)|pancreas(1)	2	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)	NADH(DB00157)	AGGCGCTGCAGCGCCTCCAGC	0.706													4	3	---	---	---	---	PASS
CPD	1362	broad.mit.edu	37	17	28758837	28758837	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28758837G>T	uc002hfb.1	+	8	2080	c.2065G>T	c.(2065-2067)GCC>TCC	p.A689S	CPD_uc010wbo.1_Missense_Mutation_p.A442S|CPD_uc010wbp.1_RNA	NM_001304	NP_001295	O75976	CBPD_HUMAN	carboxypeptidase D precursor	689	Extracellular (Potential).|Carboxypeptidase-like 2.				proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2						ACAAGGACTTGCCACATATAG	0.328													25	22	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29670025	29670025	+	Splice_Site	SNP	A	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29670025A>G	uc002hgg.2	+	48	7396	c.7063_splice	c.e48-2	p.S2355_splice	NF1_uc002hgh.2_Splice_Site_p.S2334_splice|NF1_uc010cso.2_Splice_Site_p.S543_splice|NF1_uc010wbt.1_Splice_Site|NF1_uc010wbu.1_Splice_Site	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TATCTTTAATAGAGTCCAGAG	0.368			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			21	16	---	---	---	---	PASS
C17orf66	256957	broad.mit.edu	37	17	34190043	34190043	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34190043G>T	uc002hke.1	-	8	861	c.712C>A	c.(712-714)CTA>ATA	p.L238I	C17orf66_uc010wck.1_RNA|C17orf66_uc010wcl.1_Missense_Mutation_p.L198I|C17orf66_uc010wcm.1_Missense_Mutation_p.L204I	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957	238							binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		GCCATTCGTAGCCCCGTCAAA	0.498													3	62	---	---	---	---	PASS
GGNBP2	79893	broad.mit.edu	37	17	34935839	34935839	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34935839A>T	uc002hnb.2	+	8	1259	c.1010A>T	c.(1009-1011)AAG>ATG	p.K337M	GGNBP2_uc002hna.2_Missense_Mutation_p.K337M|GGNBP2_uc002hnc.1_Missense_Mutation_p.K166M	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403	337					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GCTTTACGCAAGAGTTTTGAG	0.433													31	34	---	---	---	---	PASS
MED1	5469	broad.mit.edu	37	17	37563746	37563746	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37563746C>A	uc002hrv.3	-	17	4940	c.4728G>T	c.(4726-4728)GTG>GTT	p.V1576V	MED1_uc010wee.1_Silent_p.V1404V|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	1576					androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		CAATCAGGGCCACATCCATAA	0.423										HNSCC(31;0.082)			23	22	---	---	---	---	PASS
KRT16	3868	broad.mit.edu	37	17	39768836	39768836	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39768836C>A	uc002hxg.3	-	1	244	c.105G>T	c.(103-105)CTG>CTT	p.L35L	JUP_uc010wfs.1_Intron	NM_005557	NP_005548	P08779	K1C16_HUMAN	keratin 16	35	Head.				cell proliferation|epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton			skin(1)	1		Breast(137;0.000307)				ACCCTCCGGCCAGGACGGAGG	0.721													5	3	---	---	---	---	PASS
G6PC	2538	broad.mit.edu	37	17	41063047	41063047	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41063047G>T	uc002icb.1	+	5	757	c.678G>T	c.(676-678)CTG>CTT	p.L226L	G6PC_uc010whf.1_3'UTR	NM_000151	NP_000142	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	226	Helical; (Potential).				gluconeogenesis|glucose homeostasis|transmembrane transport	integral to endoplasmic reticulum membrane	glucose-6-phosphatase activity|phosphate binding			ovary(1)|breast(1)|kidney(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		TTTATCTGCTGCTCAAGGGAC	0.498									Glycogen_Storage_Disease_type_Ia				18	19	---	---	---	---	PASS
SLC4A1	6521	broad.mit.edu	37	17	42330535	42330535	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42330535C>A	uc002igf.3	-	17	2411	c.2262G>T	c.(2260-2262)CAG>CAT	p.Q754H		NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	754	Membrane (anion exchange).				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CTTTGACCTCCTGGATCTGGG	0.642													18	17	---	---	---	---	PASS
FTSJ3	117246	broad.mit.edu	37	17	61902031	61902031	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61902031G>C	uc002jbz.2	-	9	961	c.883C>G	c.(883-885)CAG>GAG	p.Q295E	FTSJ3_uc002jca.2_Missense_Mutation_p.Q295E|PSMC5_uc002jcb.2_5'Flank|PSMC5_uc010ddy.2_5'Flank|PSMC5_uc010ddz.2_5'Flank|PSMC5_uc002jcc.2_5'Flank|PSMC5_uc002jcd.2_5'Flank	NM_017647	NP_060117	Q8IY81	RRMJ3_HUMAN	FtsJ homolog 3	295					RNA methylation|rRNA processing	nucleolus	methyltransferase activity|nucleic acid binding			ovary(1)	1						CTGATGTCCTGACAGCACACC	0.572													49	44	---	---	---	---	PASS
TEX2	55852	broad.mit.edu	37	17	62272361	62272361	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62272361C>A	uc002jec.2	-	3	1912	c.1739G>T	c.(1738-1740)AGA>ATA	p.R580I	TEX2_uc002jed.2_Missense_Mutation_p.R580I|TEX2_uc002jee.2_Missense_Mutation_p.R580I	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	testis expressed sequence 2	580					signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CTTTGAAAGTCTTAAGGTTCC	0.438													22	27	---	---	---	---	PASS
SLC16A6	9120	broad.mit.edu	37	17	66267059	66267059	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66267059G>T	uc002jgz.1	-	5	1430	c.1242C>A	c.(1240-1242)GGC>GGA	p.G414G	ARSG_uc002jhc.2_Intron|SLC16A6_uc002jha.1_Silent_p.G414G	NM_004694	NP_004685	O15403	MOT7_HUMAN	solute carrier family 16, member 6	414	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity				0	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	TCTTCTCAATGCCCACGACAT	0.453													6	49	---	---	---	---	PASS
GPR142	350383	broad.mit.edu	37	17	72368028	72368028	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72368028G>T	uc010wqy.1	+	4	678	c.678G>T	c.(676-678)GTG>GTT	p.V226V	GPR142_uc010wqx.1_Silent_p.V138V	NM_181790	NP_861455	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	226	Extracellular (Potential).					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CCCGCCAGGTGCCCCAGGCTG	0.627													13	7	---	---	---	---	PASS
THOC4	10189	broad.mit.edu	37	17	79846200	79846200	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79846200T>C	uc002kbu.2	-	5	703	c.697A>G	c.(697-699)AGA>GGA	p.R233G		NM_005782	NP_005773	Q86V81	THOC4_HUMAN	THO complex 4	226	Ala/Arg/Gly-rich.				intronless viral mRNA export from host nucleus|mRNA 3'-end processing|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear speck|transcription export complex	nucleotide binding|protein binding|RNA binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CCTCTGCCTCTTCCACGGGCG	0.627													7	10	---	---	---	---	PASS
NARF	26502	broad.mit.edu	37	17	80445995	80445995	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80445995C>A	uc002kfg.3	+	11	1473	c.1333C>A	c.(1333-1335)CAG>AAG	p.Q445K	NARF_uc002kff.3_Missense_Mutation_p.Q386K|NARF_uc010dit.2_Missense_Mutation_p.Q491K|NARF_uc002kfj.3_Missense_Mutation_p.Q397K|NARF_uc002kfi.3_RNA|NARF_uc002kfh.3_Missense_Mutation_p.Q491K|NARF_uc002kfk.2_RNA	NM_012336	NP_036468	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor isoform a	445						lamin filament	lamin binding			skin(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GTACCAGAGCCAGGAGCGTGG	0.622													4	50	---	---	---	---	PASS
ZFP161	7541	broad.mit.edu	37	18	5291962	5291962	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5291962C>T	uc002kmq.2	-	4	406	c.245G>A	c.(244-246)CGT>CAT	p.R82H	ZFP161_uc002kmr.2_Missense_Mutation_p.R82H|ZFP161_uc010dkp.2_Missense_Mutation_p.R82H	NM_003409	NP_003400	O43829	ZF161_HUMAN	zinc finger protein 161 homolog	82	BTB.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TATATCAGAACGAAGAAAATC	0.373													5	66	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6961946	6961946	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6961946C>T	uc002knm.2	-	52	7544	c.7450G>A	c.(7450-7452)GAG>AAG	p.E2484K	LAMA1_uc002knl.2_5'UTR|LAMA1_uc010wzj.1_Missense_Mutation_p.E1960K	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2484					axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TTTCCTACCTCCAGTAAACAG	0.378													28	76	---	---	---	---	PASS
CHMP1B	57132	broad.mit.edu	37	18	11851718	11851718	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11851718G>T	uc002kqe.2	+	1	330	c.208G>T	c.(208-210)GCG>TCG	p.A70S	GNAL_uc002kqc.2_Intron|GNAL_uc010dkz.2_Intron|GNAL_uc002kqd.2_Intron	NM_020412	NP_065145	Q7LBR1	CHM1B_HUMAN	chromatin modifying protein 1B	70					cell cycle|cell division|protein transport	cytosol|late endosome membrane	protein domain specific binding				0						GAGAATGAGTGCGCGAGTCGA	0.542													9	44	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21534555	21534555	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21534555C>A	uc002kuq.2	+	75	10031	c.9945C>A	c.(9943-9945)GTC>GTA	p.V3315V	LAMA3_uc002kur.2_Silent_p.V3259V|LAMA3_uc002kus.3_Silent_p.V1706V|LAMA3_uc002kut.3_Silent_p.V1650V	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	3315	Laminin G-like 5.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTGTCCCTGTCACTGAAGCCT	0.468													15	46	---	---	---	---	PASS
TAF4B	6875	broad.mit.edu	37	18	23866021	23866021	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23866021C>A	uc002kvu.3	+	7	1637	c.1148C>A	c.(1147-1149)TCT>TAT	p.S383Y	TAF4B_uc002kvs.3_RNA|TAF4B_uc002kvt.3_Missense_Mutation_p.S383Y	NM_005640	NP_005631	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding	383					transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleolus|transcription factor TFIID complex	DNA binding|NF-kappaB binding|sequence-specific DNA binding transcription factor activity			lung(1)|central_nervous_system(1)|skin(1)	3	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			ATTATTGTTTCTGGAGCAACA	0.468													20	71	---	---	---	---	PASS
CDH2	1000	broad.mit.edu	37	18	25570062	25570062	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25570062T>C	uc002kwg.2	-	10	2056	c.1597A>G	c.(1597-1599)AGA>GGA	p.R533G	CDH2_uc010xbn.1_Missense_Mutation_p.R502G	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	533	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						ATTTCATACCTAATATTTTGC	0.363													22	63	---	---	---	---	PASS
DSG1	1828	broad.mit.edu	37	18	28918392	28918392	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28918392C>A	uc002kwp.2	+	10	1592	c.1380C>A	c.(1378-1380)TAC>TAA	p.Y460*		NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	460	Extracellular (Potential).|Cadherin 4.				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			GAGGAAAATACCAAGGAACGA	0.318													15	60	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28972210	28972210	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28972210G>T	uc002kwq.2	+	8	1047	c.912G>T	c.(910-912)TTG>TTT	p.L304F	DSG4_uc002kwr.2_Missense_Mutation_p.L304F	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	304	Cadherin 3.|Extracellular (Potential).		Missing (in LAH1).		homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			ATAACTGGTTGGCTCAATATT	0.363													17	46	---	---	---	---	PASS
DSG3	1830	broad.mit.edu	37	18	29055916	29055916	+	Missense_Mutation	SNP	G	T	T	rs147711163	byFrequency	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29055916G>T	uc002kws.2	+	16	2802	c.2693G>T	c.(2692-2694)TGC>TTC	p.C898F	DSG3_uc002kwt.2_Missense_Mutation_p.C180F	NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	898	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding	p.C898G(1)		skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTTGTTAAGTGCCAGACTTTG	0.507													10	51	---	---	---	---	PASS
DSG3	1830	broad.mit.edu	37	18	29056145	29056145	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29056145C>A	uc002kws.2	+	16	3031	c.2922C>A	c.(2920-2922)GGC>GGA	p.G974G	DSG3_uc002kwt.2_Silent_p.G256G	NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	974	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GTGTTCCTGGCAACCTAGCTG	0.502													21	76	---	---	---	---	PASS
GALNT1	2589	broad.mit.edu	37	18	33263508	33263508	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33263508G>T	uc010dmu.2	+	5	688	c.635G>T	c.(634-636)TGT>TTT	p.C212F	GALNT1_uc002kyz.3_Missense_Mutation_p.C152F|GALNT1_uc002kzb.2_Missense_Mutation_p.C212F	NM_020474	NP_065207	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	212	Lumenal (Potential).|Catalytic subdomain A.				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2						GATGCCCATTGTGAGTGTACA	0.443													5	27	---	---	---	---	PASS
CELF4	56853	broad.mit.edu	37	18	34839189	34839189	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34839189G>A	uc002lae.2	-	11	1684	c.1288C>T	c.(1288-1290)CAG>TAG	p.Q430*	CELF4_uc010dnd.1_Nonsense_Mutation_p.Q428*|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Nonsense_Mutation_p.Q424*|CELF4_uc002lai.2_Nonsense_Mutation_p.Q414*	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1	430	RRM 3.				embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						CCAAACTCCTGGGGCAGATGG	0.398													5	14	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50741921	50741921	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50741921C>A	uc002lfe.1	+	12	2452	c.1865C>A	c.(1864-1866)CCA>CAA	p.P622Q	DCC_uc010xdr.1_Missense_Mutation_p.P470Q|DCC_uc010dpf.1_Missense_Mutation_p.P277Q	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	622	Extracellular (Potential).|Fibronectin type-III 3.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CTTTTAGTGCCAAGTGCCCCG	0.383													15	45	---	---	---	---	PASS
NFATC1	4772	broad.mit.edu	37	18	77171011	77171011	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77171011G>A	uc010xfg.1	+	2	1189	c.736G>A	c.(736-738)GTC>ATC	p.V246I	NFATC1_uc002lnc.1_Missense_Mutation_p.V246I|NFATC1_uc010xff.1_Missense_Mutation_p.V246I|NFATC1_uc002lnd.2_Missense_Mutation_p.V246I|NFATC1_uc002lne.2_Intron|NFATC1_uc010xfh.1_Missense_Mutation_p.V246I|NFATC1_uc010xfi.1_Missense_Mutation_p.V233I|NFATC1_uc010xfj.1_Intron|NFATC1_uc002lnf.2_Missense_Mutation_p.V233I|NFATC1_uc002lng.2_Missense_Mutation_p.V233I|NFATC1_uc010xfk.1_Missense_Mutation_p.V233I	NM_006162	NP_006153	O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytosolic	246	3 X SP repeats.|2.				intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)		CCGCGCCAGCGTCACTGAGGA	0.711													12	19	---	---	---	---	PASS
AZU1	566	broad.mit.edu	37	19	828280	828280	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:828280C>A	uc002lpz.1	+	2	125	c.109C>A	c.(109-111)CAG>AAG	p.Q37K		NM_001700	NP_001691	P20160	CAP7_HUMAN	azurocidin 1 preproprotein	37	Peptidase S1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cellular extravasation|defense response to Gram-negative bacterium|glial cell migration|induction of positive chemotaxis|inflammatory response|macrophage chemotaxis|microglial cell activation|monocyte activation|positive regulation of cell adhesion|positive regulation of fractalkine biosynthetic process|positive regulation of interleukin-1 beta biosynthetic process|positive regulation of MHC class II biosynthetic process|positive regulation of phagocytosis|positive regulation of tumor necrosis factor biosynthetic process|proteolysis|regulation of vascular permeability	azurophil granule|extracellular region	heparin binding|serine-type endopeptidase activity|toxin binding			pancreas(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGCCCCGCCAGTTCCCGTT	0.647													24	52	---	---	---	---	PASS
ABCA7	10347	broad.mit.edu	37	19	1055129	1055129	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1055129C>A	uc002lqw.3	+	30	4215	c.3984C>A	c.(3982-3984)GCC>GCA	p.A1328A	ABCA7_uc010dsb.1_Silent_p.A1190A|ABCA7_uc002lqy.2_5'Flank	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	1328	Extracellular (By similarity).				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGAAGTGGCCAAGGTCTTGG	0.657													9	20	---	---	---	---	PASS
CELF5	60680	broad.mit.edu	37	19	3282474	3282474	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3282474C>A	uc002lxm.2	+	8	1054	c.1017C>A	c.(1015-1017)GCC>GCA	p.A339A	CELF5_uc002lxl.1_Silent_p.A339A|CELF5_uc010dtj.1_Silent_p.A314A|CELF5_uc010xhg.1_Silent_p.A225A|CELF5_uc002lxn.2_RNA	NM_021938	NP_068757	Q8N6W0	CELF5_HUMAN	bruno-like 5, RNA binding protein	339					mRNA processing	cytoplasm|nucleus	nucleotide binding|RNA binding			ovary(2)	2						CCGTCTATGCCAATGGCCTTG	0.587													10	37	---	---	---	---	PASS
TMIGD2	126259	broad.mit.edu	37	19	4298276	4298276	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4298276C>G	uc002lzx.1	-	2	159	c.113G>C	c.(112-114)AGT>ACT	p.S38T	TMIGD2_uc010dtv.1_Missense_Mutation_p.S38T	NM_144615	NP_653216	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain	38	Extracellular (Potential).|Ig-like.					integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTCGCCTGACTGCCCTGCCT	0.617													3	15	---	---	---	---	PASS
UBXN6	80700	broad.mit.edu	37	19	4446553	4446553	+	Silent	SNP	C	A	A	rs111828265		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4446553C>A	uc002man.1	-	8	960	c.864G>T	c.(862-864)CTG>CTT	p.L288L	UBXN6_uc010dty.1_Silent_p.L192L|UBXN6_uc002mam.1_Silent_p.L235L	NM_025241	NP_079517	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6	288						microtubule organizing center|nucleus	protein binding				0						AGTCCCCAGGCAGTTCGAACT	0.692													6	27	---	---	---	---	PASS
PLIN4	729359	broad.mit.edu	37	19	4512634	4512634	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4512634C>A	uc002mar.1	-	3	1296	c.1296G>T	c.(1294-1296)TTG>TTT	p.L432F	PLIN4_uc010dub.1_5'Flank	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	432	11.|27 X 33 AA approximate tandem repeat.					lipid particle|plasma membrane					0						TTCCTCTGGCCAAATTCATGG	0.557													5	119	---	---	---	---	PASS
VAV1	7409	broad.mit.edu	37	19	6829837	6829837	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6829837C>A	uc002mfu.1	+	14	1403	c.1306C>A	c.(1306-1308)CGC>AGC	p.R436S	VAV1_uc010xjh.1_Missense_Mutation_p.R404S|VAV1_uc010dva.1_Missense_Mutation_p.R436S|VAV1_uc002mfv.1_Missense_Mutation_p.R381S	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	436	PH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						CATCTGTAAGCGCAGGGGAGA	0.532													5	68	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8165861	8165861	+	Intron	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8165861G>A	uc002mjf.2	-							NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						AGTCAGCTGCGCAAAGGGGAA	0.622													14	19	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8183899	8183899	+	Missense_Mutation	SNP	G	T	T	rs142033402		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8183899G>T	uc002mjf.2	-	25	3240	c.3219C>A	c.(3217-3219)GAC>GAA	p.D1073E		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1073	EGF-like 14; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						TTGCACACTCGTCCACGTCTG	0.617													6	19	---	---	---	---	PASS
ZNF266	10781	broad.mit.edu	37	19	9525231	9525231	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9525231T>A	uc002mll.2	-	4	636	c.370A>T	c.(370-372)ACT>TCT	p.T124S	ZNF266_uc002mlm.2_Missense_Mutation_p.T124S|ZNF266_uc002mln.2_Missense_Mutation_p.T124S|ZNF266_uc002mlo.2_Missense_Mutation_p.T124S|ZNF266_uc010dwp.2_Missense_Mutation_p.T124S|ZNF266_uc010dwq.2_Missense_Mutation_p.T124S	NM_198058	NP_932175	Q14584	ZN266_HUMAN	zinc finger protein 266	124					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TGCTCTCCAGTAGAGGTTTTC	0.428													52	66	---	---	---	---	PASS
ILF3	3609	broad.mit.edu	37	19	10792704	10792704	+	Silent	SNP	C	T	T	rs141175607		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10792704C>T	uc002mpn.2	+	12	1533	c.1216C>T	c.(1216-1218)CTG>TTG	p.L406L	ILF3_uc002mpm.2_Silent_p.L406L|ILF3_uc002mpl.2_Silent_p.L406L|ILF3_uc002mpk.2_Silent_p.L406L|ILF3_uc010xli.1_Silent_p.L4L|ILF3_uc002mpo.2_Silent_p.L406L|ILF3_uc002mpp.2_Silent_p.L227L	NM_012218	NP_036350	Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3 isoform a	406	DRBM 1.				M phase|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleolus|ribonucleoprotein complex	DNA binding|double-stranded RNA binding|protein binding|protein binding			ovary(3)	3			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			TATGAATGCCCTGATGCGGTT	0.587													10	27	---	---	---	---	PASS
RTBDN	83546	broad.mit.edu	37	19	12939770	12939770	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12939770G>T	uc002mvi.2	-						RTBDN_uc002mvh.1_Intron|RTBDN_uc002mvj.2_Intron	NM_001080997	NP_001074466	Q9BSG5	RTBDN_HUMAN	retbindin isoform 1							extracellular region					0						ACAAGGTCCTGGCAAAGGGGA	0.552													5	39	---	---	---	---	PASS
NOTCH3	4854	broad.mit.edu	37	19	15271574	15271574	+	Missense_Mutation	SNP	C	A	A	rs79447691		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15271574C>A	uc002nan.2	-	33	6941	c.6865G>T	c.(6865-6867)GCC>TCC	p.A2289S		NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor	2289	Cytoplasmic (Potential).				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			AGTGGCTGGGCAGGCAGTGCC	0.672													6	40	---	---	---	---	PASS
MYO9B	4650	broad.mit.edu	37	19	17212975	17212975	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17212975G>T	uc010eak.2	+	2	600	c.448G>T	c.(448-450)GAC>TAC	p.D150Y	MYO9B_uc002nfi.2_Missense_Mutation_p.D150Y|MYO9B_uc002nfj.1_Missense_Mutation_p.D150Y	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	150	Myosin head-like.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						GGACTTTGATGACCTGTGTAA	0.602													18	37	---	---	---	---	PASS
FAM98C	147965	broad.mit.edu	37	19	38895709	38895709	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38895709C>A	uc002oin.1	+	4	530	c.511C>A	c.(511-513)CCA>ACA	p.P171T	FAM98C_uc002oio.1_Missense_Mutation_p.P171T|FAM98C_uc010xtz.1_Intron	NM_174905	NP_777565	Q17RN3	FA98C_HUMAN	hypothetical protein LOC147965	171										skin(1)	1	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CAGACCTGCACCAGGGACCCC	0.642													6	77	---	---	---	---	PASS
RASGRP4	115727	broad.mit.edu	37	19	38911820	38911820	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38911820G>T	uc002oir.2	-	3	443	c.229C>A	c.(229-231)CAC>AAC	p.H77N	RASGRP4_uc010efz.1_5'Flank|RASGRP4_uc010ega.1_5'Flank|RASGRP4_uc010xua.1_Missense_Mutation_p.H77N|RASGRP4_uc010xub.1_Missense_Mutation_p.H77N|RASGRP4_uc010xuc.1_Missense_Mutation_p.H77N|RASGRP4_uc010xud.1_Missense_Mutation_p.H77N|RASGRP4_uc010xue.1_Missense_Mutation_p.H77N|RASGRP4_uc010egb.2_Missense_Mutation_p.H77N	NM_170604	NP_733749	Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4 isoform a	77	N-terminal Ras-GEF.				activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity			pancreas(1)|lung(1)|skin(1)	3	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGGTCCTCGTGGCACAGGCTG	0.463													9	21	---	---	---	---	PASS
LRFN1	57622	broad.mit.edu	37	19	39798893	39798893	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39798893C>T	uc002okw.2	-	2	1696	c.1696G>A	c.(1696-1698)GAC>AAC	p.D566N		NM_020862	NP_065913	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III	566	Cytoplasmic (Potential).					cell junction|integral to membrane|postsynaptic density|postsynaptic membrane				ovary(2)	2	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CGGCGGCTGTCCCCGTCGCCA	0.682													10	10	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41040149	41040149	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41040149G>T	uc002ony.2	+	20	4344	c.4258G>T	c.(4258-4260)GCT>TCT	p.A1420S	SPTBN4_uc002onx.2_Missense_Mutation_p.A1420S|SPTBN4_uc002onz.2_Missense_Mutation_p.A1420S|SPTBN4_uc010egx.2_Missense_Mutation_p.A163S|SPTBN4_uc010egy.1_Missense_Mutation_p.A96S|SPTBN4_uc002ooa.2_Missense_Mutation_p.A96S|SPTBN4_uc010egz.1_Missense_Mutation_p.A96S	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	1420	Spectrin 12.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCAGAGCTTTGCTGAGCTGGA	0.607													12	18	---	---	---	---	PASS
LTBP4	8425	broad.mit.edu	37	19	41115449	41115449	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41115449C>A	uc002ooh.1	+	13	1641	c.1641C>A	c.(1639-1641)GGC>GGA	p.G547G	LTBP4_uc002oog.1_Silent_p.G510G|LTBP4_uc002ooi.1_Silent_p.G480G|LTBP4_uc002ooj.1_5'Flank|LTBP4_uc010xvo.1_5'Flank|LTBP4_uc010ehb.1_5'Flank|LTBP4_uc002ook.1_5'Flank	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding	547	Pro-rich.|EGF-like 3.				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCTCCTCCGGCATGTGTCAGC	0.662													7	47	---	---	---	---	PASS
ZNF575	284346	broad.mit.edu	37	19	44039768	44039768	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44039768G>T	uc002ows.2	+	4	1195	c.667G>T	c.(667-669)GGC>TGC	p.G223C	ZNF575_uc002owq.2_Missense_Mutation_p.G322C	NM_174945	NP_777605	Q86XF7	ZN575_HUMAN	zinc finger protein 575	223	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0199)				CCAGGCCTTTGGCCAGAGACG	0.662													11	13	---	---	---	---	PASS
ZNF296	162979	broad.mit.edu	37	19	45575836	45575836	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45575836G>C	uc002pao.2	-	3	508	c.451C>G	c.(451-453)CGA>GGA	p.R151G		NM_145288	NP_660331	Q8WUU4	ZN296_HUMAN	zinc finger protein 296	151					regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGCTCCTCTCGTTCTGGTAAG	0.582													10	36	---	---	---	---	PASS
GLTSCR2	29997	broad.mit.edu	37	19	48248819	48248819	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48248819G>T	uc002phm.2	+	1	27	c.3G>T	c.(1-3)ATG>ATT	p.M1I	GLTSCR2_uc002phk.2_Missense_Mutation_p.M1I|GLTSCR2_uc002phl.2_Missense_Mutation_p.M1I|GLTSCR2_uc010elj.2_Missense_Mutation_p.M1I	NM_015710	NP_056525	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	1						nucleolus				central_nervous_system(1)	1		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		TTGACAAGATGGCGGCAGGAG	0.612													5	114	---	---	---	---	PASS
CCDC114	93233	broad.mit.edu	37	19	48806033	48806033	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48806033G>T	uc002pir.2	-	10	1730	c.1047C>A	c.(1045-1047)CGC>CGA	p.R349R	CCDC114_uc002piq.2_Silent_p.R158R|CCDC114_uc002pio.2_Silent_p.R386R|CCDC114_uc002pis.1_Silent_p.R29R|CCDC114_uc002pit.1_Silent_p.R386R	NM_144577	NP_653178	Q96M63	CC114_HUMAN	coiled-coil domain containing 114 isoform 2	349	Potential.									ovary(1)	1		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		CCTTGTCCATGCGCTGCTGCA	0.632													30	64	---	---	---	---	PASS
TMEM143	55260	broad.mit.edu	37	19	48836478	48836478	+	Nonstop_Mutation	SNP	A	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48836478A>G	uc002pix.1	-	8	1387	c.1378T>C	c.(1378-1380)TGA>CGA	p.*460R	TMEM143_uc002piw.1_RNA|TMEM143_uc002piy.1_Nonstop_Mutation_p.*425R|TMEM143_uc010xzn.1_Nonstop_Mutation_p.*395R|TMEM143_uc010elw.1_Nonstop_Mutation_p.*360R|TMEM143_uc010xzo.1_Nonstop_Mutation_p.*250R	NM_018273	NP_060743	Q96AN5	TM143_HUMAN	transmembrane protein 143	460						integral to membrane|mitochondrion					0		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)		GGTTCTACTCAGGAGATGTTA	0.562													7	22	---	---	---	---	PASS
GRIN2D	2906	broad.mit.edu	37	19	48908114	48908114	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48908114C>A	uc002pjc.3	+	3	677	c.589C>A	c.(589-591)CAC>AAC	p.H197N		NM_000836	NP_000827	O15399	NMDE4_HUMAN	N-methyl-D-aspartate receptor subunit 2D	197	Extracellular (Potential).					cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|protein binding			ovary(3)|breast(3)	6		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Orphenadrine(DB01173)	TGCCCCTGGCCACCGGGCCTT	0.642													47	121	---	---	---	---	PASS
SLC6A16	28968	broad.mit.edu	37	19	49797732	49797732	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49797732G>T	uc002pmz.2	-	8	1542	c.1308C>A	c.(1306-1308)TAC>TAA	p.Y436*	SLC6A16_uc002pna.2_Nonsense_Mutation_p.Y436*	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	436	Extracellular (Potential).					integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		AGGTTGGGTTGTAAAGCAGGT	0.498													15	41	---	---	---	---	PASS
CCDC155	147872	broad.mit.edu	37	19	49913138	49913138	+	Intron	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49913138C>A	uc002pnm.1	+						CCDC155_uc010emx.1_Intron	NM_144688	NP_653289	Q8N6L0	CC155_HUMAN	coiled-coil domain containing 155							integral to membrane	calcium ion binding			ovary(1)|central_nervous_system(1)	2						GACAGGTGAGCACAGGAAAAG	0.572													11	28	---	---	---	---	PASS
MIR519E	574463	broad.mit.edu	37	19	54183251	54183251	+	RNA	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54183251C>T	hsa-mir-519e|MI0003145	+			c.58C>T			MIR520F_hsa-mir-520f|MI0003146_5'Flank																	0						AACAAAGTGCCTCCTTTTAGA	0.408													10	24	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54754789	54754789	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54754789G>C	uc002qex.2	-	13	1745	c.1634C>G	c.(1633-1635)GCA>GGA	p.A545G	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.H616D|LILRB5_uc002qey.2_Missense_Mutation_p.A546G|LILRB5_uc002qez.2_Missense_Mutation_p.A446G|LILRB5_uc002qfa.1_3'UTR	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	545	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGCTTCAGATGCAGCAGCCTG	0.622													10	26	---	---	---	---	PASS
LILRB2	10288	broad.mit.edu	37	19	54780734	54780734	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54780734G>T	uc002qfb.2	-	10	1676	c.1410C>A	c.(1408-1410)GTC>GTA	p.V470V	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Silent_p.V470V|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Silent_p.V469V|LILRB2_uc010yet.1_Silent_p.V354V	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	470	Helical; (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ggagcagtaggaCGACGGCCA	0.428													11	54	---	---	---	---	PASS
LILRB4	11006	broad.mit.edu	37	19	55175367	55175367	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55175367G>T	uc002qgp.2	+	3	588	c.226G>T	c.(226-228)GAG>TAG	p.E76*	LILRB4_uc002qgo.1_Nonsense_Mutation_p.E117*|LILRB4_uc002qgq.2_Nonsense_Mutation_p.E76*|LILRB4_uc010ers.1_5'UTR|LILRB4_uc002qgr.2_Nonsense_Mutation_p.E117*|LILRB4_uc010ert.2_Nonsense_Mutation_p.E117*|LILRB4_uc010eru.2_Nonsense_Mutation_p.E105*	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,	76	Ig-like C2-type 1.|Extracellular (Potential).					integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)		GAACCCACTGGAGCCCAAGAA	0.572													45	127	---	---	---	---	PASS
ZNF667	63934	broad.mit.edu	37	19	56952734	56952734	+	Silent	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56952734G>A	uc002qnd.2	-	5	1792	c.1630C>T	c.(1630-1632)CTA>TTA	p.L544L	ZNF667_uc010etl.2_Silent_p.L326L|ZNF667_uc002qne.2_Silent_p.L544L|ZNF667_uc010etm.2_Silent_p.L487L	NM_022103	NP_071386	Q5HYK9	ZN667_HUMAN	zinc finger protein 667	544	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		CTTTCATGTAGAATAAGAGAT	0.433													34	51	---	---	---	---	PASS
ZNF548	147694	broad.mit.edu	37	19	57910055	57910055	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57910055G>C	uc002qom.2	+	3	650	c.400G>C	c.(400-402)GAT>CAT	p.D134H	ZNF547_uc002qpm.3_Intron|ZNF548_uc002qon.2_Missense_Mutation_p.D137H	NM_152909	NP_690873	Q8NEK5	ZN548_HUMAN	zinc finger protein 548	134					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TTCCAGAGGGGATGATTGGAT	0.458													19	50	---	---	---	---	PASS
ZCCHC3	85364	broad.mit.edu	37	20	279139	279139	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:279139G>T	uc002wdf.2	+	2	933	c.909G>T	c.(907-909)CTG>CTT	p.L303L	ZCCHC3_uc002wdg.2_RNA	NM_033089	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	304							nucleic acid binding|zinc ion binding				0		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			AGATCGAGCTGCGCCAGGGGG	0.637													16	39	---	---	---	---	PASS
PLCB1	23236	broad.mit.edu	37	20	8609072	8609072	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8609072G>T	uc002wnb.2	+	4	381	c.378G>T	c.(376-378)GTG>GTT	p.V126V	PLCB1_uc010zrb.1_Silent_p.V25V|PLCB1_uc010gbv.1_Silent_p.V126V|PLCB1_uc002wmz.1_Silent_p.V126V|PLCB1_uc002wna.2_Silent_p.V126V|PLCB1_uc002wnc.1_Silent_p.V25V	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1	126					activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						AAGAAGAAGTGGCCAAGGTAT	0.458													9	47	---	---	---	---	PASS
BFSP1	631	broad.mit.edu	37	20	17489584	17489584	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17489584G>A	uc002wpo.2	-	5	724	c.685C>T	c.(685-687)CGG>TGG	p.R229W	BFSP1_uc002wpp.2_Missense_Mutation_p.R104W|BFSP1_uc010zrn.1_Missense_Mutation_p.R90W|BFSP1_uc010zro.1_Missense_Mutation_p.R90W	NM_001195	NP_001186	Q12934	BFSP1_HUMAN	filensin isoform 1	229	Rod.|Coil 2.					cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens			central_nervous_system(1)	1						AGCACCTCCCGGCCCTCCTCC	0.642													3	11	---	---	---	---	PASS
ENTPD6	955	broad.mit.edu	37	20	25194014	25194014	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25194014G>T	uc002wuj.2	+	5	749	c.569G>T	c.(568-570)GGA>GTA	p.G190V	ENTPD6_uc010zsy.1_Missense_Mutation_p.G190V|ENTPD6_uc010gdj.1_Missense_Mutation_p.G162V|ENTPD6_uc010zsz.1_Intron|ENTPD6_uc002wum.2_Missense_Mutation_p.G173V|ENTPD6_uc010zta.1_Missense_Mutation_p.G190V|ENTPD6_uc002wun.2_Missense_Mutation_p.G190V|ENTPD6_uc002wuk.2_Missense_Mutation_p.G189V|ENTPD6_uc002wul.2_Missense_Mutation_p.G189V|ENTPD6_uc010ztb.1_Missense_Mutation_p.G162V|ENTPD6_uc010ztc.1_Missense_Mutation_p.G162V|ENTPD6_uc002wuo.2_5'UTR|ENTPD6_uc010ztd.1_5'UTR	NM_001247	NP_001238	O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6	190	Lumenal (Potential).					Golgi membrane|integral to membrane	nucleoside-diphosphatase activity				0						CTGTTACCTGGAGAAAAGGCC	0.552													19	44	---	---	---	---	PASS
C20orf186	149954	broad.mit.edu	37	20	31671639	31671639	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31671639C>A	uc010zue.1	+	3	651	c.636C>A	c.(634-636)CTC>CTA	p.L212L		NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor	212	Gly-rich.					cytoplasm|extracellular region	lipid binding				0						TGGGCGTGCTCGGCGAGGGTG	0.637													3	31	---	---	---	---	PASS
RALY	22913	broad.mit.edu	37	20	32660040	32660040	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32660040C>A	uc002xab.2	+	3	458	c.160C>A	c.(160-162)CAC>AAC	p.H54N	RALY_uc010zui.1_Missense_Mutation_p.H54N|RALY_uc002xac.2_Missense_Mutation_p.H54N|RALY_uc002xad.2_RNA|RALY_uc002xae.1_Missense_Mutation_p.H54N	NM_016732	NP_057951	Q9UKM9	RALY_HUMAN	RNA binding protein (autoantigenic,	54	RRM.					catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(1)	1						CTGTTCTGTGCACAAGGGCTA	0.562													21	46	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33338098	33338098	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33338098G>T	uc002xav.2	-	10	4471	c.1900C>A	c.(1900-1902)CAG>AAG	p.Q634K	NCOA6_uc002xaw.2_Missense_Mutation_p.Q634K	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	634	TBP/GTF2A-binding region.|NCOA1-binding region.|Gln-rich.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						TGGACCATCTGGCCCTGGGAG	0.587													18	53	---	---	---	---	PASS
CEP250	11190	broad.mit.edu	37	20	34053864	34053864	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34053864G>T	uc002xcm.2	+	8	998	c.327G>T	c.(325-327)AGG>AGT	p.R109S	CEP250_uc010zve.1_5'UTR|CEP250_uc010gfe.1_RNA|CEP250_uc010zvd.1_RNA|CEP250_uc002xco.2_5'Flank	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2	109	Potential.				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CCCAGTGCAGGTGTGAGAGTC	0.488													14	60	---	---	---	---	PASS
DLGAP4	22839	broad.mit.edu	37	20	35075090	35075090	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35075090G>T	uc002xff.2	+						DLGAP4_uc010zvp.1_Intron	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a						cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GCCTGCCTTTGCCTGGACAGG	0.637													9	24	---	---	---	---	PASS
EMILIN3	90187	broad.mit.edu	37	20	39991632	39991632	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39991632G>T	uc002xjy.1	-	4	801	c.577C>A	c.(577-579)CTG>ATG	p.L193M		NM_052846	NP_443078	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	193						proteinaceous extracellular matrix				ovary(1)	1		Myeloproliferative disorder(115;0.00425)				GTTTGAGCCAGGCGCTGGACA	0.627													6	20	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40944489	40944489	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40944489G>T	uc002xkg.2	-	12	2197	c.2013C>A	c.(2011-2013)GCC>GCA	p.A671A	PTPRT_uc010ggj.2_Silent_p.A671A	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	671	Extracellular (Potential).|Fibronectin type-III 4.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CAGGCAGGTTGGCAGGCTTCA	0.512													22	56	---	---	---	---	PASS
HNF4A	3172	broad.mit.edu	37	20	43030116	43030116	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43030116C>A	uc002xma.2	+	1	193	c.104C>A	c.(103-105)ACG>AAG	p.T35K	HNF4A_uc010zwo.1_Intron|HNF4A_uc002xlt.2_Intron|HNF4A_uc002xlu.2_Intron|HNF4A_uc002xlv.2_Intron|uc002xlw.1_Intron|HNF4A_uc002xly.2_Missense_Mutation_p.T35K|HNF4A_uc002xlz.2_Missense_Mutation_p.T35K|HNF4A_uc010ggq.2_5'UTR	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b	35					blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CAGGTGTTGACGATGGGCAAT	0.587													15	28	---	---	---	---	PASS
ZNF335	63925	broad.mit.edu	37	20	44594330	44594330	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44594330G>A	uc002xqw.2	-	7	1162	c.1039C>T	c.(1039-1041)CCC>TCC	p.P347S	ZNF335_uc010zxk.1_Missense_Mutation_p.P192S|ZNF335_uc002xqx.1_Missense_Mutation_p.P315S	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	347					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				CTCCTTCGGGGCCTTGGGGTA	0.662													12	24	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47248919	47248919	+	Silent	SNP	G	A	A	rs41283546		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47248919G>A	uc002xtw.1	-	35	4445	c.4422C>T	c.(4420-4422)AAC>AAT	p.N1474N	PREX1_uc002xtv.1_Silent_p.N771N	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	1474					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GCCCCTCCACGTTCTCCAGCA	0.667													13	87	---	---	---	---	PASS
CSE1L	1434	broad.mit.edu	37	20	47692046	47692046	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47692046C>A	uc002xty.2	+	12	1458	c.1324C>A	c.(1324-1326)CAA>AAA	p.Q442K	CSE1L_uc010zyg.1_Missense_Mutation_p.Q225K|CSE1L_uc010ghx.2_Missense_Mutation_p.Q386K|CSE1L_uc010ghy.2_Missense_Mutation_p.Q91K|CSE1L_uc010zyh.1_Missense_Mutation_p.Q91K	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein	442					apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			ATCAAAAGCCCAAACACAGAA	0.373													11	44	---	---	---	---	PASS
ZNFX1	57169	broad.mit.edu	37	20	47863852	47863852	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47863852G>T	uc002xui.2	-	14	5956	c.5709C>A	c.(5707-5709)GAC>GAA	p.D1903E		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1903							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TGTTGGCCGTGTCAGACCAGG	0.517													26	39	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60885757	60885757	+	Silent	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60885757G>T	uc002ycq.2	-	75	10477	c.10410C>A	c.(10408-10410)GGC>GGA	p.G3470G		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	3470	Laminin G-like 4.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCGGGAGGCCGCCCACAAAGA	0.711													3	14	---	---	---	---	PASS
COL9A3	1299	broad.mit.edu	37	20	61461872	61461872	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61461872C>A	uc002ydm.2	+	24	1222	c.1219C>A	c.(1219-1221)CAG>AAG	p.Q407K		NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor	407	Triple-helical region 3 (COL3).				axon guidance	collagen type IX					0	Breast(26;5.68e-08)					TCCCCAGGGCCAGAAGGGCAG	0.706													4	8	---	---	---	---	PASS
EEF1A2	1917	broad.mit.edu	37	20	62120333	62120333	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62120333A>G	uc002yfd.1	-	6	1303	c.1202T>C	c.(1201-1203)ATC>ACC	p.I401T	EEF1A2_uc002yfe.1_Missense_Mutation_p.I401T|EEF1A2_uc010gkg.1_Intron	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha	401						nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			CATCTCCACGATGGCCGCGTC	0.637													13	30	---	---	---	---	PASS
STMN3	50861	broad.mit.edu	37	20	62273640	62273640	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62273640G>T	uc002yfr.1	-	4	386	c.304C>A	c.(304-306)CAG>AAG	p.Q102K	STMN3_uc011abb.1_Missense_Mutation_p.Q102K	NM_015894	NP_056978	Q9NZ72	STMN3_HUMAN	SCG10-like-protein	102	Potential.				cytoplasmic microtubule organization|intracellular signal transduction|negative regulation of Rac protein signal transduction|neuron projection development|regulation of cytoskeleton organization|regulation of Rac GTPase activity	cytoplasm	protein domain specific binding				0	all_cancers(38;2.31e-11)|all_epithelial(29;7.76e-13)		Epithelial(9;1.9e-09)|all cancers(9;1.22e-08)|BRCA - Breast invasive adenocarcinoma(10;8.86e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.00559)			TTCAGCACCTGCGCCTCCTGC	0.736													4	6	---	---	---	---	PASS
KRTAP13-2	337959	broad.mit.edu	37	21	31744167	31744167	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31744167C>A	uc002ynz.3	-	1	391	c.365G>T	c.(364-366)TGT>TTT	p.C122F		NM_181621	NP_853652	Q52LG2	KR132_HUMAN	keratin associated protein 13-2	122						intermediate filament					0						ACTGGACCCACAGCCCACTGA	0.577													11	32	---	---	---	---	PASS
KRTAP19-3	337970	broad.mit.edu	37	21	31864270	31864270	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31864270G>T	uc002yog.1	-	1	6	c.6C>A	c.(4-6)AGC>AGA	p.S2R		NM_181609	NP_853640	Q7Z4W3	KR193_HUMAN	keratin associated protein 19-3	2						intermediate filament					0						TGCCGTAGTAGCTCATGGTGT	0.547													42	87	---	---	---	---	PASS
MICAL3	57553	broad.mit.edu	37	22	18301125	18301125	+	Silent	SNP	G	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18301125G>A	uc002zng.3	-	26	4655	c.4302C>T	c.(4300-4302)TCC>TCT	p.S1434S	MICAL3_uc011agl.1_Silent_p.S1350S|MICAL3_uc010gre.1_5'Flank	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin	1434	Pro-rich.					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		TCATGTTGGAGGAGCTCCCGT	0.711													11	33	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21107265	21107265	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21107265C>A	uc002zsz.3	-	25	2970	c.2739G>T	c.(2737-2739)CTG>CTT	p.L913L		NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	913					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			AGTTCACCAACAGGAACTGAG	0.507													19	111	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26164321	26164321	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26164321G>C	uc003abz.1	+	4	688	c.438G>C	c.(436-438)AGG>AGC	p.R146S	MYO18B_uc003aca.1_Missense_Mutation_p.R27S|MYO18B_uc010guy.1_Missense_Mutation_p.R27S|MYO18B_uc010guz.1_Missense_Mutation_p.R27S|MYO18B_uc011aka.1_5'UTR|MYO18B_uc011akb.1_5'Flank	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	146						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						CCTTCAAGAGGGGCGTGAGGA	0.597													6	12	---	---	---	---	PASS
THOC5	8563	broad.mit.edu	37	22	29938946	29938946	+	Splice_Site	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29938946C>A	uc003afr.2	-	6	690	c.355_splice	c.e6-1	p.A119_splice	THOC5_uc003afs.2_Splice_Site_p.A119_splice|THOC5_uc003aft.2_Splice_Site_p.A119_splice|THOC5_uc003afu.2_Splice_Site_p.A119_splice|THOC5_uc010gvo.2_Splice_Site|THOC5_uc003afv.1_Splice_Site_p.A119_splice|THOC5_uc003afw.1_Intron	NM_001002878	NP_001002878	Q13769	THOC5_HUMAN	THO complex 5						intronless viral mRNA export from host nucleus|monocyte differentiation|mRNA processing|primitive hemopoiesis|RNA splicing	cytoplasm|intermediate filament cytoskeleton|THO complex part of transcription export complex	protein binding|RNA binding			breast(3)	3						TCTGCTTAGCCTGAAAGGAAA	0.458													5	13	---	---	---	---	PASS
RNF215	200312	broad.mit.edu	37	22	30782755	30782755	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30782755G>T	uc003ahp.2	-						RNF215_uc011akw.1_5'UTR	NM_001017981	NP_001017981	Q9Y6U7	RN215_HUMAN	ring finger protein 215							integral to membrane	zinc ion binding			central_nervous_system(1)	1						CCATCTGTGTGGCAAGGGGCC	0.632													11	20	---	---	---	---	PASS
TCN2	6948	broad.mit.edu	37	22	31008891	31008891	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31008891C>A	uc003aip.1	+	3	447	c.289C>A	c.(289-291)CAG>AAG	p.Q97K	TCN2_uc003aiq.1_Missense_Mutation_p.Q93K|TCN2_uc003air.1_Missense_Mutation_p.Q97K	NM_000355	NP_000346	P20062	TCO2_HUMAN	transcobalamin II precursor	97					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CGGTGACTGCCAGGGCAAGCC	0.597													7	25	---	---	---	---	PASS
RFPL2	10739	broad.mit.edu	37	22	32587046	32587046	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32587046C>A	uc003amg.3	-	5	1786	c.850G>T	c.(850-852)GGA>TGA	p.G284*	RFPL2_uc003ame.3_Nonsense_Mutation_p.G223*|RFPL2_uc003amf.3_Nonsense_Mutation_p.G194*|RFPL2_uc003amh.3_Nonsense_Mutation_p.G194*	NM_001098527	NP_001091997	O75678	RFPL2_HUMAN	ret finger protein-like 2 isoform 2	284	B30.2/SPRY.						zinc ion binding			skin(1)	1						AGGCGGCCTCCATCCCTCAAA	0.552													17	44	---	---	---	---	PASS
TXN2	25828	broad.mit.edu	37	22	36876629	36876629	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36876629G>T	uc003apk.1	-	2	333	c.256C>A	c.(256-258)CAC>AAC	p.H86N	TXN2_uc003apl.1_RNA	NM_012473	NP_036605	Q99757	THIOM_HUMAN	thioredoxin 2 precursor	86	Thioredoxin.				cell redox homeostasis|electron transport chain|glycerol ether metabolic process|transport	mitochondrion|nucleolus	electron carrier activity				0						CACTGTGCGTGGAAATCCACA	0.363													15	55	---	---	---	---	PASS
CYTH4	27128	broad.mit.edu	37	22	37697068	37697068	+	Intron	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37697068G>T	uc003arf.2	+						CYTH4_uc003are.2_Intron|CYTH4_uc011amw.1_Intron|CYTH4_uc010gxe.2_Intron	NM_013385	NP_037517	Q9UIA0	CYH4_HUMAN	cytohesin 4						regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						CAGGTGCCAGGAGGGGAGTGG	0.637													5	9	---	---	---	---	PASS
TAB1	10454	broad.mit.edu	37	22	39824059	39824059	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39824059C>A	uc003axt.2	+	10	1227	c.1178C>A	c.(1177-1179)CCA>CAA	p.P393Q	TAB1_uc003axr.2_Missense_Mutation_p.P469Q|TAB1_uc011aok.1_Missense_Mutation_p.P227Q|TAB1_uc003axu.1_Missense_Mutation_p.P393Q	NM_006116	NP_006107	Q15750	TAB1_HUMAN	mitogen-activated protein kinase kinase kinase 7	393					activation of MAPK activity|activation of MAPKKK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane	catalytic activity|protein binding			breast(1)	1						GTGTCTGTGCCATACTCCAGC	0.622													12	26	---	---	---	---	PASS
RRP7A	27341	broad.mit.edu	37	22	42912112	42912112	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42912112C>A	uc003bcq.2	-	3	263	c.247G>T	c.(247-249)GGC>TGC	p.G83C	SERHL_uc011apm.1_Intron|RRP7A_uc003bcp.2_Missense_Mutation_p.G106C	NM_015703	NP_056518	Q9Y3A4	RRP7A_HUMAN	ribosomal RNA processing 7 homolog A	83	RRM.						nucleotide binding|RNA binding			central_nervous_system(1)|skin(1)	2						TGGACGAGGCCACAGGTGGAC	0.612													7	12	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50720445	50720445	+	Silent	SNP	A	C	C			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50720445A>C	uc003bkv.3	-	20	3289	c.3183T>G	c.(3181-3183)CCT>CCG	p.P1061P	PLXNB2_uc003bkt.1_5'UTR|PLXNB2_uc003bku.1_Silent_p.P46P	NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	1061	IPT/TIG 3.|Extracellular (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CTGGCTCCTCAGGCACAGCCG	0.642													7	24	---	---	---	---	PASS
STS	412	broad.mit.edu	37	X	7177396	7177396	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7177396G>T	uc004cry.3	+	5	649	c.404G>T	c.(403-405)TGG>TTG	p.W135L		NM_000351	NP_000342	P08842	STS_HUMAN	steryl-sulfatase precursor	135	Lumenal.				female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)	TCAGGGAAATGGCACCTTGGG	0.453									Ichthyosis				19	10	---	---	---	---	PASS
FANCB	2187	broad.mit.edu	37	X	14861742	14861742	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14861742C>A	uc004cwg.1	-	10	2795	c.2527G>T	c.(2527-2529)GCT>TCT	p.A843S	FANCB_uc004cwh.1_Missense_Mutation_p.A843S	NM_001018113	NP_001018123	Q8NB91	FANCB_HUMAN	Fanconi anemia complementation group B	843					DNA repair	nucleoplasm				lung(1)	1	Hepatocellular(33;0.183)					TGAACCTCAGCTACTTTCAAA	0.313								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				49	22	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	28807481	28807481	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:28807481C>A	uc004dby.2	+	2	529	c.21C>A	c.(19-21)CAC>CAA	p.H7Q		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	7					innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						CGATTCCACACTTGATTCTCT	0.353													24	14	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123654528	123654528	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123654528G>T	uc004euj.2	-	18	3204	c.3140C>A	c.(3139-3141)TCA>TAA	p.S1047*	ODZ1_uc011muj.1_Nonsense_Mutation_p.S1046*|ODZ1_uc010nqy.2_Nonsense_Mutation_p.S1047*	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1047	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						AGGAATCGTTGAATGTGTCAG	0.502													42	12	---	---	---	---	PASS
BCORL1	63035	broad.mit.edu	37	X	129139248	129139248	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129139248G>T	uc004evb.1	+	2	155	c.41G>T	c.(40-42)TGG>TTG	p.W14L		NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	14					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						GTGCACAACTGGACCAGTTCT	0.592													43	32	---	---	---	---	PASS
MAGEC2	51438	broad.mit.edu	37	X	141291533	141291533	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:141291533C>T	uc004fbu.1	-	3	589	c.241G>A	c.(241-243)GAG>AAG	p.E81K		NM_016249	NP_057333	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	81						cytoplasm|nucleus				breast(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					GGAATGCTCTCGGTAAGATTT	0.388										HNSCC(46;0.14)			6	24	---	---	---	---	PASS
RPL10	6134	broad.mit.edu	37	X	153627841	153627841	+	Silent	SNP	C	A	A			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153627841C>A	uc004fkm.2	+	4	284	c.96C>A	c.(94-96)CGC>CGA	p.R32R	uc010nuv.1_5'Flank|RPL10_uc004fko.2_Silent_p.R32R|RPL10_uc004fkn.1_Silent_p.R32R|RPL10_uc004fkp.1_Silent_p.R32R|RPL10_uc004fkq.1_RNA|RPL10_uc004fkr.1_5'Flank|SNORA70_uc010nux.1_5'Flank	NM_006013	NP_006004	P27635	RL10_HUMAN	ribosomal protein L10	32					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|endoplasmic reticulum	structural constituent of ribosome				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCAAGATTCGCATTTTTGACC	0.527											OREG0019957	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	71	---	---	---	---	PASS
GAB3	139716	broad.mit.edu	37	X	153940624	153940624	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153940624G>T	uc004fmj.1	-	4	994	c.946C>A	c.(946-948)CAT>AAT	p.H316N	GAB3_uc004fmk.1_Missense_Mutation_p.H317N|GAB3_uc010nve.1_Missense_Mutation_p.H317N|GAB3_uc004fml.1_Intron	NM_080612	NP_542179	Q8WWW8	GAB3_HUMAN	Gab3 protein isoform 2	316										ovary(1)	1	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TCAGACAGATGGCTTGGCTTA	0.498													36	26	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12405431	12405432	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12405431_12405432delAC	uc001atv.2	+	43	9027_9028	c.8886_8887delAC	c.(8884-8889)AGACACfs	p.R2962fs	VPS13D_uc001atw.2_Frame_Shift_Del_p.R2937fs|VPS13D_uc001atx.2_Frame_Shift_Del_p.R2149fs	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	2961_2962					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TGCCTGACAGACACACCCATGA	0.426													61	35	---	---	---	---	
RSPO1	284654	broad.mit.edu	37	1	38078272	38078272	+	3'UTR	DEL	G	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38078272delG	uc001cbl.1	-	8					RSPO1_uc001cbm.1_3'UTR|RSPO1_uc009vvf.1_3'UTR|RSPO1_uc009vvg.1_3'UTR	NM_001038633	NP_001033722	Q2MKA7	RSPO1_HUMAN	R-spondin1 precursor						positive regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization		heparin binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TATGTGGACAGGGGTTTGAGC	0.333													19	14	---	---	---	---	
BCAS2	10286	broad.mit.edu	37	1	115110989	115110990	+	Intron	INS	-	T	T	rs149306367		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115110989_115110990insT	uc001efa.2	-						DENND2C_uc001eez.2_Intron	NM_005872	NP_005863	O75934	SPF27_HUMAN	breast carcinoma amplified sequence 2						mRNA processing|RNA splicing, via transesterification reactions	nucleolus|spliceosomal complex	protein binding			large_intestine(1)	1	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTAACCTTCACttttttttttt	0.149													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	243251423	243251423	+	RNA	DEL	A	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243251423delA	uc001hzq.1	-	8		c.1209delT								Homo sapiens cDNA FLJ52610 complete cds.																		actccatctcaaaaaaaaaaa	0.179													4	2	---	---	---	---	
AHCTF1	25909	broad.mit.edu	37	1	247031205	247031207	+	Intron	DEL	ACA	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247031205_247031207delACA	uc001ibu.1	-						AHCTF1_uc001ibv.1_Intron|AHCTF1_uc009xgs.1_Intron|AHCTF1_uc001ibw.1_Intron	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS						cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CCCCCCCCCcacacacacacaca	0.222													4	2	---	---	---	---	
ITSN2	50618	broad.mit.edu	37	2	24553641	24553641	+	Intron	DEL	T	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24553641delT	uc002rfe.2	-						ITSN2_uc002rff.2_Intron|ITSN2_uc002rfg.2_Intron|ITSN2_uc010eyd.2_Intron	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1						endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCAttttacttttttttttt	0.119													4	3	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54131014	54131015	+	Intron	INS	-	T	T	rs72533956		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54131014_54131015insT	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			attaaaaaaaagaacagatatg	0.069													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	61816705	61816705	+	IGR	DEL	G	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61816705delG								XPO1 (51287 upstream) : FAM161A (235280 downstream)																							CCATATTTCTGGATCAGACTG	0.483													9	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96652817	96652818	+	Intron	DEL	AA	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96652817_96652818delAA	uc010yug.1	-											Homo sapiens cDNA FLJ54441 complete cds, highly similar to Homo sapiens ankyrin repeat domain 36 (ANKRD36), mRNA.																		TCTCATGCTCAAAAAGAGTCAG	0.406													4	2	---	---	---	---	
CPS1	1373	broad.mit.edu	37	2	211542446	211542446	+	Intron	DEL	G	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211542446delG	uc002vee.3	+						CPS1_uc010fur.2_Intron|CPS1_uc010fus.2_Intron	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b						carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CCCATGGTGAGGTCTGAGACA	0.373													11	15	---	---	---	---	
DNAH12	201625	broad.mit.edu	37	3	57493928	57493928	+	Intron	DEL	A	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57493928delA	uc003dit.2	-						DNAH12_uc003diu.2_Intron	NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						aaaaaaaaacaaaaaaaaaaa	0.119													4	4	---	---	---	---	
RAPGEF2	9693	broad.mit.edu	37	4	160259361	160259361	+	Intron	DEL	A	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160259361delA	uc003iqg.3	+							NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2						cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CATGAGCTGCAAAAAAAAAAT	0.279													4	2	---	---	---	---	
DDX60	55601	broad.mit.edu	37	4	169145281	169145281	+	Intron	DEL	T	-	-	rs76603259		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169145281delT	uc003irp.2	-						DDX60_uc003iro.2_Intron	NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TACACCCAGATTTTTTTTTTC	0.363													6	3	---	---	---	---	
SLC35F1	222553	broad.mit.edu	37	6	118606159	118606160	+	Intron	INS	-	T	T	rs143802435	by1000genomes	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118606159_118606160insT	uc003pxx.3	+						SLC35F1_uc003pxy.1_Intron	NM_001029858	NP_001025029	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1						transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)		TTCACACTTAATTTTTTTTAAT	0.356											OREG0017635	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	5	---	---	---	---	
NKAIN2	154215	broad.mit.edu	37	6	124676216	124676217	+	Intron	INS	-	AAA	AAA	rs55912345		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124676216_124676217insAAA	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304	Q5VXU1	NKAI2_HUMAN	T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)		actttgtcattaaaaaaaaaaa	0.124													4	2	---	---	---	---	
PPIL4	85313	broad.mit.edu	37	6	149813468	149813468	+	Intron	DEL	T	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149813468delT	uc010kic.2	-							NM_139126		Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase-like 4						protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		ttttcttttcttttttttttt	0.289													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152734821	152734822	+	Intron	INS	-	G	G	rs138384898	by1000genomes	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152734821_152734822insG	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAATGGAAAAAGTACTTTTAAA	0.287										HNSCC(10;0.0054)			6	3	---	---	---	---	
SLC26A4	5172	broad.mit.edu	37	7	107315731	107315731	+	Intron	DEL	A	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107315731delA	uc003vep.2	+							NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin						regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						ctcatctcttaaaaaaaaaaa	0.000									Pendred_syndrome				7	4	---	---	---	---	
KLHDC10	23008	broad.mit.edu	37	7	129760949	129760950	+	Intron	INS	-	T	T	rs145009695	by1000genomes	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129760949_129760950insT	uc003vpj.1	+						KLHDC10_uc003vpk.1_Intron|KLHDC10_uc010lmb.1_Intron	NM_014997	NP_055812	Q6PID8	KLD10_HUMAN	kelch domain containing 10												0						cctttcttttctttttttttcA	0.287													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142223659	142223659	+	Intron	DEL	A	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142223659delA	uc011krp.1	+						uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		ATGTTTTAAGAAAATAGTTCA	0.388													5	4	---	---	---	---	
RHPN1	114822	broad.mit.edu	37	8	144457734	144457745	+	In_Frame_Del	DEL	CCTGACGCAGAT	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144457734_144457745delCCTGACGCAGAT	uc003yyb.2	+	2	205_216	c.72_83delCCTGACGCAGAT	c.(70-84)TCCCTGACGCAGATC>TCC	p.LTQI25del		NM_052924	NP_443156	Q8TCX5	RHPN1_HUMAN	rhophilin 1	25_28					signal transduction	intracellular				large_intestine(1)	1	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			GCTGTGACTCCCTGACGCAGATCCAGTGCGGC	0.665													6	3	---	---	---	---	
C8orf73	642475	broad.mit.edu	37	8	144652393	144652394	+	Intron	INS	-	CCCTCCTCA	CCCTCCTCA	rs147017186	by1000genomes	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144652393_144652394insCCCTCCTCA	uc010mff.2	-						C8orf73_uc010mfg.1_Intron	NM_001100878	NP_001094348	A6NGR9	CH073_HUMAN	hypothetical protein LOC642475								binding			ovary(1)	1	all_cancers(97;6.49e-11)|all_epithelial(106;4.73e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.014)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CACCCTGGGGCCCCTCCTCACC	0.673													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69440235	69440236	+	Frame_Shift_Ins	INS	-	TA	TA			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69440235_69440236insTA	uc010mnx.1	+	3	488_489	c.319_320insTA	c.(319-321)CTAfs	p.L107fs		NM_001098806	NP_001092276			coiled-coil domain containing 29																		AATTAGTAAACTACAAGAATAT	0.292													32	21	---	---	---	---	
NXNL2	158046	broad.mit.edu	37	9	91150746	91150747	+	Intron	INS	-	C	C	rs150222723	by1000genomes	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91150746_91150747insC	uc011ltj.1	+						NXNL2_uc004aqa.2_Intron	NM_001161625	NP_001155097	Q5VZ03	NXNL2_HUMAN	nucleoredoxin-like 2 isoform 1												0						TCTTTATGACGCCCCCCCCCAA	0.559													4	2	---	---	---	---	
C9orf98	158067	broad.mit.edu	37	9	135690206	135690206	+	Intron	DEL	A	-	-	rs140406073		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135690206delA	uc004cbu.1	-						C9orf98_uc010mzx.1_Intron|C9orf98_uc004cbv.1_Intron	NM_152572	NP_689785	Q96MA6	KAD8_HUMAN	putative adenylate kinase-like protein C9orf98							cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)		CTGCTGAGGGAAAAAAAAAAG	0.393													4	2	---	---	---	---	
WDR11	55717	broad.mit.edu	37	10	122619467	122619468	+	Intron	DEL	AC	-	-	rs3217470		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122619467_122619468delAC	uc010qtf.1	+						WDR11_uc010qte.1_Intron|WDR11_uc001lfd.1_Intron	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2							integral to membrane					0						GAATATTGATacacacacacac	0.238													3	3	---	---	---	---	
DDX12	440081	broad.mit.edu	37	12	9571594	9571595	+	Intron	DEL	CC	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9571594_9571595delCC	uc010sgs.1	-						DDX12_uc001qvx.3_Intron|DDX12_uc001qvy.1_3'UTR	NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						CCCATGGCGACCCCCCCTCACC	0.599													5	3	---	---	---	---	
LOH12CR1	118426	broad.mit.edu	37	12	12510571	12510571	+	Intron	DEL	A	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12510571delA	uc001ral.2	+						LOH12CR1_uc009zhu.2_Intron|LOH12CR2_uc001rak.2_5'Flank	NM_058169	NP_477517	Q969J3	L12R1_HUMAN	LOH1CR12											ovary(1)	1		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.0205)		TGCTAGTAGGAAAAAAAAAAA	0.572													4	2	---	---	---	---	
FOXN4	121643	broad.mit.edu	37	12	109723079	109723080	+	Intron	INS	-	GC	GC	rs10774644		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109723079_109723080insGC	uc001toe.3	-						FOXN4_uc009zvg.2_Intron|FOXN4_uc001tof.3_Intron	NM_213596	NP_998761	Q96NZ1	FOXN4_HUMAN	forkhead box N4						axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|lung(1)	2						tgtgtgtgtgtgCGCGCACTGC	0.500													4	2	---	---	---	---	
ATG2B	55102	broad.mit.edu	37	14	96772926	96772927	+	Intron	DEL	AA	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96772926_96772927delAA	uc001yfi.2	-							NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B											ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		ATAGTATATTAAAAAAAAAAAA	0.307													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9250217	9250217	+	IGR	DEL	G	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9250217delG								C16orf72 (36672 upstream) : GRIN2A (597050 downstream)																							ttttttttttGTAGCCCAGAG	0.368													4	3	---	---	---	---	
CP110	9738	broad.mit.edu	37	16	19553060	19553063	+	Intron	DEL	GAAG	-	-	rs149433681		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19553060_19553063delGAAG	uc002dgl.3	+						CP110_uc002dgk.3_Intron			O43303	CP110_HUMAN	RecName: Full=Centrosomal protein of 110 kDa;          Short=Cep110;						centriole replication|G2/M transition of mitotic cell cycle|regulation of cytokinesis	centriole|cytosol	protein binding				0						AGGGAAGGGAGAAGGAAGGAAGGA	0.196													1	6	---	---	---	---	
CHMP1A	5119	broad.mit.edu	37	16	89724077	89724090	+	5'UTR	DEL	ACCGACCAAGCTGC	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89724077_89724090delACCGACCAAGCTGC	uc002fnu.2	-	1					CHMP1A_uc002fnv.2_5'UTR|C16orf55_uc002fnw.1_5'Flank|C16orf55_uc002fnx.3_5'Flank|C16orf55_uc010vpk.1_5'Flank|C16orf55_uc002fny.1_5'Flank	NM_002768	NP_002759	Q9HD42	CHM1A_HUMAN	chromatin modifying protein 1A isoform 2						cell division|gene silencing|mitotic chromosome condensation|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription by glucose|protein transport|transcription, DNA-dependent|vesicle-mediated transport	condensed nuclear chromosome|early endosome|endomembrane system|endosome membrane|microtubule organizing center|nuclear matrix	metallopeptidase activity|protein domain specific binding|zinc ion binding				0		all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.048)		CGGCGATCGAACCGACCAAGCTGCACCCGGCGGG	0.645													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25755770	25755771	+	Intron	INS	-	T	T			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25755770_25755771insT	uc002gzg.2	+											Homo sapiens similar to ubiquitin specific protease 6, mRNA (cDNA clone IMAGE:5168266), with apparent retained intron.																		GCATGGGGACCTGCCACCCCCA	0.450													40	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	46754509	46754512	+	IGR	DEL	CCTT	-	-	rs143755906		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46754509_46754512delCCTT								MIR196A1 (44588 upstream) : PRAC (44580 downstream)																							ttccttcctcccttccttccttcc	0.005													3	3	---	---	---	---	
TBX4	9496	broad.mit.edu	37	17	59561014	59561015	+	3'UTR	DEL	TA	-	-	rs77924694		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59561014_59561015delTA	uc002izi.2	+	8					TBX4_uc010ddo.2_3'UTR|TBX4_uc010woy.1_3'UTR	NM_018488	NP_060958	P57082	TBX4_HUMAN	T-box 4						leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						tgtgtgtgtgtATACACGAGCA	0.327													4	2	---	---	---	---	
DPM1	8813	broad.mit.edu	37	20	49565355	49565355	+	Intron	DEL	A	-	-	rs76899294		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49565355delA	uc002xvw.1	-						DPM1_uc002xvv.1_5'Flank|DPM1_uc002xvx.1_Intron	NM_003859	NP_003850	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase 1						C-terminal protein lipidation|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|protein N-linked glycosylation via asparagine|protein O-linked mannosylation	dolichol-phosphate-mannose synthase complex|endoplasmic reticulum membrane|membrane fraction	dolichyl-phosphate beta-D-mannosyltransferase activity|dolichyl-phosphate-mannose-protein mannosyltransferase activity|protein binding			ovary(1)	1						TTGCCAAAAGAAAAAAAAAAG	0.189													4	4	---	---	---	---	
GTPBP5	26164	broad.mit.edu	37	20	60775592	60775593	+	Intron	INS	-	AAAT	AAAT	rs146828134	by1000genomes	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60775592_60775593insAAAT	uc002yce.3	+						GTPBP5_uc011aab.1_Intron|GTPBP5_uc011aac.1_Intron|GTPBP5_uc011aad.1_Intron|GTPBP5_uc011aae.1_Intron|GTPBP5_uc011aaf.1_Intron	NM_015666	NP_056481	Q9H4K7	GTPB5_HUMAN	GTP binding protein 5						ribosome biogenesis	mitochondrion	GTP binding|GTPase activity|magnesium ion binding				0	Breast(26;3.52e-09)		BRCA - Breast invasive adenocarcinoma(19;2.5e-08)			TCAGTTCAAGGCGTTCCTTGAA	0.540													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9766147	9766147	+	Intron	DEL	T	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9766147delT	uc011abu.1	+											Homo sapiens, clone IMAGE:4720764, mRNA.																		CCTATAGCAGttttttttttt	0.194													7	6	---	---	---	---	
C21orf45	54069	broad.mit.edu	37	21	33642573	33642574	+	Intron	INS	-	A	A	rs11397095		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33642573_33642574insA	uc002ypi.2	-							NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45						cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0						GAGGTCAAAGCAAAAAAAAAAA	0.287													8	5	---	---	---	---	
TRAPPC10	7109	broad.mit.edu	37	21	45499777	45499777	+	Intron	DEL	A	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45499777delA	uc002zea.2	+						TRAPPC10_uc010gpo.2_Intron|TRAPPC10_uc011afa.1_5'Flank	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						CTAGTAACTTAAAAAAAAAAA	0.388													4	2	---	---	---	---	
AP1B1	162	broad.mit.edu	37	22	29763327	29763328	+	Intron	INS	-	GGA	GGA	rs5844847		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29763327_29763328insGGA	uc003afj.2	-						AP1B1_uc003afi.2_5'Flank|AP1B1_uc003afk.2_Intron|AP1B1_uc003afl.2_Intron	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						ATGGTGCAGAGGGAGGAGAAGG	0.436													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	42384501	42384501	+	IGR	DEL	A	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:42384501delA								CASK (602214 upstream) : PPP1R2P9 (252118 downstream)																							ttgtctcaggaaaaaaaaaaa	0.149													4	2	---	---	---	---	
DGKK	139189	broad.mit.edu	37	X	50165595	50165596	+	Intron	INS	-	AC	AC	rs59226442		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50165595_50165596insAC	uc010njr.1	-							NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					TTAAAAGGTAAacacacacaca	0.317													4	2	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53652847	53652852	+	Intron	DEL	GCCGGT	-	-	rs11091285	by1000genomes	TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53652847_53652852delGCCGGT	uc004dsp.2	-							NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						cggggccggggccggtgccgggactg	0.199													2	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13500860	13500860	+	IGR	DEL	G	-	-	rs76607402		TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13500860delG								None (None upstream) : None (None downstream)																							TGATTTCTAAGACTTTTGAAA	0.274													5	4	---	---	---	---	
DDX3Y	8653	broad.mit.edu	37	Y	15029495	15029495	+	Intron	DEL	C	-	-			TCGA-22-5472-01A-01D-1632-08	TCGA-22-5472-11A-11D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:15029495delC	uc004fsu.1	+						DDX3Y_uc004fsv.2_Intron|DDX3Y_uc010nww.1_Intron|DDX3Y_uc011nar.1_Intron	NM_001122665	NP_001116137	O15523	DDX3Y_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 3,							cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|RNA binding				0						ttttgtttttctttttttttt	0.229													6	3	---	---	---	---	
