Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRAMEF1	65121	broad.mit.edu	37	1	12853509	12853509	+	Missense_Mutation	SNP	A	C	C	rs148996974	by1000genomes	TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12853509A>C	uc001auj.1	+	2	236	c.133A>C	c.(133-135)AGC>CGC	p.S45R		NM_023013	NP_075389	O95521	PRAM1_HUMAN	PRAME family member 1	45											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGAGGCCTTCAGCAGGAGACA	0.587													4	125	---	---	---	---	PASS
DDI2	84301	broad.mit.edu	37	1	15956822	15956822	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15956822T>G	uc001awx.1	+	3	367	c.271T>G	c.(271-273)TTA>GTA	p.L91V	DDI2_uc001aww.2_Missense_Mutation_p.L91V|DDI2_uc009voj.1_5'UTR	NM_032341	NP_115717	Q5TDH0	DDI2_HUMAN	DNA-damage inducible protein 2	91					proteolysis		aspartic-type endopeptidase activity				0		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00327)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.03e-07)|COAD - Colon adenocarcinoma(227;4.48e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		CCCAACAGACTTACCCCGAAT	0.463													19	82	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39797858	39797858	+	Silent	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39797858A>G	uc010oiu.1	+	1	1049	c.918A>G	c.(916-918)CTA>CTG	p.L306L	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	1871	Plectin 5.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	p.L306V(1)		ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAGATGCCCTAGAACAAGGTA	0.458													42	30	---	---	---	---	PASS
MFSD2A	84879	broad.mit.edu	37	1	40420981	40420981	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40420981G>T	uc001cev.2	+	1	198	c.17G>T	c.(16-18)GGC>GTC	p.G6V	MFSD2A_uc010ojb.1_Missense_Mutation_p.G6V|MFSD2A_uc001ceu.2_Missense_Mutation_p.G6V|MFSD2A_uc010ojc.1_5'UTR|MFSD2A_uc009vvy.2_RNA|MFSD2A_uc001cew.1_Missense_Mutation_p.G6V	NM_001136493	NP_001129965	Q8NA29	MFS2A_HUMAN	major facilitator superfamily domain containing	6					transmembrane transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)|pancreas(1)	2						AAAGGAGAAGGCGCCGAGAGC	0.716													6	4	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43774787	43774787	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43774787C>T	uc001ciu.2	+	8	1252	c.1173C>T	c.(1171-1173)GAC>GAT	p.D391D	TIE1_uc010okd.1_Silent_p.D391D|TIE1_uc010oke.1_Silent_p.D346D|TIE1_uc009vwq.2_Silent_p.D347D|TIE1_uc010okf.1_Silent_p.D36D|TIE1_uc010okg.1_Silent_p.D36D|TIE1_uc010okc.1_Intron	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	391	Ig-like C2-type 2.|Extracellular (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GCAAGCCAGACGGCACTGTGC	0.617													16	9	---	---	---	---	PASS
EVI5	7813	broad.mit.edu	37	1	93091411	93091411	+	Missense_Mutation	SNP	T	G	G	rs137964507		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93091411T>G	uc001dox.2	-	13	1570	c.1560A>C	c.(1558-1560)GAA>GAC	p.E520D	EVI5_uc010otf.1_Missense_Mutation_p.E531D|EVI5_uc001doy.1_RNA	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5	520	Targeting to the centrosomes.|Potential.|Dimerization.|Interaction with AURKB and INCENP.				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		CCATAATGGCTTCTGCTTCTC	0.348													23	77	---	---	---	---	PASS
NTNG1	22854	broad.mit.edu	37	1	107950333	107950333	+	Intron	SNP	A	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107950333A>C	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvi.2_Intron|NTNG1_uc001dve.2_Intron|NTNG1_uc009wek.2_Intron|NTNG1_uc001dvg.2_Intron|NTNG1_uc009wem.2_Intron|NTNG1_uc001dvd.1_Missense_Mutation_p.K364Q	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		TATTGGTAGTAAGTAAAAACA	0.328													8	53	---	---	---	---	PASS
NOS1AP	9722	broad.mit.edu	37	1	162335234	162335234	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162335234C>G	uc001gbv.2	+	9	1367	c.980C>G	c.(979-981)GCG>GGG	p.A327G	NOS1AP_uc010pks.1_RNA|NOS1AP_uc001gbw.2_Missense_Mutation_p.A322G|NOS1AP_uc009wut.1_Missense_Mutation_p.A32G	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor	327	Potential.				regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			GAGGCTGCGGCGCGGCTGGAG	0.587													17	60	---	---	---	---	PASS
GLUL	2752	broad.mit.edu	37	1	182353685	182353685	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182353685G>C	uc001gpa.1	-	7	1189	c.977C>G	c.(976-978)CCC>CGC	p.P326R	GLUL_uc010pnt.1_Missense_Mutation_p.P113R|GLUL_uc001gpb.1_Missense_Mutation_p.P326R|GLUL_uc001gpc.1_Missense_Mutation_p.P326R|GLUL_uc001gpd.1_Missense_Mutation_p.P326R	NM_001033056	NP_001028228	P15104	GLNA_HUMAN	glutamine synthetase	326					cell proliferation|glutamine biosynthetic process|neurotransmitter uptake	cytosol|Golgi apparatus|mitochondrion	ATP binding|glutamate decarboxylase activity|glutamate-ammonia ligase activity|identical protein binding				0					Asparaginase(DB00023)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)|L-Methionine(DB00134)	AACAGTCCGGGGAATGCGTAT	0.552													8	34	---	---	---	---	PASS
C1orf14	81626	broad.mit.edu	37	1	182909662	182909662	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182909662T>C	uc001gpu.2	-	3	857	c.572A>G	c.(571-573)TAC>TGC	p.Y191C	C1orf14_uc001gpv.2_Missense_Mutation_p.Y72C|C1orf14_uc010pnz.1_Missense_Mutation_p.Y49C|C1orf14_uc001gpw.2_Translation_Start_Site	NM_030933	NP_112195	Q9BZQ2	SHP1L_HUMAN	chromosome 1 open reading frame 14	263											0				Colorectal(1306;1.64e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00267)		TGAGTCTTGGTATGGTTCACA	0.333													26	24	---	---	---	---	PASS
C1orf25	81627	broad.mit.edu	37	1	185114649	185114649	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185114649T>C	uc001grf.3	-	5	849	c.577A>G	c.(577-579)ATC>GTC	p.I193V	C1orf25_uc010pon.1_Missense_Mutation_p.I37V	NM_030934	NP_112196	Q7Z2T5	TRM1L_HUMAN	N2,N2-dimethylguanosine tRNA	193	C2H2-type.					intracellular	RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding				0						CTTCTGGTGATTGTTGCTGAA	0.338													48	111	---	---	---	---	PASS
F13B	2165	broad.mit.edu	37	1	197030140	197030140	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197030140T>G	uc001gtt.1	-	4	561	c.517A>C	c.(517-519)AAG>CAG	p.K173Q		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	173	Sushi 3.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						ACTTTGTCCTTCACTTTGAAT	0.338													14	64	---	---	---	---	PASS
CAMSAP1L1	23271	broad.mit.edu	37	1	200784772	200784772	+	Silent	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200784772G>A	uc001gvl.2	+	4	915	c.645G>A	c.(643-645)AAG>AAA	p.K215K	CAMSAP1L1_uc001gvk.2_Silent_p.K215K|CAMSAP1L1_uc001gvm.2_Silent_p.K215K	NM_203459	NP_982284	Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein	215	CH.					cytoplasm|microtubule	protein binding			ovary(2)|large_intestine(1)|pancreas(1)	4						GAGGTCAAAAGGTATTTATTT	0.264													6	9	---	---	---	---	PASS
CD46	4179	broad.mit.edu	37	1	207930442	207930442	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207930442G>C	uc001hgc.2	+	2	337	c.181G>C	c.(181-183)GAT>CAT	p.D61H	CD46_uc001hgd.2_Missense_Mutation_p.D61H|CD46_uc001hge.2_Missense_Mutation_p.D61H|CD46_uc001hgf.2_Missense_Mutation_p.D61H|CD46_uc001hgg.2_Missense_Mutation_p.D61H|CD46_uc001hgh.2_Missense_Mutation_p.D61H|CD46_uc001hgi.2_Missense_Mutation_p.D61H|CD46_uc001hgj.2_Missense_Mutation_p.D61H|CD46_uc001hgk.2_Missense_Mutation_p.D61H|CD46_uc001hgl.2_Missense_Mutation_p.D61H|CD46_uc001hgm.2_Missense_Mutation_p.D61H|CD46_uc001hgn.2_Missense_Mutation_p.D61H|CD46_uc001hgo.2_Missense_Mutation_p.D61H|CD46_uc001hgp.2_Missense_Mutation_p.D61H	NM_002389	NP_002380	P15529	MCP_HUMAN	CD46 antigen, complement regulatory protein	61	Extracellular (Potential).|Sushi 1.				complement activation, classical pathway|innate immune response|interspecies interaction between organisms|single fertilization	inner acrosomal membrane|integral to plasma membrane	protein binding|receptor activity			large_intestine(2)|lung(1)|central_nervous_system(1)	4						TGAACGAGTAGATTATAAGTG	0.418													73	45	---	---	---	---	PASS
KCTD3	51133	broad.mit.edu	37	1	215759994	215759994	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215759994G>T	uc001hks.2	+	9	1077	c.783G>T	c.(781-783)TGG>TGT	p.W261C	KCTD3_uc001hkt.2_Missense_Mutation_p.W261C|KCTD3_uc010pub.1_Missense_Mutation_p.W159C|KCTD3_uc009xdn.2_Missense_Mutation_p.W13C	NM_016121	NP_057205	Q9Y597	KCTD3_HUMAN	potassium channel tetramerisation domain	261	WD 1.					voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			ovary(3)	3				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		TCATCTTGTGGAGTGTTCAGG	0.388													73	59	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235896901	235896901	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235896901C>A	uc001hxj.2	-	34	8878	c.8703G>T	c.(8701-8703)GAG>GAT	p.E2901D	LYST_uc001hxi.2_Missense_Mutation_p.E125D	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	2901					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CCTTTTTTCTCTCATTTCCTT	0.398									Chediak-Higashi_syndrome				11	59	---	---	---	---	PASS
C1orf150	148823	broad.mit.edu	37	1	247719715	247719715	+	Silent	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247719715G>T	uc001idf.2	+	2	81	c.36G>T	c.(34-36)CTG>CTT	p.L12L	C1orf150_uc009xgw.2_RNA|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	hypothetical protein LOC148823	12											0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)			ATAGTTGCCTGGGAGAGAATC	0.343													4	14	---	---	---	---	PASS
OR1C1	26188	broad.mit.edu	37	1	247921596	247921596	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247921596G>T	uc010pza.1	-	1	113	c.113C>A	c.(112-114)ACC>AAC	p.T38N		NM_012353	NP_036485	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C,	38	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CCCCAAGGTGGTGGCTAAATA	0.478													6	18	---	---	---	---	PASS
EHBP1	23301	broad.mit.edu	37	2	63176080	63176080	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63176080A>T	uc002sby.2	+	14	2686	c.2204A>T	c.(2203-2205)GAA>GTA	p.E735V	EHBP1_uc010fcp.2_Missense_Mutation_p.E700V|EHBP1_uc002sbz.2_Missense_Mutation_p.E700V|EHBP1_uc002scb.2_Missense_Mutation_p.E700V	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1	735						cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TTGGAGAAAGAAAAATTAGAG	0.353									Hereditary_Prostate_Cancer				16	32	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80816562	80816562	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80816562T>C	uc010ysh.1	+	14	2146	c.2141T>C	c.(2140-2142)CTG>CCG	p.L714P	CTNNA2_uc010yse.1_Missense_Mutation_p.L714P|CTNNA2_uc010ysf.1_Missense_Mutation_p.L714P|CTNNA2_uc010ysg.1_Missense_Mutation_p.L714P|CTNNA2_uc010ysi.1_Missense_Mutation_p.L346P|CTNNA2_uc010ysj.1_Missense_Mutation_p.L43P	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	714					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						ATCATTGTACTGGCCAAGCAG	0.458													17	28	---	---	---	---	PASS
CD8B	926	broad.mit.edu	37	2	87085418	87085418	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87085418C>T	uc002srz.2	-	2	215	c.165G>A	c.(163-165)CTG>CTA	p.L55L	RMND5A_uc002srs.3_Intron|CD8B_uc002srw.2_Silent_p.L55L|CD8B_uc002srx.2_Silent_p.L55L|CD8B_uc002sry.2_Silent_p.L55L|CD8B_uc010fgt.2_Silent_p.L55L|CD8B_uc002ssa.2_Silent_p.L55L|CD8B_uc010yto.1_Silent_p.L55L	NM_004931	NP_004922	P10966	CD8B_HUMAN	CD8b antigen isoform 5 precursor	55	Ig-like V-type.|Extracellular (Potential).				immune response|regulation of defense response to virus by virus|regulation of immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway|viral reproduction	early endosome|extracellular region|integral to plasma membrane|T cell receptor complex	coreceptor activity|MHC class I protein binding			upper_aerodigestive_tract(1)|skin(1)	2						GGCGCTGTCTCAGCCAGTAGA	0.547													16	36	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130832484	130832484	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130832484T>A	uc010fmh.2	-	17	2961	c.2561A>T	c.(2560-2562)GAC>GTC	p.D854V		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	854	Actin-like.					cell cortex	ATP binding			skin(3)|ovary(2)	5						GTCACCAGAGTCCATCACGAT	0.607													46	50	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131520751	131520751	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131520751C>A	uc002trw.2	+	2	1296	c.1106C>A	c.(1105-1107)ACA>AAA	p.T369K	FAM123C_uc010fmv.2_Missense_Mutation_p.T369K|FAM123C_uc010fms.1_Missense_Mutation_p.T369K|FAM123C_uc010fmt.1_Missense_Mutation_p.T369K|FAM123C_uc010fmu.1_Missense_Mutation_p.T369K	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	369										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		TCCATCGACACAGGCACCCCC	0.627													10	32	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136566581	136566581	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136566581G>T	uc002tuu.1	-	8	3347	c.3336C>A	c.(3334-3336)TAC>TAA	p.Y1112*		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1112	3.|Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		GCTCCTGCCTGTATTTCTCAT	0.587													34	54	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141598565	141598565	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141598565C>A	uc002tvj.1	-	30	6008	c.5036G>T	c.(5035-5037)AGG>ATG	p.R1679M		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1679	Extracellular (Potential).|LDL-receptor class B 15.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCCATCTAGCCTTGCCACATT	0.398										TSP Lung(27;0.18)			4	57	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152525607	152525607	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152525607C>T	uc010fnx.2	-	39	4736	c.4545G>A	c.(4543-4545)AAG>AAA	p.K1515K		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	1515					muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CAATAGTATACTTGTGCTTCA	0.393													3	8	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166872247	166872247	+	Intron	SNP	A	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166872247A>T	uc010zcz.1	-						SCN1A_uc002udo.3_Intron|SCN1A_uc010fpk.2_Intron	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	TCTGTAAGTGAGATGGACATA	0.393													9	74	---	---	---	---	PASS
SCN9A	6335	broad.mit.edu	37	2	167108342	167108342	+	Silent	SNP	A	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167108342A>T	uc010fpl.2	-	18	3713	c.3372T>A	c.(3370-3372)CCT>CCA	p.P1124P	uc002udp.2_RNA	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1135						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	CTCCTTCTCCAGGCAAAGGGT	0.458													20	22	---	---	---	---	PASS
GAD1	2571	broad.mit.edu	37	2	171709291	171709291	+	Missense_Mutation	SNP	G	A	A	rs143058194	byFrequency	TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171709291G>A	uc002ugi.2	+	13	1674	c.1252G>A	c.(1252-1254)GTC>ATC	p.V418I	GAD1_uc010fqc.2_Missense_Mutation_p.V37I	NM_000817	NP_000808	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 isoform GAD67	418					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion|protein-pyridoxal-5-phosphate linkage	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|plasma membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	TGCCATTCTCGTCAAGGAAAA	0.512													7	25	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179586871	179586871	+	Intron	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179586871G>T	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGGAGGATGAGAAGAAAGG	0.373													33	88	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189916169	189916169	+	Silent	SNP	C	A	A	rs141089340		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189916169C>A	uc002uqk.2	-	42	3083	c.2808G>T	c.(2806-2808)GGG>GGT	p.G936G	COL5A2_uc010frx.2_Silent_p.G512G	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	936					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			GTCCCTCCTTCCCGGGTTCCC	0.597													11	19	---	---	---	---	PASS
CASP8	841	broad.mit.edu	37	2	202149561	202149561	+	Silent	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202149561A>G	uc002uxr.1	+	9	1034	c.825A>G	c.(823-825)GAA>GAG	p.E275E	CASP8_uc002uxp.1_Silent_p.E292E|CASP8_uc002uxq.1_Silent_p.E260E|CASP8_uc002uxt.1_Silent_p.E334E|CASP8_uc002uxu.1_RNA|CASP8_uc002uxw.1_Silent_p.E260E|CASP8_uc002uxy.1_Intron|CASP8_uc002uxx.1_Intron|CASP8_uc010ftf.2_Silent_p.E191E	NM_033355	NP_203519	Q14790	CASP8_HUMAN	caspase 8 isoform B precursor	275					activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding			upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						CGACCTTTGAAGAGCTTCATT	0.438										HNSCC(4;0.00038)			20	45	---	---	---	---	PASS
UNC80	285175	broad.mit.edu	37	2	210650903	210650903	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210650903C>G	uc010zjc.1	+	5	794	c.714C>G	c.(712-714)AAC>AAG	p.N238K	UNC80_uc002vdj.1_Missense_Mutation_p.N238K	NM_032504	NP_115893	Q8N2C7	UNC80_HUMAN	chromosome 2 open reading frame 21 isoform 1	238						integral to membrane					0						CCATCAGGAACATCATTACAG	0.498													6	41	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211481167	211481167	+	Silent	SNP	C	A	A	rs139626513		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211481167C>A	uc002vee.3	+	21	2721	c.2589C>A	c.(2587-2589)TCC>TCA	p.S863S	CPS1_uc010fur.2_Silent_p.S869S|CPS1_uc010fus.2_Silent_p.S412S|LOC29034_uc002vef.2_5'Flank	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	863					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		ACAACATGTCCCTTGATGAGA	0.363													23	42	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211481168	211481168	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211481168C>A	uc002vee.3	+	21	2722	c.2590C>A	c.(2590-2592)CTT>ATT	p.L864I	CPS1_uc010fur.2_Missense_Mutation_p.L870I|CPS1_uc010fus.2_Missense_Mutation_p.L413I|LOC29034_uc002vef.2_5'Flank	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	864					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CAACATGTCCCTTGATGAGAT	0.363													23	43	---	---	---	---	PASS
PECR	55825	broad.mit.edu	37	2	216904093	216904093	+	Intron	SNP	A	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216904093A>T	uc002vft.2	-						PECR_uc010zjq.1_Intron|PECR_uc002vfr.2_Intron|PECR_uc002vfs.2_Intron	NM_018441	NP_060911	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase						fatty acid biosynthetic process|regulation of apoptosis	peroxisome	binding|trans-2-enoyl-CoA reductase (NADPH) activity				0		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	TCTGTTAAAGAAGTGGAAAGC	0.453													9	28	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227895291	227895291	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227895291G>T	uc010zlt.1	-	41	4495	c.3841C>A	c.(3841-3843)CCT>ACT	p.P1281T		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	1281	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		ACACTCCCAGGGAGGCCTGGA	0.557													16	51	---	---	---	---	PASS
C2orf57	165100	broad.mit.edu	37	2	232458019	232458019	+	Silent	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232458019G>A	uc002vrz.2	+	1	408	c.357G>A	c.(355-357)CAG>CAA	p.Q119Q		NM_152614	NP_689827	Q53QW1	CB057_HUMAN	hypothetical protein LOC165100	119										ovary(1)	1		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		GGACAAGTCAGAGTCTAGTGG	0.547													15	36	---	---	---	---	PASS
UGT1A5	54579	broad.mit.edu	37	2	234681017	234681017	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234681017C>T	uc002vuw.2	+	5	1417	c.1417C>T	c.(1417-1419)CCA>TCA	p.P473S	UGT1A8_uc002vup.2_Missense_Mutation_p.P469S|UGT1A10_uc002vur.2_Missense_Mutation_p.P469S|UGT1A9_uc002vus.2_Missense_Mutation_p.P469S|UGT1A7_uc002vut.2_Missense_Mutation_p.P469S|UGT1A6_uc002vuu.2_Missense_Mutation_p.P204S|UGT1A6_uc002vuv.3_Missense_Mutation_p.P471S|UGT1A4_uc002vux.2_Missense_Mutation_p.P473S|UGT1A3_uc002vuy.2_Missense_Mutation_p.P473S|UGT1A9_uc002vva.2_RNA|UGT1A1_uc002vvb.2_Missense_Mutation_p.P472S	NM_019078	NP_061951	P35504	UD15_HUMAN	UDP glycosyltransferase 1 family, polypeptide A5	473					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		CAAGGGCGCGCCACACCTGCG	0.622													24	74	---	---	---	---	PASS
EPM2AIP1	9852	broad.mit.edu	37	3	37034359	37034359	+	Silent	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37034359C>A	uc003cgk.2	-	1	437	c.210G>T	c.(208-210)GCG>GCT	p.A70A	MLH1_uc011aye.1_5'Flank|MLH1_uc003cgl.2_5'Flank|MLH1_uc011ayb.1_5'Flank|MLH1_uc010hge.2_5'Flank|MLH1_uc003cgn.3_5'Flank|MLH1_uc011ayc.1_5'Flank|MLH1_uc011ayd.1_5'Flank|MLH1_uc003cgo.2_5'Flank	NM_014805	NP_055620	Q7L775	EPMIP_HUMAN	EPM2A interacting protein 1	70						endoplasmic reticulum					0						GCTCGCCGTCCGCCACATACC	0.677													8	19	---	---	---	---	PASS
CCK	885	broad.mit.edu	37	3	42299725	42299725	+	Intron	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42299725T>C	uc003clc.1	-						CCK_uc003cld.1_Intron	NM_000729	NP_000720	P06307	CCKN_HUMAN	cholecystokinin preproprotein						axonogenesis|eating behavior|neuron migration		neuropeptide hormone activity			central_nervous_system(1)	1		Ovarian(412;0.0728)		KIRC - Kidney renal clear cell carcinoma(284;0.219)		CAGAAGGAGCTACAAGGAGCA	0.423													10	16	---	---	---	---	PASS
OR5H15	403274	broad.mit.edu	37	3	97887798	97887798	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97887798C>A	uc011bgu.1	+	1	255	c.255C>A	c.(253-255)TTC>TTA	p.F85L		NM_001005515	NP_001005515	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TGAATAACTTCTTAGCTAAGA	0.393													12	121	---	---	---	---	PASS
ST3GAL6	10402	broad.mit.edu	37	3	98487337	98487337	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98487337T>A	uc003dsz.2	+	2	289	c.53T>A	c.(52-54)GTA>GAA	p.V18E	ST3GAL6_uc003dsy.2_5'UTR|ST3GAL6_uc003dta.2_5'UTR|ST3GAL6_uc003dtb.2_Intron|ST3GAL6_uc003dtc.2_Missense_Mutation_p.V18E|ST3GAL6_uc010hpd.2_Missense_Mutation_p.V71E	NM_006100	NP_006091	Q9Y274	SIA10_HUMAN	alpha2,3-sialyltransferase VI	18	Helical; Signal-anchor for type II membrane protein; (Potential).				amino sugar metabolic process|glycolipid metabolic process|protein glycosylation|protein lipoylation	integral to Golgi membrane	sialyltransferase activity			ovary(1)	1						CTCTATTATGTACTGCATTGC	0.393													16	93	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129281766	129281766	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129281766C>A	uc003emx.2	-	27	4789	c.4689G>T	c.(4687-4689)CAG>CAT	p.Q1563H	PLXND1_uc011blb.1_Missense_Mutation_p.Q231H	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1563	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						TGCCACAGCCCTGGAAGGACA	0.597													3	23	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129284822	129284822	+	Silent	SNP	A	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129284822A>T	uc003emx.2	-	24	4330	c.4230T>A	c.(4228-4230)ATT>ATA	p.I1410I	PLXND1_uc011blb.1_Silent_p.I78I	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1410	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						AGAACAAGCTAATTCCCTCTT	0.547													5	25	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129290106	129290106	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129290106G>A	uc003emx.2	-	18	3477	c.3377C>T	c.(3376-3378)TCC>TTC	p.S1126F		NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1126	Extracellular (Potential).|IPT/TIG 3.				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						GGCCCCGGGGGACGGGCAGGT	0.647													13	21	---	---	---	---	PASS
COL29A1	256076	broad.mit.edu	37	3	130189746	130189746	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130189746G>A	uc010htj.1	+	39	8003	c.7509G>A	c.(7507-7509)ATG>ATA	p.M2503I	COL29A1_uc010hti.1_RNA|COL29A1_uc010htk.1_Missense_Mutation_p.M542I	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN	collagen, type XXIX, alpha 1	2503	Nonhelical region.				axon guidance|cell adhesion	collagen					0						CCGAAGATATGAAAGCCACAT	0.433													4	17	---	---	---	---	PASS
CEP70	80321	broad.mit.edu	37	3	138290096	138290096	+	Intron	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138290096G>A	uc003esl.2	-						CEP70_uc011bmk.1_Intron|CEP70_uc011bml.1_Intron|CEP70_uc011bmm.1_Intron|CEP70_uc003esm.2_Intron|CEP70_uc003esn.2_Intron	NM_024491	NP_077817	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70 kDa						G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding			skin(1)	1						ATCAAGAATAGGATCTAATTA	0.284													9	23	---	---	---	---	PASS
SAMD7	344658	broad.mit.edu	37	3	169644912	169644912	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169644912G>T	uc003fgd.2	+	6	1129	c.862G>T	c.(862-864)GCA>TCA	p.A288S	SAMD7_uc003fge.2_Missense_Mutation_p.A288S|SAMD7_uc011bpo.1_Missense_Mutation_p.A189S	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	288										skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			GCAGATTTTTGCAACCTGTGA	0.557													10	106	---	---	---	---	PASS
SPATA16	83893	broad.mit.edu	37	3	172634157	172634157	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172634157G>T	uc003fin.3	-	9	1611	c.1453C>A	c.(1453-1455)CTA>ATA	p.L485I		NM_031955	NP_114161	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	485					cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			ATGGTTGCTAGCTCTGCCATT	0.473													60	371	---	---	---	---	PASS
YEATS2	55689	broad.mit.edu	37	3	183490318	183490318	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183490318G>T	uc003fly.2	+	16	2368	c.2173G>T	c.(2173-2175)GCT>TCT	p.A725S		NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	725					histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GGTTACTGCCGCTGGTCCTCA	0.507													42	25	---	---	---	---	PASS
ACAP2	23527	broad.mit.edu	37	3	195027282	195027282	+	Silent	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195027282G>T	uc003fun.3	-	13	1315	c.1074C>A	c.(1072-1074)ACC>ACA	p.T358T		NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2	358	PH.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2						TAGCAATACTGGTCTGAACAG	0.383													25	298	---	---	---	---	PASS
RGS12	6002	broad.mit.edu	37	4	3432376	3432376	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3432376A>C	uc003ggw.2	+	17	4712	c.3808A>C	c.(3808-3810)AGC>CGC	p.S1270R	RGS12_uc003ggv.2_Missense_Mutation_p.S1270R|RGS12_uc003ggy.1_3'UTR|RGS12_uc003ggz.2_Missense_Mutation_p.S622R|RGS12_uc011bvs.1_3'UTR|RGS12_uc003gha.2_Missense_Mutation_p.S612R|RGS12_uc010icv.2_Missense_Mutation_p.S469R	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1	1270						condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GAGCAGCGACAGCCCGTCCAC	0.706													10	3	---	---	---	---	PASS
SORCS2	57537	broad.mit.edu	37	4	7727000	7727000	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7727000G>A	uc003gkb.3	+	20	2731	c.2731G>A	c.(2731-2733)GGC>AGC	p.G911S	SORCS2_uc011bwi.1_Missense_Mutation_p.G739S	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor	911	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						CTGGTGGATCGGCCACAGCCT	0.607													18	8	---	---	---	---	PASS
SEPSECS	51091	broad.mit.edu	37	4	25160666	25160666	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25160666T>A	uc003grg.2	-	2	391	c.178A>T	c.(178-180)ATC>TTC	p.I60F	uc003grj.2_5'Flank|PI4K2B_uc011bxs.1_5'Flank|SEPSECS_uc003gri.2_Missense_Mutation_p.I59F|SEPSECS_uc003grh.2_Intron	NM_153825	NP_722547	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine)	60					selenocysteine incorporation	cytoplasm|nucleus	pyridoxal phosphate binding|transferase activity, transferring selenium-containing groups|tRNA binding				0		Breast(46;0.173)			Pyridoxal Phosphate(DB00114)	CTGTCCATGATTGCAAGTTCA	0.378													42	20	---	---	---	---	PASS
UNC5C	8633	broad.mit.edu	37	4	96222807	96222807	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96222807C>T	uc003htp.1	-	3	594	c.440G>A	c.(439-441)TGG>TAG	p.W147*	UNC5C_uc010ilc.1_Nonsense_Mutation_p.W147*|UNC5C_uc003htq.2_Nonsense_Mutation_p.W147*	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor	147	Extracellular (Potential).|Ig-like.				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CGCGGAGCTCCAGGCCACACA	0.507													34	21	---	---	---	---	PASS
EGF	1950	broad.mit.edu	37	4	110915996	110915996	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110915996G>T	uc003hzy.3	+	20	3417	c.2965G>T	c.(2965-2967)GTG>TTG	p.V989L	EGF_uc011cfu.1_Missense_Mutation_p.V947L|EGF_uc011cfv.1_Missense_Mutation_p.V948L|EGF_uc010imk.2_Missense_Mutation_p.V137L	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	989	EGF-like 9.|Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	CCATGATGGTGTGTGCATGTA	0.468													17	26	---	---	---	---	PASS
FNIP2	57600	broad.mit.edu	37	4	159789250	159789250	+	Intron	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159789250C>T	uc003iqe.3	+							NM_020840	NP_065891	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2						DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		CCTTTGCTCTCTAGGTGATCT	0.463													45	56	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13700983	13700983	+	Intron	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13700983A>G	uc003jfd.2	-						DNAH5_uc003jfc.2_Intron	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GTTATTTCCTATTCAGGGCAG	0.453									Kartagener_syndrome				31	139	---	---	---	---	PASS
CAPSL	133690	broad.mit.edu	37	5	35910625	35910625	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35910625T>C	uc003jjt.1	-	3	253	c.158A>G	c.(157-159)GAC>GGC	p.D53G	CAPSL_uc003jju.1_Missense_Mutation_p.D53G	NM_001042625	NP_001036090	Q8WWF8	CAPSL_HUMAN	calcyphosine-like	53	EF-hand 1.|1 (Potential).					cytoplasm	calcium ion binding			skin(1)	1	all_lung(31;0.000268)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.167)|Colorectal(62;0.202)			ATTATTATCGTCATCCATAAT	0.318													14	58	---	---	---	---	PASS
CAPSL	133690	broad.mit.edu	37	5	35910626	35910626	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35910626C>A	uc003jjt.1	-	3	252	c.157G>T	c.(157-159)GAC>TAC	p.D53Y	CAPSL_uc003jju.1_Missense_Mutation_p.D53Y	NM_001042625	NP_001036090	Q8WWF8	CAPSL_HUMAN	calcyphosine-like	53	EF-hand 1.|1 (Potential).					cytoplasm	calcium ion binding			skin(1)	1	all_lung(31;0.000268)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.167)|Colorectal(62;0.202)			TTATTATCGTCATCCATAATT	0.313													13	56	---	---	---	---	PASS
CENPK	64105	broad.mit.edu	37	5	64850711	64850711	+	Silent	SNP	C	A	A	rs75497175	byFrequency	TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64850711C>A	uc003jts.2	-	3	236	c.24G>T	c.(22-24)CCG>CCT	p.P8P	CENPK_uc003jtt.2_5'UTR|CENPK_uc003jtu.2_Silent_p.P8P	NM_022145	NP_071428	Q9BS16	CENPK_HUMAN	SoxLZ/Sox6 leucine zipper binding protein	8					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm					0		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00466)		TAGTACTATCCGGATCTAGAT	0.274													40	63	---	---	---	---	PASS
SV2C	22987	broad.mit.edu	37	5	75427860	75427860	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75427860C>T	uc003kei.1	+	2	419	c.285C>T	c.(283-285)GGC>GGT	p.G95G		NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	95	Cytoplasmic (Potential).				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		AGTATCAGGGCATCCCCAGTA	0.542													4	6	---	---	---	---	PASS
RASGRF2	5924	broad.mit.edu	37	5	80363979	80363979	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80363979T>C	uc003kha.1	+	3	524	c.524T>C	c.(523-525)ATC>ACC	p.I175T	RASGRF2_uc011ctn.1_RNA|RASGRF2_uc003khb.1_5'Flank	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine	175	Potential.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		GACACAGAAATCGAAAGGCTT	0.383													24	22	---	---	---	---	PASS
RASA1	5921	broad.mit.edu	37	5	86679553	86679553	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86679553T>A	uc003kiw.2	+	21	2832	c.2714T>A	c.(2713-2715)ATC>AAC	p.I905N	RASA1_uc010jav.2_RNA|RASA1_uc003kix.2_Missense_Mutation_p.I728N|RASA1_uc011ctv.1_Missense_Mutation_p.I738N|RASA1_uc011ctw.1_Missense_Mutation_p.I739N|RASA1_uc010jaw.2_Missense_Mutation_p.I727N	NM_002890	NP_002881	P20936	RASA1_HUMAN	RAS p21 protein activator 1 isoform 1	905	Ras-GAP.				cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding			upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		CTTCGACTCATCTGTCCTGCC	0.284													16	13	---	---	---	---	PASS
KCNN2	3781	broad.mit.edu	37	5	113831669	113831669	+	Silent	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113831669G>T	uc003kqo.2	+	8	1987	c.1530G>T	c.(1528-1530)CTG>CTT	p.L510L	KCNN2_uc003kqp.2_Silent_p.L162L|KCNN2_uc010jcg.2_RNA|uc003kqr.1_Intron	NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	510						integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		TTGTTACCCTGGAAACAAAAC	0.443													27	54	---	---	---	---	PASS
KCNN2	3781	broad.mit.edu	37	5	113831670	113831670	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113831670G>T	uc003kqo.2	+	8	1988	c.1531G>T	c.(1531-1533)GAA>TAA	p.E511*	KCNN2_uc003kqp.2_Nonsense_Mutation_p.E163*|KCNN2_uc010jcg.2_RNA|uc003kqr.1_Intron	NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	511						integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		TGTTACCCTGGAAACAAAACT	0.443													28	51	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140572876	140572876	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140572876G>A	uc003lix.2	+	1	925	c.751G>A	c.(751-753)GCT>ACT	p.A251T		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	251	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGAGACCCAGGCTCCAGAAAA	0.498													22	21	---	---	---	---	PASS
ATF6B	1388	broad.mit.edu	37	6	32085724	32085724	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32085724C>A	uc003nzn.2	-	12	1369	c.1336G>T	c.(1336-1338)GAG>TAG	p.E446*	TNXB_uc010jts.1_5'Flank|ATF6B_uc003nzm.1_Nonsense_Mutation_p.E19*|ATF6B_uc003nzo.2_Nonsense_Mutation_p.E443*|ATF6B_uc003nzp.1_Nonsense_Mutation_p.E135*	NM_004381	NP_004372	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta isoform	446	Lumenal (Potential).				response to unfolded protein|signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGAACTGGCTCTTGCTCTGAG	0.607													17	15	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38830132	38830132	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38830132A>G	uc003ooe.1	+	42	6157	c.5557A>G	c.(5557-5559)ACA>GCA	p.T1853A		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						CACTGGCAAAACAGAAACCAC	0.463													41	42	---	---	---	---	PASS
LRFN2	57497	broad.mit.edu	37	6	40360526	40360526	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40360526C>A	uc003oph.1	-	3	1991	c.1526G>T	c.(1525-1527)GGC>GTC	p.G509V		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	509	Fibronectin type-III.|Extracellular (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTGGGCGCAGCCCACGATGTT	0.597													9	12	---	---	---	---	PASS
MCHR2	84539	broad.mit.edu	37	6	100369140	100369140	+	Intron	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100369140G>A	uc003pqh.1	-						MCHR2_uc003pqi.1_Intron	NM_001040179	NP_001035269	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2							integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		AGCTGCAGAGGAAACATTCAG	0.428													25	41	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	101095150	101095150	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101095150T>A	uc003pqk.2	-	21	3759	c.3430A>T	c.(3430-3432)AAA>TAA	p.K1144*	ASCC3_uc011eai.1_Nonsense_Mutation_p.K1046*	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1144	SEC63 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GTAAGCTTTTTTTCTTCTAAT	0.353													23	53	---	---	---	---	PASS
AIM1	202	broad.mit.edu	37	6	106992566	106992566	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106992566A>G	uc003prh.2	+	10	4423	c.3936A>G	c.(3934-3936)ATA>ATG	p.I1312M	AIM1_uc003pri.2_Missense_Mutation_p.I116M	NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	1312	Beta/gamma crystallin 'Greek key' 6.						sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TACGACCTATATTAGGTGTAA	0.383													24	55	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117704610	117704610	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117704610A>G	uc003pxp.1	-	16	2565	c.2366T>C	c.(2365-2367)GTG>GCG	p.V789A	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	789	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CATGTCATTCACCAATAGCTT	0.428			T	GOPC|ROS1	glioblastoma|NSCLC								46	107	---	---	---	---	PASS
TMEM200A	114801	broad.mit.edu	37	6	130762050	130762050	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130762050G>C	uc003qca.2	+	3	1354	c.483G>C	c.(481-483)AGG>AGC	p.R161S	TMEM200A_uc010kfh.2_Missense_Mutation_p.R161S|TMEM200A_uc010kfi.2_Missense_Mutation_p.R161S|TMEM200A_uc003qcb.2_Missense_Mutation_p.R161S	NM_052913	NP_443145	Q86VY9	T200A_HUMAN	transmembrane protein 200A	161	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		TACACATGAGGGATATCTATT	0.408													16	51	---	---	---	---	PASS
VIP	7432	broad.mit.edu	37	6	153073419	153073419	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153073419G>T	uc003qpe.2	+	2	279	c.107G>T	c.(106-108)AGG>ATG	p.R36M	VIP_uc003qpf.2_Missense_Mutation_p.R36M|VIP_uc010kjd.2_Missense_Mutation_p.R36M	NM_003381	NP_003372	P01282	VIP_HUMAN	vasoactive intestinal peptide isoform 1	36					body fluid secretion|G-protein coupled receptor protein signaling pathway|positive regulation of cell proliferation	extracellular region	neuropeptide hormone activity				0		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;4.5e-11)|BRCA - Breast invasive adenocarcinoma(81;0.144)		TCTGCTCTCAGGTAAGTTCCC	0.418													13	33	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169623439	169623439	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169623439G>A	uc003qwt.2	-	19	3153	c.2905C>T	c.(2905-2907)CCC>TCC	p.P969S		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	969	TSP C-terminal.				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GTCCCTTTGGGATCCAAGGGG	0.502													18	53	---	---	---	---	PASS
INTS1	26173	broad.mit.edu	37	7	1514004	1514004	+	Intron	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1514004C>A	uc003skn.2	-						INTS1_uc003skm.1_Intron	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1						snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		TGCCTGCGGGCGCGGTGAGGG	0.731													7	31	---	---	---	---	PASS
C7orf28B	221960	broad.mit.edu	37	7	6854386	6854386	+	Intron	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6854386C>A	uc003sqx.1	-						C7orf28B_uc011jxd.1_Intron	NM_198097	NP_932765	P86791	CCZ1_HUMAN	hypothetical protein LOC221960							lysosomal membrane					0		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)		GCTATGGTACCCATCATACCT	0.468													36	60	---	---	---	---	PASS
AOAH	313	broad.mit.edu	37	7	36656025	36656025	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36656025G>T	uc003tfh.3	-	11	1208	c.807C>A	c.(805-807)CAC>CAA	p.H269Q	AOAH_uc010kxf.2_Missense_Mutation_p.H269Q|AOAH_uc011kba.1_Missense_Mutation_p.H237Q	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	269					inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						CAGGAGAGATGTGAAAATGAG	0.438													10	14	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	77975258	77975258	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77975258C>T	uc003ugx.2	-	8	1460	c.1206G>A	c.(1204-1206)CTG>CTA	p.L402L	MAGI2_uc003ugy.2_Silent_p.L402L|MAGI2_uc010ldx.1_Silent_p.L11L|MAGI2_uc010ldy.1_Silent_p.L11L|MAGI2_uc011kgr.1_Silent_p.L234L|MAGI2_uc011kgs.1_Silent_p.L239L|RPL13AP17_uc010ldz.2_5'Flank	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	402						cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CTGGGGCCTGCAGGGGCTTTG	0.443													29	70	---	---	---	---	PASS
MGC26647	219557	broad.mit.edu	37	7	88423638	88423638	+	Silent	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88423638G>A	uc003ujv.2	-	2	801	c.619C>T	c.(619-621)CTA>TTA	p.L207L	ZNF804B_uc011khi.1_Intron	NM_152706	NP_689919	Q8TBZ9	CG062_HUMAN	hypothetical protein LOC219557	207											0	Esophageal squamous(14;0.00802)|all_hematologic(106;0.109)|Lung NSC(181;0.168)|all_lung(186;0.169)		STAD - Stomach adenocarcinoma(171;0.229)			GGGAGGAGTAGGTCAGGTGCA	0.408													45	45	---	---	---	---	PASS
MGC26647	219557	broad.mit.edu	37	7	88423646	88423646	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88423646G>A	uc003ujv.2	-	2	793	c.611C>T	c.(610-612)GCA>GTA	p.A204V	ZNF804B_uc011khi.1_Intron	NM_152706	NP_689919	Q8TBZ9	CG062_HUMAN	hypothetical protein LOC219557	204											0	Esophageal squamous(14;0.00802)|all_hematologic(106;0.109)|Lung NSC(181;0.168)|all_lung(186;0.169)		STAD - Stomach adenocarcinoma(171;0.229)			TAGGTCAGGTGCAACTTGGTG	0.403													45	49	---	---	---	---	PASS
PPP1R9A	55607	broad.mit.edu	37	7	94827677	94827677	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94827677G>T	uc003unp.2	+	6	2053	c.1771G>T	c.(1771-1773)GAA>TAA	p.E591*	PPP1R9A_uc010lfj.2_Nonsense_Mutation_p.E591*|PPP1R9A_uc011kif.1_Nonsense_Mutation_p.E591*|PPP1R9A_uc003unq.2_Nonsense_Mutation_p.E591*|PPP1R9A_uc011kig.1_Nonsense_Mutation_p.E591*	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	591	PDZ.					cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TATTGGGCGGGAAAAACCAGG	0.318										HNSCC(28;0.073)			20	30	---	---	---	---	PASS
PVRIG	79037	broad.mit.edu	37	7	99818380	99818380	+	Intron	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99818380C>A	uc003uue.2	+						GATS_uc003uty.3_Intron|GATS_uc003utz.3_Intron|GATS_uc003uua.3_Intron|GATS_uc010lgt.2_Intron|GATS_uc011kjl.1_Intron|GATS_uc010lgu.2_Intron|PVRIG_uc003uuf.1_Intron	NM_024070	NP_076975	Q6DKI7	PVRIG_HUMAN	poliovirus receptor related immunoglobulin							integral to membrane				skin(2)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGCTCTCTCCCAGCCCTGCCC	0.662													10	46	---	---	---	---	PASS
FIS1	51024	broad.mit.edu	37	7	100888297	100888297	+	5'UTR	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100888297C>T	uc003uyj.3	-	1					FIS1_uc010lht.2_Intron|FIS1_uc010lhu.2_Intron	NM_016068	NP_057152	Q9Y3D6	FIS1_HUMAN	tetratricopeptide repeat domain 11						apoptosis|mitochondrial fission|peroxisome fission	integral to mitochondrial outer membrane|integral to peroxisomal membrane	protein binding				0	Lung NSC(181;0.168)|all_lung(186;0.215)					GCCACTGCCCCCGCGAGCCTC	0.672													16	23	---	---	---	---	PASS
PNPLA8	50640	broad.mit.edu	37	7	108119674	108119674	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108119674C>T	uc003vff.1	-	11	2435	c.2028G>A	c.(2026-2028)TTG>TTA	p.L676L	PNPLA8_uc003vfg.1_RNA|PNPLA8_uc003vfh.1_Silent_p.L676L|PNPLA8_uc003vfi.1_Silent_p.L576L|PNPLA8_uc003vfj.1_Silent_p.L676L|PNPLA8_uc003vfk.1_Silent_p.L576L	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	676					fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2						GTTTAGTTTTCAAGCTTGTGT	0.393													29	40	---	---	---	---	PASS
WNT2	7472	broad.mit.edu	37	7	116955272	116955272	+	Silent	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116955272G>A	uc003viz.2	-	3	741	c.441C>T	c.(439-441)GAC>GAT	p.D147D	WNT2_uc003vja.2_Silent_p.D51D	NM_003391	NP_003382	P09544	WNT2_HUMAN	wingless-type MMTV integration site family	147					atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		TGCCTTTGCTGTCCTTGGCGC	0.438													31	47	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154585838	154585838	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154585838G>T	uc003wlk.2	+	11	1315	c.1186G>T	c.(1186-1188)GTG>TTG	p.V396L	DPP6_uc003wli.2_Missense_Mutation_p.V332L|DPP6_uc003wlm.2_Missense_Mutation_p.V334L|DPP6_uc011kvq.1_Missense_Mutation_p.V289L	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	396	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CAAGGTCGCCGTGACCTGGCT	0.647													6	10	---	---	---	---	PASS
MNX1	3110	broad.mit.edu	37	7	156798434	156798434	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156798434C>T	uc003wnd.1	-	3	1289	c.986G>A	c.(985-987)GGA>GAA	p.G329E	MNX1_uc003wmz.2_Intron|MNX1_uc003wna.2_Intron|MNX1_uc010lqq.1_Missense_Mutation_p.G122E|MNX1_uc003wnc.1_Missense_Mutation_p.G117E|MNX1_uc010lqr.1_RNA	NM_005515	NP_005506	P50219	MNX1_HUMAN	motor neuron and pancreas homeobox 1 isoform 1	329					humoral immune response|regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTCCTCGGCTCCCGGCTCCTC	0.612									Currarino_syndrome				7	13	---	---	---	---	PASS
XKR6	286046	broad.mit.edu	37	8	10756095	10756095	+	Silent	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10756095A>G	uc003wtk.1	-	3	1320	c.1293T>C	c.(1291-1293)TTT>TTC	p.F431F		NM_173683	NP_775954	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related	431	Helical; (Potential).					integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		CCTTGACGTTAAACCAGCAGA	0.463													15	13	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35541202	35541202	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35541202C>T	uc003xjr.1	+	5	1036	c.708C>T	c.(706-708)ATC>ATT	p.I236I	UNC5D_uc003xjs.1_Silent_p.I231I|UNC5D_uc003xjt.1_Silent_p.I5I	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	236	Extracellular (Potential).|Ig-like C2-type.				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CAGCCAACATCGTGGCTAAGA	0.532													13	19	---	---	---	---	PASS
NKAIN3	286183	broad.mit.edu	37	8	63659621	63659621	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63659621T>A	uc010lyq.1	+	4	536	c.404T>A	c.(403-405)GTC>GAC	p.V135D		NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3	135						integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				TACGTCTCTGTCACAGGCTGC	0.498													11	23	---	---	---	---	PASS
NCOA2	10499	broad.mit.edu	37	8	71060681	71060681	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71060681T>A	uc003xyn.1	-	12	2594	c.2432A>T	c.(2431-2433)GAT>GTT	p.D811V	NCOA2_uc011lfb.1_5'UTR	NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	811					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CTGCAAATCATCCAAAATCTC	0.478			T	RUNXBP2	AML						OREG0018819	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	32	38	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77618090	77618090	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77618090C>A	uc003yav.2	+	2	2154	c.1767C>A	c.(1765-1767)CAC>CAA	p.H589Q	ZFHX4_uc003yat.1_Missense_Mutation_p.H589Q|ZFHX4_uc003yau.1_Missense_Mutation_p.H589Q|ZFHX4_uc003yaw.1_Missense_Mutation_p.H589Q	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	589						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCACTCCTCACCAGCATGGCT	0.582										HNSCC(33;0.089)			10	46	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77618091	77618091	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77618091C>A	uc003yav.2	+	2	2155	c.1768C>A	c.(1768-1770)CAG>AAG	p.Q590K	ZFHX4_uc003yat.1_Missense_Mutation_p.Q590K|ZFHX4_uc003yau.1_Missense_Mutation_p.Q590K|ZFHX4_uc003yaw.1_Missense_Mutation_p.Q590K	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	590						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CACTCCTCACCAGCATGGCTT	0.582										HNSCC(33;0.089)			11	47	---	---	---	---	PASS
DCAF4L2	138009	broad.mit.edu	37	8	88886097	88886097	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88886097C>A	uc003ydz.2	-	1	200	c.103G>T	c.(103-105)GGT>TGT	p.G35C		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	35										ovary(1)	1						CTGAGGAAACCTAGCTGGTTC	0.517													22	69	---	---	---	---	PASS
TM7SF4	81501	broad.mit.edu	37	8	105367395	105367395	+	Silent	SNP	G	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105367395G>C	uc003ylx.1	+	3	1369	c.1320G>C	c.(1318-1320)CTG>CTC	p.L440L		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	440	Cytoplasmic.				osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AAAGACGGCTGAGTCTCTATC	0.473													10	39	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110455259	110455259	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110455259A>C	uc003yne.2	+	36	4582	c.4478A>C	c.(4477-4479)CAA>CCA	p.Q1493P		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1493	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATTTTTCTCCAAGGAGTCATT	0.408										HNSCC(38;0.096)			10	193	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113308094	113308094	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113308094T>C	uc003ynu.2	-	54	8741	c.8582A>G	c.(8581-8583)CAC>CGC	p.H2861R	CSMD3_uc003yns.2_Missense_Mutation_p.H2063R|CSMD3_uc003ynt.2_Missense_Mutation_p.H2821R|CSMD3_uc011lhx.1_Missense_Mutation_p.H2692R	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2861	Extracellular (Potential).|Sushi 18.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AGACCAATTGTGATCCTGTTG	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			18	25	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113326230	113326230	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113326230G>A	uc003ynu.2	-	49	7760	c.7601C>T	c.(7600-7602)TCT>TTT	p.S2534F	CSMD3_uc003yns.2_Missense_Mutation_p.S1736F|CSMD3_uc003ynt.2_Missense_Mutation_p.S2494F|CSMD3_uc011lhx.1_Missense_Mutation_p.S2430F|CSMD3_uc003ynw.1_Missense_Mutation_p.S245F	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2534	CUB 14.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATTAAAAGCAGATGAATAATC	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			13	56	---	---	---	---	PASS
SLC45A4	57210	broad.mit.edu	37	8	142228546	142228546	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142228546T>A	uc003ywd.1	-	4	1348	c.1040A>T	c.(1039-1041)TAC>TTC	p.Y347F	SLC45A4_uc003ywc.1_Missense_Mutation_p.Y347F|SLC45A4_uc010meq.1_Missense_Mutation_p.Y345F	NM_001080431	NP_001073900	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4	398					transport	integral to membrane				ovary(2)	2	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			CACCCTGGTGTAGCCGCCGAG	0.632													17	42	---	---	---	---	PASS
CYC1	1537	broad.mit.edu	37	8	145151539	145151539	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145151539C>G	uc003zaz.3	+	5	707	c.664C>G	c.(664-666)CCC>GCC	p.P222A	CYC1_uc003zay.2_Missense_Mutation_p.P163A	NM_001916	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	222					respiratory electron transport chain|transport	cell junction|integral to membrane|mitochondrial inner membrane|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTGCGAGCCACCCACCGGGGT	0.572													28	46	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32630711	32630711	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32630711T>C	uc003zrg.1	-	1	4957	c.4867A>G	c.(4867-4869)ATT>GTT	p.I1623V	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1623					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TACTCAGTAATTGTCTGGTAA	0.398													35	29	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79971682	79971682	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79971682A>G	uc004akr.2	+	55	7965	c.7705A>G	c.(7705-7707)ATG>GTG	p.M2569V	VPS13A_uc004akp.3_Missense_Mutation_p.M2569V|VPS13A_uc004akq.3_Missense_Mutation_p.M2569V|VPS13A_uc004aks.2_Missense_Mutation_p.M2530V	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	2569	TPR 7.				Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						ATGGAAGCCAATGAGTGTAAA	0.343													21	22	---	---	---	---	PASS
ISCA1	81689	broad.mit.edu	37	9	88880991	88880991	+	Silent	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88880991C>A	uc004aop.2	-	4	474	c.357G>T	c.(355-357)GGG>GGT	p.G119G	GOLM1_uc010mqd.1_Intron	NM_030940	NP_112202	Q9BUE6	ISCA1_HUMAN	HESB like domain containing 2 precursor	119					iron-sulfur cluster assembly	mitochondrion	iron-sulfur cluster binding|metal ion binding|structural molecule activity				0				OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)		AGCCACAAGTCCCTTTGATGT	0.423													35	126	---	---	---	---	PASS
ISCA1	81689	broad.mit.edu	37	9	88880992	88880992	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88880992C>T	uc004aop.2	-	4	473	c.356G>A	c.(355-357)GGG>GAG	p.G119E	GOLM1_uc010mqd.1_Intron	NM_030940	NP_112202	Q9BUE6	ISCA1_HUMAN	HESB like domain containing 2 precursor	119					iron-sulfur cluster assembly	mitochondrion	iron-sulfur cluster binding|metal ion binding|structural molecule activity				0				OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)		GCCACAAGTCCCTTTGATGTT	0.423													35	127	---	---	---	---	PASS
PPP3R2	5535	broad.mit.edu	37	9	104356945	104356945	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104356945C>T	uc004bbr.2	-	1	339	c.268G>A	c.(268-270)GAC>AAC	p.D90N	GRIN3A_uc004bbp.1_Intron|GRIN3A_uc004bbq.1_Intron|PPP3R2_uc010mtf.1_Intron	NM_147180	NP_671709	Q96LZ3	CANB2_HUMAN	protein phosphatase 3 regulatory subunit B, beta	87	EF-hand 3.						calcium ion binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)			Cyclosporine(DB00091)	TGCTCCTCGTCGCCCTTGACG	0.532													64	61	---	---	---	---	PASS
ZFP37	7539	broad.mit.edu	37	9	115805839	115805839	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115805839C>A	uc004bgm.1	-	4	1087	c.1059G>T	c.(1057-1059)CAG>CAT	p.Q353H	ZFP37_uc011lwz.1_Missense_Mutation_p.Q368H|ZFP37_uc011lxa.1_Missense_Mutation_p.Q354H	NM_003408	NP_003399	Q9Y6Q3	ZFP37_HUMAN	zinc finger protein 37 homolog	353	C2H2-type 3; atypical.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						CTTTGCCACACTGAATACATT	0.408													86	82	---	---	---	---	PASS
DBC1	1620	broad.mit.edu	37	9	122004337	122004337	+	Silent	SNP	A	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122004337A>T	uc004bkc.2	-	4	1023	c.567T>A	c.(565-567)ACT>ACA	p.T189T	DBC1_uc004bkd.2_Silent_p.T189T	NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	189	MACPF.				cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						TGATTGCTCCAGTTGATATCT	0.488													44	41	---	---	---	---	PASS
RBM18	92400	broad.mit.edu	37	9	125007527	125007527	+	Intron	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125007527C>T	uc004bma.2	-						RBM18_uc004blz.2_Intron|RBM18_uc010mvy.2_Intron|RBM18_uc011lyp.1_Intron	NM_033117	NP_149108	Q96H35	RBM18_HUMAN	RNA binding motif protein 18								nucleotide binding|RNA binding				0						TATAGTACATCATCTTACCTT	0.363													6	95	---	---	---	---	PASS
RABGAP1	23637	broad.mit.edu	37	9	125760918	125760918	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125760918C>T	uc011lzh.1	+	10	1381	c.1247C>T	c.(1246-1248)ACA>ATA	p.T416I	RABGAP1_uc004bnl.3_RNA	NM_012197	NP_036329	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	416					cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5						TTGGTAATAACAGAAGTACAG	0.398													44	139	---	---	---	---	PASS
LRIT2	340745	broad.mit.edu	37	10	85982265	85982265	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85982265G>T	uc001kcy.2	-	3	1072	c.1064C>A	c.(1063-1065)TCT>TAT	p.S355Y	LRIT2_uc010qmc.1_Missense_Mutation_p.S365Y	NM_001017924	NP_001017924	A6NDA9	LRIT2_HUMAN	leucine rich repeat containing 22 precursor	355						integral to membrane				ovary(2)	2						GATGGAAAGAGAATCAGGTGC	0.542													10	18	---	---	---	---	PASS
FAM190B	54462	broad.mit.edu	37	10	86133468	86133468	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86133468C>T	uc001kdh.1	+	3	1705	c.1511C>T	c.(1510-1512)TCT>TTT	p.S504F	FAM190B_uc001kdg.1_Missense_Mutation_p.S504F|FAM190B_uc010qmd.1_Missense_Mutation_p.S504F	NM_018999	NP_061872	Q9H7U1	F190B_HUMAN	granule cell antiserum positive 14	504										ovary(3)|skin(1)	4						CTCTCTCCATCTGATAGCTCT	0.433													3	35	---	---	---	---	PASS
C10orf12	26148	broad.mit.edu	37	10	98744528	98744528	+	Silent	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98744528A>G	uc001kmv.2	+	1	3488	c.3381A>G	c.(3379-3381)CCA>CCG	p.P1127P		NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	1127										skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CCAAGAGGCCAGCTGCAAGGG	0.532													5	22	---	---	---	---	PASS
TLX1	3195	broad.mit.edu	37	10	102896674	102896674	+	3'UTR	SNP	T	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102896674T>G	uc001ksw.2	+	3						NM_005521	NP_005512	P31314	TLX1_HUMAN	T-cell leukemia homeobox 1							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1				Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CGAGTGAGCCTGCCCATTCTG	0.647			T	TRB@|TRD@	T-ALL								8	19	---	---	---	---	PASS
TAF5	6877	broad.mit.edu	37	10	105138194	105138194	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105138194C>G	uc001kwv.2	+	3	1023	c.1000C>G	c.(1000-1002)CAG>GAG	p.Q334E	TAF5_uc010qqq.1_Missense_Mutation_p.Q334E	NM_006951	NP_008882	Q15542	TAF5_HUMAN	TBP-associated factor 5	334					histone acetylation|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	actin cytoskeleton|transcription factor TFIID complex|transcription factor TFTC complex	protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)	2		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		GAACATAGTTCAGGAGCACCT	0.458													18	19	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115380405	115380405	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115380405T>G	uc001laj.2	-	25	2996	c.2832A>C	c.(2830-2832)TTA>TTC	p.L944F	NRAP_uc009xyb.2_Intron|NRAP_uc001lak.2_Missense_Mutation_p.L909F|NRAP_uc001lal.3_Missense_Mutation_p.L944F	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	944						fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GCTCCACATTTAATGACCCGG	0.512													48	98	---	---	---	---	PASS
FGFR2	2263	broad.mit.edu	37	10	123263335	123263335	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123263335C>G	uc010qtk.1	-	11	2055	c.1408G>C	c.(1408-1410)GAG>CAG	p.E470Q	FGFR2_uc010qtg.1_Missense_Mutation_p.E358Q|FGFR2_uc010qth.1_Missense_Mutation_p.E355Q|FGFR2_uc010qti.1_Missense_Mutation_p.E381Q|FGFR2_uc010qtj.1_Missense_Mutation_p.E471Q|FGFR2_uc010qtl.1_Missense_Mutation_p.E354Q|FGFR2_uc010qtm.1_Missense_Mutation_p.E353Q|FGFR2_uc001lfl.3_Missense_Mutation_p.E471Q|FGFR2_uc001lfm.2_Missense_Mutation_p.E382Q|FGFR2_uc001lfg.3_Missense_Mutation_p.E78Q	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1	470	Cytoplasmic (Potential).				angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)	TTTGGGTCCTCTGGAAGTTCA	0.502		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				3	35	---	---	---	---	PASS
EBF3	253738	broad.mit.edu	37	10	131665464	131665464	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131665464G>C	uc001lki.1	-	10	1012	c.953C>G	c.(952-954)ACC>AGC	p.T318S		NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3	327	IPT/TIG.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		GTAGGAGAGGGTCACTTCGAC	0.577													3	30	---	---	---	---	PASS
ZNF143	7702	broad.mit.edu	37	11	9516304	9516304	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9516304C>T	uc001mhr.2	+	8	875	c.757C>T	c.(757-759)CAT>TAT	p.H253Y	ZNF143_uc009yfu.2_Missense_Mutation_p.H252Y|ZNF143_uc010rby.1_Missense_Mutation_p.H222Y	NM_003442	NP_003433	P52747	ZN143_HUMAN	zinc finger protein 143	253	C2H2-type 1.				regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		AACAGCTCATCATCTCAAGGT	0.323													9	45	---	---	---	---	PASS
OR10AG1	282770	broad.mit.edu	37	11	55735795	55735795	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55735795G>T	uc010rit.1	-	1	145	c.145C>A	c.(145-147)CCC>ACC	p.P49T		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	49	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					AAATACATGGGAGTCTGGAGA	0.338													18	22	---	---	---	---	PASS
OR5AK2	390181	broad.mit.edu	37	11	56757107	56757107	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56757107C>T	uc010rjp.1	+	1	719	c.719C>T	c.(718-720)ACA>ATA	p.T240I		NM_001005323	NP_001005323	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK,	240	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3						TCCTTCTCAACATGTGCTTCC	0.413													62	34	---	---	---	---	PASS
ATG2A	23130	broad.mit.edu	37	11	64678310	64678310	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64678310G>C	uc001obx.2	-	11	1698	c.1583C>G	c.(1582-1584)CCC>CGC	p.P528R		NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	528							protein binding			ovary(1)|central_nervous_system(1)	2						GGTGCCCCGGGGCCACAGACA	0.672													8	3	---	---	---	---	PASS
PPP2R5B	5526	broad.mit.edu	37	11	64693371	64693371	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64693371C>G	uc001oby.2	+	2	750	c.165C>G	c.(163-165)AAC>AAG	p.N55K	PPP2R5B_uc001obz.2_Missense_Mutation_p.N55K	NM_006244	NP_006235	Q15173	2A5B_HUMAN	beta isoform of regulatory subunit B56, protein	55					signal transduction	cytoplasm|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(2)	2						ATCAGAGCAACCAGCAAGAGC	0.692													9	7	---	---	---	---	PASS
KDM2A	22992	broad.mit.edu	37	11	67017759	67017759	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67017759G>A	uc001ojw.2	+	17	3122	c.2258G>A	c.(2257-2259)CGC>CAC	p.R753H	KDM2A_uc001ojx.2_RNA|KDM2A_uc001ojy.2_Missense_Mutation_p.R447H|KDM2A_uc010rpn.1_Missense_Mutation_p.R314H|KDM2A_uc001ojz.1_Missense_Mutation_p.R211H|KDM2A_uc001oka.2_5'Flank	NM_012308	NP_036440	Q9Y2K7	KDM2A_HUMAN	F-box and leucine-rich repeat protein 11	753					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9						AGTGCCAGCCGCGATGAGCGC	0.632													13	13	---	---	---	---	PASS
FOLH1B	219595	broad.mit.edu	37	11	89413808	89413808	+	Silent	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89413808A>G	uc001pda.2	+	8	1006	c.480A>G	c.(478-480)CCA>CCG	p.P160P		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	160					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						ATTGTACACCACTGATGTACA	0.294													4	19	---	---	---	---	PASS
PANX3	116337	broad.mit.edu	37	11	124481559	124481559	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124481559G>A	uc001qah.2	+	1	107	c.107G>A	c.(106-108)CGG>CAG	p.R36Q		NM_052959	NP_443191	Q96QZ0	PANX3_HUMAN	pannexin 3	36	Cytoplasmic (Potential).				protein hexamerization	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity				0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		CCCCTGGACCGGATAGTCAAG	0.597													33	13	---	---	---	---	PASS
MLF2	8079	broad.mit.edu	37	12	6859057	6859057	+	Silent	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6859057C>A	uc010sfi.1	-	7	579	c.516G>T	c.(514-516)ACG>ACT	p.T172T	MLF2_uc001qqp.2_Silent_p.T172T|MLF2_uc009zey.1_Silent_p.T172T	NM_005439	NP_005430	Q15773	MLF2_HUMAN	myeloid leukemia factor 2	172					defense response	cytoplasm|nucleus	protein binding			large_intestine(1)	1						CCTGGTCCCCCGTGCGATGGT	0.612													3	68	---	---	---	---	PASS
TPI1	7167	broad.mit.edu	37	12	6979288	6979288	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6979288A>G	uc001qrk.2	+	6	657	c.619A>G	c.(619-621)ATC>GTC	p.I207V	TPI1_uc010sfo.1_Missense_Mutation_p.I125V	NM_000365	NP_000356	P60174	TPIS_HUMAN	triosephosphate isomerase 1 isoform 1	207					fatty acid biosynthetic process|gluconeogenesis|glycolysis|pentose-phosphate shunt	cytosol	triose-phosphate isomerase activity				0						GAGCACCCGTATCATTTATGG	0.572											OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	33	50	---	---	---	---	PASS
CD69	969	broad.mit.edu	37	12	9913369	9913369	+	Silent	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9913369C>A	uc001qwk.2	-	1	129	c.48G>T	c.(46-48)CCG>CCT	p.P16P	CD69_uc010sgu.1_Silent_p.P16P|CD69_uc010sgv.1_Silent_p.P16P	NM_001781	NP_001772	Q07108	CD69_HUMAN	CD69 molecule	16	Cytoplasmic (Potential).					integral to plasma membrane	sugar binding|transmembrane receptor activity				0						GTCCACTCTCCGGATGCAAAG	0.368													4	108	---	---	---	---	PASS
ATF7IP	55729	broad.mit.edu	37	12	14610203	14610203	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14610203C>A	uc001rbw.2	+	8	2290	c.2132C>A	c.(2131-2133)CCA>CAA	p.P711Q	ATF7IP_uc010shs.1_Intron|ATF7IP_uc001rbu.2_Missense_Mutation_p.P711Q|ATF7IP_uc001rbv.1_Missense_Mutation_p.P710Q|ATF7IP_uc001rbx.2_Missense_Mutation_p.P710Q|ATF7IP_uc010sht.1_Intron|ATF7IP_uc001rby.3_Missense_Mutation_p.P711Q|ATF7IP_uc001rca.2_Missense_Mutation_p.P711Q	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	711	Interaction with SETDB1.				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						AGTGCACCACCATCCTTTCAA	0.343													13	27	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49434608	49434608	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49434608G>C	uc001rta.3	-	31	6945	c.6945C>G	c.(6943-6945)CAC>CAG	p.H2315Q		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	2315	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GGCCACCCAGGTGGGTGCCTG	0.612			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	16	---	---	---	---	PASS
OSBPL8	114882	broad.mit.edu	37	12	76791654	76791654	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76791654C>A	uc001sye.1	-	8	972	c.492G>T	c.(490-492)TGG>TGT	p.W164C	OSBPL8_uc001syf.1_Missense_Mutation_p.W122C|OSBPL8_uc001syg.1_Missense_Mutation_p.W122C|OSBPL8_uc001syh.1_Missense_Mutation_p.W139C	NM_020841	NP_065892	Q9BZF1	OSBL8_HUMAN	oxysterol-binding protein-like protein 8 isoform	164	PH.				lipid transport		lipid binding			ovary(1)	1						ATAACTTGGTCCAGCTCTTTA	0.378													16	26	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78513708	78513708	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78513708C>T	uc001syp.2	+	15	3905	c.3732C>T	c.(3730-3732)GCC>GCT	p.A1244A	NAV3_uc001syo.2_Silent_p.A1244A|NAV3_uc010sub.1_Silent_p.A744A|NAV3_uc009zsf.2_Silent_p.A252A	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1244	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CAGATATTGCCTCACCCACAT	0.378										HNSCC(70;0.22)			10	23	---	---	---	---	PASS
ACSS3	79611	broad.mit.edu	37	12	81545666	81545666	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81545666G>T	uc001szl.1	+	6	1056	c.965G>T	c.(964-966)TGG>TTG	p.W322L	ACSS3_uc001szm.1_Missense_Mutation_p.W321L|ACSS3_uc001szn.1_Missense_Mutation_p.W4L	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	322						mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						ATGCTACACTGGTCAATGTCT	0.348													13	35	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104097022	104097022	+	Silent	SNP	A	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104097022A>C	uc001tjw.2	+	35	3997	c.3811A>C	c.(3811-3813)AGA>CGA	p.R1271R		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1271	Extracellular (Potential).				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						TCAGAAGAACAGATGTGATAA	0.373													18	40	---	---	---	---	PASS
GJB2	2706	broad.mit.edu	37	13	20763463	20763463	+	Silent	SNP	C	A	A	rs139362103		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20763463C>A	uc001umy.2	-	2	473	c.258G>T	c.(256-258)ACG>ACT	p.T86T		NM_004004	NP_003995	P29033	CXB2_HUMAN	gap junction protein beta 2	86	Helical; (Potential).		T -> R (in DFNB1A; does not form gap junctions since the mutated protein is confined in the cytoplasm and not transported to the cell membrane; when the mutation is co-expressed with the wild-type protein ionic and biochemical coupling is normal consistent with the recessive nature of the mutation).	T -> S (in Ref. 1; AAD21314).	cell-cell signaling|cellular membrane organization|gap junction assembly|sensory perception of sound|transport	connexon complex|ER-Golgi intermediate compartment|integral to membrane					0		all_cancers(29;3.95e-22)|all_epithelial(30;2.36e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;0.000435)|Epithelial(112;0.000722)|OV - Ovarian serous cystadenocarcinoma(117;0.0096)|Lung(94;0.0236)|LUSC - Lung squamous cell carcinoma(192;0.0738)		GGAGCGCTGGCGTGGACACGA	0.557									Keratitis_Ichthyosis_and_Deafness_syndrome		OREG0022282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	32	---	---	---	---	PASS
KLF12	11278	broad.mit.edu	37	13	74269769	74269769	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74269769C>T	uc001vjf.2	-	8	1289	c.1067G>A	c.(1066-1068)TGG>TAG	p.W356*	KLF12_uc010aeq.2_Nonsense_Mutation_p.W356*	NM_007249	NP_009180	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12	356	C2H2-type 2.				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		AGCGAACTTCCAGGTGCAGCC	0.512													11	41	---	---	---	---	PASS
F10	2159	broad.mit.edu	37	13	113803804	113803804	+	Silent	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113803804G>A	uc001vsx.2	+	8	1497	c.1440G>A	c.(1438-1440)GAG>GAA	p.E480E	F10_uc001vsy.2_3'UTR|F10_uc001vsz.2_3'UTR	NM_000504	NP_000495	P00742	FA10_HUMAN	coagulation factor X preproprotein	480					blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of cell migration|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|phospholipid binding|protein binding|serine-type endopeptidase activity			pancreas(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Heparin(DB01109)|Menadione(DB00170)|Reteplase(DB00015)|Tenecteplase(DB00031)	ATGCCCCGGAGGTCATAACGT	0.577													13	53	---	---	---	---	PASS
ACTR10	55860	broad.mit.edu	37	14	58681996	58681996	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58681996G>A	uc001xdf.2	+	7	695	c.592G>A	c.(592-594)GTG>ATG	p.V198M	C14orf37_uc010tro.1_Intron|ACTR10_uc001xdg.2_Translation_Start_Site|ACTR10_uc001xdh.2_Translation_Start_Site|ACTR10_uc010trp.1_RNA|ACTR10_uc010apc.2_Translation_Start_Site	NM_018477	NP_060947	Q9NZ32	ARP10_HUMAN	uncharacterized hypothalamus protein HARP11	198						cytoplasm				central_nervous_system(1)	1						CCTTCCCTCAGTGATGGGTAA	0.224													3	35	---	---	---	---	PASS
KIAA0586	9786	broad.mit.edu	37	14	58954599	58954599	+	Intron	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58954599C>A	uc001xdv.3	+						KIAA0586_uc010trr.1_Intron|KIAA0586_uc001xdt.3_Intron|KIAA0586_uc001xdu.3_Intron|KIAA0586_uc010trs.1_Intron|KIAA0586_uc010trt.1_Intron|KIAA0586_uc010tru.1_Intron	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein											ovary(1)	1						AAAAAAAAACCTTTAGGAGAT	0.408													4	11	---	---	---	---	PASS
RTN1	6252	broad.mit.edu	37	14	60072158	60072158	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60072158C>A	uc001xen.1	-	5	2249	c.2040G>T	c.(2038-2040)CAG>CAT	p.Q680H	RTN1_uc001xem.1_Missense_Mutation_p.Q260H|RTN1_uc001xek.1_Missense_Mutation_p.Q112H|RTN1_uc001xel.1_RNA|RTN1_uc010apl.1_Missense_Mutation_p.Q97H	NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A	680	Reticulon.				neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TCACGTAGAACTGCAGGCAGT	0.478													34	20	---	---	---	---	PASS
ACOT2	10965	broad.mit.edu	37	14	74036495	74036495	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74036495A>G	uc001xon.3	+	1	724	c.551A>G	c.(550-552)CAG>CGG	p.Q184R	ACOT1_uc010tuc.1_Intron|ACOT2_uc001xom.2_Intron	NM_006821	NP_006812	P49753	ACOT2_HUMAN	acyl-CoA thioesterase 2	184					acyl-CoA metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process	mitochondrion	carboxylesterase activity|palmitoyl-CoA hydrolase activity|protein binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)		CTGCTGTGCCAGACGCGGCAC	0.736													3	6	---	---	---	---	PASS
EML5	161436	broad.mit.edu	37	14	89202760	89202760	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89202760C>A	uc001xxg.2	-	8	1183	c.997G>T	c.(997-999)GTC>TTC	p.V333F		NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	333	WD 7.					cytoplasm|microtubule				ovary(3)	3						GTAGGATGGACAGCAAGTGCC	0.388													16	110	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102507987	102507987	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102507987C>T	uc001yks.2	+	65	12182	c.12018C>T	c.(12016-12018)CAC>CAT	p.H4006H		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	4006	AAA 6 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						CCATGGCCCACATGTTTGTTT	0.577													29	129	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106790997	106790997	+	RNA	SNP	A	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106790997A>T	uc010tyt.1	-	386		c.14621T>A								Parts of antibodies, mostly variable regions.												0						ACTTCCCCTCACTGTGTCTCT	0.557													66	152	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106791065	106791065	+	RNA	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106791065C>A	uc010tyt.1	-	386		c.14553G>T								Parts of antibodies, mostly variable regions.												0						GCAGATACAGCGTGTTCTTGG	0.483													68	177	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107048664	107048664	+	RNA	SNP	A	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107048664A>T	uc010tyt.1	-	145		c.6925T>A								Parts of antibodies, mostly variable regions.												0						ACTTCCCCTCACTGTGTCTCT	0.562													5	71	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107048732	107048732	+	RNA	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107048732C>A	uc010tyt.1	-	144		c.6858G>T								Parts of antibodies, mostly variable regions.												0						GAAGATACAGCGTGTTCTTGG	0.522													8	140	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107131025	107131025	+	Intron	SNP	A	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107131025A>T	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						GCCTCCCCTCACTGTGTCTCT	0.562													5	173	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107219081	107219081	+	Intron	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107219081C>T	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						CTCCATGAATCACCTTTTAAA	0.473													19	136	---	---	---	---	PASS
PAR4	347745	broad.mit.edu	37	15	25455122	25455122	+	Intron	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25455122G>A	uc001yzk.1	+						PAR4_uc010ayo.1_Intron|SNORD115-20_uc001yzq.1_Intron|SNORD115-22_uc001yzr.1_RNA|PAR4_uc001yzs.2_5'Flank					Homo sapiens clone Rt-13I SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						TAAAAATCATGCTCAATAGGA	0.488													21	212	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	26793167	26793167	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26793167C>A	uc001zaz.2	-	9	1337	c.1195G>T	c.(1195-1197)GGA>TGA	p.G399*	GABRB3_uc010uae.1_Nonsense_Mutation_p.G314*|GABRB3_uc001zba.2_Nonsense_Mutation_p.G399*|GABRB3_uc001zbb.2_Nonsense_Mutation_p.G455*	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	399	Cytoplasmic (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TACTGGATTCCTGAGTTGTCA	0.502													7	90	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	26866572	26866572	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26866572C>A	uc001zaz.2	-	4	492	c.350G>T	c.(349-351)TGG>TTG	p.W117L	GABRB3_uc010uae.1_Missense_Mutation_p.W32L|GABRB3_uc001zba.2_Missense_Mutation_p.W117L|GABRB3_uc001zbb.2_Missense_Mutation_p.W173L|GABRB3_uc001zbc.2_RNA	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	117	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	GTCGGGCACCCATAGCTGGTC	0.453													39	41	---	---	---	---	PASS
USP50	373509	broad.mit.edu	37	15	50833434	50833434	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50833434C>T	uc001zyq.3	-	4	667	c.487G>A	c.(487-489)GAG>AAG	p.E163K		NM_203494	NP_987090	E9PP86	E9PP86_HUMAN	ubiquitin specific protease 50	158					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			lung(1)|breast(1)	2				all cancers(107;0.000519)|GBM - Glioblastoma multiforme(94;0.00288)		GATCCTTTCTCATATGATCTT	0.368													33	18	---	---	---	---	PASS
FAM81A	145773	broad.mit.edu	37	15	59752218	59752218	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59752218G>A	uc002agc.2	+	3	294	c.107G>A	c.(106-108)AGG>AAG	p.R36K	FAM81A_uc010uha.1_Missense_Mutation_p.R36K	NM_152450	NP_689663	Q8TBF8	FA81A_HUMAN	hypothetical protein LOC145773	36										ovary(1)	1						CTGGAAGACAGGATCCTCTGC	0.532													5	23	---	---	---	---	PASS
ARNT2	9915	broad.mit.edu	37	15	80873576	80873576	+	Intron	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80873576G>T	uc002bfr.2	+						ARNT2_uc010unm.1_Intron|ARNT2_uc002bfs.2_Intron	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator						central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)			TGTCCTGATTGTAGCAAATCC	0.582													6	51	---	---	---	---	PASS
KIAA1199	57214	broad.mit.edu	37	15	81181912	81181912	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81181912C>T	uc002bfw.1	+	9	1325	c.1065C>T	c.(1063-1065)TGC>TGT	p.C355C	KIAA1199_uc010unn.1_Silent_p.C355C	NM_018689	NP_061159	Q8WUJ3	K1199_HUMAN	KIAA1199 precursor	355										upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						GAAAAATATGCAATCGTCCCA	0.363													30	23	---	---	---	---	PASS
C15orf42	90381	broad.mit.edu	37	15	90144552	90144552	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90144552G>T	uc002boe.2	+	10	2177	c.2177G>T	c.(2176-2178)CGT>CTT	p.R726L		NM_152259	NP_689472	Q7Z2Z1	TICRR_HUMAN	leucine-rich repeat kinase 1	726					cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GTATTTCTTCGTTTGGAGATG	0.383													15	58	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2168068	2168068	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2168068C>T	uc002cos.1	-	5	1134	c.925G>A	c.(925-927)GAC>AAC	p.D309N	PKD1_uc002cot.1_Missense_Mutation_p.D309N	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	309	Extracellular (Potential).|PKD 1.				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						GCGGAGCCGTCTCCGAAGTCC	0.716													11	13	---	---	---	---	PASS
BTBD12	84464	broad.mit.edu	37	16	3658448	3658448	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3658448G>C	uc002cvp.2	-	2	1145	c.518C>G	c.(517-519)TCC>TGC	p.S173C	BTBD12_uc002cvq.1_Missense_Mutation_p.S173C	NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	173	Interaction with C20orf94, ERCC4 and MSH2.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						TTTCTCTCTGGAAAGGTTTGG	0.353								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				25	23	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21061293	21061293	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21061293C>T	uc010vbe.1	-	30	4285	c.4285G>A	c.(4285-4287)GGT>AGT	p.G1429S		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1429	ATP (Potential).|AAA 1 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		CCAGCTGGACCCTCTGGAGCA	0.507													33	24	---	---	---	---	PASS
COG7	91949	broad.mit.edu	37	16	23417525	23417525	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23417525C>A	uc002dlo.2	-	12	1722	c.1534G>T	c.(1534-1536)GGT>TGT	p.G512C		NM_153603	NP_705831	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	512					intracellular protein transport|protein glycosylation|protein localization in Golgi apparatus|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0				GBM - Glioblastoma multiforme(48;0.0401)		TCCTGAAAACCAGCCAGGCTC	0.463													9	80	---	---	---	---	PASS
ABCC11	85320	broad.mit.edu	37	16	48239387	48239387	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48239387G>A	uc002eff.1	-	12	2092	c.1742C>T	c.(1741-1743)GCC>GTC	p.A581V	ABCC11_uc002efg.1_Missense_Mutation_p.A581V|ABCC11_uc002efh.1_Missense_Mutation_p.A581V|ABCC11_uc010vgk.1_RNA	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	581	ABC transporter 1.|Cytoplasmic (Potential).					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				GACGATCCAGGCCTGCTGGGG	0.622									Cerumen_Type				75	64	---	---	---	---	PASS
CCDC102A	92922	broad.mit.edu	37	16	57546761	57546761	+	Silent	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57546761G>A	uc002elw.2	-	9	1758	c.1545C>T	c.(1543-1545)AAC>AAT	p.N515N		NM_033212	NP_149989	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	515	Potential.									ovary(1)	1						AGAGGGGAGCGTTCTGCTGCT	0.642													37	44	---	---	---	---	PASS
IRF8	3394	broad.mit.edu	37	16	85952247	85952247	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85952247C>A	uc002fjh.2	+	7	883	c.826C>A	c.(826-828)CGC>AGC	p.R276S	IRF8_uc010chp.2_Intron	NM_002163	NP_002154	Q02556	IRF8_HUMAN	interferon regulatory factor 8	276					interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(2)|ovary(1)	3		Prostate(104;0.0771)				GCACCTGGAGCGCGGGGTGCT	0.716													9	9	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578556	7578556	+	Splice_Site	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578556T>C	uc002gim.2	-	5	570	c.376_splice	c.e5-1	p.Y126_splice	TP53_uc002gig.1_Splice_Site_p.Y126_splice|TP53_uc002gih.2_Splice_Site_p.Y126_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'UTR|TP53_uc010cng.1_5'UTR|TP53_uc002gii.1_5'UTR|TP53_uc010cnh.1_Splice_Site_p.Y126_splice|TP53_uc010cni.1_Splice_Site_p.Y126_splice|TP53_uc002gij.2_Splice_Site_p.Y126_splice|TP53_uc010cnj.1_Splice_Site|TP53_uc002gin.2_Splice_Site_p.Y33_splice|TP53_uc002gio.2_Splice_Site|TP53_uc010vug.1_Splice_Site_p.Y87_splice	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(14)|p.0?(7)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AGGGGAGTACTGTAGGAAGAG	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			19	6	---	---	---	---	PASS
MYH10	4628	broad.mit.edu	37	17	8413273	8413273	+	Intron	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8413273G>A	uc002gll.2	-						MYH10_uc002glm.2_Intron|MYH10_uc010cnx.2_Intron	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						AGGTCCTTGTGAAGAACACAC	0.443													32	13	---	---	---	---	PASS
ITGA2B	3674	broad.mit.edu	37	17	42466708	42466708	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42466708G>T	uc002igt.1	-	1	166	c.134C>A	c.(133-135)CCC>CAC	p.P45H		NM_000419	NP_000410	P08514	ITA2B_HUMAN	integrin alpha 2b preproprotein	45	Extracellular (Potential).|FG-GAP 1.				axon guidance|integrin-mediated signaling pathway|platelet activation|platelet degranulation	integrin complex|platelet alpha granule membrane	identical protein binding|receptor activity			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Tirofiban(DB00775)	GCTGCCATTGGGGCCTGCATA	0.592													50	30	---	---	---	---	PASS
TBX2	6909	broad.mit.edu	37	17	59482917	59482917	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59482917C>T	uc010wox.1	+	6	1687	c.1406C>T	c.(1405-1407)GCC>GTC	p.A469V	TBX2_uc002ize.2_3'UTR|TBX2_uc002izg.2_Missense_Mutation_p.A315V	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2	469	Gly-rich.				cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						CCCGGCCTGGCCTTTTCCAGC	0.716													4	3	---	---	---	---	PASS
BPTF	2186	broad.mit.edu	37	17	65907828	65907828	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65907828A>T	uc002jgf.2	+	11	3889	c.3828A>T	c.(3826-3828)GAA>GAT	p.E1276D	BPTF_uc002jge.2_Missense_Mutation_p.E1402D	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1402					brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGGACTTTGAAGGAAAACTGG	0.398													52	24	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78341763	78341763	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78341763T>G	uc002jyh.1	+	19	6417	c.6194T>G	c.(6193-6195)TTT>TGT	p.F2065C	uc002jyi.1_Intron|RNF213_uc010dhw.1_Missense_Mutation_p.F447C	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GATTCTAGGTTTGGGATTCAG	0.547													58	34	---	---	---	---	PASS
DSC3	1825	broad.mit.edu	37	18	28586895	28586895	+	Silent	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28586895C>A	uc002kwj.3	-	12	2021	c.1866G>T	c.(1864-1866)CTG>CTT	p.L622L	DSC3_uc002kwi.3_Silent_p.L622L	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein	622	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TGAGGCTCCACAGTCTACTGA	0.353													11	19	---	---	---	---	PASS
GRP	2922	broad.mit.edu	37	18	56897631	56897631	+	Intron	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56897631T>C	uc002lhv.2	+						GRP_uc002lhu.2_Intron|GRP_uc002lhw.2_Intron	NM_002091	NP_002082	P07492	GRP_HUMAN	gastrin-releasing peptide isoform 1						neuropeptide signaling pathway	extracellular space	neuropeptide hormone activity				0		Colorectal(73;0.0946)				CTAATATTTCTTAAGTTGGTA	0.358													17	30	---	---	---	---	PASS
CDH20	28316	broad.mit.edu	37	18	59221671	59221671	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59221671G>C	uc010dps.1	+	11	2161	c.2149G>C	c.(2149-2151)GCA>CCA	p.A717P	CDH20_uc002lif.2_Missense_Mutation_p.A711P	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	717	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)				TCAGACGTGCGCAGTGAACAG	0.662													8	22	---	---	---	---	PASS
DSEL	92126	broad.mit.edu	37	18	65179576	65179576	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65179576T>G	uc002lke.1	-	2	3524	c.2300A>C	c.(2299-2301)AAG>ACG	p.K767T		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	757						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)				TCTTACAGGCTTTACTATTGC	0.378													15	52	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74637290	74637290	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74637290G>C	uc002lmi.2	+	22	3999	c.3801G>C	c.(3799-3801)AAG>AAC	p.K1267N	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1267	C2H2-type 25.				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GTAGAAGAAAGACACACATGC	0.527													20	40	---	---	---	---	PASS
PALM	5064	broad.mit.edu	37	19	746310	746310	+	Silent	SNP	C	T	T	rs150589646	by1000genomes	TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:746310C>T	uc002lpm.1	+	9	854	c.660C>T	c.(658-660)GCC>GCT	p.A220A	PALM_uc002lpn.1_Silent_p.A176A|PALM_uc010xfu.1_Silent_p.A85A	NM_002579	NP_002570	O75781	PALM_HUMAN	paralemmin isoform 1	220					cellular component movement|negative regulation of adenylate cyclase activity|negative regulation of dopamine receptor signaling pathway|positive regulation of filopodium assembly|regulation of cell shape	cytoplasmic membrane-bounded vesicle|filopodium membrane|integral to plasma membrane					0		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)|Lung(535;0.201)		ACGGCACCGCCGAGAACGGGA	0.647													6	36	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9060155	9060155	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9060155G>T	uc002mkp.2	-	3	27495	c.27291C>A	c.(27289-27291)GAC>GAA	p.D9097E		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9099	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTGTTGAAGTGTCCAAGGTAA	0.483													27	40	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9076678	9076678	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9076678C>A	uc002mkp.2	-	3	10972	c.10768G>T	c.(10768-10770)GAT>TAT	p.D3590Y		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3591	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTCCAGGAATCTGATGCAGCT	0.493													17	55	---	---	---	---	PASS
S1PR2	9294	broad.mit.edu	37	19	10335434	10335434	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10335434C>T	uc002mnl.2	-	2	259	c.148G>A	c.(148-150)GAA>AAA	p.E50K		NM_004230	NP_004221	O95136	S1PR2_HUMAN	endothelial differentiation, sphingolipid	50	Helical; Name=1; (By similarity).				activation of MAPK activity|positive regulation of cell proliferation	integral to membrane|plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity			lung(1)|central_nervous_system(1)	2						AGAAGGTTTTCCACCACAATG	0.567													38	89	---	---	---	---	PASS
TYK2	7297	broad.mit.edu	37	19	10478977	10478977	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10478977C>A	uc002moc.3	-	4	689	c.311G>T	c.(310-312)CGC>CTC	p.R104L	TYK2_uc010dxe.2_Intron|TYK2_uc002mod.2_Missense_Mutation_p.R104L	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	104	FERM.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CCACCTTATGCGGAAATATAG	0.552													34	68	---	---	---	---	PASS
GIPC1	10755	broad.mit.edu	37	19	14589276	14589276	+	Silent	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14589276G>A	uc002myt.2	-	9	1224	c.954C>T	c.(952-954)GTC>GTT	p.V318V	GIPC1_uc002myu.2_Silent_p.V318V|GIPC1_uc002myv.2_Silent_p.V221V|GIPC1_uc002myw.2_Silent_p.V221V|GIPC1_uc002myx.2_Silent_p.V318V|GIPC1_uc002myy.2_Silent_p.V221V	NM_005716	NP_005707	O14908	GIPC1_HUMAN	regulator of G-protein signalling 19 interacting	318					endothelial cell migration|G-protein coupled receptor protein signaling pathway|glutamate secretion|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|protein targeting|regulation of protein stability|regulation of synaptic plasticity|synaptic transmission	cell cortex|dendritic shaft|dendritic spine|membrane fraction|soluble fraction|synaptic vesicle|vesicle membrane	actin binding|myosin binding|protein homodimerization activity|receptor binding				0						AGACGTCAAAGACGAACTCGT	0.657													5	6	---	---	---	---	PASS
CYP4F11	57834	broad.mit.edu	37	19	16024572	16024572	+	Silent	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16024572C>A	uc002nbu.2	-	13	1581	c.1545G>T	c.(1543-1545)CGG>CGT	p.R515R	CYP4F11_uc010eab.1_3'UTR|CYP4F11_uc002nbt.2_Silent_p.R515R	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide	515					inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1						GGGGCTCCACCCGCAGCCAAA	0.607													8	9	---	---	---	---	PASS
FAM129C	199786	broad.mit.edu	37	19	17660297	17660297	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17660297G>A	uc010xpr.1	+	15	1942	c.1804G>A	c.(1804-1806)GAC>AAC	p.D602N	FAM129C_uc010xpq.1_Missense_Mutation_p.D602N|FAM129C_uc002ngy.3_Missense_Mutation_p.D328N|FAM129C_uc010xpu.1_Intron|FAM129C_uc002ngz.3_RNA|FAM129C_uc010eaw.2_Missense_Mutation_p.D292N	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a	602											0						CTGCACTCTGGACGGCTGCTT	0.552													27	69	---	---	---	---	PASS
ARRDC2	27106	broad.mit.edu	37	19	18120427	18120427	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18120427G>C	uc002nhv.2	+	4	659	c.516G>C	c.(514-516)AAG>AAC	p.K172N	ARRDC2_uc002nhu.2_Missense_Mutation_p.K167N	NM_015683	NP_056498	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2 isoform 1	172										pancreas(1)	1						CTCGGGAAAAGGTTGCCCGAT	0.582													14	40	---	---	---	---	PASS
TMEM161A	54929	broad.mit.edu	37	19	19243311	19243311	+	Missense_Mutation	SNP	C	A	A	rs140905727	byFrequency	TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19243311C>A	uc002nlg.2	-	5	323	c.293G>T	c.(292-294)CGC>CTC	p.R98L	TMEM161A_uc010eca.2_RNA|TMEM161A_uc002nlh.2_Intron|TMEM161A_uc002nli.2_Intron|TMEM161A_uc002nlj.2_5'UTR	NM_017814	NP_060284	Q9NX61	T161A_HUMAN	transmembrane protein 161A precursor	98	Extracellular (Potential).				cellular response to oxidative stress|cellular response to UV|negative regulation of apoptosis|positive regulation of DNA repair|response to retinoic acid	integral to membrane				breast(2)	2			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			CAGGAAGAAGCGCAGGACTGT	0.587													12	41	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30936105	30936105	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30936105C>G	uc002nsu.1	+	2	1774	c.1636C>G	c.(1636-1638)CGC>GGC	p.R546G	ZNF536_uc010edd.1_Missense_Mutation_p.R546G	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	546					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					TCCGCTGCAGCGCAACCACGA	0.562													17	54	---	---	---	---	PASS
MAG	4099	broad.mit.edu	37	19	35791178	35791178	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35791178C>T	uc002nyy.1	+	6	990	c.841C>T	c.(841-843)CGG>TGG	p.R281W	MAG_uc002nyx.1_Missense_Mutation_p.R281W|MAG_uc010eds.1_Missense_Mutation_p.R256W|MAG_uc002nyz.1_Missense_Mutation_p.R281W	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a	281	Ig-like C2-type 2.|Extracellular (Potential).				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GACAGTCCTCCGGGAGGCGGT	0.697													6	12	---	---	---	---	PASS
SIPA1L3	23094	broad.mit.edu	37	19	38682891	38682891	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38682891G>T	uc002ohk.2	+	17	5046	c.4537G>T	c.(4537-4539)GAC>TAC	p.D1513Y		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	1513					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CATCGAGGATGACCTGAAGAA	0.587													9	19	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41007885	41007885	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41007885A>G	uc002ony.2	+	8	928	c.842A>G	c.(841-843)TAC>TGC	p.Y281C	SPTBN4_uc002onx.2_Missense_Mutation_p.Y281C|SPTBN4_uc002onz.2_Missense_Mutation_p.Y281C	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	281	Actin-binding.|CH 2.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GTCTCTTTCTACCACTATTTC	0.522													48	94	---	---	---	---	PASS
ZNF235	9310	broad.mit.edu	37	19	44793161	44793161	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44793161C>T	uc002oza.3	-	5	530	c.427G>A	c.(427-429)GTG>ATG	p.V143M	ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF235_uc002ozb.3_Missense_Mutation_p.V139M|ZNF235_uc010xwx.1_Missense_Mutation_p.V57M	NM_004234	NP_004225	Q14590	ZN235_HUMAN	zinc finger protein 93 homolog	143					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)	3		Prostate(69;0.0352)|all_neural(266;0.116)				CCTGCTCCCACTTGACAGGGG	0.428													26	64	---	---	---	---	PASS
PVRL2	5819	broad.mit.edu	37	19	45368682	45368682	+	Silent	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45368682T>C	uc002ozw.1	+	2	633	c.243T>C	c.(241-243)AAT>AAC	p.N81N	PVRL2_uc002ozv.2_Silent_p.N81N	NM_001042724	NP_001036189	Q92692	PVRL2_HUMAN	poliovirus receptor related 2 isoform delta	81	Ig-like V-type.|Extracellular (Potential).				adherens junction organization|adhesion to symbiont|cell junction assembly|homophilic cell adhesion|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|susceptibility to natural killer cell mediated cytotoxicity|susceptibility to T cell mediated cytotoxicity|viral envelope fusion with host membrane|virion attachment, binding of host cell surface coreceptor	cell surface|integral to membrane|zonula adherens	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		ACCACCAGAATGTGGCCGCCT	0.647													9	22	---	---	---	---	PASS
CLPTM1	1209	broad.mit.edu	37	19	45477734	45477734	+	Silent	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45477734A>G	uc002pai.2	+	4	363	c.348A>G	c.(346-348)ACA>ACG	p.T116T	CLPTM1_uc010ejv.1_Silent_p.T14T|CLPTM1_uc010xxf.1_Silent_p.T14T|CLPTM1_uc010xxg.1_Silent_p.T102T	NM_001294	NP_001285	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane	116	Extracellular (Potential).				cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane				ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		AGCACTTTACAGACTTCAACG	0.557													11	36	---	---	---	---	PASS
GRLF1	2909	broad.mit.edu	37	19	47425108	47425108	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47425108T>C	uc010ekv.2	+	1	3176	c.3176T>C	c.(3175-3177)TTA>TCA	p.L1059S		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	1059					axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		CTATCTTATTTAGACCAAGGC	0.458													9	16	---	---	---	---	PASS
ZNF808	388558	broad.mit.edu	37	19	53057901	53057901	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53057901C>G	uc010epq.1	+	5	1909	c.1732C>G	c.(1732-1734)CAA>GAA	p.Q578E	ZNF808_uc002pzq.2_RNA|ZNF808_uc010epr.1_5'Flank	NM_001039886	NP_001034975	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	578	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		AGCTTTTAATCAACAATCACA	0.373													30	65	---	---	---	---	PASS
FCAR	2204	broad.mit.edu	37	19	55401172	55401172	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55401172C>A	uc002qhr.1	+	5	1004	c.807C>A	c.(805-807)AGC>AGA	p.S269R	FCAR_uc002qhs.1_RNA|FCAR_uc002qht.1_Missense_Mutation_p.S220R|FCAR_uc010esi.1_Missense_Mutation_p.S146R|FCAR_uc002qhu.1_Missense_Mutation_p.S173R|FCAR_uc002qhv.1_Missense_Mutation_p.S247R|FCAR_uc002qhw.1_Missense_Mutation_p.S257R|FCAR_uc002qhx.1_Missense_Mutation_p.S161R|FCAR_uc002qhy.1_Missense_Mutation_p.S235R|FCAR_uc002qhz.1_3'UTR|FCAR_uc002qia.1_Missense_Mutation_p.S160R	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor	269	Cytoplasmic (Potential).				immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		CGAGCTGGAGCCAACAGATGT	0.547													30	75	---	---	---	---	PASS
DUXA	503835	broad.mit.edu	37	19	57678802	57678802	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57678802C>A	uc002qoa.1	-	1	55	c.10G>T	c.(10-12)GAC>TAC	p.D4Y		NM_001012729	NP_001012747	A6NLW8	DUXA_HUMAN	double homeobox A	4						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		GAATAGGTGTCTTCGGCCATG	0.502													27	66	---	---	---	---	PASS
NKX2-2	4821	broad.mit.edu	37	20	21492936	21492936	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21492936C>A	uc002wsi.2	-	2	804	c.447G>T	c.(445-447)CAG>CAT	p.Q149H		NM_002509	NP_002500	O95096	NKX22_HUMAN	NK2 transcription factor related, locus 2	149	Homeobox.				brain development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	chromatin binding|core promoter proximal region DNA binding|transcription coactivator activity			pancreas(1)|skin(1)	2						GGTACCGCTGCTGCCGAAAGC	0.672													8	27	---	---	---	---	PASS
PLAGL2	5326	broad.mit.edu	37	20	30784376	30784376	+	Missense_Mutation	SNP	G	T	T	rs142086831		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30784376G>T	uc002wxn.2	-	3	1587	c.1370C>A	c.(1369-1371)CCT>CAT	p.P457H		NM_002657	NP_002648	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	457						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GGAATCTTGAGGCTGAGCTTG	0.622													6	19	---	---	---	---	PASS
EMILIN3	90187	broad.mit.edu	37	20	39991677	39991677	+	Silent	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39991677G>A	uc002xjy.1	-	4	756	c.532C>T	c.(532-534)CTG>TTG	p.L178L		NM_052846	NP_443078	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	178						proteinaceous extracellular matrix				ovary(1)	1		Myeloproliferative disorder(115;0.00425)				TCACCAAACAGCCCTGGGCCT	0.597													5	5	---	---	---	---	PASS
NPEPL1	79716	broad.mit.edu	37	20	57273764	57273764	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57273764G>A	uc010zzs.1	+	4	627	c.532G>A	c.(532-534)GTG>ATG	p.V178M	NPEPL1_uc010zzr.1_Missense_Mutation_p.V130M|NPEPL1_uc002xzn.2_RNA|NPEPL1_uc010gjo.1_Missense_Mutation_p.V150M|NPEPL1_uc002xzp.2_Missense_Mutation_p.V66M	NM_024663	NP_078939	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1	178					proteolysis	cytoplasm	aminopeptidase activity|manganese ion binding|metalloexopeptidase activity				0	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			CACAGACGGCGTGCGGCTAGC	0.602													7	30	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10942991	10942991	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10942991A>T	uc002yip.1	-	12	964	c.596T>A	c.(595-597)CTT>CAT	p.L199H	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.L181H|TPTE_uc002yir.1_Missense_Mutation_p.L161H|TPTE_uc010gkv.1_Missense_Mutation_p.L61H	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	199					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CAGAATAATAAGTCGTAGAAG	0.308													8	53	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22849615	22849615	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22849615G>A	uc002yld.1	+	15	2149	c.1900G>A	c.(1900-1902)GAT>AAT	p.D634N	NCAM2_uc011acb.1_Missense_Mutation_p.D492N	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	634	Fibronectin type-III 2.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TTCACAGAAAGATAAGGAAGA	0.328													9	17	---	---	---	---	PASS
RNF160	26046	broad.mit.edu	37	21	30302818	30302818	+	Silent	SNP	T	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30302818T>C	uc002ymr.2	-	30	5404	c.5391A>G	c.(5389-5391)ACA>ACG	p.T1797T		NM_015565	NP_056380	O94822	LTN1_HUMAN	zinc finger protein 294	1751	RING-type.						ligase activity|zinc ion binding				0						TGTTGCTAGATGTAAACCATT	0.338													17	59	---	---	---	---	PASS
ZNF74	7625	broad.mit.edu	37	22	20760468	20760468	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20760468A>G	uc010gsm.2	+	6	1357	c.1145A>G	c.(1144-1146)CAC>CGC	p.H382R	ZNF74_uc002zsg.2_Missense_Mutation_p.H311R|ZNF74_uc002zsh.2_Missense_Mutation_p.H382R|ZNF74_uc002zsi.2_Missense_Mutation_p.H311R|ZNF74_uc010gsn.2_Missense_Mutation_p.H311R	NM_003426	NP_003417	Q16587	ZNF74_HUMAN	zinc finger protein 74	382	C2H2-type 5.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CACCGCATCCACACGGGCGAG	0.657													10	34	---	---	---	---	PASS
EIF4ENIF1	56478	broad.mit.edu	37	22	31835938	31835938	+	Silent	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31835938A>G	uc003akz.1	-	19	3050	c.2886T>C	c.(2884-2886)GAT>GAC	p.D962D	EIF4ENIF1_uc003akx.1_Silent_p.D617D|EIF4ENIF1_uc003aky.1_Silent_p.D642D|EIF4ENIF1_uc003ala.1_Silent_p.D962D|EIF4ENIF1_uc003alb.1_Silent_p.D788D|EIF4ENIF1_uc003akw.1_Silent_p.D452D	NM_019843	NP_062817	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E	962						nucleus	protein binding|protein transporter activity			ovary(1)	1						GCTGTAGCACATCTGAGCCAA	0.602													9	51	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41553417	41553417	+	Intron	SNP	G	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41553417G>A	uc003azl.3	+							NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300						apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						AGAAAGGTAAGAAATGTGTTT	0.408			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				11	66	---	---	---	---	PASS
TNFRSF13C	115650	broad.mit.edu	37	22	42321458	42321458	+	Silent	SNP	T	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42321458T>G	uc003bbl.2	-	3	512	c.468A>C	c.(466-468)CCA>CCC	p.P156P	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|TNFRSF13C_uc010gyp.1_Silent_p.P157P	NM_052945	NP_443177	Q96RJ3	TR13C_HUMAN	BAFF receptor	156	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						TGTGGCCAGGTGGGGTGGTTC	0.637													5	46	---	---	---	---	PASS
ARSF	416	broad.mit.edu	37	X	3030249	3030249	+	Silent	SNP	G	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3030249G>C	uc004cre.1	+	11	1646	c.1425G>C	c.(1423-1425)CCG>CCC	p.P475P	ARSF_uc004crf.1_Silent_p.P475P	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor	475						extracellular region	arylsulfatase activity|metal ion binding			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ATGTGACCCCGGTATTCCAGC	0.363													20	10	---	---	---	---	PASS
TLR8	51311	broad.mit.edu	37	X	12937337	12937337	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12937337A>G	uc004cve.2	+	2	246	c.178A>G	c.(178-180)ACG>GCG	p.T60A	TLR8_uc004cvd.2_Missense_Mutation_p.T78A	NM_138636	NP_619542	Q9NR97	TLR8_HUMAN	toll-like receptor 8 precursor	60	Extracellular (Potential).				cellular response to mechanical stimulus|defense response to virus|I-kappaB kinase/NF-kappaB cascade|immunoglobulin mediated immune response|inflammatory response|innate immune response|positive regulation of innate immune response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process	endosome membrane	DNA binding|double-stranded RNA binding|single-stranded RNA binding|transmembrane receptor activity			ovary(4)|lung(2)|large_intestine(1)	7						AGTTCCCCAAACGGTGGGCAA	0.383													3	41	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	31462724	31462724	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31462724C>T	uc004dda.1	-	60	9202	c.8958G>A	c.(8956-8958)GCG>GCA	p.A2986A	DMD_uc004dcq.1_Silent_p.A257A|DMD_uc004dcr.1_Silent_p.A526A|DMD_uc004dcs.1_Silent_p.A526A|DMD_uc004dct.1_Silent_p.A526A|DMD_uc004dcu.1_Silent_p.A526A|DMD_uc004dcv.1_Silent_p.A526A|DMD_uc004dcw.2_Silent_p.A1642A|DMD_uc004dcx.2_Silent_p.A1645A|DMD_uc004dcz.2_Silent_p.A2863A|DMD_uc004dcy.1_Silent_p.A2982A|DMD_uc004ddb.1_Silent_p.A2978A	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2986	Spectrin 22.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTTTCAGAGGCGCAATTTCTC	0.453													11	6	---	---	---	---	PASS
MAOB	4129	broad.mit.edu	37	X	43702931	43702931	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:43702931C>T	uc004dfz.3	-	2	302	c.126G>A	c.(124-126)AGG>AGA	p.R42R	MAOB_uc011mkx.1_Silent_p.R26R|MAOB_uc011mky.1_Silent_p.R26R|MAOB_uc010nhj.2_Silent_p.R42R	NM_000898	NP_000889	P27338	AOFB_HUMAN	monoamine oxidase B	42	Arg/Lys-rich (basic).|Cytoplasmic.				xenobiotic metabolic process	integral to membrane|mitochondrial outer membrane	electron carrier activity|primary amine oxidase activity			ovary(1)|central_nervous_system(1)	2					Amantadine(DB00915)|Bupropion(DB01156)|Carbidopa(DB00190)|Citalopram(DB00215)|Dopamine(DB00988)|Entacapone(DB00494)|Furazolidone(DB00614)|Ginkgo biloba(DB01381)|Ibuprofen(DB01050)|Imipramine(DB00458)|Iproniazid(DB04818)|Isocarboxazid(DB01247)|Levodopa(DB01235)|Maprotiline(DB00934)|Meclizine(DB00737)|Moclobemide(DB01171)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Rasagiline(DB01367)|Selegiline(DB01037)|Tranylcypromine(DB00752)	GAGTGTAAGTCCTGCCTCCCA	0.483													16	8	---	---	---	---	PASS
PGAM4	441531	broad.mit.edu	37	X	77224608	77224608	+	Silent	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77224608C>T	uc004ecy.1	-	1	528	c.528G>A	c.(526-528)AAG>AAA	p.K176K	ATP7A_uc004ecw.2_Intron|ATP7A_uc004ecx.3_Intron	NM_001029891	NP_001025062	Q8N0Y7	PGAM4_HUMAN	bisphosphoglycerate mutase 4	176					glycolysis		2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity|phosphoglycerate mutase activity				0						GTTTCCCCTCCTTGATCTGGG	0.522													33	12	---	---	---	---	PASS
ATP7A	538	broad.mit.edu	37	X	77301842	77301842	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77301842A>G	uc004ecx.3	+	23	4438	c.4278A>G	c.(4276-4278)ATA>ATG	p.I1426M		NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1426	Cytoplasmic (Potential).				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						GGAGCCAGATAGGACAGAAGA	0.403													57	27	---	---	---	---	PASS
PABPC5	140886	broad.mit.edu	37	X	90691561	90691561	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90691561A>T	uc004efg.2	+	2	1425	c.985A>T	c.(985-987)AGT>TGT	p.S329C	PABPC5_uc004eff.1_Missense_Mutation_p.S165C	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	329	RRM 4.					cytoplasm	nucleotide binding|RNA binding			ovary(1)|lung(1)|pancreas(1)	3						TGGGTCAATTAGTCGGGCCAA	0.443													20	10	---	---	---	---	PASS
HTR2C	3358	broad.mit.edu	37	X	113865290	113865290	+	Intron	SNP	C	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:113865290C>A	uc004epu.1	+						HTR2C_uc010nqc.1_Intron|HTR2C_uc004epv.1_Intron|SNORA35_uc004epw.1_RNA	NM_000868	NP_000859	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C						cGMP biosynthetic process|ERK1 and ERK2 cascade|feeding behavior|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	cytoplasm|integral to membrane|nucleus|plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|protein binding|serotonin binding|serotonin receptor activity			ovary(3)	3					Chlorprothixene(DB01239)|Clozapine(DB00363)|Dexfenfluramine(DB01191)|Fenfluramine(DB00574)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Tramadol(DB00193)|Ziprasidone(DB00246)	TGGGCTCCATCTTGACCAACT	0.547													13	7	---	---	---	---	PASS
ZDHHC9	51114	broad.mit.edu	37	X	128957694	128957694	+	Missense_Mutation	SNP	G	A	A	rs137852215		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128957694G>A	uc004euv.2	-	4	817	c.448C>T	c.(448-450)CCC>TCC	p.P150S	ZDHHC9_uc004euw.2_Missense_Mutation_p.P150S|ZDHHC9_uc004eux.1_Missense_Mutation_p.P150S|ZDHHC9_uc004euy.1_Missense_Mutation_p.P77S	NM_001008222	NP_001008223	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC domain containing 9	150	Cytoplasmic (Potential).|DHHC-type.		P -> S (in MRXSZ).			endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1						GAGGCCCGGGGAGGCCGGAAG	0.507													33	27	---	---	---	---	PASS
GABRA3	2556	broad.mit.edu	37	X	151336921	151336921	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151336921C>T	uc010ntk.1	-	10	1498	c.1258G>A	c.(1258-1260)GCT>ACT	p.A420T		NM_000808	NP_000799	P34903	GBRA3_HUMAN	gamma-aminobutyric acid A receptor, alpha 3	420	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	p.A420T(1)		ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)				Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CTGGGAGCAGCGCCCTTGGAG	0.552													64	31	---	---	---	---	PASS
CELA2B	51032	broad.mit.edu	37	1	15809913	15809914	+	Intron	INS	-	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15809913_15809914insC	uc001awl.2	+							NM_015849	NP_056933	P08218	CEL2B_HUMAN	elastase 2B preproprotein						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						GGAGCCAGGAGCCCCCAGGCCT	0.644													27	35	---	---	---	---	
CLCNKA	1187	broad.mit.edu	37	1	16360071	16360072	+	Intron	INS	-	C	C			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16360071_16360072insC	uc001axu.2	+						CLCNKA_uc001axt.2_Intron|CLCNKA_uc001axv.2_Intron|CLCNKA_uc010obw.1_Intron|CLCNKB_uc001axw.3_Intron	NM_004070	NP_004061	P51800	CLCKA_HUMAN	chloride channel Ka isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	CTCCTCTACATCCCCCCCCACC	0.535													13	7	---	---	---	---	
RUNX3	864	broad.mit.edu	37	1	25291141	25291141	+	5'UTR	DEL	T	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25291141delT	uc009vrj.2	-	2					RUNX3_uc001bjr.2_5'UTR|RUNX3_uc009vrk.2_5'UTR|RUNX3_uc009vrl.1_Intron	NM_001031680	NP_001026850	Q13761	RUNX3_HUMAN	runt-related transcription factor 3 isoform 1						cell proliferation|induction of apoptosis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|protein phosphorylation|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		TGTTGTTTTATTTTTTTTTCC	0.443													4	2	---	---	---	---	
PTGER3	5733	broad.mit.edu	37	1	71438805	71438806	+	Intron	DEL	GT	-	-	rs141568629		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71438805_71438806delGT	uc001dfg.1	-						PTGER3_uc001dfh.1_Intron|PTGER3_uc001dfi.1_Intron|PTGER3_uc001dfj.1_Intron|PTGER3_uc001dfk.1_Intron|PTGER3_uc001dfl.1_Intron|PTGER3_uc009wbm.1_Intron|PTGER3_uc001dfm.1_Intron|PTGER3_uc001dfn.2_Intron|PTGER3_uc009wbn.1_Intron|PTGER3_uc009wbo.2_Intron|PTGER3_uc001dfo.2_Intron|PTGER3_uc001dfp.1_Intron	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform						cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)	CAgtgtgcacgtgtgtgtgtgt	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	106433417	106433417	+	IGR	DEL	G	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:106433417delG								None (None upstream) : None (None downstream)																							ATACTCTTCTGGGATTGTATA	0.403													27	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	152628870	152628870	+	IGR	DEL	C	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152628870delC								LCE3A (33291 upstream) : LCE2D (7002 downstream)																							CTACCAAGTGCCCCCCAAAAT	0.567													14	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	248789379	248789380	+	IGR	INS	-	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248789379_248789380insA								OR2T10 (32310 upstream) : OR2T11 (99 downstream)																							TCTTAACTGCCAGTAGTAAGTG	0.450													1	9	---	---	---	---	
NFE2L2	4780	broad.mit.edu	37	2	178098935	178098937	+	In_Frame_Del	DEL	AAT	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098935_178098937delAAT	uc002ulh.3	-	2	663_665	c.108_110delATT	c.(106-111)GTATTT>GTT	p.F37del	NFE2L2_uc002ulg.3_In_Frame_Del_p.F21del|NFE2L2_uc010zfa.1_In_Frame_Del_p.F21del|NFE2L2_uc002uli.3_In_Frame_Del_p.F21del|NFE2L2_uc010fra.2_In_Frame_Del_p.F21del|NFE2L2_uc010frb.2_In_Frame_Del_p.F21del	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	37					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ACTGAAGTCAAATACTTCTCGAC	0.384			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			32	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	216402777	216402778	+	IGR	INS	-	CTA	CTA	rs138976228	by1000genomes	TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216402777_216402778insCTA								FN1 (101986 upstream) : MREG (404537 downstream)																							cttccttccttccttccttcct	0.188													4	3	---	---	---	---	
HHATL	57467	broad.mit.edu	37	3	42740026	42740026	+	Intron	DEL	A	-	-	rs34722222		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42740026delA	uc003clw.2	-						HHATL_uc003clx.2_Intron	NM_020707	NP_065758	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like						negative regulation of N-terminal protein palmitoylation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm				ovary(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.215)		GATGATCTGGATAGTTCCTCC	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	122242443	122242443	+	IGR	DEL	C	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122242443delC								KPNA1 (8657 upstream) : PARP9 (4319 downstream)																							tcttttctttctttttttttt	0.000													4	2	---	---	---	---	
WDFY3	23001	broad.mit.edu	37	4	85699910	85699913	+	Intron	DEL	ACAA	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85699910_85699913delACAA	uc003hpd.2	-							NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		acatacacacacaaacacacacat	0.147													3	7	---	---	---	---	
CDH6	1004	broad.mit.edu	37	5	31267935	31267935	+	Intron	DEL	T	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31267935delT	uc003jhe.1	+						CDH6_uc003jhd.1_Intron	NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7						CTGGTAAGACTTTTTTTTTTT	0.368													9	4	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	32010190	32010191	+	Intron	INS	-	AAAAAAAAAAA	AAAAAAAAAAA	rs66669782		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32010190_32010191insAAAAAAAAAAA	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						aagactgtctcaaaaaaaagaa	0.158													6	3	---	---	---	---	
ISOC1	51015	broad.mit.edu	37	5	128440485	128440485	+	Intron	DEL	T	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128440485delT	uc003kva.2	+							NM_016048	NP_057132	Q96CN7	ISOC1_HUMAN	isochorismatase domain containing 1							peroxisome	catalytic activity				0		all_cancers(142;0.0813)|Prostate(80;0.0865)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)		tctttttgagttttttttttt	0.030													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	153939208	153939210	+	IGR	DEL	GGA	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153939208_153939210delGGA								HAND1 (81384 upstream) : MIR1303 (126126 downstream)																							aggaggagggggaggaggaggag	0.207													4	2	---	---	---	---	
ATXN1	6310	broad.mit.edu	37	6	16327913	16327915	+	In_Frame_Del	DEL	TGA	-	-	rs11969612	by1000genomes	TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16327913_16327915delTGA	uc003nbt.2	-	8	1598_1600	c.627_629delTCA	c.(625-630)CATCAG>CAG	p.H209del	ATXN1_uc010jpi.2_In_Frame_Del_p.H209del|ATXN1_uc010jpj.1_Intron	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1	209	Poly-Gln.				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				ctgctgatgctgatgctgctgct	0.379													4	11	---	---	---	---	
HIST1H2BH	8345	broad.mit.edu	37	6	26252236	26252236	+	Frame_Shift_Del	DEL	A	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26252236delA	uc003nhh.2	+	1	358	c.358delA	c.(358-360)ACCfs	p.T120fs	HIST1H3F_uc003nhg.1_5'Flank	NM_003524	NP_003515	Q93079	H2B1H_HUMAN	histone cluster 1, H2bh	120					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(3)	3						TAAGGCCGTCACCAAGTACAC	0.537													33	37	---	---	---	---	
SNX3	8724	broad.mit.edu	37	6	108533548	108533549	+	Intron	INS	-	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108533548_108533549insT	uc003psh.2	-						SNX3_uc003psi.2_Intron|SNX3_uc010kdi.2_Intron	NM_003795	NP_003786	O60493	SNX3_HUMAN	sorting nexin 3 isoform a						cell communication|endocytosis|protein transport	early endosome|endosome membrane	phosphatidylinositol-3-phosphate binding|protein phosphatase binding				0		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0136)|Epithelial(106;0.0564)|OV - Ovarian serous cystadenocarcinoma(136;0.0717)|all cancers(137;0.0743)		AGCATGTATAAttttttttttt	0.158													4	2	---	---	---	---	
SLC2A12	154091	broad.mit.edu	37	6	134373388	134373389	+	Intron	INS	-	ACACACAC	ACACACAC	rs150064447		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134373388_134373389insACACACAC	uc003qem.1	-							NM_145176	NP_660159	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose							endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity			ovary(1)	1	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		CGCGCGCGcatacacacacaca	0.455													3	3	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	144843999	144843999	+	Intron	DEL	A	-	-	rs150930485		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144843999delA	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AGTATCATTTAAAAAAAAAAA	0.289													4	2	---	---	---	---	
TMEM181	57583	broad.mit.edu	37	6	159044795	159044795	+	Intron	DEL	T	-	-	rs67157899		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159044795delT	uc003qrm.3	+						TMEM181_uc010kjr.1_Intron	NM_020823	NP_065874	Q9P2C4	TM181_HUMAN	G protein-coupled receptor 178						pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		TTTGGGGAAAttttttttttt	0.184													4	2	---	---	---	---	
STAG3L4	64940	broad.mit.edu	37	7	66767611	66767611	+	5'Flank	DEL	T	-	-	rs12531701	by1000genomes	TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66767611delT	uc003tvt.3	+						PMS2L4_uc003tvo.2_5'Flank|PMS2L4_uc003tvq.2_5'Flank|PMS2L4_uc003tvr.3_5'Flank|PMS2L4_uc003tvs.3_5'Flank|STAG3L4_uc010laj.2_5'Flank	NM_022906	NP_075057	Q8TBR4	STG34_HUMAN	stromal antigen 3-like 4												0		Lung NSC(55;0.0839)|all_lung(88;0.181)				ACCGGACTGCTTTTTTTTTTT	0.542													6	3	---	---	---	---	
LHFPL3	375612	broad.mit.edu	37	7	103969195	103969197	+	5'UTR	DEL	AGG	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103969195_103969197delAGG	uc003vce.2	+	1					LHFPL3_uc003vcf.2_5'UTR	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3							integral to membrane					0						gcggaggaccaggaggaggagga	0.419													4	4	---	---	---	---	
ZNF786	136051	broad.mit.edu	37	7	148767305	148767305	+	3'UTR	DEL	A	-	-	rs74496698		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148767305delA	uc003wfh.2	-	4					ZNF786_uc011kuk.1_3'UTR|ZNF786_uc003wfi.2_3'UTR	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			tccatcttggaaaaaaaaaaa	0.189													4	2	---	---	---	---	
ZNF705D	728957	broad.mit.edu	37	8	11952949	11952950	+	Intron	INS	-	TG	TG			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11952949_11952950insTG	uc003wva.2	+							NM_001039615	NP_001034704	P0CH99	Z705D_HUMAN	zinc finger protein 705D						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTGTGTGGATTTGTGTGTGTGT	0.252													4	4	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20789722	20789722	+	Intron	DEL	T	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20789722delT	uc003zog.1	+							NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		GGGTTGATGAttttttttttt	0.224													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44097480	44097481	+	IGR	INS	-	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44097480_44097481insA								FAM75A6 (466750 upstream) : FAM27C (892755 downstream)																							ATCCAGCTTCCCCTCAAAAAAG	0.312													16	13	---	---	---	---	
TMC1	117531	broad.mit.edu	37	9	75430881	75430881	+	Intron	DEL	A	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75430881delA	uc004aiz.1	+						TMC1_uc010moz.1_Intron|TMC1_uc004aja.1_Intron|TMC1_uc004ajb.1_Intron|TMC1_uc004ajc.1_Intron|TMC1_uc010mpa.1_Intron	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1						CACTGTGTTTAAAAAAAAAAA	0.209													4	2	---	---	---	---	
NR4A3	8013	broad.mit.edu	37	9	102591156	102591156	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102591156delC	uc004baf.1	+	3	1561	c.832delC	c.(832-834)CCGfs	p.P278fs	NR4A3_uc004bae.2_Frame_Shift_Del_p.P278fs|NR4A3_uc004bag.1_Frame_Shift_Del_p.P278fs|NR4A3_uc004bai.2_Frame_Shift_Del_p.P289fs	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	278					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				TCCCAGCCTGCCGTCGCCGCC	0.746			T	EWSR1	extraskeletal myxoid chondrosarcoma								4	3	---	---	---	---	
LAMC3	10319	broad.mit.edu	37	9	133967310	133967311	+	3'UTR	INS	-	CA	CA	rs139352027	by1000genomes	TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133967310_133967311insCA	uc004caa.1	+	28					LAMC3_uc010mze.1_3'UTR	NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor						cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GTGTGGATAGTCACTCCCTGCC	0.594													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38981889	38981890	+	IGR	INS	-	ACAT	ACAT	rs117971611	by1000genomes	TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38981889_38981890insACAT								LOC399744 (240809 upstream) : None (None downstream)																							CACACACACACGCAGTAAATAC	0.272													4	2	---	---	---	---	
OR51B2	79345	broad.mit.edu	37	11	5344882	5344882	+	Frame_Shift_Del	DEL	A	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5344882delA	uc001mao.1	-	1	701	c.646delT	c.(646-648)TATfs	p.Y216fs	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033180	NP_149420	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B,	216	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATTAGAATATAGGAGAAGAGG	0.383													15	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	69594096	69594102	+	IGR	DEL	AAGAGAT	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69594096_69594102delAAGAGAT								CPM (237076 upstream) : CPSF6 (39215 downstream)																							agagataagaaagagataagagataag	0.024													4	2	---	---	---	---	
LRCH1	23143	broad.mit.edu	37	13	47224214	47224214	+	Intron	DEL	A	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47224214delA	uc001vbj.2	+						LRCH1_uc010acp.2_Intron|LRCH1_uc001vbk.2_Intron|LRCH1_uc001vbl.3_Intron	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)											ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		ACAGAGGTGCAAAAAAAAATG	0.299													4	2	---	---	---	---	
FRMD6	122786	broad.mit.edu	37	14	52167714	52167715	+	Intron	INS	-	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52167714_52167715insT	uc001wzd.2	+						FRMD6_uc001wzb.2_Intron|FRMD6_uc001wzc.2_Intron|FRMD6_uc001wze.2_Intron	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN	FERM domain containing 6							cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)					TTCTTTCTATATTTTTTTTCTT	0.307													5	5	---	---	---	---	
MIR376A2	664615	broad.mit.edu	37	14	101506227	101506228	+	5'Flank	DEL	TG	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101506227_101506228delTG	hsa-mir-376a-2|MI0003529	+						MIR654_hsa-mir-654|MI0003676_5'Flank|MIR376B_hsa-mir-376b|MI0002466_5'Flank|uc010awc.1_5'Flank|MIR376A1_hsa-mir-376a-1|MI0000784_5'Flank|MIR300_hsa-mir-300|MI0005525_5'Flank																	0						TCGTGCCATATGTCTGCGGACC	0.589													5	18	---	---	---	---	
MLST8	64223	broad.mit.edu	37	16	2255814	2255814	+	Intron	DEL	A	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2255814delA	uc002coz.2	+						MLST8_uc002coy.2_Intron|MLST8_uc002cpa.2_Intron|MLST8_uc002cpb.2_Intron|MLST8_uc010uvx.1_Intron|MLST8_uc002cpc.2_Intron|MLST8_uc002cpd.2_Intron|MLST8_uc002cpe.2_5'UTR|MLST8_uc010uvy.1_5'UTR|MLST8_uc002cpg.2_5'UTR|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_5'UTR	NM_022372	NP_071767	Q9BVC4	LST8_HUMAN	G protein beta subunit-like						insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0						TGGGGGGGGGACGGCGCCCCC	0.488													5	4	---	---	---	---	
RSL1D1	26156	broad.mit.edu	37	16	11940251	11940252	+	Intron	INS	-	A	A			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11940251_11940252insA	uc002dbp.1	-						RSL1D1_uc010buv.1_Intron|RSL1D1_uc010uyw.1_Intron|RSL1D1_uc010buw.2_Intron	NM_015659	NP_056474	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1						regulation of protein localization|translation	large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						gactccatctcaaaaaaaaaaa	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34329586	34329586	+	IGR	DEL	G	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34329586delG								MIR1826 (363994 upstream) : UBE2MP1 (74216 downstream)																							ACTGAAATCTGGtttttaaaa	0.214													4	4	---	---	---	---	
RNFT1	51136	broad.mit.edu	37	17	58031310	58031310	+	Intron	DEL	T	-	-	rs112263224		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58031310delT	uc002iya.2	-						RNFT1_uc002iyb.2_Intron|RNFT1_uc002iyc.2_Intron	NM_016125	NP_057209	Q5M7Z0	RNFT1_HUMAN	PTD016 protein							integral to membrane	zinc ion binding				0	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			AAACACTAGATTTTTTTTTTT	0.323													4	2	---	---	---	---	
RNMT	8731	broad.mit.edu	37	18	13742794	13742794	+	Intron	DEL	A	-	-	rs7229786		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13742794delA	uc002ksk.1	+						RNMT_uc002ksl.1_Intron|RNMT_uc002ksm.1_Intron|RNMT_uc010dlk.2_Intron|RNMT_uc010xae.1_Intron	NM_003799	NP_003790	O43148	MCES_HUMAN	RNA (guanine-7-) methyltransferase						mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	mRNA (guanine-N7-)-methyltransferase activity|RNA binding				0						TTGTGTTTTTAAAAAAAAAAA	0.289													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21817605	21817605	+	IGR	DEL	G	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21817605delG								ZNF429 (78537 upstream) : ZNF100 (89239 downstream)																							aaaaaaaaaagaaaaaaacaa	0.104													8	4	---	---	---	---	
GPATCH1	55094	broad.mit.edu	37	19	33620855	33620856	+	Intron	INS	-	A	A	rs140157903		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33620855_33620856insA	uc002nug.1	+						GPATCH1_uc002nuh.1_Intron|WDR88_uc002nui.2_5'Flank	NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1							catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					catctcgggggaaaaaaaaaaa	0.213													4	2	---	---	---	---	
KIR3DX1	90011	broad.mit.edu	37	19	55049049	55049050	+	Intron	INS	-	AAA	AAA			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55049049_55049050insAAA	uc010erm.2	+						KIR3DX1_uc010yfa.1_Intron|KIR3DX1_uc010yfb.1_Intron|KIR3DX1_uc010yfc.1_Intron|KIR3DX1_uc010yfd.1_Intron					Homo sapiens killer cell immunoglobulin-like receptor, three domains, X1, mRNA (cDNA clone IMAGE:4849085).											ovary(1)	1				GBM - Glioblastoma multiforme(193;0.099)		gactccatctcaaaaaaaaaaa	0.074													5	3	---	---	---	---	
KIR2DL3	3804	broad.mit.edu	37	19	55253785	55253785	+	Intron	DEL	G	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55253785delG	uc002qgv.2	+						KIR2DL3_uc002qgx.2_Intron|KIR2DL3_uc002qgy.2_Intron|KIR2DL3_uc010erw.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron	NM_015868	NP_056952	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two						immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		TCCACGACTTGGAACCCCCAG	0.488													61	28	---	---	---	---	
NLRP7	199713	broad.mit.edu	37	19	55446085	55446085	+	Intron	DEL	T	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55446085delT	uc002qih.3	-						NLRP7_uc002qig.3_Intron|NLRP7_uc002qii.3_Intron|NLRP7_uc010esk.2_Intron|NLRP7_uc010esl.2_Intron	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7								ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		CCCTATCAGCttttttttttt	0.264													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	2056544	2056549	+	IGR	DEL	ACACAC	-	-	rs72165579		TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2056544_2056549delACACAC								PDYN (81841 upstream) : STK35 (25979 downstream)																							AAAAAAAAATacacacacacacacac	0.175													5	3	---	---	---	---	
POTEH	23784	broad.mit.edu	37	22	16278070	16278070	+	Intron	DEL	A	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16278070delA	uc010gqp.2	-						POTEH_uc002zlg.1_Intron|POTEH_uc002zlh.1_Intron|POTEH_uc002zlj.1_Intron|uc002zlk.2_RNA	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3											skin(1)	1						AGGAAGGGACAAAAAAAAAAA	0.368													4	4	---	---	---	---	
LRP5L	91355	broad.mit.edu	37	22	25772051	25772052	+	Intron	INS	-	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25772051_25772052insT	uc011ajz.1	-						LRP5L_uc010guw.1_Intron	NM_001135772	NP_001129244	A4QPB2	LRP5L_HUMAN	low density lipoprotein receptor-related protein												0						CAtttactttcttttttttttt	0.287													3	3	---	---	---	---	
CACNA1I	8911	broad.mit.edu	37	22	40062090	40062091	+	Intron	INS	-	TG	TG			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40062090_40062091insTG	uc003ayc.2	+						CACNA1I_uc003ayd.2_Intron|CACNA1I_uc003aye.2_Intron|CACNA1I_uc003ayf.2_Intron	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	cagacctggcttgtcttgcact	0.228													2	4	---	---	---	---	
GAGE10	643832	broad.mit.edu	37	X	49158061	49158062	+	5'Flank	INS	-	T	T			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49158061_49158062insT	uc010nir.1	+							NM_001098413	NP_001091883	A6NGK3	GAG10_HUMAN	G antigen 10												0	Ovarian(276;0.236)					gacatcattccttttttttttt	0.000													4	2	---	---	---	---	
GAGE12J	729396	broad.mit.edu	37	X	49237563	49237564	+	Intron	DEL	CA	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49237563_49237564delCA	uc004dnl.3	+						GAGE13_uc004dnn.3_Intron|GAGE8_uc011mne.1_Intron|GAGE8_uc011mnf.1_Intron|GAGE8_uc011mng.1_Intron|GAGE2A_uc004dnr.3_Intron|GAGE8_uc004dnq.3_Intron|GAGE2A_uc004dnv.3_Intron|GAGE4_uc011mnk.1_Intron|GAGE2A_uc004dny.3_Intron|GAGE8_uc011mnl.1_Intron|GAGE8_uc004dnz.3_Intron|GAGE12D_uc011mnm.1_Intron|GAGE2B_uc011mnj.1_Intron|GAGE2B_uc011mnn.1_Intron	NM_001098406	NP_001465	A6NER3	GG12J_HUMAN	G antigen 12J												0	Ovarian(276;0.236)					tgtgtgtgtgcatgtgtgtgtg	0.332													4	3	---	---	---	---	
KIAA1210	57481	broad.mit.edu	37	X	118284641	118284641	+	5'Flank	DEL	C	-	-			TCGA-22-5482-01A-01D-1632-08	TCGA-22-5482-11A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118284641delC	uc004era.3	-							NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481											ovary(4)|skin(1)	5						CCCACTCACACGCACACGCAC	0.632													3	11	---	---	---	---	
