Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIAA1751	85452	broad.mit.edu	37	1	1920058	1920058	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1920058C>A	uc001aim.1	-	4	345	c.189G>T	c.(187-189)TTG>TTT	p.L63F	KIAA1751_uc009vkz.1_Missense_Mutation_p.L63F|KIAA1751_uc001ain.1_Missense_Mutation_p.L63F	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	63										pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		TTTTCTTCTTCAATTTATCAG	0.498													96	108	---	---	---	---	PASS
CLSTN1	22883	broad.mit.edu	37	1	9794028	9794028	+	Splice_Site	SNP	A	G	G	rs111547640		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9794028A>G	uc001aqh.2	-	15	3040	c.2281_splice	c.e15+1	p.G761_splice	CLSTN1_uc001aqi.2_Splice_Site_p.G751_splice|CLSTN1_uc010oag.1_Splice_Site_p.G742_splice|CLSTN1_uc001aqf.2_5'Flank	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN	calsyntenin 1 isoform 1						homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding			skin(1)	1	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		CGCTCCCCTTACCTGTGAAGG	0.597													8	155	---	---	---	---	PASS
CASP9	842	broad.mit.edu	37	1	15821807	15821807	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15821807T>C	uc001awn.2	-	7	1104	c.1009A>G	c.(1009-1011)ACA>GCA	p.T337A	CASP9_uc001awm.1_Missense_Mutation_p.T337A|CASP9_uc001awo.2_Missense_Mutation_p.T187A|CASP9_uc001awp.2_Missense_Mutation_p.T181A|CASP9_uc009voi.2_Missense_Mutation_p.T181A|CASP9_uc010obm.1_Missense_Mutation_p.T254A|CASP9_uc001awq.2_Missense_Mutation_p.T254A	NM_001229	NP_001220	P55211	CASP9_HUMAN	caspase 9 isoform alpha preproprotein	337					activation of caspase activity by cytochrome c|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol	cysteine-type endopeptidase activity|enzyme activator activity|protein binding			central_nervous_system(1)|kidney(1)	2		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		TCACTGGGTGTGGGCAAACTA	0.582													15	23	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16902816	16902816	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16902816G>A	uc009vos.1	-	19	2953	c.2065C>T	c.(2065-2067)CAG>TAG	p.Q689*	NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Nonsense_Mutation_p.Q147*|NBPF1_uc010oce.1_Nonsense_Mutation_p.Q418*	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	689						cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCAGCCAGCTGTTCTTGGAGG	0.582													34	883	---	---	---	---	PASS
UBXN10	127733	broad.mit.edu	37	1	20517189	20517189	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20517189G>T	uc001bdb.2	+	2	219	c.135G>T	c.(133-135)CGG>CGT	p.R45R		NM_152376	NP_689589	Q96LJ8	UBX10_HUMAN	UBX domain protein 10	45										ovary(1)	1						CCAAGGGACGGACAAGACCGA	0.532													73	77	---	---	---	---	PASS
ECE1	1889	broad.mit.edu	37	1	21548343	21548343	+	Intron	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21548343G>T	uc001bek.2	-						ECE1_uc001bem.2_Intron|ECE1_uc001bej.2_Intron|ECE1_uc001bei.2_Intron|ECE1_uc010odl.1_Intron	NM_001397	NP_001388	P42892	ECE1_HUMAN	endothelin converting enzyme 1 isoform 1						bradykinin catabolic process|calcitonin catabolic process|ear development|embryonic digit morphogenesis|endothelin maturation|heart development|positive regulation of receptor recycling|substance P catabolic process	early endosome|external side of plasma membrane|integral to membrane|intrinsic to endosome membrane|membrane fraction|perinuclear region of cytoplasm|plasma membrane|Weibel-Palade body	metal ion binding|metalloendopeptidase activity|protein homodimerization activity			ovary(2)|skin(1)	3		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		AGCCTGGGAGGAGAGAAAACC	0.587													66	303	---	---	---	---	PASS
EPHA8	2046	broad.mit.edu	37	1	22915561	22915561	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22915561G>T	uc001bfx.1	+	5	1302	c.1177G>T	c.(1177-1179)GTG>TTG	p.V393L	EPHA8_uc001bfw.2_Missense_Mutation_p.V393L	NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	393	Extracellular (Potential).|Fibronectin type-III 1.					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GACAAGCCTGGTGCAGGCCAG	0.672													8	29	---	---	---	---	PASS
SNHG12	85028	broad.mit.edu	37	1	28907460	28907460	+	Intron	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28907460C>G	uc001bqk.2	-						SNHG12_uc001bql.2_Intron|SNHG12_uc001bqm.2_RNA|SNHG12_uc001bqn.2_Intron|SNHG12_uc001bqo.2_RNA|SNHG12_uc001bqp.2_Intron|SNORD99_uc001bqq.1_5'Flank|SNORA61_uc001bqr.2_5'Flank|SNORA44_uc001bqs.2_5'Flank|SNORA16A_uc001bqt.2_RNA	NR_024127				Homo sapiens PNAS-123 mRNA, complete cds.												0						TGTTGCAGATCAGTTACAACA	0.473													52	299	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34238179	34238179	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34238179C>G	uc001bxn.1	-	13	1746	c.1717G>C	c.(1717-1719)GGC>CGC	p.G573R	CSMD2_uc001bxm.1_Missense_Mutation_p.G613R	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	573	Sushi 3.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CACACGCAGCCTGGCTTCTTA	0.587													38	128	---	---	---	---	PASS
CSF3R	1441	broad.mit.edu	37	1	36941098	36941098	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36941098C>T	uc001caw.1	-	4	419	c.241G>A	c.(241-243)GGG>AGG	p.G81R	CSF3R_uc001cav.1_Missense_Mutation_p.G81R|CSF3R_uc001cax.1_Missense_Mutation_p.G81R|CSF3R_uc001cay.1_Missense_Mutation_p.G81R	NM_000760	NP_000751	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor isoform a	81	Ig-like C2-type.|Extracellular (Potential).				cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity			central_nervous_system(2)|ovary(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	TCCTGGGTCCCATCAGACAGA	0.602													84	70	---	---	---	---	PASS
C1orf122	127687	broad.mit.edu	37	1	38274864	38274864	+	3'UTR	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38274864C>T	uc001ccd.2	+	3					YRDC_uc001cca.1_5'Flank|C1orf122_uc001ccb.1_3'UTR|C1orf122_uc010oii.1_3'UTR	NM_198446	NP_940848	Q6ZSJ8	CA122_HUMAN	hypothetical protein LOC127687 isoform 1												0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0393)				ACTTGGCTCTCAGCCTGGAGT	0.572													12	66	---	---	---	---	PASS
AKIRIN1	79647	broad.mit.edu	37	1	39457232	39457232	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39457232G>T	uc001ccw.2	+	1	317	c.180G>T	c.(178-180)CAG>CAT	p.Q60H	AKIRIN1_uc010oip.1_Missense_Mutation_p.Q60H|AKIRIN1_uc010oiq.1_Missense_Mutation_p.Q60H	NM_024595	NP_078871	Q9H9L7	AKIR1_HUMAN	akirin 1 isoform 1	60	Pro-rich.					nucleus					0						GTCTGCAGCAGCCCGCCCCGC	0.736													3	3	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39696876	39696876	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39696876G>C	uc010ois.1	+	4	448	c.243G>C	c.(241-243)AAG>AAC	p.K81N	MACF1_uc001cda.1_5'UTR|MACF1_uc010oit.1_Missense_Mutation_p.K44N	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	81	Actin-binding.|CH 1.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGGTTCAGAAGAAAACGTTCA	0.512													90	472	---	---	---	---	PASS
NT5C1A	84618	broad.mit.edu	37	1	40131788	40131788	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40131788G>T	uc001cdq.1	-	2	256	c.256C>A	c.(256-258)CAT>AAT	p.H86N		NM_032526	NP_115915	Q9BXI3	5NT1A_HUMAN	5'-nucleotidase, cytosolic IA	86					purine base metabolic process|purine nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			ovary(1)	1	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TCGTTCTCATGTTCCAGCTGG	0.478													66	123	---	---	---	---	PASS
ZNF642	339559	broad.mit.edu	37	1	40954798	40954798	+	Silent	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40954798C>G	uc001cfo.2	+	4	552	c.258C>G	c.(256-258)ACC>ACG	p.T86T	ZNF642_uc009vwb.2_Silent_p.T86T|ZNF642_uc010ojk.1_Silent_p.T86T	NM_198494	NP_940896	Q49AA0	ZN642_HUMAN	zinc finger protein 642	86	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.81e-19)			TTGACTTCACCCAGGAAGAGT	0.468													18	127	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43778111	43778111	+	Missense_Mutation	SNP	G	T	T	rs148519949	byFrequency	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43778111G>T	uc001ciu.2	+	12	1845	c.1766G>T	c.(1765-1767)CGG>CTG	p.R589L	TIE1_uc010okd.1_Missense_Mutation_p.R589L|TIE1_uc010oke.1_Missense_Mutation_p.R544L|TIE1_uc009vwq.2_Missense_Mutation_p.R545L|TIE1_uc010okf.1_Missense_Mutation_p.R234L|TIE1_uc010okg.1_Missense_Mutation_p.R234L	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	589	Fibronectin type-III 2.|Extracellular (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GACGGGACACGGGGGCAGGAG	0.697													44	80	---	---	---	---	PASS
SLC1A7	6512	broad.mit.edu	37	1	53569154	53569154	+	Silent	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53569154G>C	uc001cuy.2	-	5	729	c.561C>G	c.(559-561)GTC>GTG	p.V187V		NM_006671	NP_006662	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter),	187	Extracellular (Potential).					integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)	TCTCCTCCTGGACCCCGTAGA	0.637													19	43	---	---	---	---	PASS
C8A	731	broad.mit.edu	37	1	57351626	57351626	+	Silent	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57351626A>T	uc001cyo.2	+	7	1014	c.882A>T	c.(880-882)ACA>ACT	p.T294T		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	294	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3						GAATCTTCACAAAGGTGCAGA	0.363													57	73	---	---	---	---	PASS
INSL5	10022	broad.mit.edu	37	1	67266898	67266898	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67266898C>A	uc001dcw.2	-	1	42	c.7G>T	c.(7-9)GGC>TGC	p.G3C		NM_005478	NP_005469	Q9Y5Q6	INSL5_HUMAN	insulin-like 5 precursor	3						extracellular region	hormone activity				0						AAAATGGAGCCCTTCATTTTG	0.403													16	31	---	---	---	---	PASS
WDR78	79819	broad.mit.edu	37	1	67337155	67337155	+	Nonsense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67337155T>A	uc001dcx.2	-	6	894	c.838A>T	c.(838-840)AGA>TGA	p.R280*	WDR78_uc001dcy.2_Nonsense_Mutation_p.R280*|WDR78_uc001dcz.2_Nonsense_Mutation_p.R280*|WDR78_uc009waw.2_Nonsense_Mutation_p.R26*|WDR78_uc009wax.2_RNA	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1	280										ovary(2)	2						TTGCCTAATCTGTTTCTACAA	0.313													34	52	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75038644	75038644	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75038644T>C	uc001dgg.2	-	14	2969	c.2750A>G	c.(2749-2751)CAT>CGT	p.H917R		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	917	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						TGCTACTTCATGAAGATGCTC	0.542													25	464	---	---	---	---	PASS
PALMD	54873	broad.mit.edu	37	1	100155158	100155158	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100155158G>C	uc001dsg.2	+	7	1785	c.1342G>C	c.(1342-1344)GAT>CAT	p.D448H	PALMD_uc001dsf.2_Missense_Mutation_p.D448H	NM_017734	NP_060204	Q9NP74	PALMD_HUMAN	palmdelphin	448					regulation of cell shape	cytoplasm|membrane				ovary(2)|pancreas(1)	3		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		GGTTGTGATTGATGATGAGGA	0.483													6	97	---	---	---	---	PASS
RTCD1	8634	broad.mit.edu	37	1	100742810	100742810	+	Intron	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100742810A>T	uc001dtc.2	+						RTCD1_uc001dtd.2_Intron	NM_003729	NP_003720	O00442	RTC1_HUMAN	RNA terminal phosphate cyclase domain 1 isoform						RNA processing	mitochondrion|nucleoplasm	ATP binding|protein binding|RNA binding|RNA-3'-phosphate cyclase activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0513)|all cancers(265;0.0902)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)		TTTTTCTTGCATAGAATTATT	0.353													80	85	---	---	---	---	PASS
MIR197	406974	broad.mit.edu	37	1	110141522	110141522	+	RNA	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110141522C>T	hsa-mir-197|MI0000239	+			c.8C>T			uc010ovq.1_RNA																	0						GGGGGCTGTGCCGGGTAGAGA	0.567													5	242	---	---	---	---	PASS
PROK1	84432	broad.mit.edu	37	1	110998902	110998902	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110998902A>T	uc001dzs.2	+	3	298	c.247A>T	c.(247-249)AAC>TAC	p.N83Y		NM_032414	NP_115790	P58294	PROK1_HUMAN	prokineticin 1 precursor	83					angiogenesis|positive regulation of cell division	extracellular region	growth factor activity				0		all_cancers(81;6.23e-06)|all_epithelial(167;2.12e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0239)|all cancers(265;0.0699)|Epithelial(280;0.0753)|Colorectal(144;0.105)|LUSC - Lung squamous cell carcinoma(189;0.135)		TTGCTTGCCCAACCTGCTGTG	0.552													102	98	---	---	---	---	PASS
KCNA2	3737	broad.mit.edu	37	1	111146539	111146539	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111146539G>A	uc001dzu.2	-	2	1362	c.866C>T	c.(865-867)TCA>TTA	p.S289L	KCNA2_uc009wfv.1_Missense_Mutation_p.S289L|KCNA2_uc009wfw.2_Missense_Mutation_p.S289L	NM_004974	NP_004965	P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related	289						juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(1)	1		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)		GATGGCCAGTGACATGGCCTG	0.517													68	179	---	---	---	---	PASS
PLEKHO1	51177	broad.mit.edu	37	1	150129217	150129217	+	Intron	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150129217G>T	uc001ett.2	+						PLEKHO1_uc001etr.2_Intron|PLEKHO1_uc001ets.2_Intron|PLEKHO1_uc001etu.2_Intron	NM_016274	NP_057358	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O							cytoplasm|nucleus|plasma membrane				lung(1)	1	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAGGTCAGGGGGCTCACTGTG	0.592													56	37	---	---	---	---	PASS
S100A1	6271	broad.mit.edu	37	1	153604243	153604243	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153604243G>A	uc001fck.1	+	3	324	c.211G>A	c.(211-213)GAC>AAC	p.D71N	C1orf77_uc001fcm.1_5'Flank|C1orf77_uc001fcn.1_5'Flank|S100A13_uc001fcj.2_Intron|S100A1_uc001fcl.1_RNA|C1orf77_uc009woi.1_5'Flank|C1orf77_uc009woj.1_5'Flank	NM_006271	NP_006262	P23297	S10A1_HUMAN	S100 calcium binding protein A1	71	2; high affinity.|EF-hand 2.				intracellular signal transduction|regulation of heart contraction	nucleus|protein complex|sarcoplasmic reticulum	ATPase binding|calcium ion binding|protein homodimerization activity|S100 alpha binding|S100 beta binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Olopatadine(DB00768)	CGGGGAGGTGGACTTCCAGGA	0.562													123	662	---	---	---	---	PASS
BCAN	63827	broad.mit.edu	37	1	156622664	156622664	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156622664T>A	uc001fpp.2	+	8	2258	c.1922T>A	c.(1921-1923)GTG>GAG	p.V641E	BCAN_uc001fpo.2_Missense_Mutation_p.V641E	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1	641					cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CGAGGTGGAGTGGCCGTGGTC	0.607													48	117	---	---	---	---	PASS
CADM3	57863	broad.mit.edu	37	1	159169596	159169596	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159169596C>T	uc001ftl.2	+	8	1150	c.1008C>T	c.(1006-1008)ATC>ATT	p.I336I	CADM3_uc001ftk.2_Silent_p.I370I|uc001ftm.1_RNA	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2	336	Helical; (Potential).				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)					TCGGTGGGATCGTGGCTTTCA	0.557													32	99	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160281763	160281763	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160281763G>T	uc009wti.2	-	11	1365	c.971C>A	c.(970-972)CCA>CAA	p.P324Q	COPA_uc001fvv.3_Missense_Mutation_p.P324Q|COPA_uc009wtj.1_Missense_Mutation_p.P270Q	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	324					COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGCATAGGCTGGCCGTTCCCG	0.468													35	50	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167088577	167088577	+	Missense_Mutation	SNP	G	A	A	rs150600224		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167088577G>A	uc001geb.1	+	4	529	c.529G>A	c.(529-531)GAA>AAA	p.E177K		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	177					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						CACTGGCCCCGAATTCTACAC	0.562													47	69	---	---	---	---	PASS
FMO2	2327	broad.mit.edu	37	1	171168503	171168503	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171168503G>A	uc001ghk.1	+	5	620	c.503G>A	c.(502-504)GGC>GAC	p.G168D	FMO2_uc010pmd.1_Intron	NM_001460	NP_001451	Q99518	FMO2_HUMAN	flavin containing monooxygenase 2	168					drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AGGTTCAAAGGCCAATATTTC	0.448													10	132	---	---	---	---	PASS
SLC9A11	284525	broad.mit.edu	37	1	173526509	173526509	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173526509G>T	uc001giz.2	-	10	1608	c.1185C>A	c.(1183-1185)CTC>CTA	p.L395L	SLC9A11_uc009wwe.2_5'UTR|SLC9A11_uc010pmq.1_RNA	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11	395					sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						TTCGTTCAGCGAGATTATAAA	0.348													75	127	---	---	---	---	PASS
RC3H1	149041	broad.mit.edu	37	1	173916691	173916691	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173916691C>A	uc001gju.3	-	14	2640	c.2553G>T	c.(2551-2553)CAG>CAT	p.Q851H	RC3H1_uc010pms.1_Missense_Mutation_p.Q851H|RC3H1_uc001gjv.2_Missense_Mutation_p.Q851H|RC3H1_uc010pmt.1_Missense_Mutation_p.Q851H	NM_172071	NP_742068	Q5TC82	RC3H1_HUMAN	roquin	851					cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						GATCTAATCGCTGGTCCCTCA	0.438													37	121	---	---	---	---	PASS
TDRD5	163589	broad.mit.edu	37	1	179562999	179562999	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179562999G>C	uc001gnf.1	+	3	887	c.637G>C	c.(637-639)GCA>CCA	p.A213P	TDRD5_uc010pnp.1_Missense_Mutation_p.A213P	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	213	Lotus/OST-HTH 2.				DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						AGGATGTCCAGCAGGTACGCA	0.413													57	71	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181764045	181764045	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181764045C>A	uc001gow.2	+	45	6109	c.5944C>A	c.(5944-5946)CGG>AGG	p.R1982R	CACNA1E_uc009wxs.2_Silent_p.R1870R|CACNA1E_uc009wxt.2_Silent_p.R1251R	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	2025	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						TTCCACTATTCGGGATAAGCG	0.473													35	79	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186275939	186275939	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186275939C>A	uc001gru.3	+	7	1139	c.1088C>A	c.(1087-1089)CCC>CAC	p.P363H	PRG4_uc001grt.3_Missense_Mutation_p.P322H|PRG4_uc009wyl.2_Missense_Mutation_p.P270H|PRG4_uc009wym.2_Missense_Mutation_p.P229H|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	363	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|2; approximate.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						TCTACCACACCCAAAGAGCCC	0.597													98	284	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190423824	190423824	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190423824C>T	uc001gse.1	-	2	429	c.197G>A	c.(196-198)AGA>AAA	p.R66K	FAM5C_uc010pot.1_Missense_Mutation_p.E28K	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	66						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					CTGCCGGCTTCTGTCCACAAA	0.458													5	51	---	---	---	---	PASS
CHIT1	1118	broad.mit.edu	37	1	203194875	203194875	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203194875C>T	uc001gzn.2	-	3	275	c.179G>A	c.(178-180)GGC>GAC	p.G60D	FMOD_uc010pqi.1_Intron|CHIT1_uc001gzm.1_RNA|CHIT1_uc009xal.1_5'Flank|CHIT1_uc009xam.1_RNA|CHIT1_uc009xan.1_RNA|CHIT1_uc001gzo.2_Missense_Mutation_p.G70D	NM_003465	NP_003456	Q13231	CHIT1_HUMAN	chitotriosidase precursor	60					chitin catabolic process|immune response|response to bacterium	extracellular space|lysosome	cation binding|chitin binding|endochitinase activity				0						GTTGGTCATGCCAGCGAAGGC	0.572													4	181	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203696535	203696535	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203696535A>G	uc001gzw.2	+	20	4029	c.3145A>G	c.(3145-3147)ATA>GTA	p.I1049V	ATP2B4_uc001gzv.2_Missense_Mutation_p.I1049V|ATP2B4_uc009xaq.2_Missense_Mutation_p.I1049V|ATP2B4_uc001gzx.2_Missense_Mutation_p.I80V|ATP2B4_uc009xar.2_Missense_Mutation_p.I44V|ATP2B4_uc010pqj.1_5'Flank|uc010pqk.1_5'Flank|SNORA77_uc001gzy.1_5'Flank	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b	1049	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CATCTCCGCAATACCTACCCG	0.542													76	81	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216040426	216040426	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216040426C>G	uc001hku.1	-	44	9155	c.8768G>C	c.(8767-8769)GGT>GCT	p.G2923A		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2923	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTCTGGAAGACCAGCTAACGT	0.458										HNSCC(13;0.011)			29	79	---	---	---	---	PASS
CAPN2	824	broad.mit.edu	37	1	223959871	223959871	+	Intron	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223959871C>T	uc001hob.3	+						CAPN2_uc010puy.1_Intron|CAPN2_uc001hoc.2_Intron	NM_001748	NP_001739	P17655	CAN2_HUMAN	calpain 2 isoform 1						proteolysis	cytoplasm|plasma membrane				lung(3)|breast(1)|skin(1)	5				GBM - Glioblastoma multiforme(131;0.109)		CCCTCTTTTTCTCCCTCCACA	0.463													8	166	---	---	---	---	PASS
DNAH14	127602	broad.mit.edu	37	1	225147866	225147866	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225147866G>A	uc001how.2	+	4	444	c.229G>A	c.(229-231)GAA>AAA	p.E77K	DNAH14_uc001hou.3_Missense_Mutation_p.E77K|DNAH14_uc001hot.3_Missense_Mutation_p.E77K|DNAH14_uc001hov.3_Missense_Mutation_p.E77K	NM_001373	NP_001364	Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy polypeptide 14 isoform	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1						TTACCTTAGAGAAAGTATAAT	0.348													5	33	---	---	---	---	PASS
WNT3A	89780	broad.mit.edu	37	1	228210498	228210498	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228210498G>A	uc001hrq.1	+	2	280	c.202G>A	c.(202-204)GAG>AAG	p.E68K	WNT3A_uc001hrp.1_Missense_Mutation_p.E68K	NM_033131	NP_149122	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family,	68					axis specification|cell proliferation in forebrain|cell-cell signaling|cellular response to retinoic acid|convergent extension|dermatome development|dorsal/ventral neural tube patterning|embryonic pattern specification|extracellular matrix organization|hemopoietic stem cell proliferation|hippocampus development|inner ear morphogenesis|mammary gland development|midbrain-hindbrain boundary development|negative regulation of fat cell differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of neuron projection development|notochord development|palate development|paraxial mesodermal cell fate commitment|positive regulation of catenin import into nucleus|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of receptor internalization|positive regulation of transcription from RNA polymerase II promoter|signalosome assembly|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuroblast division|Wnt receptor signaling pathway, calcium modulating pathway	cell surface|early endosome|extracellular space|late endosome|membrane raft|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|frizzled-2 binding|receptor agonist activity|signal transducer activity|transcription coactivator activity			ovary(1)	1		Prostate(94;0.0405)				CAGCGTGGCCGAGGGCATCAA	0.667													19	123	---	---	---	---	PASS
C1orf96	126731	broad.mit.edu	37	1	229462485	229462485	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229462485C>A	uc001htl.3	-	3	714	c.636G>T	c.(634-636)GAG>GAT	p.E212D	C1orf96_uc009xfc.2_RNA	NM_145257	NP_660300	Q6IQ19	CA096_HUMAN	hypothetical protein LOC126731	212						centrosome					0	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				CAGAGCGCACCTCGTGCACAG	0.562													20	232	---	---	---	---	PASS
NUP133	55746	broad.mit.edu	37	1	229606322	229606322	+	Intron	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229606322C>G	uc001htn.2	-							NM_018230	NP_060700	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			breast(4)|skin(2)|ovary(1)	7	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				GAGGACTCATCTTACCTCCCT	0.443													30	69	---	---	---	---	PASS
AGT	183	broad.mit.edu	37	1	230846075	230846075	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230846075C>A	uc001hty.3	-	2	1030	c.522G>T	c.(520-522)CGG>CGT	p.R174R	AGT_uc009xfe.2_Silent_p.R174R|AGT_uc009xff.2_Silent_p.R146R	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein	174					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)	GCGCATCCAGCCGGGAGGTGC	0.632													37	98	---	---	---	---	PASS
C1orf31	388753	broad.mit.edu	37	1	234509501	234509501	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234509501G>T	uc001hwc.2	+	1	73	c.37G>T	c.(37-39)GGG>TGG	p.G13W	C1orf31_uc001hwb.2_Intron	NM_001012985	NP_001013003	Q5JTJ3	CA031_HUMAN	hypothetical protein LOC388753	13						mitochondrion	cytochrome-c oxidase activity				0	Ovarian(103;0.0339)	all_cancers(173;0.241)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			CCCGAGCCGCGGGTTCCTCTT	0.622													51	85	---	---	---	---	PASS
SDCCAG8	10806	broad.mit.edu	37	1	243471409	243471409	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243471409G>A	uc001hzw.2	+	8	1015	c.859G>A	c.(859-861)GCT>ACT	p.A287T	SDCCAG8_uc010pyk.1_Missense_Mutation_p.A142T|SDCCAG8_uc010pyl.1_Missense_Mutation_p.A99T|SDCCAG8_uc001hzx.2_Missense_Mutation_p.A99T	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	287	Sufficient for homodimerization (By similarity).				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		TTTGAAATGTGCTCAGCATGA	0.403													35	291	---	---	---	---	PASS
VN1R5	317705	broad.mit.edu	37	1	247419893	247419893	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247419893C>A	uc010pyu.1	+	2	520	c.520C>A	c.(520-522)CTC>ATC	p.L174I		NM_173858	NP_776257	Q7Z5H4	VN1R5_HUMAN	vomeronasal 1 receptor 5	174	Helical; Name=5; (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity				0	all_cancers(71;5.7e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)	all_cancers(173;0.0314)	OV - Ovarian serous cystadenocarcinoma(106;0.00854)			CTCATGGGTCCTCAACATGTT	0.488													112	323	---	---	---	---	PASS
OR2W5	441932	broad.mit.edu	37	1	247654487	247654487	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247654487C>A	uc001icz.1	+	1	58	c.58C>A	c.(58-60)CGG>AGG	p.R20R		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	20					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CTCTTCTGATCGGCCTGGACT	0.463													40	111	---	---	---	---	PASS
OR2M7	391196	broad.mit.edu	37	1	248487077	248487077	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248487077T>A	uc010pzk.1	-	1	794	c.794A>T	c.(793-795)CAT>CTT	p.H265L		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	265	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGAGAATGATGAGATGTGGG	0.478													101	120	---	---	---	---	PASS
TPO	7173	broad.mit.edu	37	2	1497666	1497666	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1497666A>G	uc002qww.2	+	11	1952	c.1861A>G	c.(1861-1863)AAG>GAG	p.K621E	TPO_uc010ewj.2_RNA|TPO_uc002qwu.2_Missense_Mutation_p.K564E|TPO_uc002qwr.2_Missense_Mutation_p.K621E|TPO_uc002qwx.2_Missense_Mutation_p.K564E|TPO_uc010yio.1_Missense_Mutation_p.K448E|TPO_uc010yip.1_Missense_Mutation_p.K621E|TPO_uc002qwy.1_5'UTR|TPO_uc002qwz.2_RNA	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	621	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CGTGGCCGACAAGATCCTGGA	0.607													76	24	---	---	---	---	PASS
DDX1	1653	broad.mit.edu	37	2	15746377	15746377	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15746377C>T	uc002rce.2	+	12	1094	c.806C>T	c.(805-807)TCA>TTA	p.S269L	DDX1_uc010yjq.1_Missense_Mutation_p.S177L	NM_004939	NP_004930	Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1	269	Necessary for interaction with HNRNPK.|Necessary for interaction with RELA.|Helicase ATP-binding.				DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		ATTGTCAAATCACAGCACTCA	0.398													49	244	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21235356	21235356	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21235356C>T	uc002red.2	-	26	4512	c.4384G>A	c.(4384-4386)GGA>AGA	p.G1462R		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1462					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	ATCTGTGGTCCCCAGGAACTA	0.378													23	224	---	---	---	---	PASS
ITSN2	50618	broad.mit.edu	37	2	24435597	24435597	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24435597C>A	uc002rfe.2	-	33	4269	c.4011G>T	c.(4009-4011)CGG>CGT	p.R1337R	ITSN2_uc002rff.2_Silent_p.R1310R	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	1337	DH.				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCCTTTACACCGCGGGTCAG	0.542													86	282	---	---	---	---	PASS
ITSN2	50618	broad.mit.edu	37	2	24435600	24435600	+	Silent	SNP	C	A	A	rs146758206	byFrequency	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24435600C>A	uc002rfe.2	-	33	4266	c.4008G>T	c.(4006-4008)CCG>CCT	p.P1336P	ITSN2_uc002rff.2_Silent_p.P1309P	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	1336	DH.				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTTACACCGCGGGTCAGATG	0.542													80	264	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25523041	25523041	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25523041C>A	uc002rgc.2	-	3	401	c.144G>T	c.(142-144)GTG>GTT	p.V48V	DNMT3A_uc002rgd.2_Silent_p.V48V|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rge.2_Silent_p.V45V|DNMT3A_uc002rgf.2_Silent_p.V48V	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	48					regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGCCGCCCCACCTTCCGTG	0.662			Mis|F|N|S		AML								51	139	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26684724	26684724	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26684724C>T	uc002rhk.2	-	43	5500	c.5373G>A	c.(5371-5373)TGG>TGA	p.W1791*	OTOF_uc010yla.1_Nonsense_Mutation_p.W521*|OTOF_uc002rhh.2_Nonsense_Mutation_p.W1024*|OTOF_uc002rhi.2_Nonsense_Mutation_p.W1101*|OTOF_uc002rhj.2_Nonsense_Mutation_p.W1024*	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	1791	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACAGGTAGCGCCAGTTGAAGT	0.597													17	478	---	---	---	---	PASS
SPAST	6683	broad.mit.edu	37	2	32289035	32289035	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32289035G>A	uc002roc.2	+	1	356	c.135G>A	c.(133-135)CCG>CCA	p.P45P	SPAST_uc002rod.2_Silent_p.P45P	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1	45	Required for interaction with RTN1.|Required for nuclear localization.|Required for midbody localization.|Required for interaction with ATL1.		P -> Q (rare polymorphism which modifies the phenotype of SPG4 disease).		cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					ccgAGTCGCCGCATAAGCGGA	0.517													4	93	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48873862	48873862	+	Missense_Mutation	SNP	C	A	A	rs142381844		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48873862C>A	uc010yol.1	+	5	2677	c.2630C>A	c.(2629-2631)TCT>TAT	p.S877Y	STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.S924Y|GTF2A1L_uc002rws.1_Missense_Mutation_p.S220Y|GTF2A1L_uc010yom.1_Missense_Mutation_p.S186Y|GTF2A1L_uc002rwt.2_Missense_Mutation_p.S220Y	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	877					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			ATACTTGTATCTCCTGGAAAT	0.428													20	195	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61417463	61417463	+	Silent	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61417463T>A	uc002sbe.2	-	78	9838	c.9816A>T	c.(9814-9816)CTA>CTT	p.L3272L	USP34_uc002sbd.2_Silent_p.L74L	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	3272					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			AATCAGACTGTAGGTTCTGAT	0.398													325	158	---	---	---	---	PASS
ANTXR1	84168	broad.mit.edu	37	2	69350194	69350194	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69350194C>T	uc002sfg.2	+	11	1204	c.848C>T	c.(847-849)GCG>GTG	p.A283V	ANTXR1_uc002sfe.2_Missense_Mutation_p.A283V|ANTXR1_uc002sff.2_Missense_Mutation_p.A283V	NM_032208	NP_115584	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1 isoform 1 precursor	283	Extracellular (Potential).				actin cytoskeleton reorganization|substrate adhesion-dependent cell spreading	filopodium membrane|integral to membrane|lamellipodium membrane	actin filament binding|collagen binding|metal ion binding|protein binding|transmembrane receptor activity			ovary(2)|skin(2)	4						CTGTGTCCAGCGCCTATCTTA	0.433									Familial_Infantile_Hemangioma				27	436	---	---	---	---	PASS
TIA1	7072	broad.mit.edu	37	2	70441526	70441526	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70441526G>A	uc002sgj.3	-	12	1206	c.989C>T	c.(988-990)CCT>CTT	p.P330L	TIA1_uc002sgk.3_Missense_Mutation_p.P319L|TIA1_uc002sgl.3_RNA	NM_022173	NP_071505	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding	330					apoptosis|induction of apoptosis|regulation of nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|poly(A) RNA binding|protein binding				0						TCCATATGCAGGAACTTGCCA	0.408													48	131	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73717751	73717751	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73717751G>C	uc002sje.1	+	12	8779	c.8668G>C	c.(8668-8670)GAA>CAA	p.E2890Q	ALMS1_uc002sjf.1_Missense_Mutation_p.E2846Q|ALMS1_uc002sjg.2_Missense_Mutation_p.E2276Q|ALMS1_uc002sjh.1_Missense_Mutation_p.E2276Q	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2888					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						AGAGCTCTTTGAACAAAGCAA	0.428													353	238	---	---	---	---	PASS
LRRTM1	347730	broad.mit.edu	37	2	80529502	80529502	+	Silent	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80529502A>G	uc002sok.1	-	2	1713	c.1443T>C	c.(1441-1443)GCT>GCC	p.A481A	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	481	Cytoplasmic (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						CAGACATGGCAGCCATCTGAT	0.537										HNSCC(69;0.2)			58	192	---	---	---	---	PASS
ST3GAL5	8869	broad.mit.edu	37	2	86075211	86075211	+	Silent	SNP	C	A	A	rs148420220	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86075211C>A	uc002sqq.1	-	4	564	c.435G>T	c.(433-435)GTG>GTT	p.V145V	ST3GAL5_uc010fgq.1_Silent_p.V17V|ST3GAL5_uc002sqp.1_Silent_p.V122V	NM_003896	NP_003887	Q9UNP4	SIAT9_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	145	Lumenal (Potential).				ganglioside biosynthetic process|protein glycosylation	integral to Golgi membrane|integral to plasma membrane	lactosylceramide alpha-2,3-sialyltransferase activity|neolactotetraosylceramide alpha-2,3-sialyltransferase activity				0						GGGCCTTCTGCACAAAAGGGA	0.498													6	905	---	---	---	---	PASS
POLR1A	25885	broad.mit.edu	37	2	86292524	86292524	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86292524C>A	uc002sqs.2	-	14	2310	c.1931G>T	c.(1930-1932)CGG>CTG	p.R644L	POLR1A_uc010ytb.1_Missense_Mutation_p.R10L	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A	644					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						AAAGCAACCCCGAGTAGTCAT	0.517													5	485	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89278130	89278130	+	Intron	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89278130T>A	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GCACCATAGATGAGGAGCCTG	0.587													19	264	---	---	---	---	PASS
TEKT4	150483	broad.mit.edu	37	2	95537633	95537633	+	Silent	SNP	G	A	A	rs111669261	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95537633G>A	uc002stw.1	+	1	402	c.309G>A	c.(307-309)TCG>TCA	p.S103S	uc002stv.1_Intron|TEKT4_uc010fhr.1_RNA	NM_144705	NP_653306	Q8WW24	TEKT4_HUMAN	tektin 4	103	Potential.				cell projection organization|microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|breast(1)|skin(1)	3						GCTGGAAGTCGGAGCTGCAGC	0.682													3	31	---	---	---	---	PASS
LOC285033	285033	broad.mit.edu	37	2	96906072	96906072	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96906072T>C	uc002svp.1	+	1	96	c.11T>C	c.(10-12)GTT>GCT	p.V4A	LOC285033_uc002svn.2_RNA|LOC285033_uc002svo.2_Intron	NM_001037228	NP_001032305	Q3KRF4	Q3KRF4_HUMAN	hypothetical protein LOC285033	4											0						ATGAAAAGTGTTTACAATATT	0.378													44	49	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100210027	100210027	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100210027G>A	uc002tag.2	-	14	2332	c.2096C>T	c.(2095-2097)TCT>TTT	p.S699F	AFF3_uc002taf.2_Missense_Mutation_p.S724F|AFF3_uc010fiq.1_Missense_Mutation_p.S699F|AFF3_uc010yvr.1_Missense_Mutation_p.S852F|AFF3_uc002tah.1_Missense_Mutation_p.S724F	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	699					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						GGAGGAGGCAGAGGCAGCCAC	0.617													45	313	---	---	---	---	PASS
NPAS2	4862	broad.mit.edu	37	2	101582167	101582167	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101582167C>T	uc002tap.1	+	10	1132	c.846C>T	c.(844-846)ACC>ACT	p.T282T	NPAS2_uc010yvt.1_Silent_p.T347T	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	282	PAS 2.				central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4						TGCTGGGAACCTCAGGCTATG	0.577													31	231	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116599900	116599900	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116599900G>T	uc002tla.1	+	26	2827	c.2370G>T	c.(2368-2370)CAG>CAT	p.Q790H	DPP10_uc002tlb.1_Missense_Mutation_p.Q740H|DPP10_uc002tlc.1_Missense_Mutation_p.Q786H|DPP10_uc002tle.2_Missense_Mutation_p.Q794H|DPP10_uc002tlf.1_Missense_Mutation_p.Q783H	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	790	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TGCTACCACAGGAACCAGAAG	0.373													25	85	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116599901	116599901	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116599901G>T	uc002tla.1	+	26	2828	c.2371G>T	c.(2371-2373)GAA>TAA	p.E791*	DPP10_uc002tlb.1_Nonsense_Mutation_p.E741*|DPP10_uc002tlc.1_Nonsense_Mutation_p.E787*|DPP10_uc002tle.2_Nonsense_Mutation_p.E795*|DPP10_uc002tlf.1_Nonsense_Mutation_p.E784*	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	791	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						GCTACCACAGGAACCAGAAGA	0.373													26	86	---	---	---	---	PASS
STEAP3	55240	broad.mit.edu	37	2	120005403	120005403	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120005403T>C	uc002tlp.2	+	4	798	c.641T>C	c.(640-642)GTG>GCG	p.V214A	STEAP3_uc002tlq.2_Missense_Mutation_p.V224A|STEAP3_uc002tlr.2_Missense_Mutation_p.V214A|STEAP3_uc010fle.2_Missense_Mutation_p.V214A	NM_018234	NP_060704	Q658P3	STEA3_HUMAN	dudulin 2 isoform b	214	Helical; (Potential).				apoptosis|cell cycle|cellular iron ion homeostasis|protein secretion|transferrin transport|transmembrane transport	endosome membrane|integral to membrane|multivesicular body	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			central_nervous_system(2)|skin(1)	3						GCCTGGAAGGTGCCCACCCTG	0.642													23	162	---	---	---	---	PASS
CLASP1	23332	broad.mit.edu	37	2	122120801	122120801	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122120801C>T	uc002tnc.2	-	36	4543	c.4153G>A	c.(4153-4155)GCC>ACC	p.A1385T	CLASP1_uc010yyv.1_Missense_Mutation_p.A431T|CLASP1_uc002tmz.2_Missense_Mutation_p.A470T|CLASP1_uc002tna.2_Missense_Mutation_p.A431T|CLASP1_uc010yyw.1_RNA|CLASP1_uc002tnb.2_RNA|CLASP1_uc010yyx.1_RNA|CLASP1_uc010yyy.1_RNA|CLASP1_uc010yyz.1_Missense_Mutation_p.A1326T|CLASP1_uc010yza.1_Missense_Mutation_p.A1318T|CLASP1_uc010yzb.1_RNA|CLASP1_uc010yzc.1_RNA|CLASP1_uc002tmy.2_Missense_Mutation_p.A221T	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1	1385	Localization to kinetochores.|Interaction with PHLDB2 and RSN.|Interaction with CLIP2 (By similarity).				axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					GTCAGCTCGGCGTAGTTTTTA	0.468													5	58	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125320836	125320836	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125320836G>T	uc002tno.2	+	11	2053	c.1689G>T	c.(1687-1689)CAG>CAT	p.Q563H	CNTNAP5_uc010flu.2_Missense_Mutation_p.Q564H	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	563	EGF-like 1.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GCTGCTCCCAGTCCTGGACTA	0.443													3	18	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128388470	128388470	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128388470T>A	uc002top.2	+	35	4899	c.4846T>A	c.(4846-4848)TAT>AAT	p.Y1616N	MYO7B_uc002tor.1_Missense_Mutation_p.Y469N	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	1616	SH3 2.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GGAGTTCTCCTATGAGTTCTT	0.348													7	19	---	---	---	---	PASS
SPOPL	339745	broad.mit.edu	37	2	139310159	139310159	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139310159G>T	uc002tvh.2	+	5	788	c.388G>T	c.(388-390)GAC>TAC	p.D130Y		NM_001001664	NP_001001664	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	130	MATH.					nucleus				skin(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0296)		GCAAGGGAAGGACTGGGGTTT	0.348													51	71	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	140990769	140990769	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140990769C>T	uc002tvj.1	-	91	14758	c.13786G>A	c.(13786-13788)GAG>AAG	p.E4596K		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4596	Cytoplasmic (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCCACTGTCTCTCTTATACCA	0.313										TSP Lung(27;0.18)			9	52	---	---	---	---	PASS
DPP4	1803	broad.mit.edu	37	2	162881449	162881449	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162881449C>A	uc002ubz.2	-	11	1449	c.888G>T	c.(886-888)GGG>GGT	p.G296G	DPP4_uc010fpb.2_5'UTR	NM_001935	NP_001926	P27487	DPP4_HUMAN	dipeptidylpeptidase IV	296	Extracellular (Potential).				cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)	AGTAGTGATCCCTggaaggaa	0.318													71	133	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166848831	166848831	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166848831C>T	uc010zcz.1	-	26	4939	c.4921G>A	c.(4921-4923)GGA>AGA	p.G1641R		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1652	Helical; Voltage-sensor; Name=S4 of repeat IV; (By similarity).|IV.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	CCCTTTGCTCCTTTGATCAGA	0.493													80	135	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166892640	166892640	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166892640G>T	uc010zcz.1	-	16	3332	c.3314C>A	c.(3313-3315)CCA>CAA	p.P1105Q	SCN1A_uc002udo.3_Missense_Mutation_p.P985Q|SCN1A_uc010fpk.2_Missense_Mutation_p.P957Q	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1116						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	TACAGCAATTGGTACAGTCAC	0.368													85	205	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166892641	166892641	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166892641G>T	uc010zcz.1	-	16	3331	c.3313C>A	c.(3313-3315)CCA>ACA	p.P1105T	SCN1A_uc002udo.3_Missense_Mutation_p.P985T|SCN1A_uc010fpk.2_Missense_Mutation_p.P957T	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1116						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	ACAGCAATTGGTACAGTCACA	0.368													87	205	---	---	---	---	PASS
SCN9A	6335	broad.mit.edu	37	2	167141025	167141025	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167141025T>A	uc010fpl.2	-	12	2253	c.1912A>T	c.(1912-1914)ATG>TTG	p.M638L	uc002udp.2_Intron|SCN9A_uc002udr.1_Missense_Mutation_p.M509L|SCN9A_uc002uds.1_Missense_Mutation_p.M509L|SCN9A_uc002udt.1_Missense_Mutation_p.M509L	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	638						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	TTGGGGAGCATGAGGGCTGAG	0.552													30	67	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179393015	179393015	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179393015G>A	uc010zfg.1	-	310	99883	c.99659C>T	c.(99658-99660)TCC>TTC	p.S33220F	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S26915F|TTN_uc010zfi.1_Missense_Mutation_p.S26848F|TTN_uc010zfj.1_Missense_Mutation_p.S26723F|TTN_uc002umq.2_Missense_Mutation_p.S237F	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	34147							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACCATTAAGGAAGCTGTAGC	0.413													11	83	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179544138	179544138	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179544138C>A	uc010zfg.1	-	139	30162	c.29938G>T	c.(29938-29940)GAG>TAG	p.E9980*	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Nonsense_Mutation_p.E6641*|TTN_uc010fre.1_Intron|TTN_uc002una.1_RNA|TTN_uc010frf.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10907							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAGGAACCTCAGGCACTTTA	0.378													40	61	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179621147	179621147	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179621147C>A	uc010zfh.1	-	44	10767	c.10543G>T	c.(10543-10545)GAT>TAT	p.D3515Y	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc002unb.2_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGAAAGAATCATCTTTTAAA	0.428													23	69	---	---	---	---	PASS
CERKL	375298	broad.mit.edu	37	2	182413546	182413546	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182413546C>T	uc002unx.2	-	8	1113	c.1012G>A	c.(1012-1014)GCT>ACT	p.A338T	CERKL_uc002uny.2_Missense_Mutation_p.A312T|CERKL_uc010zfm.1_Missense_Mutation_p.A294T|CERKL_uc002unz.2_Missense_Mutation_p.A60T|CERKL_uc002uoa.2_Missense_Mutation_p.A243T|CERKL_uc002uob.2_Missense_Mutation_p.A60T|CERKL_uc002uoc.2_Missense_Mutation_p.A199T|CERKL_uc010frk.2_RNA|CERKL_uc002uod.1_Missense_Mutation_p.A107T|CERKL_uc002uoe.2_Missense_Mutation_p.A312T|CERKL_uc002unw.2_5'Flank	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b	338	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)			AGCTTGCCAGCGGTGCTGAAG	0.453													5	158	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196825142	196825142	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196825142C>A	uc002utj.3	-	18	2834	c.2733G>T	c.(2731-2733)GAG>GAT	p.E911D		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	911	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						CTGCATCCCACTCAGTAATCA	0.368													103	182	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196825143	196825143	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196825143T>C	uc002utj.3	-	18	2833	c.2732A>G	c.(2731-2733)GAG>GGG	p.E911G		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	911	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TGCATCCCACTCAGTAATCAT	0.373													104	186	---	---	---	---	PASS
SF3B1	23451	broad.mit.edu	37	2	198285797	198285797	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198285797C>T	uc002uue.2	-	3	304	c.256G>A	c.(256-258)GCC>ACC	p.A86T	SF3B1_uc010fsk.1_RNA|SF3B1_uc002uuf.2_Missense_Mutation_p.A86T|SF3B1_uc002uug.2_Missense_Mutation_p.A86T	NM_012433	NP_036565	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1 isoform 1	86					nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding			pancreas(3)|ovary(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GCCACAGGGGCATGATATCCT	0.383													96	189	---	---	---	---	PASS
PLCL1	5334	broad.mit.edu	37	2	198950232	198950232	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198950232G>C	uc010fsp.2	+	2	2282	c.1991G>C	c.(1990-1992)TGT>TCT	p.C664S	PLCL1_uc002uuv.3_Missense_Mutation_p.C585S	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	664	PI-PLC Y-box.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	AATTGTGGCTGTCAGATTGTA	0.418													58	74	---	---	---	---	PASS
BARD1	580	broad.mit.edu	37	2	215617174	215617174	+	Silent	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215617174T>A	uc002veu.2	-	7	1809	c.1674A>T	c.(1672-1674)TCA>TCT	p.S558S	BARD1_uc010zjm.1_Silent_p.S414S	NM_000465	NP_000456	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	558	Flexible linker.				cell cycle arrest|DNA repair|negative regulation of apoptosis|negative regulation of mRNA 3'-end processing|negative regulation of protein export from nucleus|positive regulation of apoptosis|positive regulation of protein catabolic process|protein K6-linked ubiquitination|regulation of phosphorylation|tissue homeostasis	BRCA1-A complex|BRCA1-BARD1 complex|cytoplasm	kinase binding|protein heterodimerization activity|protein homodimerization activity|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TACTTACTACTGAGCAGTGGC	0.343									Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				36	19	---	---	---	---	PASS
CLASP2	23122	broad.mit.edu	37	3	33617681	33617681	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33617681C>A	uc003cfu.2	-	24	2788	c.2434G>T	c.(2434-2436)GAG>TAG	p.E812*	CLASP2_uc003cfs.2_Nonsense_Mutation_p.E12*|CLASP2_uc003cft.2_RNA|CLASP2_uc010hgb.2_RNA|CLASP2_uc011axt.1_Nonsense_Mutation_p.E405*	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2	813										ovary(3)|central_nervous_system(1)	4						GCCACCGCCTCCTCCACATCA	0.448													63	13	---	---	---	---	PASS
CLASP2	23122	broad.mit.edu	37	3	33617682	33617682	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33617682C>G	uc003cfu.2	-	24	2787	c.2433G>C	c.(2431-2433)GAG>GAC	p.E811D	CLASP2_uc003cfs.2_Missense_Mutation_p.E11D|CLASP2_uc003cft.2_RNA|CLASP2_uc010hgb.2_RNA|CLASP2_uc011axt.1_Missense_Mutation_p.E404D	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2	812										ovary(3)|central_nervous_system(1)	4						CCACCGCCTCCTCCACATCAG	0.448													63	13	---	---	---	---	PASS
ZNF167	55888	broad.mit.edu	37	3	44611936	44611936	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44611936G>C	uc010hin.2	+	6	1722	c.1334G>C	c.(1333-1335)GGA>GCA	p.G445A	ZNF167_uc003cnh.2_RNA|ZNF167_uc003cni.2_Intron|ZNF167_uc010hio.2_Missense_Mutation_p.G294A|ZNF167_uc003cnj.2_Missense_Mutation_p.G445A|ZNF167_uc003cnk.2_Intron	NM_018651	NP_061121	Q9P0L1	ZN167_HUMAN	zinc finger protein 167 isoform 1	445	C2H2-type 3.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(197;0.0486)|Kidney(197;0.0609)		AGTGAGTGTGGAAAGGCCTAT	0.463													64	27	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48630780	48630780	+	Intron	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48630780G>A	uc003ctz.2	-							NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor						cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACTCCTGCTCGGTCCTTACCC	0.592													80	459	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51263153	51263153	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51263153G>T	uc011bds.1	+	15	1349	c.1326G>T	c.(1324-1326)AAG>AAT	p.K442N		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	442	DHR-1.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GTGTACAAAAGAATATTGAAG	0.438													106	31	---	---	---	---	PASS
TNNC1	7134	broad.mit.edu	37	3	52485422	52485422	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52485422G>A	uc003deb.2	-	5	465	c.439C>T	c.(439-441)CGC>TGC	p.R147C		NM_003280	NP_003271	P63316	TNNC1_HUMAN	troponin C, slow	147	3.|EF-hand 4.				cardiac muscle contraction|muscle filament sliding|regulation of ATPase activity|regulation of muscle filament sliding speed|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin filament binding|calcium ion binding|calcium-dependent protein binding|protein homodimerization activity|troponin I binding|troponin T binding				0				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00175)|KIRC - Kidney renal clear cell carcinoma(197;0.00198)|OV - Ovarian serous cystadenocarcinoma(275;0.0525)	Bepridil(DB01244)|Dihydroxyaluminium(DB01375)|Levosimendan(DB00922)	TAGTCGATGCGGCCGTCGTTG	0.592													23	75	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74313618	74313618	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74313618C>T	uc003dpm.1	-	22	3101	c.3021G>A	c.(3019-3021)TCG>TCA	p.S1007S		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	1007					cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		GGTGGACATTCGAGATGGCTG	0.338													50	38	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77671537	77671537	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77671537C>A	uc003dpy.3	+	23	4357	c.3714C>A	c.(3712-3714)GAC>GAA	p.D1238E	ROBO2_uc003dpz.2_Missense_Mutation_p.D1242E|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.D1242E	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	1238	Cytoplasmic (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GAGCACTGGACCAGACTCCTG	0.463													12	63	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89391229	89391229	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89391229C>T	uc003dqy.2	+	5	1520	c.1295C>T	c.(1294-1296)ACT>ATT	p.T432I	EPHA3_uc003dqx.1_Missense_Mutation_p.T432I|EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	432	Extracellular (Potential).					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		AGCATCACAACTAATCAGGCT	0.463										TSP Lung(6;0.00050)			33	18	---	---	---	---	PASS
NSUN3	63899	broad.mit.edu	37	3	93845224	93845224	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93845224G>T	uc003drl.1	+	6	1029	c.913G>T	c.(913-915)GCT>TCT	p.A305S		NM_022072	NP_071355	Q9H649	NSUN3_HUMAN	NOL1/NOP2/Sun domain family, member 3	305							methyltransferase activity			skin(1)	1						CTTCACATTTGCTCCCACTGG	0.453													14	195	---	---	---	---	PASS
EPHA6	285220	broad.mit.edu	37	3	97454806	97454806	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97454806C>T	uc010how.1	+	16	3015	c.2972C>T	c.(2971-2973)GCT>GTT	p.A991V	EPHA6_uc003drt.2_Missense_Mutation_p.A383V|EPHA6_uc010hox.1_RNA	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	896	Protein kinase.|Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						AGACTTCCAGCTCCCATGGGC	0.413													78	31	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108211997	108211997	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108211997C>T	uc003dxa.1	-	9	856	c.799G>A	c.(799-801)GCC>ACC	p.A267T		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	267	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						ATGCCTCTGGCACCAAAGTGC	0.363													9	116	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108229345	108229345	+	Silent	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108229345G>C	uc003dxa.1	-	2	150	c.93C>G	c.(91-93)GCC>GCG	p.A31A		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	31	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						TTCTGAGGAAGGCTGCGGCTT	0.458													43	95	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108229346	108229346	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108229346G>T	uc003dxa.1	-	2	149	c.92C>A	c.(91-93)GCC>GAC	p.A31D		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	31	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						TCTGAGGAAGGCTGCGGCTTC	0.453													45	95	---	---	---	---	PASS
PVRL3	25945	broad.mit.edu	37	3	110840989	110840989	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110840989C>T	uc003dxt.1	+	4	821	c.821C>T	c.(820-822)ACA>ATA	p.T274I	PVRL3_uc003dxu.1_Missense_Mutation_p.T251I	NM_015480	NP_056295	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3 precursor	274	Extracellular (Potential).|Ig-like C2-type 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane	cell adhesion molecule binding|protein homodimerization activity			upper_aerodigestive_tract(2)	2						GTTTCGGTAACAGGATATGAT	0.333													11	132	---	---	---	---	PASS
LSAMP	4045	broad.mit.edu	37	3	115560723	115560723	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115560723C>A	uc003ebt.2	-	6	1388	c.888G>T	c.(886-888)CTG>CTT	p.L296L	LSAMP_uc011bis.1_Silent_p.L296L	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein	296	Ig-like C2-type 3.				cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		TGGTGACCCCCAGCTTGTTGG	0.502													96	62	---	---	---	---	PASS
UROC1	131669	broad.mit.edu	37	3	126216888	126216888	+	Intron	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126216888C>T	uc003eiz.1	-						UROC1_uc010hsi.1_Intron	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1						histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		CCACCAATGGCGTCACCTCCA	0.607													76	667	---	---	---	---	PASS
TMEM108	66000	broad.mit.edu	37	3	133098894	133098894	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133098894G>T	uc003eph.2	+	4	613	c.339G>T	c.(337-339)CTG>CTT	p.L113L	TMEM108_uc003epi.2_Silent_p.L113L|TMEM108_uc003epj.1_Silent_p.L113L|TMEM108_uc003epk.2_Intron|TMEM108_uc003epm.2_Silent_p.L64L	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor	113	Pro-rich.|Extracellular (Potential).					integral to membrane				ovary(2)|skin(2)	4						AAAGCTCCCTGTCCACAGGGC	0.657													31	189	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134898766	134898766	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134898766G>T	uc003eqt.2	+	10	2044	c.1824G>T	c.(1822-1824)CGG>CGT	p.R608R	EPHB1_uc003equ.2_Silent_p.R169R	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	608	Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						AAGCTGTCCGGGAGTTTGCCA	0.483													64	260	---	---	---	---	PASS
PPP2R3A	5523	broad.mit.edu	37	3	135768131	135768131	+	Silent	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135768131T>A	uc003eqv.1	+	5	2962	c.2397T>A	c.(2395-2397)TCT>TCA	p.S799S	PPP2R3A_uc011blz.1_Silent_p.S63S|PPP2R3A_uc003eqw.1_Silent_p.S178S|PPP2R3A_uc011bma.1_RNA	NM_002718	NP_002709	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'',	799					protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7						ATGATGCCTCTAAATTCATCT	0.373													259	109	---	---	---	---	PASS
XRN1	54464	broad.mit.edu	37	3	142031585	142031585	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142031585G>A	uc003eus.2	-	41	4740	c.4673C>T	c.(4672-4674)TCG>TTG	p.S1558L	XRN1_uc010huu.2_Missense_Mutation_p.S1012L|XRN1_uc003eut.2_Missense_Mutation_p.S1545L|XRN1_uc003euu.2_Missense_Mutation_p.S1546L	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a	1558					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						ATGAGACGACGAAGGCATTAT	0.428													23	476	---	---	---	---	PASS
SLC9A9	285195	broad.mit.edu	37	3	143082377	143082377	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143082377G>A	uc003evn.2	-	14	1735	c.1553C>T	c.(1552-1554)ACG>ATG	p.T518M		NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen	518					regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						CTCTGCTTTCGTCATGTTTTT	0.368													28	276	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155282752	155282752	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155282752C>A	uc011bok.1	-	7	1262	c.985G>T	c.(985-987)GTG>TTG	p.V329L	PLCH1_uc011boj.1_Missense_Mutation_p.V329L|PLCH1_uc011bol.1_Missense_Mutation_p.V311L	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	329	PI-PLC X-box.				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TACATATCCACTTTGGACTGA	0.502													17	258	---	---	---	---	PASS
SHOX2	6474	broad.mit.edu	37	3	157818036	157818036	+	Intron	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157818036A>G	uc003fbr.2	-						SHOX2_uc003fbs.2_Intron|SHOX2_uc010hvw.2_Intron	NM_006884	NP_006875	O60902	SHOX2_HUMAN	short stature homeobox 2 isoform a						nervous system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			TTGTATAAGAAGCATACCTTT	0.318													25	100	---	---	---	---	PASS
KPNA4	3840	broad.mit.edu	37	3	160239695	160239695	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160239695G>C	uc003fdn.2	-	11	1081	c.775C>G	c.(775-777)CTG>GTG	p.L259V		NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4	259	ARM 5.				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			GTGTCTACCAGTATCTAATGA	0.333													22	138	---	---	---	---	PASS
GOLIM4	27333	broad.mit.edu	37	3	167750493	167750493	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167750493C>T	uc003ffe.2	-	9	1335	c.991G>A	c.(991-993)GAG>AAG	p.E331K	GOLIM4_uc011bpe.1_Missense_Mutation_p.E331K|GOLIM4_uc011bpf.1_Missense_Mutation_p.E303K|GOLIM4_uc011bpg.1_Missense_Mutation_p.E303K	NM_014498	NP_055313	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	331	Glu-rich.|Lumenal (Potential).				transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus				breast(4)|skin(1)	5						TGATGCTCCTCAGGTTCTCTG	0.527													39	641	---	---	---	---	PASS
NLGN1	22871	broad.mit.edu	37	3	173996992	173996992	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173996992G>A	uc003fio.1	+	6	1624	c.1201G>A	c.(1201-1203)GAT>AAT	p.D401N	NLGN1_uc010hww.1_Missense_Mutation_p.D441N|NLGN1_uc003fip.1_Missense_Mutation_p.D401N	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	418	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			AAATATAGTAGATAGCGATGA	0.353													52	350	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179399767	179399767	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179399767G>A	uc003fkh.2	+	2	351	c.270G>A	c.(268-270)ATG>ATA	p.M90I	USP13_uc003fkf.2_Missense_Mutation_p.M90I	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	90					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			GTGTATACATGCACCTGAAAA	0.443													124	525	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179501877	179501877	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179501877G>T	uc003fkh.2	+	21	2621	c.2540G>T	c.(2539-2541)AGG>ATG	p.R847M		NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	847					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			GCCTCAGAAAGGCCCCCTAAA	0.388													48	791	---	---	---	---	PASS
TRA2B	6434	broad.mit.edu	37	3	185636142	185636142	+	Intron	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185636142T>C	uc003fpv.2	-						TRA2B_uc003fpt.2_Intron|TRA2B_uc003fpu.2_Intron|TRA2B_uc010hym.2_Intron|TRA2B_uc003fpw.2_Intron	NM_004593	NP_004584	P62995	TRA2B_HUMAN	splicing factor, arginine/serine-rich 10						nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|protein binding|RNA binding			ovary(2)	2						CATATTAAGATAAAAACTTAC	0.373													74	229	---	---	---	---	PASS
ATP13A4	84239	broad.mit.edu	37	3	193132516	193132516	+	Nonsense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193132516T>A	uc003ftd.2	-	26	2974	c.2866A>T	c.(2866-2868)AAG>TAG	p.K956*	ATP13A4_uc010hzi.2_RNA	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	956	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		GGCACCAGCTTAGGGTAGGCA	0.373													191	35	---	---	---	---	PASS
ATP13A4	84239	broad.mit.edu	37	3	193272586	193272586	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193272586C>T	uc003ftd.2	-	1	111	c.3G>A	c.(1-3)ATG>ATA	p.M1I	ATP13A4_uc003fte.1_Missense_Mutation_p.M1I|ATP13A4_uc011bsr.1_5'UTR	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	1	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		CAAAGTGTCCCATGAAAAAGT	0.517													34	475	---	---	---	---	PASS
RNF168	165918	broad.mit.edu	37	3	196214260	196214260	+	Intron	SNP	T	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196214260T>G	uc003fwq.2	-						RNF168_uc010iah.2_Intron	NM_152617	NP_689830	Q8IYW5	RN168_HUMAN	ring finger protein 168						double-strand break repair|histone H2A K63-linked ubiquitination|positive regulation of DNA repair|response to ionizing radiation	nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		CGTTCCCTCCTAAAACTTACA	0.468													159	760	---	---	---	---	PASS
MFSD7	84179	broad.mit.edu	37	4	680322	680322	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:680322G>A	uc003gay.2	-	2	350	c.293C>T	c.(292-294)GCG>GTG	p.A98V	MFSD7_uc003gaw.2_5'Flank|MFSD7_uc003gax.2_Missense_Mutation_p.A98V|MFSD7_uc003gaz.2_Missense_Mutation_p.A76V|MFSD7_uc003gba.2_Missense_Mutation_p.A98V|MFSD7_uc003gbb.1_Missense_Mutation_p.A34V	NM_032219	NP_115595	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing	98					transmembrane transport	integral to membrane					0						CTGACTCACCGCCGCACGGAG	0.657													68	190	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3189570	3189570	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3189570G>A	uc011bvq.1	+	40	5333	c.5188G>A	c.(5188-5190)GAA>AAA	p.E1730K		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	1728					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		AGAACACAGTGAAGGGAAACA	0.398													16	129	---	---	---	---	PASS
TADA2B	93624	broad.mit.edu	37	4	7056107	7056107	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7056107G>T	uc003gjw.3	+	2	740	c.589G>T	c.(589-591)GTG>TTG	p.V197L	TADA2B_uc010idi.2_Missense_Mutation_p.V122L	NM_152293	NP_689506	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2 (ADA2 homolog,	197					regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|zinc ion binding				0						TGACGACGACGTGGAGATCGA	0.582													69	105	---	---	---	---	PASS
CPZ	8532	broad.mit.edu	37	4	8621244	8621244	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8621244G>T	uc003glm.2	+	11	1985	c.1859G>T	c.(1858-1860)CGG>CTG	p.R620L	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Missense_Mutation_p.R483L|CPZ_uc003glo.2_Missense_Mutation_p.R609L|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	620					proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3						GACCCGCTCCGGGCGCGCAGG	0.667													57	61	---	---	---	---	PASS
DRD5	1816	broad.mit.edu	37	4	9783698	9783698	+	Missense_Mutation	SNP	C	A	A	rs147198780	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9783698C>A	uc003gmb.3	+	1	441	c.45C>A	c.(43-45)TTC>TTA	p.F15L		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	15	Extracellular (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	CGGGGCAGTTCGCTCTATACC	0.721													3	16	---	---	---	---	PASS
DRD5	1816	broad.mit.edu	37	4	9783701	9783701	+	Silent	SNP	T	G	G	rs140576108	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9783701T>G	uc003gmb.3	+	1	444	c.48T>G	c.(46-48)GCT>GCG	p.A16A		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	16	Extracellular (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	GGCAGTTCGCTCTATACCAGC	0.716													3	16	---	---	---	---	PASS
NCAPG	64151	broad.mit.edu	37	4	17827057	17827057	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17827057G>T	uc003gpp.2	+	11	1702	c.1526G>T	c.(1525-1527)TGC>TTC	p.C509F	NCAPG_uc011bxj.1_Missense_Mutation_p.C18F	NM_022346	NP_071741	Q9BPX3	CND3_HUMAN	chromosome condensation protein G	509					cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding			large_intestine(1)	1				STAD - Stomach adenocarcinoma(129;0.18)		TTGGAAAATTGCATTACCTTA	0.318													8	48	---	---	---	---	PASS
LGI2	55203	broad.mit.edu	37	4	25026481	25026481	+	Nonsense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25026481G>C	uc003grf.2	-	4	473	c.374C>G	c.(373-375)TCA>TGA	p.S125*		NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	125	LRR 2.					extracellular region					0		Breast(46;0.173)				GGCATTTCTTGAAATGGTTTC	0.363													15	67	---	---	---	---	PASS
TLR10	81793	broad.mit.edu	37	4	38776273	38776273	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38776273G>A	uc003gti.2	-	2	1318	c.939C>T	c.(937-939)TAC>TAT	p.Y313Y	TLR10_uc003gtj.2_Silent_p.Y313Y|TLR10_uc003gtk.2_Silent_p.Y313Y	NM_030956	NP_112218	Q9BXR5	TLR10_HUMAN	toll-like receptor 10 precursor	313	LRR 7.|Extracellular (Potential).				inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane	transmembrane receptor activity			lung(1)|breast(1)	2						CCTGTTGAATGTAAAACACTC	0.338													14	90	---	---	---	---	PASS
SPATA18	132671	broad.mit.edu	37	4	52928491	52928491	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52928491C>G	uc003gzl.2	+	4	693	c.415C>G	c.(415-417)CAA>GAA	p.Q139E	SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Missense_Mutation_p.Q139E|SPATA18_uc003gzk.1_Missense_Mutation_p.Q139E	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18 homolog	139	Potential.				mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding			ovary(2)|skin(2)	4			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			CAACCAGGTTCAAGACGAGTA	0.368													89	72	---	---	---	---	PASS
EXOC1	55763	broad.mit.edu	37	4	56738082	56738082	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56738082C>T	uc003hbe.1	+	8	1190	c.1032C>T	c.(1030-1032)GCC>GCT	p.A344A	EXOC1_uc003hbf.1_Silent_p.A344A|EXOC1_uc003hbg.1_Silent_p.A344A	NM_018261	NP_060731	Q9NV70	EXOC1_HUMAN	exocyst complex component 1 isoform 1	344					exocytosis|protein transport	exocyst	protein binding			ovary(2)|skin(2)|lung(1)|central_nervous_system(1)	6	Glioma(25;0.08)|all_neural(26;0.101)					AGCTTTTTGCCCGGAGACTGG	0.398													28	70	---	---	---	---	PASS
MMRN1	22915	broad.mit.edu	37	4	90856839	90856839	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90856839G>A	uc003hst.2	+	6	2079	c.2008G>A	c.(2008-2010)GAA>AAA	p.E670K	MMRN1_uc010iku.2_Intron|MMRN1_uc011cds.1_Missense_Mutation_p.E412K	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	670					cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		ACAACCAAAGGAAGCAATAGT	0.348													57	21	---	---	---	---	PASS
PDHA2	5161	broad.mit.edu	37	4	96762275	96762275	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96762275G>T	uc003htr.3	+	1	1037	c.974G>T	c.(973-975)AGC>ATC	p.S325I		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	325					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	ATGGTAAACAGCAAGCTCGCC	0.428													34	138	---	---	---	---	PASS
ADAD1	132612	broad.mit.edu	37	4	123333884	123333884	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123333884C>G	uc003ieo.2	+	10	1401	c.1169C>G	c.(1168-1170)ACC>AGC	p.T390S	ADAD1_uc003iep.2_Missense_Mutation_p.T379S|ADAD1_uc003ieq.2_Missense_Mutation_p.T372S	NM_139243	NP_640336	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1	390	A to I editase.				multicellular organismal development|RNA processing	nucleus	adenosine deaminase activity|double-stranded RNA binding				0						GACAAATTGACCAGATGGGAA	0.413													74	256	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126315166	126315166	+	Intron	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126315166C>G	uc003ifj.3	+						FAT4_uc011cgp.1_Intron	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						TATTGTAAGTCAAGCACAGAT	0.393													22	45	---	---	---	---	PASS
GLRB	2743	broad.mit.edu	37	4	158065105	158065105	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158065105C>A	uc003ipj.2	+	8	1100	c.898C>A	c.(898-900)CCC>ACC	p.P300T		NM_000824	NP_000815	P48167	GLRB_HUMAN	glycine receptor, beta isoform A precursor	300	Helical; (Probable).				nervous system development|neuropeptide signaling pathway|startle response	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|protein binding|receptor activity			skin(2)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Glycine(DB00145)	TGCCAGAGTGCCCCTGGGTAA	0.448													32	28	---	---	---	---	PASS
MTRR	4552	broad.mit.edu	37	5	7897251	7897251	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7897251G>T	uc003jed.2	+	14	1954	c.1924G>T	c.(1924-1926)GTT>TTT	p.V642F	MTRR_uc003jee.3_Missense_Mutation_p.V615F|MTRR_uc003jef.3_RNA|MTRR_uc003jeg.3_RNA|MTRR_uc010ito.2_RNA	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2	642					methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	AGATGCTCCTGTTGGGGAGGA	0.448													84	190	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11236820	11236820	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11236820T>G	uc003jfa.1	-	10	1889	c.1744A>C	c.(1744-1746)AAC>CAC	p.N582H	CTNND2_uc010itt.2_Missense_Mutation_p.N491H|CTNND2_uc011cmy.1_Missense_Mutation_p.N245H|CTNND2_uc011cmz.1_Missense_Mutation_p.N149H|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.N149H	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	582	ARM 3.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						TTAATTTTGTTGTCTCCAAAA	0.458													191	213	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11565180	11565180	+	Intron	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11565180C>A	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						TGAAAGAAACCCATCAACAAG	0.453													50	42	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19747337	19747337	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19747337G>T	uc003jgc.2	-	3	614	c.237C>A	c.(235-237)TCC>TCA	p.S79S	CDH18_uc003jgd.2_Silent_p.S79S|CDH18_uc011cnm.1_Silent_p.S79S	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	79	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TGTCAGAATTGGAGTGCAGCT	0.383													20	238	---	---	---	---	PASS
RAI14	26064	broad.mit.edu	37	5	34687014	34687014	+	5'UTR	SNP	A	G	G	rs112973577		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34687014A>G	uc003jir.2	+	2					RAI14_uc010iur.2_5'UTR|RAI14_uc011coj.1_5'UTR|RAI14_uc010ius.1_5'UTR|RAI14_uc003jis.2_5'UTR|RAI14_uc003jit.2_5'UTR|RAI14_uc011cok.1_5'Flank	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					GGAAGGCTGAATGCACTAAAC	0.438													39	135	---	---	---	---	PASS
IL7R	3575	broad.mit.edu	37	5	35861006	35861006	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35861006G>T	uc003jjs.2	+	2	224	c.135G>T	c.(133-135)CAG>CAT	p.Q45H	IL7R_uc011coo.1_Missense_Mutation_p.Q45H|IL7R_uc011cop.1_RNA	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor	45	Extracellular (Potential).				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			GCTATAGCCAGTTGGAAGTGA	0.448													13	955	---	---	---	---	PASS
SKP2	6502	broad.mit.edu	37	5	36168477	36168477	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36168477G>A	uc003jkc.1	+	5	781	c.599G>A	c.(598-600)GGC>GAC	p.G200D	SKP2_uc011cou.1_Intron|SKP2_uc003jkd.2_Missense_Mutation_p.G200D	NM_005983	NP_005974	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2 isoform 1	200	LRR 3.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|G1/S transition of mitotic cell cycle|S phase of mitotic cell cycle	nucleoplasm|SCF ubiquitin ligase complex	protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACCCTCCACGGCATACTGTCT	0.507													7	958	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40959652	40959652	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40959652G>C	uc003jmh.2	+	12	1705	c.1591G>C	c.(1591-1593)GGT>CGT	p.G531R	C7_uc011cpn.1_RNA	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	531	TSP type-1 2.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				TCCCAGTGGGGGTGGGAGATC	0.557													17	35	---	---	---	---	PASS
OXCT1	5019	broad.mit.edu	37	5	41805702	41805702	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41805702T>C	uc003jmn.2	-	9	1253	c.922A>G	c.(922-924)AGG>GGG	p.R308G		NM_000436	NP_000427	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1 precursor	308					cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity			ovary(2)|large_intestine(1)	3					Succinic acid(DB00139)	AGAGCGGCCCTCTTGATGATT	0.443													109	104	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262720	45262720	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262720C>A	uc003jok.2	-	8	2001	c.1976G>T	c.(1975-1977)CGC>CTC	p.R659L		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	659	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						TGTCCTCATGCGGGAGGTCGG	0.567													101	153	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140208933	140208933	+	Silent	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140208933G>C	uc003lho.2	+	1	1284	c.1257G>C	c.(1255-1257)TCG>TCC	p.S419S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Silent_p.S419S|PCDHA6_uc011dab.1_Silent_p.S419S	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	419	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGCGTGTCGGCCTATGAGT	0.612													65	408	---	---	---	---	PASS
PCDHGB1	56104	broad.mit.edu	37	5	140730487	140730487	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140730487C>T	uc003ljo.1	+	1	660	c.660C>T	c.(658-660)AGC>AGT	p.S220S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc011daq.1_Silent_p.S220S	NM_018922	NP_061745	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1 isoform 1	220	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCTCTAAGCGGCACCACCC	0.512													14	66	---	---	---	---	PASS
PCDHGB4	8641	broad.mit.edu	37	5	140768219	140768219	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140768219C>T	uc003lkc.1	+	1	768	c.768C>T	c.(766-768)TAC>TAT	p.Y256Y	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Silent_p.Y256Y	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	256	Cadherin 3.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAAACGTGTACCCGGGGACCA	0.507													285	104	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168201350	168201350	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168201350C>A	uc003mab.2	-	13	1605	c.1185G>T	c.(1183-1185)CGG>CGT	p.R395R	SLIT3_uc010jjg.2_Silent_p.R395R|SLIT3_uc010jji.2_Silent_p.R395R|SLIT3_uc003mac.1_Silent_p.R192R	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	395	LRR 10.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACGTGTTCACCCGCAGGCAGT	0.537													376	157	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168201351	168201351	+	Missense_Mutation	SNP	C	A	A	rs2288792	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168201351C>A	uc003mab.2	-	13	1604	c.1184G>T	c.(1183-1185)CGG>CTG	p.R395L	SLIT3_uc010jjg.2_Missense_Mutation_p.R395L|SLIT3_uc010jji.2_Missense_Mutation_p.R395L|SLIT3_uc003mac.1_Missense_Mutation_p.R192L	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	395	LRR 10.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGTGTTCACCCGCAGGCAGTT	0.542													375	157	---	---	---	---	PASS
DOK3	79930	broad.mit.edu	37	5	176931128	176931128	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176931128C>T	uc003mhk.2	-	6	1352	c.1347G>A	c.(1345-1347)CTG>CTA	p.L449L	DOK3_uc003mhh.3_Intron|DOK3_uc003mhi.3_Intron|DOK3_uc003mhj.3_Intron|DOK3_uc003mhl.2_Silent_p.L393L	NM_024872	NP_079148	Q7L591	DOK3_HUMAN	docking protein 3 isoform 1	449	Pro-rich.					cytoplasm|plasma membrane	insulin receptor binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			ACTGGGCCTCCAGGGTACTGT	0.687													31	9	---	---	---	---	PASS
SLC22A23	63027	broad.mit.edu	37	6	3324141	3324141	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3324141C>T	uc003mvm.3	-	4	1009	c.1009G>A	c.(1009-1011)GCC>ACC	p.A337T	SLC22A23_uc003mvn.3_Missense_Mutation_p.A56T|SLC22A23_uc003mvo.3_Missense_Mutation_p.A56T|SLC22A23_uc003mvp.1_RNA|SLC22A23_uc010jnn.2_Missense_Mutation_p.A337T|SLC22A23_uc010jno.2_Missense_Mutation_p.A337T	NM_015482	NP_056297	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23 isoform a	337					ion transport	integral to membrane	transmembrane transporter activity			ovary(1)	1	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				CGGCACAGGGCGGCTAGCCCA	0.612													14	42	---	---	---	---	PASS
BMP6	654	broad.mit.edu	37	6	7862565	7862565	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7862565G>T	uc003mxu.3	+	4	1216	c.1038G>T	c.(1036-1038)CTG>CTT	p.L346L		NM_001718	NP_001709	P22004	BMP6_HUMAN	bone morphogenetic protein 6 preproprotein	346					BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity			large_intestine(2)|ovary(1)	3	Ovarian(93;0.0721)					CCGCAGGCCTGGTGGGCAGAG	0.547													76	209	---	---	---	---	PASS
HSPA1L	3305	broad.mit.edu	37	6	31778147	31778147	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31778147T>A	uc003nxh.2	-	2	1786	c.1603A>T	c.(1603-1605)AGG>TGG	p.R535W	HSPA1L_uc010jte.2_Missense_Mutation_p.R535W	NM_005527	NP_005518	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	535					response to unfolded protein		ATP binding			ovary(3)|pleura(1)|kidney(1)|skin(1)	6						ATTTTCTCCCTCTGGACCTCA	0.448													232	302	---	---	---	---	PASS
NEU1	4758	broad.mit.edu	37	6	31827543	31827543	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31827543T>A	uc003nxq.3	-	6	1357	c.1201A>T	c.(1201-1203)ACA>TCA	p.T401S	NEU1_uc010jtg.2_RNA|NEU1_uc003nxr.3_RNA|NEU1_uc010jth.2_Missense_Mutation_p.T232S|NEU1_uc003nxs.3_3'UTR	NM_000434	NP_000425	Q99519	NEUR1_HUMAN	neuraminidase precursor	401						cytoplasmic membrane-bounded vesicle|lysosomal lumen|lysosomal membrane|plasma membrane	exo-alpha-sialidase activity|protein binding			ovary(1)	1					Oseltamivir(DB00198)|Zanamivir(DB00558)	ATGCTCTCTGTGTAGTGGTTC	0.572													87	161	---	---	---	---	PASS
RGL2	5863	broad.mit.edu	37	6	33263293	33263293	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33263293C>A	uc003odv.2	-	7	1145	c.1012G>T	c.(1012-1014)GTG>TTG	p.V338L	RGL2_uc003odu.2_5'UTR|RGL2_uc010jur.2_5'UTR|RGL2_uc003odw.2_Missense_Mutation_p.V256L|RGL2_uc011drb.1_Missense_Mutation_p.V256L	NM_004761	NP_004752	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation	338	Ras-GEF.				Ras protein signal transduction|regulation of small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity			skin(3)|lung(1)|breast(1)|pancreas(1)	6						ACCTCTGCCACGCGGATCCAC	0.617													14	89	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38754631	38754631	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38754631C>G	uc003ooe.1	+	16	2435	c.1835C>G	c.(1834-1836)ACT>AGT	p.T612S		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GTTCGGGAAACTAAGTGTATG	0.368													34	68	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38879313	38879313	+	Nonsense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38879313T>A	uc003ooe.1	+	64	9759	c.9159T>A	c.(9157-9159)TAT>TAA	p.Y3053*	uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						AAAACATTTATGCTGAAAAGG	0.294													28	67	---	---	---	---	PASS
KIAA0240	23506	broad.mit.edu	37	6	42789780	42789780	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42789780C>T	uc003osn.1	+	3	171	c.20C>T	c.(19-21)TCG>TTG	p.S7L	KIAA0240_uc003osm.1_Missense_Mutation_p.S7L|KIAA0240_uc011duw.1_Missense_Mutation_p.S7L|KIAA0240_uc003oso.1_Missense_Mutation_p.S7L|KIAA0240_uc003osp.1_Missense_Mutation_p.S7L	NM_015349	NP_056164	Q6AI39	K0240_HUMAN	hypothetical protein LOC23506	7										ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)			GATGATGACTCGTGTCTCCTT	0.358													13	253	---	---	---	---	PASS
BMP5	653	broad.mit.edu	37	6	55623922	55623922	+	Intron	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55623922T>C	uc003pcq.2	-						BMP5_uc011dxf.1_Intron	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein						cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			TCCTGacacatacacacacac	0.224													4	79	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70669889	70669889	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70669889G>A	uc003pfc.1	+	10	1055	c.938G>A	c.(937-939)GGT>GAT	p.G313D	COL19A1_uc010kam.1_Missense_Mutation_p.G209D	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	313	Triple-helical region 1 (COL1).				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						TTCTTTTAGGGTGAAAATGGT	0.328													22	56	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87971382	87971382	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87971382G>T	uc003plm.3	+	8	8076	c.8035G>T	c.(8035-8037)GAG>TAG	p.E2679*		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	2679					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		AGATTGCACTGAGCTTGTCTT	0.343													11	24	---	---	---	---	PASS
VNN3	55350	broad.mit.edu	37	6	133050112	133050112	+	3'UTR	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133050112G>T	uc003qdp.2	-	4					VNN3_uc010kfs.2_Intron|VNN3_uc011ecl.1_Intron|VNN3_uc011ecm.1_5'UTR|VNN3_uc011ecn.1_5'UTR|VNN3_uc010kfu.2_5'UTR|VNN3_uc010kfv.2_Intron|VNN3_uc010kfw.2_Intron|VNN3_uc010kfx.2_Intron|VNN3_uc010kfy.2_5'UTR|VNN3_uc010kfz.2_Intron	NM_078625	NP_523239			SubName: Full=PAGEL-beta;												0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		CTATATTTTAGTGATTTCTGA	0.363													38	80	---	---	---	---	PASS
VNN3	55350	broad.mit.edu	37	6	133052588	133052588	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133052588T>A	uc003qdp.2	-	3	495	c.423A>T	c.(421-423)CAA>CAT	p.Q141H	VNN3_uc010kfs.2_Intron|VNN3_uc011ecl.1_Intron|VNN3_uc011ecm.1_Intron|VNN3_uc011ecn.1_5'UTR|VNN3_uc010kfu.2_Intron|VNN3_uc010kfv.2_Intron|VNN3_uc010kfw.2_Intron|VNN3_uc010kfx.2_Intron|VNN3_uc010kfy.2_Intron|VNN3_uc010kfz.2_Intron	NM_078625	NP_523239			SubName: Full=PAGEL-beta;												0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		acaatttccattggccatatt	0.189													20	102	---	---	---	---	PASS
TNFAIP3	7128	broad.mit.edu	37	6	138196127	138196127	+	Silent	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138196127C>G	uc003qhr.2	+	3	507	c.441C>G	c.(439-441)CTC>CTG	p.L147L	TNFAIP3_uc003qhs.2_Silent_p.L147L	NM_006290	NP_006281	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	147	TRAF-binding.|OTU.				anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding	p.0?(22)|p.L147fs*7(1)		haematopoietic_and_lymphoid_tissue(133)|lung(3)|ovary(1)	137	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		TGGAGTCTCTCAAATCTCAGG	0.483			D|N|F		marginal zone B-cell lymphomas|Hodgkin's lymphoma|primary mediastinal B cell lymphoma								39	238	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144768801	144768801	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144768801G>A	uc003qkt.2	+	15	1878	c.1786G>A	c.(1786-1788)GAT>AAT	p.D596N	UTRN_uc010khq.1_Missense_Mutation_p.D596N	NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	596	Interaction with SYNM.|Spectrin 4.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GATTGGCCAGGATGTGGGACA	0.378													36	181	---	---	---	---	PASS
STXBP5	134957	broad.mit.edu	37	6	147636666	147636666	+	Nonsense_Mutation	SNP	T	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147636666T>G	uc003qlz.2	+	15	1579	c.1418T>G	c.(1417-1419)TTA>TGA	p.L473*	STXBP5_uc010khz.1_Nonsense_Mutation_p.L473*|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Nonsense_Mutation_p.L144*	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	473	WD 8.				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		CTACAAGTATTATATAAGCTA	0.284													20	27	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152536168	152536168	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152536168C>A	uc010kiw.2	-	122	22821	c.22219G>T	c.(22219-22221)GCT>TCT	p.A7407S	SYNE1_uc010kiv.2_Missense_Mutation_p.A1931S|SYNE1_uc003qos.3_Missense_Mutation_p.A1931S|SYNE1_uc003qot.3_Missense_Mutation_p.A7336S|SYNE1_uc003qou.3_Missense_Mutation_p.A7407S|SYNE1_uc003qor.3_Missense_Mutation_p.A307S	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7407	Spectrin 24.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AAATCTGGAGCCATGCTGCTG	0.388										HNSCC(10;0.0054)			80	135	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152536169	152536169	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152536169C>A	uc010kiw.2	-	122	22820	c.22218G>T	c.(22216-22218)ATG>ATT	p.M7406I	SYNE1_uc010kiv.2_Missense_Mutation_p.M1930I|SYNE1_uc003qos.3_Missense_Mutation_p.M1930I|SYNE1_uc003qot.3_Missense_Mutation_p.M7335I|SYNE1_uc003qou.3_Missense_Mutation_p.M7406I|SYNE1_uc003qor.3_Missense_Mutation_p.M306I	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7406	Spectrin 24.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AATCTGGAGCCATGCTGCTGA	0.388										HNSCC(10;0.0054)			81	135	---	---	---	---	PASS
MAD1L1	8379	broad.mit.edu	37	7	2255539	2255539	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2255539C>A	uc003slh.1	-	9	1171	c.905G>T	c.(904-906)GGC>GTC	p.G302V	MAD1L1_uc003sle.1_Missense_Mutation_p.G31V|MAD1L1_uc003slf.1_Missense_Mutation_p.G302V|MAD1L1_uc003slg.1_Missense_Mutation_p.G302V|MAD1L1_uc010ksh.1_Missense_Mutation_p.G302V|MAD1L1_uc003sli.1_Missense_Mutation_p.G210V|MAD1L1_uc010ksi.1_Missense_Mutation_p.G255V|MAD1L1_uc010ksj.2_Missense_Mutation_p.G302V	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	302	Potential.				cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		CAGCTCCAAGCCAACCAGCGT	0.637													123	214	---	---	---	---	PASS
MAD1L1	8379	broad.mit.edu	37	7	2255540	2255540	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2255540C>A	uc003slh.1	-	9	1170	c.904G>T	c.(904-906)GGC>TGC	p.G302C	MAD1L1_uc003sle.1_Missense_Mutation_p.G31C|MAD1L1_uc003slf.1_Missense_Mutation_p.G302C|MAD1L1_uc003slg.1_Missense_Mutation_p.G302C|MAD1L1_uc010ksh.1_Missense_Mutation_p.G302C|MAD1L1_uc003sli.1_Missense_Mutation_p.G210C|MAD1L1_uc010ksi.1_Missense_Mutation_p.G255C|MAD1L1_uc010ksj.2_Missense_Mutation_p.G302C	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	302	Potential.				cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		AGCTCCAAGCCAACCAGCGTC	0.632													125	213	---	---	---	---	PASS
PHF14	9678	broad.mit.edu	37	7	11078436	11078436	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11078436G>A	uc003sry.1	+	11	2465	c.2030G>A	c.(2029-2031)AGT>AAT	p.S677N	PHF14_uc011jxi.1_Missense_Mutation_p.S392N|PHF14_uc003srz.2_Missense_Mutation_p.S677N|PHF14_uc011jxj.1_Missense_Mutation_p.S392N	NM_014660	NP_055475	O94880	PHF14_HUMAN	PHD finger protein 14 isoform 2	677							zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		AAACTTCGAAGTGAAGGACAA	0.353													6	28	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21723437	21723437	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21723437A>T	uc003svc.2	+	33	5548	c.5517A>T	c.(5515-5517)CAA>CAT	p.Q1839H		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1839	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GGCTGTCTCAACTTCGTCACC	0.438									Kartagener_syndrome				204	234	---	---	---	---	PASS
GHRHR	2692	broad.mit.edu	37	7	31008714	31008714	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31008714C>A	uc003tbx.2	+	3	245	c.197C>A	c.(196-198)CCA>CAA	p.P66Q	GHRHR_uc003tbw.1_Missense_Mutation_p.P66Q|GHRHR_uc003tby.2_5'Flank|GHRHR_uc003tbz.2_5'Flank	NM_000823	NP_000814	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	66	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation|positive regulation of growth hormone secretion|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of multicellular organism growth|response to estrogen stimulus|response to glucocorticoid stimulus	cell surface|integral to membrane|nuclear inner membrane|nuclear matrix|nuclear outer membrane|plasma membrane|stored secretory granule	growth factor binding|growth hormone-releasing hormone receptor activity|peptide hormone binding			ovary(2)|lung(1)|breast(1)|large_intestine(1)	5					Sermorelin(DB00010)	CTGTGCTGGCCAACGGCAGGC	0.637													4	6	---	---	---	---	PASS
DPY19L1	23333	broad.mit.edu	37	7	35050089	35050089	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35050089G>T	uc003tem.3	-	6	681	c.536C>A	c.(535-537)ACA>AAA	p.T179K		NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1	179						integral to membrane					0						CCTTAAATATGTGCCATATAT	0.234													10	26	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42005725	42005725	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42005725C>A	uc011kbh.1	-	15	3037	c.2946G>T	c.(2944-2946)GGG>GGT	p.G982G	GLI3_uc011kbg.1_Silent_p.G923G	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	982					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						CGTGGGCTCCCCCGTCGCTGC	0.746									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				8	8	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48431646	48431646	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48431646A>G	uc003toq.2	+	38	11808	c.11783A>G	c.(11782-11784)GAC>GGC	p.D3928G	ABCA13_uc010kys.1_Missense_Mutation_p.D1002G|ABCA13_uc003tos.1_Missense_Mutation_p.D754G|ABCA13_uc010kyt.1_RNA	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3928	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						ATCCTGTTGGACAACCTCACC	0.507													16	106	---	---	---	---	PASS
CALN1	83698	broad.mit.edu	37	7	71252808	71252808	+	Silent	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71252808A>G	uc003twa.3	-	6	1139	c.612T>C	c.(610-612)AGT>AGC	p.S204S	CALN1_uc003twb.3_Silent_p.S246S|CALN1_uc003twc.3_Silent_p.S204S	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	204	Helical; Anchor for type IV membrane protein; (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				TCAGCATGACACTGATGATGA	0.582													9	97	---	---	---	---	PASS
CCDC146	57639	broad.mit.edu	37	7	76916837	76916837	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76916837C>A	uc003uga.2	+	17	2485	c.2358C>A	c.(2356-2358)GAC>GAA	p.D786E	CCDC146_uc010ldp.2_Missense_Mutation_p.D500E|CCDC146_uc003ugc.2_Missense_Mutation_p.D123E	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	786	Potential.									ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				GGCTCACAGACAGGCTCTGCA	0.522													45	59	---	---	---	---	PASS
STAG3	10734	broad.mit.edu	37	7	99779815	99779815	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99779815G>A	uc003utx.1	+	3	374	c.219G>A	c.(217-219)CCG>CCA	p.P73P	STAG3_uc010lgs.1_5'UTR|STAG3_uc011kjk.1_Silent_p.P73P	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3	73					chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AAACAACACCGGTGAGTCAGC	0.333													4	67	---	---	---	---	PASS
SLC12A9	56996	broad.mit.edu	37	7	100452291	100452291	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100452291G>T	uc003uwp.2	+	3	373	c.231G>T	c.(229-231)CTG>CTT	p.L77L	SLC12A9_uc003uwo.1_Intron|SLC12A9_uc003uwq.2_Intron|SLC12A9_uc011kki.1_Intron|SLC12A9_uc003uwr.2_5'Flank|SLC12A9_uc003uws.2_5'Flank|SLC12A9_uc003uwt.2_5'Flank	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride	77	Helical; (Potential).					integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCATGCTGCTGGTTGCCTACT	0.612													115	170	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100682800	100682800	+	Silent	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100682800C>G	uc003uxp.1	+	3	8156	c.8103C>G	c.(8101-8103)ACC>ACG	p.T2701T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2701	Extracellular (Potential).|43.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TTGTCAGCACCACGCTGTTGG	0.488													76	521	---	---	---	---	PASS
MOGAT3	346606	broad.mit.edu	37	7	100841537	100841537	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100841537G>A	uc003uyc.2	-	5	770	c.603C>T	c.(601-603)GTC>GTT	p.V201V	MOGAT3_uc010lhr.2_Silent_p.V201V	NM_178176	NP_835470	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	201					glycerol metabolic process|lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity|diacylglycerol O-acyltransferase activity			ovary(2)	2	Lung NSC(181;0.168)|all_lung(186;0.215)					GCTCCCCGGGGACTGAATACA	0.672													25	165	---	---	---	---	PASS
EMID2	136227	broad.mit.edu	37	7	101006372	101006372	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101006372C>T	uc010lhy.1	+	1	251	c.59C>T	c.(58-60)GCC>GTC	p.A20V	EMID2_uc003uyo.1_Missense_Mutation_p.A20V	NM_133457	NP_597714	Q96A83	EMID2_HUMAN	EMI domain containing 2	20						collagen				ovary(1)	1	Lung NSC(181;0.215)					TCGGCGCTGGCCACCGGCTTC	0.751													3	7	---	---	---	---	PASS
ORC5L	5001	broad.mit.edu	37	7	103838219	103838219	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103838219T>C	uc003vcb.2	-	4	506	c.395A>G	c.(394-396)GAT>GGT	p.D132G	ORC5L_uc011klp.1_5'UTR|ORC5L_uc003vcc.2_Missense_Mutation_p.D132G|ORC5L_uc003vcd.2_Missense_Mutation_p.D132G	NM_002553	NP_002544	O43913	ORC5_HUMAN	origin recognition complex subunit 5 isoform 1	132					cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	cytoplasm|nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|identical protein binding				0						TGCTTCCATATCTCTTAGATA	0.199													19	16	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106508006	106508006	+	5'UTR	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106508006C>A	uc003vdv.3	+	2					PIK3CG_uc003vdu.2_5'UTR|PIK3CG_uc003vdw.2_5'UTR	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma						G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						TCGCATAGGGCATGGAGCTGG	0.572													105	136	---	---	---	---	PASS
SLC26A3	1811	broad.mit.edu	37	7	107418637	107418637	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107418637G>C	uc003ver.2	-	13	1708	c.1497C>G	c.(1495-1497)ATC>ATG	p.I499M	SLC26A3_uc003ves.2_Missense_Mutation_p.I464M	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3	499					excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						TCCTGAACACGATGGTTAGCA	0.473													18	22	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111405235	111405235	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111405235C>A	uc003vfx.2	-	38	4201	c.3932G>T	c.(3931-3933)CGT>CTT	p.R1311L	DOCK4_uc011kml.1_Missense_Mutation_p.R192L|DOCK4_uc011kmm.1_Missense_Mutation_p.R218L|DOCK4_uc003vfw.2_Missense_Mutation_p.R761L|DOCK4_uc003vfy.2_Missense_Mutation_p.R1356L	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1311	DHR-2.				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				TGGTTCAAGACGTTGCTGGTC	0.328													4	4	---	---	---	---	PASS
ANKRD7	56311	broad.mit.edu	37	7	117876971	117876971	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117876971G>A	uc003vji.2	+	5	876	c.703G>A	c.(703-705)GTT>ATT	p.V235I		NM_019644	NP_062618	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	235					male gonad development						0						TATTTCCATGGTTTTACTGCG	0.393													230	302	---	---	---	---	PASS
TSPAN12	23554	broad.mit.edu	37	7	120478828	120478828	+	Intron	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120478828T>C	uc003vjk.2	-							NM_012338	NP_036470	O95859	TSN12_HUMAN	transmembrane 4 superfamily member 12						angiogenesis|cell surface receptor linked signaling pathway|regulation of angiogenesis|retina layer formation	integral to plasma membrane|membrane fraction					0	all_neural(327;0.117)					TATAACATCATACCCATGCAA	0.333													44	94	---	---	---	---	PASS
SLC37A3	84255	broad.mit.edu	37	7	140064300	140064300	+	Intron	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140064300A>G	uc003vvo.2	-						SLC37A3_uc003vvp.2_Intron|SLC37A3_uc010lnh.2_Intron|SLC37A3_uc011kqz.1_Intron|SLC37A3_uc011kra.1_Intron|SLC37A3_uc011krb.1_Intron	NM_207113	NP_996996	Q8NCC5	SPX3_HUMAN	solute carrier family 37 (glycerol-3-phosphate						carbohydrate transport|transmembrane transport	integral to membrane				ovary(3)	3	Melanoma(164;0.0142)					CCCTAAAAATAAAGCATTTTC	0.358													22	90	---	---	---	---	PASS
DENND2A	27147	broad.mit.edu	37	7	140287512	140287512	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140287512T>G	uc010lnj.2	-	2	1209	c.1064A>C	c.(1063-1065)CAG>CCG	p.Q355P	DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Missense_Mutation_p.Q355P|DENND2A_uc003vvw.2_Missense_Mutation_p.Q355P|DENND2A_uc003vvx.2_Missense_Mutation_p.Q355P	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	355										ovary(3)|breast(1)	4	Melanoma(164;0.00956)					CAGCTTAGTCTGCGCGTACCA	0.493													46	117	---	---	---	---	PASS
TRPV5	56302	broad.mit.edu	37	7	142626552	142626552	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142626552C>T	uc003wby.1	-	4	722	c.458G>A	c.(457-459)CGC>CAC	p.R153H	TRPV5_uc003wbz.2_Missense_Mutation_p.R153H	NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	153	Cytoplasmic (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					GGGACTACGGCGGAAGGCAGT	0.622													56	66	---	---	---	---	PASS
OR9A2	135924	broad.mit.edu	37	7	142724138	142724138	+	Missense_Mutation	SNP	C	T	T	rs147361429		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142724138C>T	uc003wcc.1	-	1	82	c.82G>A	c.(82-84)GCT>ACT	p.A28T		NM_001001658	NP_001001658	Q8NGT5	OR9A2_HUMAN	olfactory receptor, family 9, subfamily A,	28	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	Melanoma(164;0.059)					AAGAATATAGCAAAAAGAATG	0.418													30	129	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149475964	149475964	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149475964T>C	uc010lpk.2	+	7	930	c.930T>C	c.(928-930)TCT>TCC	p.S310S	SSPO_uc010lpl.1_5'UTR	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	310	VWFD 1.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TCTCCATCTCTGTGGACCACG	0.637													72	175	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149489487	149489487	+	Silent	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149489487G>C	uc010lpk.2	+	38	5640	c.5640G>C	c.(5638-5640)GGG>GGC	p.G1880G		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	1880	EGF-like 2.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ACTGGCCTGGGCAACGCATCA	0.706													8	17	---	---	---	---	PASS
ABCB8	11194	broad.mit.edu	37	7	150741298	150741298	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150741298G>A	uc003wil.3	+	16	2150	c.2057G>A	c.(2056-2058)CGT>CAT	p.R686H	ABCB8_uc010lpx.2_Intron|ABCB8_uc011kvd.1_Missense_Mutation_p.R581H|ABCB8_uc003wim.3_Missense_Mutation_p.R464H|ABCB8_uc003wik.3_Missense_Mutation_p.R669H	NM_007188	NP_009119	Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B, member 8	686	ABC transporter.					ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCGATGGCCGTGTCTGGGAG	0.602													76	203	---	---	---	---	PASS
ACCN3	9311	broad.mit.edu	37	7	150748977	150748977	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150748977C>T	uc003win.2	+	7	1663	c.1295C>T	c.(1294-1296)TCA>TTA	p.S432L	ACCN3_uc003wio.2_Missense_Mutation_p.S432L|ACCN3_uc003wip.2_Missense_Mutation_p.S432L|ACCN3_uc003wiq.2_RNA	NM_004769	NP_004760	Q9UHC3	ACCN3_HUMAN	amiloride-sensitive cation channel 3 isoform a	432	Extracellular (Potential).				sensory perception|signal transduction	cytoplasm|integral to plasma membrane	ligand-gated sodium channel activity			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TATGAGATGTCAGAGCTGCTT	0.587													32	224	---	---	---	---	PASS
GBX1	2636	broad.mit.edu	37	7	150864346	150864346	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150864346G>C	uc011kvg.1	-	1	522	c.290C>G	c.(289-291)TCG>TGG	p.S97W		NM_001098834	NP_001092304	Q14549	GBX1_HUMAN	gastrulation brain homeo box 1	97	Ala-rich.|Pro-rich.					nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGCCACCATCGAGGGCACAGC	0.637													3	9	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151932996	151932996	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151932996C>A	uc003wla.2	-	16	2894	c.2675G>T	c.(2674-2676)GGA>GTA	p.G892V	MLL3_uc003wkz.2_5'UTR	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	892					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TCTCCGCTTTCCTGGAAATCC	0.493			N		medulloblastoma								7	136	---	---	---	---	PASS
MFHAS1	9258	broad.mit.edu	37	8	8748528	8748528	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8748528G>T	uc003wsj.1	-	1	2604	c.2041C>A	c.(2041-2043)CTA>ATA	p.L681I		NM_004225	NP_004216	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified	681											0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CACCAGCTTAGCCACAGTCGC	0.622													20	13	---	---	---	---	PASS
EFHA2	286097	broad.mit.edu	37	8	16884802	16884802	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16884802G>C	uc003wxd.2	+	1	56	c.14G>C	c.(13-15)CGA>CCA	p.R5P		NM_181723	NP_859074	Q86XE3	EFHA2_HUMAN	EF-hand domain family, member A2	5						integral to membrane	calcium ion binding			skin(1)	1				Colorectal(111;0.0686)|COAD - Colon adenocarcinoma(73;0.239)		GCTGCGCTGCGAAGGCTCTTG	0.622													7	27	---	---	---	---	PASS
MTUS1	57509	broad.mit.edu	37	8	17512165	17512165	+	Nonsense_Mutation	SNP	A	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17512165A>C	uc003wxv.2	-	10	3593	c.3119T>G	c.(3118-3120)TTA>TGA	p.L1040*	MTUS1_uc003wxt.2_Nonsense_Mutation_p.L287*|MTUS1_uc011kyg.1_Nonsense_Mutation_p.L185*|MTUS1_uc010lsy.2_RNA|MTUS1_uc003wxw.2_Nonsense_Mutation_p.L986*|MTUS1_uc003wxs.2_Nonsense_Mutation_p.L206*	NM_001001924	NP_001001924	Q9ULD2	MTUS1_HUMAN	mitochondrial tumor suppressor 1 isoform 1	1040	Potential.					Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)		CGCAGCATTTAAGTTGTCAAA	0.413													62	24	---	---	---	---	PASS
SH2D4A	63898	broad.mit.edu	37	8	19177078	19177078	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19177078C>T	uc003wzb.2	+	2	356	c.20C>T	c.(19-21)TCG>TTG	p.S7L	SH2D4A_uc011kym.1_Intron|SH2D4A_uc003wzc.2_Missense_Mutation_p.S7L	NM_022071	NP_071354	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	7						cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)		CAGATACTGTCGGAGATGTAC	0.468													16	86	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25203000	25203000	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25203000A>T	uc003xeg.2	+	26	2764	c.2627A>T	c.(2626-2628)GAA>GTA	p.E876V	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.E590V|DOCK5_uc003xei.2_Missense_Mutation_p.E446V|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	876						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GAGTGCAGAGAAGTGCTGCTG	0.552													25	106	---	---	---	---	PASS
FGFR1	2260	broad.mit.edu	37	8	38275843	38275843	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38275843G>A	uc003xlp.2	-	11	2275	c.1333C>T	c.(1333-1335)CGG>TGG	p.R445W	FGFR1_uc010lwf.2_RNA|FGFR1_uc011lbo.1_Missense_Mutation_p.R443W|FGFR1_uc011lbp.1_Missense_Mutation_p.R356W|FGFR1_uc011lbq.1_Missense_Mutation_p.R354W|FGFR1_uc010lwk.2_Missense_Mutation_p.R435W	NM_023110	NP_075598	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1 isoform 1	445	Cytoplasmic (Potential).				axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity			lung(5)|central_nervous_system(5)|stomach(2)|breast(2)|ovary(1)	15	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)	CGTGATGGCCGAACCAGAAGA	0.607		1	T	BCR|FOP|ZNF198|CEP1	MPD|NHL		Pfeiffer syndrome|Kallman syndrome						4	105	---	---	---	---	PASS
ADAM18	8749	broad.mit.edu	37	8	39564308	39564308	+	Splice_Site	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39564308G>T	uc003xni.2	+	18	1903	c.1903_splice	c.e18-1	p.I635_splice	ADAM18_uc010lww.2_Splice_Site|ADAM18_uc010lwx.2_Splice_Site_p.I611_splice	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18						cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TTCTGTTTCAGATATGTAATA	0.333													15	8	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41522352	41522352	+	Intron	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41522352T>C	uc003xok.2	-						NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Intron|ANK1_uc003xoi.2_Intron|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron|ANK1_uc011lcl.1_Missense_Mutation_p.R64G|ANK1_uc003xod.2_Missense_Mutation_p.R64G|ANK1_uc003xoc.2_Missense_Mutation_p.R64G|ANK1_uc003xof.2_Missense_Mutation_p.R64G	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CGGACCACCCTGGTGGAGATG	0.687													31	47	---	---	---	---	PASS
HOOK3	84376	broad.mit.edu	37	8	42868200	42868200	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42868200C>T	uc003xpr.2	+	20	2088	c.1846C>T	c.(1846-1848)CGT>TGT	p.R616C		NM_032410	NP_115786	Q86VS8	HOOK3_HUMAN	golgi-associated microtubule-binding protein	616	Potential.|Required for interaction with MSR1.|Required for association with Golgi.				cytoplasmic microtubule organization|early endosome to late endosome transport|endosome organization|endosome to lysosome transport|Golgi localization|interkinetic nuclear migration|lysosome organization|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome|protein transport	cis-Golgi network|FHF complex|microtubule|pericentriolar material	identical protein binding|microtubule binding			ovary(1)|breast(1)	2	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			GCAGGTCATCCGTACTTTAGA	0.318			T	RET	papillary thyroid								28	35	---	---	---	---	PASS
POTEA	340441	broad.mit.edu	37	8	43173651	43173651	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43173651A>T	uc003xpz.1	+	9	1116	c.1073A>T	c.(1072-1074)AAC>ATC	p.N358I	POTEA_uc003xqa.1_Missense_Mutation_p.N312I	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	358										ovary(1)	1						TTATCAGAAAACCTGACTGAT	0.378													15	175	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52733146	52733146	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52733146C>A	uc003xqx.3	-	6	1180	c.839G>T	c.(838-840)AGA>ATA	p.R280I	PCMTD1_uc011ldm.1_Missense_Mutation_p.R150I|PCMTD1_uc003xqw.3_Missense_Mutation_p.R280I|PCMTD1_uc011ldn.1_Missense_Mutation_p.R92I|PCMTD1_uc010lya.2_Missense_Mutation_p.R204I	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)	280						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				CTGTTTAACTCTCTTTCTTTT	0.343													11	551	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55540455	55540455	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55540455T>C	uc003xsd.1	+	4	4161	c.4013T>C	c.(4012-4014)GTC>GCC	p.V1338A	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1338					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CCTGTCAATGTCTGCAATACC	0.383													116	181	---	---	---	---	PASS
NSMAF	8439	broad.mit.edu	37	8	59506795	59506795	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59506795G>A	uc003xtt.2	-	23	2161	c.1947C>T	c.(1945-1947)TCC>TCT	p.S649S	NSMAF_uc011lee.1_Silent_p.S680S	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation	649	WD 1.				ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				ACTGACCTTGGGATGTTGTGA	0.428													46	73	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61655205	61655205	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61655205C>T	uc003xue.2	+	2	1691	c.1214C>T	c.(1213-1215)CCA>CTA	p.P405L		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	405	Pro-rich.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			ATGAGTAATCCAGCAGGCACT	0.502													40	367	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61769073	61769073	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61769073G>C	uc003xue.2	+	34	7711	c.7234G>C	c.(7234-7236)GAA>CAA	p.E2412Q		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2412	Potential.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AATTGAGGCCGAAAGAGCTGC	0.478													5	81	---	---	---	---	PASS
SULF1	23213	broad.mit.edu	37	8	70514019	70514019	+	Missense_Mutation	SNP	G	A	A	rs61747207	byFrequency	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70514019G>A	uc010lza.1	+	10	1733	c.1016G>A	c.(1015-1017)CGT>CAT	p.R339H	SULF1_uc003xyd.2_Missense_Mutation_p.R339H|SULF1_uc003xye.2_Missense_Mutation_p.R339H|SULF1_uc003xyf.2_Missense_Mutation_p.R339H|SULF1_uc003xyg.2_Missense_Mutation_p.R339H|SULF1_uc003xyh.1_RNA	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	339					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TTTGATATTCGTGTGCCTTTT	0.423													76	665	---	---	---	---	PASS
SULF1	23213	broad.mit.edu	37	8	70540420	70540420	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70540420A>T	uc010lza.1	+	18	2774	c.2057A>T	c.(2056-2058)GAG>GTG	p.E686V	SULF1_uc003xyd.2_Missense_Mutation_p.E686V|SULF1_uc003xye.2_Missense_Mutation_p.E686V|SULF1_uc003xyf.2_Missense_Mutation_p.E686V|SULF1_uc003xyg.2_Missense_Mutation_p.E686V|SULF1_uc003xyh.1_RNA|SULF1_uc003xyi.1_5'UTR	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	686					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TACAATAAAGAGAAAGGTGTA	0.348													154	192	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87588256	87588256	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87588256C>G	uc003ydx.2	-	18	2252	c.2206G>C	c.(2206-2208)GAA>CAA	p.E736Q	CNGB3_uc010maj.2_Missense_Mutation_p.E593Q	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	736	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						tcttcattttcttttccttta	0.229													58	166	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104897620	104897620	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104897620G>A	uc003yls.2	+	2	368	c.127G>A	c.(127-129)GCA>ACA	p.A43T	RIMS2_uc003ylp.2_Missense_Mutation_p.A265T|RIMS2_uc003ylw.2_Missense_Mutation_p.A73T|RIMS2_uc003ylq.2_Missense_Mutation_p.A73T|RIMS2_uc003ylr.2_Missense_Mutation_p.A73T	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	296					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TTCGGATACCGCAATGCCTAG	0.413										HNSCC(12;0.0054)			14	186	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104987664	104987664	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104987664G>T	uc003yls.2	+	14	2432	c.2191G>T	c.(2191-2193)GGG>TGG	p.G731W	RIMS2_uc003ylp.2_Missense_Mutation_p.G953W|RIMS2_uc003ylw.2_Missense_Mutation_p.G745W|RIMS2_uc003ylq.2_Missense_Mutation_p.G745W|RIMS2_uc003ylr.2_Missense_Mutation_p.G792W|RIMS2_uc003ylt.2_Missense_Mutation_p.G338W	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1015					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TTCACCATCAGGGTCTCCTCA	0.408										HNSCC(12;0.0054)			39	76	---	---	---	---	PASS
NOV	4856	broad.mit.edu	37	8	120430560	120430560	+	Intron	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120430560C>A	uc003yoq.2	+							NM_002514	NP_002505	P48745	NOV_HUMAN	nephroblastoma overexpressed precursor						regulation of cell growth		growth factor activity|insulin-like growth factor binding			ovary(2)|skin(2)|kidney(1)	5	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GTGAGAAACTCAATATACCTA	0.453													5	437	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139833462	139833462	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139833462G>T	uc003yvd.2	-	7	1609	c.1162C>A	c.(1162-1164)CTA>ATA	p.L388I		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	388	TSP N-terminal.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TCGATGGGTAGTGTCTGCACC	0.582										HNSCC(7;0.00092)			81	114	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139890388	139890388	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139890388G>A	uc003yvd.2	-	3	710	c.263C>T	c.(262-264)ACG>ATG	p.T88M		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	88	VWFA.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTCGAAGGCCGTGGTGGGCCG	0.697										HNSCC(7;0.00092)			3	36	---	---	---	---	PASS
KCNK9	51305	broad.mit.edu	37	8	140631068	140631068	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140631068G>A	uc003yvf.1	-	2	622	c.558C>T	c.(556-558)TTC>TTT	p.F186F	KCNK9_uc003yvg.1_Silent_p.F186F|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	186	Extracellular (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			AGGCGTGGAAGAAGCTCCACT	0.587													17	218	---	---	---	---	PASS
DMRT2	10655	broad.mit.edu	37	9	1053757	1053757	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1053757C>T	uc003zha.2	+	3	761	c.561C>T	c.(559-561)TTC>TTT	p.F187F	DMRT2_uc003zgx.3_5'UTR|DMRT2_uc010mgz.2_5'UTR|DMRT2_uc003zgy.3_Silent_p.F31F|DMRT2_uc003zhb.3_Silent_p.F187F|DMRT2_uc011llt.1_Silent_p.F187F|DMRT2_uc011llu.1_Silent_p.F187F|DMRT2_uc011llv.1_Silent_p.F187F	NM_181872	NP_870987	Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor	187					male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		AGAATAATTTCGAGCGCAAAG	0.448													7	237	---	---	---	---	PASS
JAK2	3717	broad.mit.edu	37	9	5078317	5078317	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5078317C>T	uc010mhm.2	+	15	2117	c.2004C>T	c.(2002-2004)ACC>ACT	p.T668T	JAK2_uc003ziw.2_Silent_p.T668T	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2	668	Protein kinase 1.				actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		AAGAAAACACCCTTATTCATG	0.373		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				67	147	---	---	---	---	PASS
RLN2	6019	broad.mit.edu	37	9	5300255	5300255	+	Missense_Mutation	SNP	C	T	T	rs61738986	byFrequency	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5300255C>T	uc003zja.1	-	2	401	c.401G>A	c.(400-402)CGC>CAC	p.R134H	RLN2_uc003ziz.1_3'UTR	NM_134441	NP_604390	P04090	REL2_HUMAN	relaxin 2 isoform 1 preproprotein	134					female pregnancy	extracellular region	hormone activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0201)|Lung(218;0.0987)		TTGTCTATTGCGAATAAGTTT	0.393													78	118	---	---	---	---	PASS
RLN1	6013	broad.mit.edu	37	9	5335609	5335609	+	Intron	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5335609A>T	uc003zjb.1	-							NM_006911	NP_008842	P04808	REL1_HUMAN	relaxin 1 preproprotein						female pregnancy|signal transduction	extracellular region	hormone activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.02)|Lung(218;0.0984)		TGTTAAGTTTAAAAAAAAAGT	0.338													9	75	---	---	---	---	PASS
KDM4C	23081	broad.mit.edu	37	9	6984351	6984351	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6984351C>T	uc003zkh.2	+	10	1881	c.1301C>T	c.(1300-1302)TCT>TTT	p.S434F	KDM4C_uc010mhu.2_Missense_Mutation_p.S456F|KDM4C_uc011lmi.1_Missense_Mutation_p.S434F|KDM4C_uc011lmj.1_RNA|KDM4C_uc003zkg.2_Missense_Mutation_p.S434F|KDM4C_uc011lmk.1_Missense_Mutation_p.S253F|KDM4C_uc011lml.1_Missense_Mutation_p.S121F	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1	434					positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						GAAGAGTCATCTGCTAGCAGG	0.448													131	105	---	---	---	---	PASS
IFNA6	3443	broad.mit.edu	37	9	21350654	21350654	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21350654G>A	uc011lni.1	-	1	233	c.233C>T	c.(232-234)TCT>TTT	p.S78F		NM_021002	NP_066282	P05013	IFNA6_HUMAN	interferon, alpha 6 precursor	78					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		ATGGAGGACAGAGATGGCTTC	0.473													103	182	---	---	---	---	PASS
TEK	7010	broad.mit.edu	37	9	27229209	27229209	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27229209T>C	uc003zqi.3	+	23	3796	c.3354T>C	c.(3352-3354)TGT>TGC	p.C1118C	TEK_uc011lno.1_Silent_p.C1075C|TEK_uc011lnp.1_Silent_p.C970C	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor	1118	Cytoplasmic (Potential).				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		GAATTGACTGTTCTGCTGAAG	0.458													12	318	---	---	---	---	PASS
FBXO10	26267	broad.mit.edu	37	9	37516034	37516034	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37516034G>A	uc004aab.2	-	10	2612	c.2563C>T	c.(2563-2565)CGG>TGG	p.R855W	FBXO10_uc004aac.2_Missense_Mutation_p.R871W|FBXO10_uc004aad.2_Missense_Mutation_p.R405W	NM_012166	NP_036298	Q9UK96	FBX10_HUMAN	F-box protein 10	855						ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(5)	5				GBM - Glioblastoma multiforme(29;0.0107)		GCACGGCCCCGCACGGCGATG	0.478													21	166	---	---	---	---	PASS
FRMPD1	22844	broad.mit.edu	37	9	37731012	37731012	+	Missense_Mutation	SNP	G	T	T	rs148192224	byFrequency	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37731012G>T	uc004aag.1	+	9	814	c.770G>T	c.(769-771)CGC>CTC	p.R257L	FRMPD1_uc004aah.1_Missense_Mutation_p.R257L|FRMPD1_uc011lqm.1_Missense_Mutation_p.R79L|FRMPD1_uc011lqn.1_Missense_Mutation_p.R126L	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	257	FERM.					cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		CATGACTACCGCTGCCTCTTC	0.512													51	89	---	---	---	---	PASS
SMC5	23137	broad.mit.edu	37	9	72962528	72962528	+	Splice_Site	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72962528G>C	uc004ahr.2	+	21	2782	c.2665_splice	c.e21-1	p.I889_splice	SMC5_uc011lry.1_Splice_Site_p.I34_splice	NM_015110	NP_055925	Q8IY18	SMC5_HUMAN	SMC5 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			ovary(2)|central_nervous_system(1)	3						TCCCCTGCCAGATTGTTCAGG	0.289													23	7	---	---	---	---	PASS
RORB	6096	broad.mit.edu	37	9	77257578	77257578	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77257578C>T	uc004aji.2	+	4	566	c.517C>T	c.(517-519)CAG>TAG	p.Q173*	RORB_uc004ajh.2_Nonsense_Mutation_p.Q162*	NM_006914	NP_008845	Q92753	RORB_HUMAN	RAR-related orphan receptor B	173	Hinge (Potential).				eye photoreceptor cell development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|visual perception	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						CGATTCCGGTCAGCCGTCCCC	0.507													15	74	---	---	---	---	PASS
RORB	6096	broad.mit.edu	37	9	77286791	77286791	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77286791C>T	uc004aji.2	+	9	1280	c.1231C>T	c.(1231-1233)CAC>TAC	p.H411Y	RORB_uc004ajh.2_Missense_Mutation_p.H400Y	NM_006914	NP_008845	Q92753	RORB_HUMAN	RAR-related orphan receptor B	411	Ligand-binding (Potential).				eye photoreceptor cell development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|visual perception	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						TCAGAAGAATCACCTGGATGA	0.428													20	32	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78722196	78722196	+	Silent	SNP	G	A	A	rs41310061	byFrequency	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78722196G>A	uc004ajz.2	+	9	1675	c.1137G>A	c.(1135-1137)ACG>ACA	p.T379T	PCSK5_uc004ajy.2_Silent_p.T379T|PCSK5_uc004aka.2_RNA	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	379	Catalytic.				anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						AGCGTTGCACGGACAACCACA	0.483													6	53	---	---	---	---	PASS
KIF12	113220	broad.mit.edu	37	9	116857482	116857482	+	Intron	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116857482C>A	uc004bif.2	-						KIF12_uc004big.2_Intron	NM_138424	NP_612433	Q96FN5	KIF12_HUMAN	kinesin family member 12						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						CTGCCAGGCCCCGCTTAAGTA	0.652													95	48	---	---	---	---	PASS
TRIM32	22954	broad.mit.edu	37	9	119461837	119461837	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119461837G>T	uc004bjx.2	+	2	1974	c.1816G>T	c.(1816-1818)GGG>TGG	p.G606W	ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjs.1_Intron|ASTN2_uc004bjt.1_Intron|TRIM32_uc004bjw.2_Missense_Mutation_p.G606W	NM_001099679	NP_001093149	Q13049	TRI32_HUMAN	tripartite motif-containing 32	606	NHL 5.				fat cell differentiation|innate immune response|negative regulation of apoptosis|negative regulation of fibroblast proliferation|positive regulation of cell cycle|positive regulation of cell growth|positive regulation of cell migration|positive regulation of neurogenesis|positive regulation of neuron differentiation|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein catabolic process|positive regulation of proteolysis|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to tumor necrosis factor|response to UV	nucleus	myosin binding|protein self-association|RNA binding|Tat protein binding|transcription coactivator activity|translation initiation factor binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(2)|kidney(1)	3						TCCTAAGGGTGGGGGCTATAG	0.527									Bardet-Biedl_syndrome				6	148	---	---	---	---	PASS
OR1L4	254973	broad.mit.edu	37	9	125486622	125486622	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125486622T>C	uc004bmu.1	+	1	354	c.354T>C	c.(352-354)TCT>TCC	p.S118S		NM_001005235	NP_001005235	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L,	118	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TGCTGGCCTCTATGGCCATCG	0.478													40	139	---	---	---	---	PASS
STRBP	55342	broad.mit.edu	37	9	125941312	125941312	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125941312T>C	uc004bns.2	-	4	628	c.198A>G	c.(196-198)AAA>AAG	p.K66K	STRBP_uc004bnt.2_5'UTR|STRBP_uc004bnu.2_Silent_p.K52K|STRBP_uc004bnv.2_Silent_p.K66K	NM_018387	NP_060857	Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein	66					multicellular organismal development	cytoplasm|nucleus	DNA binding			breast(1)|skin(1)	2						CGGCCTCATCTTTCTTCACTT	0.443													39	222	---	---	---	---	PASS
DENND1A	57706	broad.mit.edu	37	9	126414402	126414402	+	Nonsense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126414402T>A	uc004bnz.1	-	9	741	c.508A>T	c.(508-510)AGA>TGA	p.R170*	DENND1A_uc011lzl.1_5'UTR|DENND1A_uc004bny.1_5'UTR|DENND1A_uc011lzm.1_Nonsense_Mutation_p.R138*|DENND1A_uc004boa.1_Nonsense_Mutation_p.R170*|DENND1A_uc004bob.1_Nonsense_Mutation_p.R140*|DENND1A_uc004boc.2_Nonsense_Mutation_p.R138*	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1	170	DENN.					cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						GTCAGATTTCTCTAGGAGAAA	0.368													16	25	---	---	---	---	PASS
GAPVD1	26130	broad.mit.edu	37	9	128122903	128122903	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128122903A>G	uc010mwx.2	+	27	4521	c.4195A>G	c.(4195-4197)AGA>GGA	p.R1399G	GAPVD1_uc004bpp.2_Missense_Mutation_p.R1408G|GAPVD1_uc004bpq.2_Missense_Mutation_p.R1381G|GAPVD1_uc004bpr.2_Missense_Mutation_p.R1360G|GAPVD1_uc004bps.2_Missense_Mutation_p.R1354G|GAPVD1_uc004bpt.2_Missense_Mutation_p.R414G	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1399	VPS9.				endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GTGCATCCTGAGAATGTGCTC	0.468													153	48	---	---	---	---	PASS
ABL1	25	broad.mit.edu	37	9	133760617	133760617	+	Silent	SNP	C	A	A	rs11558834	byFrequency	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133760617C>A	uc004bzw.2	+	11	2943	c.2940C>A	c.(2938-2940)CCC>CCA	p.P980P	ABL1_uc004bzv.2_Silent_p.P999P	NM_005157	NP_005148	P00519	ABL1_HUMAN	c-abl oncogene 1, receptor tyrosine kinase	980	F-actin-binding.|Pro-rich.				actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)	GCCCAGCCCCCGTTCCCTCCA	0.662			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								4	194	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135202917	135202917	+	Silent	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135202917G>C	uc004cbk.2	-	10	4251	c.4068C>G	c.(4066-4068)CCC>CCG	p.P1356P	SETX_uc004cbj.2_Silent_p.P975P|SETX_uc010mzt.2_Silent_p.P975P	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	1356					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TTTGTGATTTGGGTCTGATCT	0.358													23	115	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139902942	139902942	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139902942G>A	uc011mem.1	-	47	7346	c.7198C>T	c.(7198-7200)CGG>TGG	p.R2400W	ABCA2_uc011mel.1_Missense_Mutation_p.R2401W|ABCA2_uc004ckl.1_Missense_Mutation_p.R2331W|ABCA2_uc004ckm.1_Missense_Mutation_p.R2431W	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	2400					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACAAGTGCCCGGAGCTCCGTG	0.687													21	7	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139911420	139911420	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139911420C>A	uc011mem.1	-	18	2855	c.2707G>T	c.(2707-2709)GCC>TCC	p.A903S	ABCA2_uc011mel.1_Missense_Mutation_p.A904S|ABCA2_uc004ckl.1_Missense_Mutation_p.A834S|ABCA2_uc004ckm.1_Missense_Mutation_p.A934S|ABCA2_uc004ckn.1_RNA	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	903	Helical; (Potential).				cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TAGACCACGGCGTCCACCATC	0.657													128	50	---	---	---	---	PASS
ADARB2	105	broad.mit.edu	37	10	1284216	1284216	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1284216T>C	uc009xhq.2	-	5	1713	c.1339A>G	c.(1339-1341)ACG>GCG	p.T447A		NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	447	A to I editase.				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		TCCAGCTGCGTGTAGAGGAAG	0.701													17	29	---	---	---	---	PASS
SEPHS1	22929	broad.mit.edu	37	10	13375904	13375904	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13375904G>T	uc001imk.2	-	5	832	c.473C>A	c.(472-474)TCT>TAT	p.S158Y	SEPHS1_uc001imh.2_Missense_Mutation_p.S82Y|SEPHS1_uc010qbs.1_Missense_Mutation_p.S110Y|SEPHS1_uc001imi.2_Missense_Mutation_p.S158Y|SEPHS1_uc001imj.2_Missense_Mutation_p.S158Y|SEPHS1_uc010qbt.1_Missense_Mutation_p.S91Y|SEPHS1_uc009xje.2_Missense_Mutation_p.S158Y	NM_012247	NP_036379	P49903	SPS1_HUMAN	selenophosphate synthetase 1	158					protein modification process		ATP binding|GTP binding|selenide, water dikinase activity			skin(1)	1						GCCTGTTACAGATGTTCCTGC	0.423													19	120	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17147511	17147511	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17147511C>A	uc001ioo.2	-	11	1227	c.1175G>T	c.(1174-1176)TGT>TTT	p.C392F		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	392					cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAGCTGCACACATCCATTTGG	0.433													31	92	---	---	---	---	PASS
ST8SIA6	338596	broad.mit.edu	37	10	17363299	17363299	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17363299C>A	uc001ipd.2	-	8	775	c.775G>T	c.(775-777)GCA>TCA	p.A259S	ST8SIA6_uc010qce.1_RNA	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide	259	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						CCATAGGTTGCAATGTCCTCC	0.373													29	97	---	---	---	---	PASS
DNAJC1	64215	broad.mit.edu	37	10	22171304	22171304	+	Silent	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22171304A>G	uc001irc.2	-	8	1172	c.885T>C	c.(883-885)TAT>TAC	p.Y295Y	DNAJC1_uc001ird.2_Silent_p.Y181Y	NM_022365	NP_071760	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	295	Cytoplasmic (By similarity).				negative regulation of proteolysis|regulation of protein secretion|regulation of transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	ATPase activator activity|DNA binding|heat shock protein binding|unfolded protein binding			lung(1)	1		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				AAGACTGAATATATGTAGTTT	0.303													20	90	---	---	---	---	PASS
GAD2	2572	broad.mit.edu	37	10	26534906	26534906	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26534906G>A	uc001isp.2	+	8	1400	c.897G>A	c.(895-897)GTG>GTA	p.V299V	GAD2_uc001isq.2_Silent_p.V299V	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2	299					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	CAGACAGCGTGATTCTGATTA	0.383													7	69	---	---	---	---	PASS
PARD3	56288	broad.mit.edu	37	10	34573111	34573111	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34573111G>A	uc010qej.1	-	21	3137	c.3137C>T	c.(3136-3138)TCC>TTC	p.S1046F	PARD3_uc010qek.1_Missense_Mutation_p.S1043F|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Missense_Mutation_p.S1030F|PARD3_uc010qen.1_Missense_Mutation_p.S1000F|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Missense_Mutation_p.S956F|PARD3_uc010qeq.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog	1046					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				TGATGTAAAGGATTCCTGTAT	0.338													22	182	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43292046	43292046	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43292046G>T	uc001jaj.2	+	10	1712	c.1354G>T	c.(1354-1356)GAA>TAA	p.E452*		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	452					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						TGAAATGTCTGAAGATGACGG	0.438													78	118	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50835813	50835813	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50835813A>T	uc001jhz.2	+	7	1246	c.1093A>T	c.(1093-1095)AGG>TGG	p.R365W	CHAT_uc001jhv.1_Missense_Mutation_p.R247W|CHAT_uc001jhx.1_Missense_Mutation_p.R247W|CHAT_uc001jhy.1_Missense_Mutation_p.R247W|CHAT_uc001jia.2_Missense_Mutation_p.R247W|CHAT_uc010qgs.1_Missense_Mutation_p.R247W	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	365					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	GGCCGAGGCCAGGACGGTCCT	0.592													33	92	---	---	---	---	PASS
NRBF2	29982	broad.mit.edu	37	10	64913362	64913362	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64913362G>T	uc001jmj.3	+	4	472	c.248G>T	c.(247-249)AGA>ATA	p.R83I	NRBF2_uc010qip.1_Missense_Mutation_p.R73I	NM_030759	NP_110386	Q96F24	NRBF2_HUMAN	nuclear receptor binding factor 2	83					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	cytoplasm|nucleoplasm	protein binding				0	Prostate(12;0.0119)|all_hematologic(501;0.191)					CGTGAAGAAAGATTGAAAGCC	0.493													22	68	---	---	---	---	PASS
SFTPA1	653509	broad.mit.edu	37	10	81373751	81373751	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81373751A>G	uc001kap.2	+	6	750	c.629A>G	c.(628-630)AAC>AGC	p.N210S	SFTPA1_uc001kaq.2_Missense_Mutation_p.N210S|SFTPA1_uc009xry.2_Missense_Mutation_p.N225S|SFTPA1_uc001kar.2_Missense_Mutation_p.N210S|SFTPA1_uc010qlt.1_Missense_Mutation_p.N151S|SFTPA1_uc009xrz.2_Missense_Mutation_p.N140S|SFTPA1_uc009xsa.2_Missense_Mutation_p.N210S|SFTPA1_uc009xsf.2_RNA	NM_005411	NP_005402	Q8IWL2	SFTA1_HUMAN	surfactant protein A1 isoform 1	210	C-type lectin.				cell junction assembly|respiratory gaseous exchange	collagen|extracellular space	lipid transporter activity|sugar binding				0	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			AACTACACCAACTGGTACCGA	0.557													178	247	---	---	---	---	PASS
CDHR1	92211	broad.mit.edu	37	10	85970803	85970803	+	Missense_Mutation	SNP	C	G	G	rs142742994		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85970803C>G	uc001kcv.2	+	13	1367	c.1367C>G	c.(1366-1368)GCG>GGG	p.A456G	CDHR1_uc001kcw.2_Missense_Mutation_p.A456G|CDHR1_uc009xst.2_Intron|CDHR1_uc001kcx.2_5'Flank	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN	protocadherin 21 precursor	456	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion		calcium ion binding|receptor activity			ovary(1)	1						AGTTCCACAGCGGATGTTGTG	0.562													194	216	---	---	---	---	PASS
TNKS2	80351	broad.mit.edu	37	10	93590849	93590849	+	Intron	SNP	T	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93590849T>G	uc001khp.2	+							NM_025235	NP_079511	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related						positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding			kidney(3)|skin(3)|ovary(1)|lung(1)	8		Colorectal(252;0.162)				GGCTGATTTTTTCTCTCTAAG	0.328													33	209	---	---	---	---	PASS
CEP55	55165	broad.mit.edu	37	10	95276824	95276824	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95276824A>G	uc009xug.2	+	6	994	c.812A>G	c.(811-813)GAA>GGA	p.E271G	CEP55_uc001kiq.3_Missense_Mutation_p.E271G	NM_001127182	NP_001120654	Q53EZ4	CEP55_HUMAN	centrosomal protein 55kDa	271	Potential.				cell division|mitosis	centriole|cleavage furrow|midbody					0		Colorectal(252;0.207)				AAATATGAAGAAACCCAAAAA	0.363													59	70	---	---	---	---	PASS
ZNF518A	9849	broad.mit.edu	37	10	97919144	97919144	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97919144G>T	uc001klp.2	+	6	3922	c.3065G>T	c.(3064-3066)TGT>TTT	p.C1022F	ZNF518A_uc001klo.1_Missense_Mutation_p.C492F|ZNF518A_uc001klq.2_Missense_Mutation_p.C1022F|ZNF518A_uc001klr.2_Missense_Mutation_p.C1022F	NM_014803	NP_055618	Q6AHZ1	Z518A_HUMAN	zinc finger protein 518	1022					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		AACAATAATTGTCTTACACCT	0.433													20	45	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	106899151	106899151	+	Intron	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106899151C>A	uc001kyi.1	+							NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CCCCCACAATCTAGGTAACAA	0.438													51	151	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	117093820	117093820	+	Silent	SNP	C	T	T	rs112084285		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117093820C>T	uc001lcg.2	+	19	3452	c.3066C>T	c.(3064-3066)TGC>TGT	p.C1022C	ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	1022	Laminin EGF-like 1.|Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ATAGCACTTGCATCAATAATA	0.353													20	66	---	---	---	---	PASS
C10orf96	374355	broad.mit.edu	37	10	118084897	118084897	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118084897T>C	uc001lck.2	+	3	413	c.162T>C	c.(160-162)TCT>TCC	p.S54S		NM_198515	NP_940917	P0C7W6	CJ096_HUMAN	hypothetical protein LOC374355	54	Potential.									ovary(2)	2		Lung NSC(174;0.204)|all_lung(145;0.248)		all cancers(201;0.014)		AGCTGGAATCTAAGGTATTGA	0.343													14	19	---	---	---	---	PASS
C10orf96	374355	broad.mit.edu	37	10	118084900	118084900	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118084900G>A	uc001lck.2	+	3	416	c.165G>A	c.(163-165)AAG>AAA	p.K55K		NM_198515	NP_940917	P0C7W6	CJ096_HUMAN	hypothetical protein LOC374355	55	Potential.									ovary(2)	2		Lung NSC(174;0.204)|all_lung(145;0.248)		all cancers(201;0.014)		TGGAATCTAAGGTATTGAAAT	0.348													13	17	---	---	---	---	PASS
SLC18A2	6571	broad.mit.edu	37	10	119017365	119017365	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119017365G>T	uc001ldd.1	+	10	984	c.953G>T	c.(952-954)TGG>TTG	p.W318L	SLC18A2_uc009xyy.1_Missense_Mutation_p.W115L	NM_003054	NP_003045	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine),	318	Lumenal, vesicle (Potential).				neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity				0		Colorectal(252;0.19)		all cancers(201;0.029)	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)	CTGCCCATCTGGATGATGGAG	0.567													41	47	---	---	---	---	PASS
FAM45A	404636	broad.mit.edu	37	10	120867505	120867505	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120867505G>T	uc001ldw.2	+	2	125	c.81G>T	c.(79-81)CTG>CTT	p.L27L	FAM45A_uc010qsv.1_Silent_p.L19L|FAM45A_uc010qsw.1_5'UTR|FAM45A_uc010qsx.1_RNA|FAM45A_uc010qsy.1_5'UTR	NM_207009	NP_996892	Q8TCE6	FA45A_HUMAN	hypothetical protein LOC404636	27										ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		GAGAAGTTCTGTGGGTGTGGT	0.438													74	198	---	---	---	---	PASS
FRG2B	441581	broad.mit.edu	37	10	135440183	135440183	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135440183G>T	uc010qvg.1	-	1	117	c.64C>A	c.(64-66)CCC>ACC	p.P22T		NM_001080998	NP_001074467	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	22						nucleus					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TGGAAAGGGGGCTGGTCAGTG	0.502													29	485	---	---	---	---	PASS
OR51B2	79345	broad.mit.edu	37	11	5345319	5345319	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5345319A>C	uc001mao.1	-	1	264	c.209T>G	c.(208-210)ATG>AGG	p.M70R	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033180	NP_149420	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAATGTCACCATGAGGTCTGT	0.507													30	87	---	---	---	---	PASS
OR52E6	390078	broad.mit.edu	37	11	5862213	5862213	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5862213C>T	uc010qzq.1	-	1	915	c.915G>A	c.(913-915)CTG>CTA	p.L305L	TRIM5_uc001mbq.1_Intron	NM_001005167	NP_001005167	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E,	305	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAAAATCCTCAGCACTGTCT	0.443													11	89	---	---	---	---	PASS
TRIM5	85363	broad.mit.edu	37	11	5905511	5905511	+	Intron	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5905511C>A	uc001mbq.1	-						OR52E4_uc010qzs.1_5'Flank	NM_033093	NP_149084	Q9C035	TRIM5_HUMAN	tripartite motif protein TRIM5 isoform delta						interspecies interaction between organisms|protein trimerization|response to virus	cytoplasm|cytoplasmic mRNA processing body	ligase activity|protein binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		TTCAGTGACACTTGCTGGGAG	0.438													49	100	---	---	---	---	PASS
C11orf16	56673	broad.mit.edu	37	11	8947122	8947122	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8947122T>C	uc001mhb.3	-	5	1216	c.1092A>G	c.(1090-1092)GCA>GCG	p.A364A	C11orf16_uc001mhc.3_Silent_p.A364A	NM_020643	NP_065694	Q9NQ32	CK016_HUMAN	hypothetical protein LOC56673	364										upper_aerodigestive_tract(1)|pancreas(1)	2				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		CTGTGTTGACTGCACTGTTCA	0.552													19	81	---	---	---	---	PASS
MRVI1	10335	broad.mit.edu	37	11	10602078	10602078	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10602078C>A	uc010rcc.1	-	20	2805	c.2419G>T	c.(2419-2421)GAA>TAA	p.E807*	uc001miu.2_Intron|MRVI1_uc001miw.2_Nonsense_Mutation_p.E798*|MRVI1_uc010rcb.1_Nonsense_Mutation_p.E799*|MRVI1_uc009ygb.1_Nonsense_Mutation_p.E492*|MRVI1_uc001mix.2_Nonsense_Mutation_p.E492*|MRVI1_uc001miz.2_Nonsense_Mutation_p.E716*|MRVI1_uc009ygc.1_Nonsense_Mutation_p.E716*|MRVI1_uc010rcd.1_Nonsense_Mutation_p.E601*|MRVI1_uc009ygd.1_Nonsense_Mutation_p.E492*	NM_001100167	NP_001093637	Q9Y6F6	MRVI1_HUMAN	JAW1-related protein isoform c	780	Glu-rich.				platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CTCTTCTGTTCTTCCTCCTCC	0.493													5	255	---	---	---	---	PASS
MRGPRX4	117196	broad.mit.edu	37	11	18195697	18195697	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18195697G>A	uc001mnv.1	+	1	1314	c.894G>A	c.(892-894)AAG>AAA	p.K298K		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	298	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						TGCAGGACAAGCCTGAGGTGG	0.557													28	98	---	---	---	---	PASS
MRGPRX1	259249	broad.mit.edu	37	11	18955915	18955915	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18955915T>C	uc001mpg.2	-	1	635	c.417A>G	c.(415-417)TCA>TCG	p.S139S		NM_147199	NP_671732	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	139	Cytoplasmic (Potential).				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(2)|central_nervous_system(1)	3						ACACCACCGCTGACAGGTGTG	0.617													26	89	---	---	---	---	PASS
SLC5A12	159963	broad.mit.edu	37	11	26730881	26730881	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26730881A>G	uc001mra.2	-	4	816	c.503T>C	c.(502-504)GTT>GCT	p.V168A	SLC5A12_uc001mrb.2_RNA|SLC5A12_uc001mrc.3_Missense_Mutation_p.V168A	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose	168	Helical; (Potential).				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						GAATGTGCAAACAATTCCTGT	0.378													13	27	---	---	---	---	PASS
QSER1	79832	broad.mit.edu	37	11	32954413	32954413	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32954413G>C	uc001mty.2	+	4	1489	c.1222G>C	c.(1222-1224)GAG>CAG	p.E408Q	QSER1_uc001mtz.1_Intron|QSER1_uc001mua.2_5'Flank	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	408	Ser-rich.									ovary(3)|central_nervous_system(2)|skin(1)	6	Breast(20;0.158)					AGTTACAAATGAGAATTACCC	0.393													18	131	---	---	---	---	PASS
DGKZ	8525	broad.mit.edu	37	11	46397872	46397872	+	Intron	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46397872C>T	uc001ncn.1	+						DGKZ_uc001nch.1_Intron|DGKZ_uc010rgq.1_Intron|DGKZ_uc001ncj.1_Intron|DGKZ_uc010rgr.1_Intron|DGKZ_uc001nck.1_Intron|DGKZ_uc001ncl.2_Intron|DGKZ_uc001ncm.2_Intron|DGKZ_uc009yky.1_Intron|DGKZ_uc010rgs.1_Intron	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		TTGCTTCTCTCAACAGGAGCC	0.627													116	654	---	---	---	---	PASS
FOLH1	2346	broad.mit.edu	37	11	49204779	49204779	+	Missense_Mutation	SNP	C	A	A	rs116795343	byFrequency	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49204779C>A	uc001ngy.2	-	7	1103	c.842G>T	c.(841-843)CGT>CTT	p.R281L	FOLH1_uc001ngz.2_Missense_Mutation_p.R281L|FOLH1_uc009yly.2_Missense_Mutation_p.R266L|FOLH1_uc009ylz.2_Missense_Mutation_p.R266L|FOLH1_uc009yma.2_5'UTR	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	281	NAALADase.|Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	TGCAATTCCACGCCTATAAGC	0.348													14	63	---	---	---	---	PASS
SPRYD5	84767	broad.mit.edu	37	11	55658796	55658796	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55658796C>A	uc010rip.1	+	7	1139	c.1047C>A	c.(1045-1047)GAC>GAA	p.D349E	SPRYD5_uc010riq.1_Missense_Mutation_p.D206E	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	349	B30.2/SPRY.					intracellular	zinc ion binding				0		all_epithelial(135;0.226)				ATATGGGGGACTCTTGGAATT	0.423													73	146	---	---	---	---	PASS
SSRP1	6749	broad.mit.edu	37	11	57102589	57102589	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57102589C>A	uc001njt.2	-	2	274	c.7G>T	c.(7-9)GAG>TAG	p.E3*	SSRP1_uc010rjq.1_Nonsense_Mutation_p.E3*	NM_003146	NP_003137	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	3					DNA repair|DNA replication|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|cytoplasm|nucleoplasm	DNA binding|protein binding			ovary(2)	2						TCCAGTGTCTCTGCCATGTCG	0.567													412	487	---	---	---	---	PASS
ZP1	22917	broad.mit.edu	37	11	60635139	60635139	+	Silent	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60635139A>T	uc001nqd.2	+	1	125	c.105A>T	c.(103-105)CCA>CCT	p.P35P	ZP1_uc001nqe.2_5'Flank	NM_207341	NP_997224	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 precursor	35	Extracellular (Potential).				single fertilization	integral to membrane|plasma membrane|proteinaceous extracellular matrix					0						CTGGCCTCCCAGGCCTCCGGC	0.662													19	58	---	---	---	---	PASS
SCGB2A2	4250	broad.mit.edu	37	11	62038457	62038457	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62038457G>A	uc001ntc.2	+	2	219	c.160G>A	c.(160-162)GCC>ACC	p.A54T	SCGB2A2_uc009ynx.2_Missense_Mutation_p.A54T	NM_002411	NP_002402	Q13296	SG2A2_HUMAN	secretoglobin, family 2A, member 2 precursor	54						extracellular region	steroid binding			ovary(1)	1						AGACGACAATGCCACTACAAA	0.373													103	127	---	---	---	---	PASS
SCGB2A2	4250	broad.mit.edu	37	11	62038458	62038458	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62038458C>T	uc001ntc.2	+	2	220	c.161C>T	c.(160-162)GCC>GTC	p.A54V	SCGB2A2_uc009ynx.2_Missense_Mutation_p.A54V	NM_002411	NP_002402	Q13296	SG2A2_HUMAN	secretoglobin, family 2A, member 2 precursor	54						extracellular region	steroid binding			ovary(1)	1						GACGACAATGCCACTACAAAT	0.378													103	127	---	---	---	---	PASS
ESRRA	2101	broad.mit.edu	37	11	64074792	64074792	+	Silent	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64074792C>G	uc001nzq.1	+	2	318	c.141C>G	c.(139-141)CTC>CTG	p.L47L	ESRRA_uc001nzr.1_Silent_p.L47L|ESRRA_uc001nzs.1_Silent_p.L47L	NM_004451	NP_004442	P11474	ERR1_HUMAN	estrogen-related receptor alpha	47	Repressor domain.				positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein domain specific binding|sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding				0						CTCGCTGCCTCCCAGGCCACA	0.697													13	77	---	---	---	---	PASS
LRRC32	2615	broad.mit.edu	37	11	76372428	76372428	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76372428C>T	uc001oxq.3	-	3	452	c.209G>A	c.(208-210)GGC>GAC	p.G70D	LRRC32_uc001oxr.3_Missense_Mutation_p.G70D|LRRC32_uc010rsf.1_Missense_Mutation_p.G70D	NM_005512	NP_005503	Q14392	LRC32_HUMAN	leucine rich repeat containing 32 precursor	70	LRR 1.|Extracellular (Potential).					integral to plasma membrane					0						TGTGTAGAAGCCCAGGGGTGA	0.622													24	143	---	---	---	---	PASS
KIAA1377	57562	broad.mit.edu	37	11	101833343	101833343	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101833343A>G	uc001pgm.2	+	6	1847	c.1577A>G	c.(1576-1578)TAT>TGT	p.Y526C	KIAA1377_uc001pgn.2_Missense_Mutation_p.Y482C|KIAA1377_uc010run.1_Missense_Mutation_p.Y327C|KIAA1377_uc009yxa.1_Missense_Mutation_p.Y327C	NM_020802	NP_065853	Q9P2H0	K1377_HUMAN	hypothetical protein LOC57562	526							protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		CAAGATGCCTATATACCTCAC	0.303													13	31	---	---	---	---	PASS
MMP8	4317	broad.mit.edu	37	11	102586136	102586136	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102586136C>G	uc001phe.2	-	7	1034	c.935G>C	c.(934-936)AGA>ACA	p.R312T	MMP8_uc010rut.1_Missense_Mutation_p.R247T|MMP8_uc010ruu.1_Missense_Mutation_p.R289T	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein	312	Hemopexin-like 1.				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)		CATTTCGACTCTTTGTAGCTG	0.398													18	110	---	---	---	---	PASS
MMP10	4319	broad.mit.edu	37	11	102650099	102650099	+	Intron	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102650099G>T	uc001phg.1	-							NM_002425	NP_002416	P09238	MMP10_HUMAN	matrix metalloproteinase 10 preproprotein						collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			kidney(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)		AATCCTGGAGGAGAAAAATTG	0.363													96	136	---	---	---	---	PASS
BCO2	83875	broad.mit.edu	37	11	112071500	112071500	+	Intron	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112071500G>T	uc001pnf.2	+						BCO2_uc001pne.1_Intron|BCO2_uc001png.2_Intron|BCO2_uc001pnh.2_Intron|BCO2_uc010rwt.1_Intron|BCO2_uc009yyn.2_Intron|BCO2_uc001pni.2_Intron	NM_031938	NP_114144	Q9BYV7	BCDO2_HUMAN	beta-carotene dioxygenase 2 isoform a						carotene metabolic process|retinal metabolic process|retinoic acid metabolic process		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						TGGACAGGTGGAGTATTTTGA	0.378													59	197	---	---	---	---	PASS
NCAM1	4684	broad.mit.edu	37	11	113146071	113146071	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113146071G>A	uc001pnt.2	+	2	812	c.244G>A	c.(244-246)GAC>AAC	p.D82N	NCAM1_uc001pns.2_3'UTR|uc010rwu.1_5'Flank			P13591	NCAM1_HUMAN	Homo sapiens cDNA FLJ30008 fis, clone 3NB692000029.	847	Cytoplasmic (Potential).				axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GGTCCCCAATGACGCCACACA	0.517													7	38	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117314643	117314643	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117314643C>T	uc001prh.1	-	21	4003	c.4001G>A	c.(4000-4002)GGC>GAC	p.G1334D		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1274	Extracellular (Potential).|Fibronectin type-III 4.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCTGCTGTTGCCCCGGCCGGC	0.607													17	100	---	---	---	---	PASS
VPS11	55823	broad.mit.edu	37	11	118947642	118947642	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118947642G>T	uc010ryx.1	+	9	1316	c.1274G>T	c.(1273-1275)CGC>CTC	p.R425L	VPS11_uc010ryy.1_Missense_Mutation_p.R271L	NM_021729	NP_068375	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11	425	Clathrin.				protein transport	endocytic vesicle|HOPS complex|late endosome membrane|lysosomal membrane	nucleotide binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		TACGTGATCCGCAAGTTTCTG	0.478													36	34	---	---	---	---	PASS
RNF26	79102	broad.mit.edu	37	11	119206720	119206720	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119206720G>C	uc001pwh.2	+	1	1484	c.888G>C	c.(886-888)CAG>CAC	p.Q296H		NM_032015	NP_114404	Q9BY78	RNF26_HUMAN	ring finger protein 26	296							zinc ion binding			ovary(1)	1		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		GCAGTCTGCAGCTGGCGAGTT	0.642													52	63	---	---	---	---	PASS
ZNF202	7753	broad.mit.edu	37	11	123601187	123601187	+	Intron	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123601187C>A	uc001pzd.1	-						ZNF202_uc001pzc.1_Intron|ZNF202_uc001pze.1_Intron|ZNF202_uc001pzf.1_Intron	NM_003455	NP_003446	O95125	ZN202_HUMAN	zinc finger protein 202						lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		AGGACTCCCCCTCCTCACCCA	0.587													128	160	---	---	---	---	PASS
OPCML	4978	broad.mit.edu	37	11	132398972	132398972	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132398972C>T	uc001qgs.2	-	3	559	c.509G>A	c.(508-510)AGA>AAA	p.R170K	OPCML_uc001qgu.2_Missense_Mutation_p.R163K|OPCML_uc010sck.1_Missense_Mutation_p.R170K|OPCML_uc001qgt.2_Missense_Mutation_p.R170K|OPCML_uc010scl.1_Missense_Mutation_p.R129K	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion	170	Ig-like C2-type 2.				cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TGACAGGTGTCTCCATGTCAC	0.483													21	74	---	---	---	---	PASS
SPATA19	219938	broad.mit.edu	37	11	133715280	133715280	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133715280A>T	uc001qgv.1	-	1	113	c.62T>A	c.(61-63)CTA>CAA	p.L21Q		NM_174927	NP_777587	Q7Z5L4	SPT19_HUMAN	spermatogenesis associated 19 precursor	21					cell differentiation|multicellular organismal development|spermatogenesis	mitochondrial outer membrane					0	all_hematologic(175;0.127)	all_cancers(12;5.59e-17)|all_epithelial(12;2.65e-12)|all_lung(97;0.00045)|Lung NSC(97;0.000861)|Breast(109;0.000873)|Medulloblastoma(222;0.0425)|Esophageal squamous(93;0.0844)|all_neural(223;0.117)		Epithelial(10;4.36e-10)|all cancers(11;7.1e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00286)|Lung(977;0.207)		GGTTATTGGTAGGAAGGGAAG	0.458													47	77	---	---	---	---	PASS
IGSF9B	22997	broad.mit.edu	37	11	133790529	133790529	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133790529G>T	uc001qgx.3	-	18	3322	c.3091C>A	c.(3091-3093)CCT>ACT	p.P1031T		NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1031	Pro-rich.|Cytoplasmic (Potential).					integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CCTCCTGTAGGTGTCTGAGTC	0.677													33	188	---	---	---	---	PASS
IQSEC3	440073	broad.mit.edu	37	12	248014	248014	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:248014G>C	uc001qhw.1	+	1	582	c.576G>C	c.(574-576)CAG>CAC	p.Q192H	IQSEC3_uc001qhu.1_Missense_Mutation_p.Q192H|IQSEC3_uc001qht.1_Missense_Mutation_p.Q277H|uc001qhv.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	495					regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		TCGCCAACCAGAACATATCCG	0.677													7	75	---	---	---	---	PASS
KDM5A	5927	broad.mit.edu	37	12	461444	461444	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:461444C>A	uc001qif.1	-	9	1439	c.1076G>T	c.(1075-1077)CGA>CTA	p.R359L	KDM5A_uc001qie.1_Missense_Mutation_p.R359L|KDM5A_uc010sdn.1_Missense_Mutation_p.R318L|KDM5A_uc010sdo.1_Intron	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	359					chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						TGTATACTCTCGTACAGCTTG	0.363			T 	NUP98	AML								52	90	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2721167	2721167	+	Silent	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2721167C>G	uc009zdu.1	+	30	4189	c.3876C>G	c.(3874-3876)GCC>GCG	p.A1292A	CACNA1C_uc009zdv.1_Silent_p.A1269A|CACNA1C_uc001qkb.2_Silent_p.A1272A|CACNA1C_uc001qkc.2_Silent_p.A1272A|CACNA1C_uc001qke.2_Silent_p.A1272A|CACNA1C_uc001qkf.2_Silent_p.A1272A|CACNA1C_uc001qjz.2_Silent_p.A1272A|CACNA1C_uc001qkd.2_Silent_p.A1272A|CACNA1C_uc001qkg.2_Silent_p.A1272A|CACNA1C_uc009zdw.1_Silent_p.A1272A|CACNA1C_uc001qkh.2_Silent_p.A1272A|CACNA1C_uc001qkl.2_Silent_p.A1292A|CACNA1C_uc001qkn.2_Silent_p.A1272A|CACNA1C_uc001qko.2_Silent_p.A1292A|CACNA1C_uc001qkp.2_Silent_p.A1272A|CACNA1C_uc001qkr.2_Silent_p.A1272A|CACNA1C_uc001qku.2_Silent_p.A1272A|CACNA1C_uc001qkq.2_Silent_p.A1272A|CACNA1C_uc001qks.2_Silent_p.A1272A|CACNA1C_uc001qkt.2_Silent_p.A1272A|CACNA1C_uc001qka.1_Silent_p.A807A|CACNA1C_uc001qki.1_Silent_p.A1008A|CACNA1C_uc001qkj.1_Silent_p.A1008A|CACNA1C_uc001qkk.1_Silent_p.A1008A|CACNA1C_uc001qkm.1_Silent_p.A1008A	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1292	Helical; Name=S2 of repeat IV; (Potential).|IV.				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	AGCTCATTGCCTTCAAACCCA	0.532													35	76	---	---	---	---	PASS
FGF6	2251	broad.mit.edu	37	12	4553375	4553375	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4553375C>T	uc001qmr.1	-	2	418	c.374G>A	c.(373-375)CGA>CAA	p.R125Q		NM_020996	NP_066276	P10767	FGF6_HUMAN	fibroblast growth factor 6 precursor	125					angiogenesis|cell proliferation|cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell division|positive regulation of cell proliferation	extracellular space	growth factor activity			lung(2)|ovary(1)	3			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			CACCACGCCTCGCTCCACAGT	0.537													9	108	---	---	---	---	PASS
CLEC12A	160364	broad.mit.edu	37	12	10132050	10132050	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10132050G>T	uc001qwr.3	+	3	494	c.306G>T	c.(304-306)AAG>AAT	p.K102N	CLEC12A_uc001qwq.2_Missense_Mutation_p.K112N|CLEC12A_uc001qws.3_Missense_Mutation_p.K69N|CLEC12A_uc001qwt.2_Missense_Mutation_p.K31N	NM_138337	NP_612210	Q5QGZ9	CL12A_HUMAN	myeloid inhibitory C-type lectin-like receptor	102	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity|sugar binding			skin(1)	1						TCTCCAACAAGATCAGGAACC	0.353													15	35	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13717454	13717454	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13717454C>G	uc001rbt.2	-	13	2897	c.2718G>C	c.(2716-2718)AAG>AAC	p.K906N		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	906	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TAGCCATGTTCTTGGCCGTGC	0.592													175	311	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13717533	13717533	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13717533C>G	uc001rbt.2	-	13	2818	c.2639G>C	c.(2638-2640)CGC>CCC	p.R880P		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	880	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TACAGACTGGCGCTCCTCGAT	0.537													120	237	---	---	---	---	PASS
C12orf77	196415	broad.mit.edu	37	12	25149149	25149149	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25149149G>T	uc001rgf.2	-	2	333	c.128C>A	c.(127-129)ACG>AAG	p.T43K		NM_001101339	NP_001094809	C9JDV5	CL097_HUMAN	hypothetical protein LOC196415	43											0						GGATGTAAGCGTATAATTTGT	0.403													57	91	---	---	---	---	PASS
C12orf41	54934	broad.mit.edu	37	12	49072821	49072821	+	Silent	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49072821T>A	uc001rrx.2	-	4	618	c.543A>T	c.(541-543)CTA>CTT	p.L181L	C12orf41_uc001rrw.2_Intron|C12orf41_uc001rrz.2_Silent_p.L364L|C12orf41_uc001rry.2_Intron	NM_017822	NP_060292	Q9H9L4	CL041_HUMAN	hypothetical protein LOC54934	181										ovary(2)	2						CAACTTACTTTAGGGGATCTT	0.433													111	50	---	---	---	---	PASS
RACGAP1	29127	broad.mit.edu	37	12	50388061	50388061	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50388061C>G	uc001rvt.2	-	14	1502	c.1192G>C	c.(1192-1194)GAG>CAG	p.E398Q	RACGAP1_uc009zlm.1_Missense_Mutation_p.E398Q|RACGAP1_uc001rvs.2_Missense_Mutation_p.E398Q|RACGAP1_uc001rvu.2_Missense_Mutation_p.E398Q	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN	Rac GTPase activating protein 1	398	Rho-GAP.				blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding			kidney(1)	1						AGGAATTTCTCTTTCAGCTCT	0.393													119	154	---	---	---	---	PASS
KRT73	319101	broad.mit.edu	37	12	53004486	53004486	+	Missense_Mutation	SNP	C	A	A	rs115844388	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53004486C>A	uc001sas.2	-	7	1279	c.1244G>T	c.(1243-1245)CGC>CTC	p.R415L		NM_175068	NP_778238	Q86Y46	K2C73_HUMAN	keratin 73	415	Rod.|Coil 2.					keratin filament	structural molecule activity			large_intestine(2)|ovary(2)|skin(2)	6				BRCA - Breast invasive adenocarcinoma(357;0.189)		TTGGTACTCGCGCAGCATCCG	0.647													55	81	---	---	---	---	PASS
KRT2	3849	broad.mit.edu	37	12	53045515	53045515	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53045515G>T	uc001sat.2	-	1	445	c.412C>A	c.(412-414)CCT>ACT	p.P138T		NM_000423	NP_000414	P35908	K22E_HUMAN	keratin 2	138	Head.				keratinization|keratinocyte activation|keratinocyte migration|keratinocyte proliferation	Golgi apparatus|keratin filament	protein binding|structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.19)		AAGCCACCAGGACCCCCTAAa	0.313													62	105	---	---	---	---	PASS
SPRYD3	84926	broad.mit.edu	37	12	53468573	53468573	+	Intron	SNP	A	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53468573A>C	uc001sbt.1	-						SPRYD3_uc010snw.1_Intron	NM_032840	NP_116229	Q8NCJ5	SPRY3_HUMAN	SPRY domain containing 3											central_nervous_system(1)	1						TACAGCCTACAGACAGAGTAG	0.577													14	45	---	---	---	---	PASS
HOXC6	3223	broad.mit.edu	37	12	54422463	54422463	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54422463C>A	uc001sev.2	+	1	270	c.158C>A	c.(157-159)CCC>CAC	p.P53H	HOXC6_uc001ses.2_5'UTR|HOXC5_uc001set.2_Intron|HOXC4_uc001seu.2_Intron	NM_004503	NP_004494	P09630	HXC6_HUMAN	homeobox C6 isoform 1	53					regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|upper_aerodigestive_tract(1)	3						TACTCGACTCCCTTTTATTCG	0.532													28	188	---	---	---	---	PASS
ANKRD52	283373	broad.mit.edu	37	12	56647572	56647572	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56647572T>C	uc001skm.3	-	9	1009	c.919A>G	c.(919-921)AAA>GAA	p.K307E		NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	307	ANK 10.						protein binding			ovary(2)	2						AGAGGACTTTTCCCTTCTTTG	0.483													28	135	---	---	---	---	PASS
DPY19L2	283417	broad.mit.edu	37	12	63954358	63954358	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63954358T>C	uc001srp.1	-	22	2392	c.2211A>G	c.(2209-2211)GAA>GAG	p.E737E	DPY19L2_uc010sso.1_Silent_p.E184E	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2	737					multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		GCCTGGCGTCTTCGAGCAGGA	0.453													58	74	---	---	---	---	PASS
TBK1	29110	broad.mit.edu	37	12	64879294	64879294	+	Splice_Site	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64879294G>C	uc001ssc.1	+	10	1310	c.1248_splice	c.e10+1	p.K416_splice		NM_013254	NP_037386	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1						I-kappaB kinase/NF-kappaB cascade|innate immune response|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription from RNA polymerase II promoter|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|large_intestine(1)|breast(1)	5				GBM - Glioblastoma multiforme(28;0.0386)		CATGGCTAAGGTTAGTATTTA	0.303													2	10	---	---	---	---	PASS
IRAK3	11213	broad.mit.edu	37	12	66605326	66605326	+	Silent	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66605326A>T	uc001sth.2	+	5	639	c.537A>T	c.(535-537)GTA>GTT	p.V179V	IRAK3_uc010ssy.1_Silent_p.V118V	NM_007199	NP_009130	Q9Y616	IRAK3_HUMAN	interleukin-1 receptor-associated kinase 3	179	ATP (By similarity).|Protein kinase.				interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8				GBM - Glioblastoma multiforme(28;0.0203)		TTTTTGAGGTATACAGAGTGG	0.338													52	101	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78530995	78530995	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78530995C>G	uc001syp.2	+	19	4653	c.4480C>G	c.(4480-4482)CCC>GCC	p.P1494A	NAV3_uc001syo.2_Missense_Mutation_p.P1494A|NAV3_uc010sub.1_Missense_Mutation_p.P980A|NAV3_uc009zsf.2_Missense_Mutation_p.P325A	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1494	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CCTTCCCGGGCCCAGCATGAT	0.468										HNSCC(70;0.22)			65	94	---	---	---	---	PASS
PPFIA2	8499	broad.mit.edu	37	12	81777926	81777926	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81777926A>G	uc001szo.1	-	9	1021	c.860T>C	c.(859-861)ATG>ACG	p.M287T	PPFIA2_uc010sue.1_Missense_Mutation_p.M187T|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	213										ovary(3)|lung(2)|pancreas(1)	6						ACGTTCTTTCATCTGGGCCAT	0.418													12	48	---	---	---	---	PASS
NR2C1	7181	broad.mit.edu	37	12	95416028	95416028	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95416028G>C	uc001tdm.3	-	14	2045	c.1789C>G	c.(1789-1791)CAA>GAA	p.Q597E		NM_003297	NP_003288	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	597	Required for interaction with NRIP1 (By similarity).				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1						CCAATTATTTGAGAGTTATAA	0.368													34	210	---	---	---	---	PASS
LTA4H	4048	broad.mit.edu	37	12	96414851	96414851	+	Intron	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96414851C>T	uc001ten.1	-						LTA4H_uc010suy.1_Intron|LTA4H_uc010suz.1_Intron|LTA4H_uc010sva.1_Intron	NM_000895	NP_000886	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase						hormone biosynthetic process|inflammatory response|leukotriene biosynthetic process|peptide catabolic process|prostanoid metabolic process|proteolysis	cytosol|nucleus	aminopeptidase activity|epoxide hydrolase activity|leukotriene-A4 hydrolase activity|metallopeptidase activity|protein binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(1)	1						GAAAATTTTTCCAAAAGCTCA	0.398													31	67	---	---	---	---	PASS
ALDH1L2	160428	broad.mit.edu	37	12	105451930	105451930	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105451930G>T	uc001tlc.2	-	10	1335	c.1208C>A	c.(1207-1209)ACC>AAC	p.T403N	ALDH1L2_uc009zuo.2_5'UTR|ALDH1L2_uc009zup.2_RNA	NM_001034173	NP_001029345	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	403	Acyl carrier.				10-formyltetrahydrofolate catabolic process|biosynthetic process	mitochondrion	acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity|phosphopantetheine binding			skin(1)	1						TTCAAACTTGGTGGCCATATA	0.428													97	174	---	---	---	---	PASS
HSPB8	26353	broad.mit.edu	37	12	119617130	119617130	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119617130C>T	uc001txb.2	+	1	536	c.13C>T	c.(13-15)CAG>TAG	p.Q5*	HSPB8_uc001txc.2_Nonsense_Mutation_p.Q5*	NM_014365	NP_055180	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8	5					cell death|response to heat	cytoplasm|nucleus	identical protein binding|protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGCTGACGGTCAGATGCCCTT	0.388													47	326	---	---	---	---	PASS
HSPB8	26353	broad.mit.edu	37	12	119617283	119617283	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119617283C>T	uc001txb.2	+	1	689	c.166C>T	c.(166-168)CTC>TTC	p.L56F	HSPB8_uc001txc.2_Missense_Mutation_p.L56F	NM_014365	NP_055180	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8	56					cell death|response to heat	cytoplasm|nucleus	identical protein binding|protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCTGCCTCGTCTCTCCTCCGC	0.692													79	381	---	---	---	---	PASS
HSPB8	26353	broad.mit.edu	37	12	119617290	119617290	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119617290C>T	uc001txb.2	+	1	696	c.173C>T	c.(172-174)TCC>TTC	p.S58F	HSPB8_uc001txc.2_Missense_Mutation_p.S58F	NM_014365	NP_055180	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8	58					cell death|response to heat	cytoplasm|nucleus	identical protein binding|protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGTCTCTCCTCCGCCTGGCCA	0.692													70	347	---	---	---	---	PASS
HSPB8	26353	broad.mit.edu	37	12	119617491	119617491	+	Intron	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119617491C>T	uc001txb.2	+						HSPB8_uc001txc.2_Intron	NM_014365	NP_055180	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8						cell death|response to heat	cytoplasm|nucleus	identical protein binding|protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCTGGTAAGTCAGGGGCAGGA	0.562													20	101	---	---	---	---	PASS
HNF1A	6927	broad.mit.edu	37	12	121432067	121432067	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121432067C>A	uc001tzg.2	+	4	837	c.814C>A	c.(814-816)CGC>AGC	p.R272S	HNF1A_uc001tze.1_Missense_Mutation_p.R272S|HNF1A_uc001tzf.2_Missense_Mutation_p.R272S|HNF1A_uc010szn.1_Missense_Mutation_p.R272S	NM_000545	NP_000536	P20823	HNF1A_HUMAN	hepatic nuclear factor-1-alpha	272	Homeobox; HNF1-type.|Interaction with DNA.		R -> C (in NIDDM).|R -> H (in IDDM20 and MODY3).		glucose homeostasis|glucose import|insulin secretion|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|protein complex	DNA binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	p.K273fs*41(1)|p.R272H(1)|p.R272S(1)		liver(92)|large_intestine(15)|endometrium(6)|breast(2)|lung(1)	116	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TGCCAACCGGCGCAAAGAAGA	0.672									Hepatic_Adenoma_Familial_Clustering_of				14	25	---	---	---	---	PASS
ZCCHC8	55596	broad.mit.edu	37	12	122958565	122958565	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122958565C>T	uc001ucn.2	-	14	1734	c.1603G>A	c.(1603-1605)GAG>AAG	p.E535K	ZCCHC8_uc001ucl.2_Missense_Mutation_p.E146K|ZCCHC8_uc001ucm.2_Missense_Mutation_p.E297K|ZCCHC8_uc009zxp.2_Missense_Mutation_p.E297K|ZCCHC8_uc009zxq.2_Missense_Mutation_p.E297K	NM_017612	NP_060082	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	535	Potential.					catalytic step 2 spliceosome	nucleic acid binding|protein binding|zinc ion binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		TTTACGCTCTCGGCCTGCTCA	0.547													166	295	---	---	---	---	PASS
SBNO1	55206	broad.mit.edu	37	12	123800192	123800192	+	Nonsense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123800192G>C	uc010tap.1	-	21	2951	c.2951C>G	c.(2950-2952)TCA>TGA	p.S984*	SBNO1_uc010tao.1_Nonsense_Mutation_p.S983*|SBNO1_uc010taq.1_Translation_Start_Site|SBNO1_uc001ues.1_5'Flank	NM_018183	NP_060653	A3KN83	SBNO1_HUMAN	sno, strawberry notch homolog 1	984							ATP binding|DNA binding|hydrolase activity			breast(5)|skin(2)|ovary(1)|kidney(1)	9	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		AACTTGGTTTGATCTATGAGT	0.373													31	147	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	130015694	130015694	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130015694A>G	uc009zyl.1	-	3	1353	c.1025T>C	c.(1024-1026)ATT>ACT	p.I342T		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	342	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GACATCCCAAATGGAAGGGCT	0.532													33	84	---	---	---	---	PASS
RIMBP2	23504	broad.mit.edu	37	12	130929768	130929768	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130929768G>T	uc001uil.2	-	7	741	c.577C>A	c.(577-579)CCC>ACC	p.P193T	RIMBP2_uc001uim.2_Missense_Mutation_p.P101T|RIMBP2_uc001uin.1_5'Flank	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	193	SH3 1.					cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GCCGTGAGGGGCAGCTCAGCT	0.547													91	133	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23929364	23929364	+	Missense_Mutation	SNP	G	A	A	rs149951538		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23929364G>A	uc001uon.2	-	8	1976	c.1387C>T	c.(1387-1389)CAC>TAC	p.H463Y	SACS_uc001uoo.2_Missense_Mutation_p.H316Y|SACS_uc001uop.1_Missense_Mutation_p.H250Y|SACS_uc001uoq.1_Missense_Mutation_p.H316Y	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	463					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CCACTGATGTGAACTGGGAGG	0.483													61	26	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23929365	23929365	+	Silent	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23929365A>T	uc001uon.2	-	8	1975	c.1386T>A	c.(1384-1386)GTT>GTA	p.V462V	SACS_uc001uoo.2_Silent_p.V315V|SACS_uc001uop.1_Silent_p.V249V|SACS_uc001uoq.1_Silent_p.V315V	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	462					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CACTGATGTGAACTGGGAGGC	0.488													60	25	---	---	---	---	PASS
MTIF3	219402	broad.mit.edu	37	13	28011400	28011400	+	Silent	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28011400C>G	uc001urh.2	-	2	1695	c.471G>C	c.(469-471)CTG>CTC	p.L157L	MTIF3_uc001uri.2_Silent_p.L157L|MTIF3_uc001urj.2_Silent_p.L157L|MTIF3_uc001urk.2_Silent_p.L157L	NM_152912	NP_690876	Q9H2K0	IF3M_HUMAN	mitochondrial translational initiation factor 3	157					regulation of translational initiation|ribosome disassembly	mitochondrion	ribosomal small subunit binding|translation initiation factor activity			ovary(1)|skin(1)	2		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.108)|OV - Ovarian serous cystadenocarcinoma(117;0.157)		GTTCCTTTCTCAGGGTTGGTC	0.413													8	58	---	---	---	---	PASS
FLT3	2322	broad.mit.edu	37	13	28623591	28623591	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28623591T>C	uc001urw.2	-	8	1048	c.966A>G	c.(964-966)AGA>AGG	p.R322R	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Silent_p.R322R	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	322	Extracellular (Potential).|Ig-like C2-type.				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	CGGTGTCGTTTCTTGCCACTG	0.398			Mis|O		AML|ALL								30	295	---	---	---	---	PASS
AKAP11	11215	broad.mit.edu	37	13	42876298	42876298	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42876298C>G	uc001uys.1	+	8	3591	c.3416C>G	c.(3415-3417)TCT>TGT	p.S1139C		NM_016248	NP_057332	Q9UKA4	AKA11_HUMAN	A-kinase anchor protein 11	1139					intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		ACACCACCTTCTACTCCACAC	0.398													24	183	---	---	---	---	PASS
CPB2	1361	broad.mit.edu	37	13	46632487	46632487	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46632487C>T	uc001vaw.2	-	9	893	c.826G>A	c.(826-828)GAA>AAA	p.E276K	uc001vau.1_Intron|uc001vav.1_Intron|CPB2_uc001vax.2_Missense_Mutation_p.E239K	NM_001872	NP_001863	Q96IY4	CBPB2_HUMAN	plasma carboxypeptidase B2 isoform a	276					blood coagulation|fibrinolysis|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		CAGTAGGTTTCCGAGCATGAG	0.418													174	97	---	---	---	---	PASS
FBXL3	26224	broad.mit.edu	37	13	77589613	77589613	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77589613G>A	uc001vkd.2	-	4	945	c.574C>T	c.(574-576)CTA>TTA	p.L192L		NM_012158	NP_036290	Q9UKT7	FBXL3_HUMAN	F-box and leucine-rich repeat protein 3	192	LRR 2.				regulation of circadian rhythm|rhythmic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.218)		GBM - Glioblastoma multiforme(99;0.0521)		TTGGCCACTAGTACTTTGAGA	0.408													29	160	---	---	---	---	PASS
SLITRK6	84189	broad.mit.edu	37	13	86369028	86369028	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86369028G>T	uc001vll.1	-	2	2075	c.1616C>A	c.(1615-1617)ACA>AAA	p.T539K	SLITRK6_uc010afe.1_Intron	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	539	LRRCT 2.|Extracellular (Potential).					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		ATCTGTCACTGTGTTCTTGCT	0.453													99	39	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	92345699	92345699	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92345699G>T	uc010tif.1	+	3	950	c.584G>T	c.(583-585)CGG>CTG	p.R195L		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	195						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				GAATGCATCCGGATGGCTCGC	0.493													26	150	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	92797143	92797143	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92797143G>A	uc010tif.1	+	7	1828	c.1462G>A	c.(1462-1464)GGA>AGA	p.G488R		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	488						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				GGGCAGTGGTGGAGGCATGGT	0.463													25	159	---	---	---	---	PASS
MYO16	23026	broad.mit.edu	37	13	109772789	109772789	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109772789G>T	uc001vqt.1	+	29	3570	c.3444G>T	c.(3442-3444)CAG>CAT	p.Q1148H	MYO16_uc010agk.1_Missense_Mutation_p.Q1170H|MYO16_uc010tjh.1_Missense_Mutation_p.Q660H	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	1148	IQ.				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TACAGTTGCAGAGAAAAATTA	0.353													19	80	---	---	---	---	PASS
PROZ	8858	broad.mit.edu	37	13	113826141	113826141	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113826141G>A	uc001vta.1	+	8	932	c.925G>A	c.(925-927)GAC>AAC	p.D309N	PROZ_uc010agr.1_Missense_Mutation_p.D331N	NM_003891	NP_003882	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma	309	Peptidase S1.				blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	CAATGGCACTGACCTGGGCAA	0.647													9	89	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21863284	21863284	+	Intron	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21863284G>A	uc001was.1	-						CHD8_uc001war.1_Intron|SNORD9_uc001wat.1_5'Flank	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8						ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CTGGGCTGTGGAAAACAAAGT	0.493													16	18	---	---	---	---	PASS
EFS	10278	broad.mit.edu	37	14	23826697	23826697	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23826697T>C	uc001wjo.2	-	6	2032	c.1424A>G	c.(1423-1425)AAG>AGG	p.K475R	EFS_uc001wjp.2_Missense_Mutation_p.K382R|EFS_uc010tnm.1_Missense_Mutation_p.K306R	NM_005864	NP_005855	O43281	EFS_HUMAN	embryonal Fyn-associated substrate isoform 1	475	Divergent helix-loop-helix motif.				cell adhesion|intracellular signal transduction	cytoplasm	SH3 domain binding			large_intestine(1)	1	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		CACCACCCTCTTGCTGTGGGG	0.652													59	80	---	---	---	---	PASS
BAZ1A	11177	broad.mit.edu	37	14	35234367	35234367	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35234367C>G	uc001wsk.2	-	22	3977	c.3409G>C	c.(3409-3411)GAT>CAT	p.D1137H	BAZ1A_uc001wsl.2_Missense_Mutation_p.D1105H	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1137					chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		ACGCTACGATCCAAGGTGGAT	0.438													56	105	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44973932	44973932	+	Silent	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44973932T>A	uc001wvn.2	-	1	2568	c.2259A>T	c.(2257-2259)GTA>GTT	p.V753V		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	753						cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		ACACATTCTCTACCAGAGCCT	0.463													153	148	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47343269	47343269	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47343269C>A	uc001wwj.3	-	13	2561	c.2365G>T	c.(2365-2367)GAC>TAC	p.D789Y	MDGA2_uc001wwh.3_5'UTR|MDGA2_uc001wwi.3_Missense_Mutation_p.D560Y|MDGA2_uc010ani.2_Missense_Mutation_p.D349Y	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	789	MAM.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						CCACTACGGTCAGCATTAGGT	0.338													37	130	---	---	---	---	PASS
EXOC5	10640	broad.mit.edu	37	14	57675449	57675449	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57675449C>A	uc001xct.2	-	18	2256	c.2005G>T	c.(2005-2007)GAT>TAT	p.D669Y	EXOC5_uc001xcs.2_Missense_Mutation_p.D348Y|EXOC5_uc010trg.1_Missense_Mutation_p.D614Y|EXOC5_uc010trh.1_Missense_Mutation_p.D604Y	NM_006544	NP_006535	O00471	EXOC5_HUMAN	SEC10 protein	669					exocytosis|post-Golgi vesicle-mediated transport|protein transport|vesicle docking	cytoplasm				ovary(2)|breast(1)	3						TTTAAATTATCTGGGGCAACT	0.378													71	72	---	---	---	---	PASS
DACT1	51339	broad.mit.edu	37	14	59112477	59112477	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59112477G>T	uc001xdw.2	+	4	1300	c.1136G>T	c.(1135-1137)AGA>ATA	p.R379I	DACT1_uc010trv.1_Missense_Mutation_p.R98I|DACT1_uc001xdx.2_Missense_Mutation_p.R342I|DACT1_uc010trw.1_Missense_Mutation_p.R98I	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN	dapper 1 isoform 1	379					multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus				large_intestine(2)|lung(2)|ovary(1)	5						GTTTGTGTCAGAGCCCCGGGC	0.542													88	105	---	---	---	---	PASS
DAAM1	23002	broad.mit.edu	37	14	59822020	59822020	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59822020A>G	uc001xdz.1	+	21	2649	c.2524A>G	c.(2524-2526)AAA>GAA	p.K842E	DAAM1_uc001xea.1_Missense_Mutation_p.K832E|DAAM1_uc001xec.1_RNA	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of	842	FH2.				actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)		TAGCCTAAACAAAATTGCTGA	0.433													27	165	---	---	---	---	PASS
DCAF5	8816	broad.mit.edu	37	14	69558590	69558590	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69558590T>C	uc001xkp.2	-	6	899	c.680A>G	c.(679-681)TAT>TGT	p.Y227C	DCAF5_uc001xkq.2_Missense_Mutation_p.Y226C|DCAF5_uc001xkr.3_Missense_Mutation_p.Y227C	NM_003861	NP_003852	Q96JK2	DCAF5_HUMAN	WD repeat domain 22	227						CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)	2						GTTTCCACCATAGCGCAGGAG	0.537													29	26	---	---	---	---	PASS
SIPA1L1	26037	broad.mit.edu	37	14	72200378	72200378	+	Intron	SNP	C	A	A	rs142964544	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72200378C>A	uc001xms.2	+						SIPA1L1_uc001xmt.2_Intron|SIPA1L1_uc001xmu.2_Intron|SIPA1L1_uc001xmv.2_Intron|SIPA1L1_uc010ttm.1_Intron|SIPA1L1_uc001xmw.2_Intron	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like						actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CCTCCCTTCCCGCAGGAGAGT	0.552													4	188	---	---	---	---	PASS
TTLL5	23093	broad.mit.edu	37	14	76330119	76330119	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76330119T>C	uc001xrx.2	+	29	3641	c.3436T>C	c.(3436-3438)TAT>CAT	p.Y1146H	TTLL5_uc010ask.1_Missense_Mutation_p.Y1161H|TTLL5_uc001xrz.2_Missense_Mutation_p.Y721H|TTLL5_uc001xsa.2_Missense_Mutation_p.Y220H	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	1146					protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		AGCAGGCAGCTATCAGCTTCA	0.537													7	256	---	---	---	---	PASS
ESRRB	2103	broad.mit.edu	37	14	76964656	76964656	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76964656C>T	uc001xsq.1	+	7	1224	c.1157C>T	c.(1156-1158)CCC>CTC	p.P386L	ESRRB_uc001xsr.2_Missense_Mutation_p.P386L|ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta	386						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		CATGAGGAGCCCTGGAGGACG	0.617													32	32	---	---	---	---	PASS
ESRRB	2103	broad.mit.edu	37	14	76965079	76965079	+	Intron	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76965079G>T	uc001xsr.2	+						ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		GCCTGGGCCAGGGCTGACTCC	0.622													24	59	---	---	---	---	PASS
ESRRB	2103	broad.mit.edu	37	14	76965080	76965080	+	Intron	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76965080G>T	uc001xsr.2	+						ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		CCTGGGCCAGGGCTGACTCCC	0.622													24	61	---	---	---	---	PASS
VIPAR	63894	broad.mit.edu	37	14	77900173	77900173	+	Intron	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77900173C>A	uc001xtt.1	-						VIPAR_uc001xtu.1_Intron|VIPAR_uc010tvj.1_Intron|VIPAR_uc001xtv.1_Intron	NM_022067	NP_071350	Q9H9C1	VIPAR_HUMAN	hypothetical protein LOC63894						endosome to lysosome transport|intracellular protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	early endosome|late endosome|recycling endosome	protein binding			central_nervous_system(1)	1						AGCACAGGGGCAGGGCACACA	0.463													4	151	---	---	---	---	PASS
VIPAR	63894	broad.mit.edu	37	14	77919736	77919736	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77919736C>T	uc001xtt.1	-	4	440	c.102G>A	c.(100-102)GAG>GAA	p.E34E	VIPAR_uc001xtu.1_Silent_p.E34E|VIPAR_uc010tvj.1_Silent_p.E34E|VIPAR_uc001xtv.1_Silent_p.E34E	NM_022067	NP_071350	Q9H9C1	VIPAR_HUMAN	hypothetical protein LOC63894	34					endosome to lysosome transport|intracellular protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	early endosome|late endosome|recycling endosome	protein binding			central_nervous_system(1)	1						CCCGCTTGGACTCCTTTAACT	0.537													89	595	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	80164196	80164196	+	Silent	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80164196A>G	uc001xun.2	+	15	3212	c.2721A>G	c.(2719-2721)CCA>CCG	p.P907P	NRXN3_uc001xum.1_RNA|NRXN3_uc001xup.2_RNA|NRXN3_uc001xuq.2_Silent_p.P275P|NRXN3_uc010asw.2_Silent_p.P305P|NRXN3_uc001xur.3_Silent_p.P275P	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	1280	Extracellular (Potential).				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CCATGCCACCAGAAATGTCTA	0.468													58	118	---	---	---	---	PASS
C14orf145	145508	broad.mit.edu	37	14	81259310	81259310	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81259310C>A	uc001xux.2	-	13	1525	c.1354G>T	c.(1354-1356)GAG>TAG	p.E452*	C14orf145_uc010asz.1_RNA	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508	452	Potential.					centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		GTTGCATCCTCCGCATGGCGA	0.537													94	119	---	---	---	---	PASS
STON2	85439	broad.mit.edu	37	14	81743488	81743488	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81743488C>A	uc010tvu.1	-	4	2368	c.2167G>T	c.(2167-2169)GTT>TTT	p.V723F	STON2_uc001xvk.1_Missense_Mutation_p.V723F|STON2_uc010tvt.1_Missense_Mutation_p.V520F	NM_033104	NP_149095	Q8WXE9	STON2_HUMAN	stonin 2	723	MHD.				endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding			skin(3)|pancreas(2)	5				BRCA - Breast invasive adenocarcinoma(234;0.0348)		TCACAGGGAACCTGAGTGAGG	0.552													23	335	---	---	---	---	PASS
FLRT2	23768	broad.mit.edu	37	14	86088740	86088740	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86088740G>T	uc001xvr.2	+	2	1649	c.882G>T	c.(880-882)GGG>GGT	p.G294G	FLRT2_uc010atd.2_Silent_p.G294G	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	294	Extracellular (Potential).|LRR 10.				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TGACTCAAGGGGTTTTTGATA	0.443													75	669	---	---	---	---	PASS
GPR65	8477	broad.mit.edu	37	14	88477620	88477620	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88477620C>A	uc001xvv.2	+	2	959	c.429C>A	c.(427-429)ACC>ACA	p.T143T		NM_003608	NP_003599	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	143	Helical; Name=4; (Potential).				actin cytoskeleton reorganization|activation of Rho GTPase activity|apoptosis|immune response|multicellular organismal development|positive regulation of cAMP biosynthetic process|positive regulation of stress fiber assembly|response to acidity	integral to plasma membrane	G-protein coupled receptor activity				0						TATTGGAAACCATCTTCAATG	0.383													6	538	---	---	---	---	PASS
TRIP11	9321	broad.mit.edu	37	14	92471638	92471638	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92471638T>C	uc001xzy.2	-	11	3470	c.2682A>G	c.(2680-2682)CTA>CTG	p.L894L	TRIP11_uc010auf.1_Silent_p.L630L	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	894	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		CCTCAGATGCTAGTTCAGTAA	0.403			T	PDGFRB	AML								177	117	---	---	---	---	PASS
PPP4R4	57718	broad.mit.edu	37	14	94731758	94731758	+	Silent	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94731758C>G	uc001ycs.1	+	21	2386	c.2232C>G	c.(2230-2232)CCC>CCG	p.P744P		NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1	744						cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4						AAAGTCTGCCCAAGAACATCC	0.353													28	222	---	---	---	---	PASS
SERPINA11	256394	broad.mit.edu	37	14	94914463	94914463	+	Intron	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94914463C>T	uc001ydd.1	-							NM_001080451	NP_001073920	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1						regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			kidney(1)	1				COAD - Colon adenocarcinoma(157;0.211)		TCAGAGCAAGCCTCACCTTTG	0.408													68	159	---	---	---	---	PASS
CLMN	79789	broad.mit.edu	37	14	95786073	95786073	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95786073G>T	uc001yef.2	-	1	173	c.57C>A	c.(55-57)AGC>AGA	p.S19R		NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin	19	Actin-binding.|CH 1.					integral to membrane	actin binding				0				Epithelial(152;0.193)		CTCGGATGTCGCTAATCTGCC	0.632													8	92	---	---	---	---	PASS
MIR493	574450	broad.mit.edu	37	14	101335467	101335467	+	RNA	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101335467G>T	hsa-mir-493|MI0003132	+			c.71G>T																				0						ggtctactgtgtgccaggccc	0.433													27	226	---	---	---	---	PASS
PPP1R13B	23368	broad.mit.edu	37	14	104206296	104206296	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104206296G>A	uc001yof.1	-	12	2740	c.2457C>T	c.(2455-2457)GAC>GAT	p.D819D	PPP1R13B_uc010awv.1_RNA|PPP1R13B_uc001yog.1_Silent_p.D686D	NM_015316	NP_056131	Q96KQ4	ASPP1_HUMAN	apoptosis-stimulating protein of p53, 1	819	Pro-rich.				apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				TGTTGTTATTGTCCTCTGCCG	0.602													9	138	---	---	---	---	PASS
PAR4	347745	broad.mit.edu	37	15	25456944	25456944	+	Intron	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25456944G>C	uc001yzk.1	+						PAR4_uc010ayo.1_Intron|SNORD115-20_uc001yzq.1_Intron|PAR4_uc001yzs.2_RNA|uc001yzt.1_5'Flank|HBII-52-24_uc010ayp.1_5'Flank					Homo sapiens clone Rt-13I SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						CCCTGGGTTGGGTCAATGATG	0.532													113	384	---	---	---	---	PASS
OTUD7A	161725	broad.mit.edu	37	15	31776859	31776859	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31776859C>A	uc001zfq.2	-	11	1512	c.1419G>T	c.(1417-1419)TCG>TCT	p.S473S	OTUD7A_uc001zfr.2_Silent_p.S480S	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A	473						cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		CCGAGTCCAGCGAGTCGGCCA	0.527													3	16	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33954961	33954961	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33954961C>A	uc001zhi.2	+	35	5300	c.5230C>A	c.(5230-5232)CGG>AGG	p.R1744R	RYR3_uc010bar.2_Silent_p.R1744R	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	1744	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGATGATGTTCGGCAGATCCT	0.552													4	170	---	---	---	---	PASS
PDIA3	2923	broad.mit.edu	37	15	44062447	44062447	+	Splice_Site	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44062447G>T	uc001zsu.2	+	11	1415	c.1267_splice	c.e11-1	p.L423_splice	PDIA3_uc010bdp.2_Splice_Site_p.L403_splice|PDIA3_uc010ued.1_Splice_Site_p.L197_splice	NM_005313	NP_005304	P30101	PDIA3_HUMAN	protein disulfide-isomerase A3 precursor						cell redox homeostasis|glycerol ether metabolic process|post-translational protein modification|protein folding|protein import into nucleus|protein N-linked glycosylation via asparagine|protein retention in ER lumen|signal transduction	endoplasmic reticulum lumen|melanosome	cysteine-type endopeptidase activity|electron carrier activity|phospholipase C activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)|skin(1)	2		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.48e-07)		TTTATTAACAGCTCAGCAAAG	0.368													12	94	---	---	---	---	PASS
PDIA3	2923	broad.mit.edu	37	15	44062448	44062448	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44062448C>A	uc001zsu.2	+	11	1415	c.1267C>A	c.(1267-1269)CTC>ATC	p.L423I	PDIA3_uc010bdp.2_Missense_Mutation_p.L403I|PDIA3_uc010ued.1_Missense_Mutation_p.L197I	NM_005313	NP_005304	P30101	PDIA3_HUMAN	protein disulfide-isomerase A3 precursor	423	Thioredoxin 2.				cell redox homeostasis|glycerol ether metabolic process|post-translational protein modification|protein folding|protein import into nucleus|protein N-linked glycosylation via asparagine|protein retention in ER lumen|signal transduction	endoplasmic reticulum lumen|melanosome	cysteine-type endopeptidase activity|electron carrier activity|phospholipase C activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)|skin(1)	2		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.48e-07)		TTATTAACAGCTCAGCAAAGA	0.373													13	98	---	---	---	---	PASS
ELL3	80237	broad.mit.edu	37	15	44066938	44066938	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44066938C>A	uc001zsw.1	-	7	1082	c.679G>T	c.(679-681)GAA>TAA	p.E227*	ELL3_uc001zsv.1_Nonsense_Mutation_p.E181*|ELL3_uc001zsx.1_Nonsense_Mutation_p.E112*|uc001zsy.2_5'Flank	NM_025165	NP_079441	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3	227					positive regulation of transcription elongation, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				ovary(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		CTCTTTTCTTCCAGTTCTACA	0.443													35	153	---	---	---	---	PASS
TRIM69	140691	broad.mit.edu	37	15	45059595	45059595	+	Silent	SNP	A	T	T	rs141242641		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45059595A>T	uc001zuf.2	+	8	2023	c.1128A>T	c.(1126-1128)GGA>GGT	p.G376G	TRIM69_uc001zui.1_Silent_p.G172G|TRIM69_uc010bdy.1_Silent_p.G155G|TRIM69_uc001zug.1_Silent_p.G376G|TRIM69_uc001zuh.1_Silent_p.G217G	NM_182985	NP_892030	Q86WT6	TRI69_HUMAN	tripartite motif-containing 69 isoform a	376	B30.2/SPRY.				apoptosis	nuclear speck	zinc ion binding				0		all_cancers(109;2.47e-13)|all_epithelial(112;2.84e-11)|Lung NSC(122;2.23e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;5.5e-19)|GBM - Glioblastoma multiforme(94;1.07e-06)|Colorectal(105;0.138)|COAD - Colon adenocarcinoma(120;0.141)		TCACCTCTGGAAAGTGGTACT	0.483													81	166	---	---	---	---	PASS
DUOX2	50506	broad.mit.edu	37	15	45387146	45387146	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45387146C>A	uc010bea.2	-	32	4586	c.4383G>T	c.(4381-4383)AGG>AGT	p.R1461S	DUOX2_uc001zun.2_Missense_Mutation_p.R1461S	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	1461	Cytoplasmic (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GCATGGTGGTCCTGAGGTCGA	0.607													22	91	---	---	---	---	PASS
MYEF2	50804	broad.mit.edu	37	15	48435118	48435118	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48435118T>C	uc001zwi.3	-	17	1914	c.1790A>G	c.(1789-1791)GAT>GGT	p.D597G	MYEF2_uc001zwg.3_Missense_Mutation_p.D135G|MYEF2_uc001zwh.3_Missense_Mutation_p.D185G|MYEF2_uc001zwj.3_Missense_Mutation_p.D573G	NM_016132	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	597	RRM 3.				transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding			lung(2)|ovary(1)	3		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		TGCATTACGATCCAAGCGAAC	0.363													43	115	---	---	---	---	PASS
SLC12A1	6557	broad.mit.edu	37	15	48577447	48577447	+	Splice_Site	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48577447G>A	uc001zwn.3	+	21	2845	c.2629_splice	c.e21+1	p.D877_splice	SLC12A1_uc001zwq.3_Splice_Site_p.D648_splice|SLC12A1_uc001zwr.3_Splice_Site_p.D604_splice	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2						potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	CCTAAAAAAGGTAAGAACTTT	0.368													14	85	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53994320	53994320	+	Intron	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53994320C>A	uc002acj.2	-						WDR72_uc010bfi.1_Intron	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		ATATTTTACTCTTCGTCTTAC	0.269													39	78	---	---	---	---	PASS
DYX1C1	161582	broad.mit.edu	37	15	55724695	55724695	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55724695C>A	uc002adc.2	-	9	1521	c.1153G>T	c.(1153-1155)GGC>TGC	p.G385C	CCPG1_uc002acy.2_5'UTR|DYX1C1_uc010ugh.1_Intron|DYX1C1_uc010ugi.1_RNA|DYX1C1_uc002adb.2_Intron|DYX1C1_uc002add.2_Intron	NM_130810	NP_570722	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1 isoform a	385	TPR 3.				neuron migration|regulation of estrogen receptor signaling pathway|regulation of proteasomal protein catabolic process	cytoplasm|nucleus	estrogen receptor binding			skin(1)	1				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		AATTCCTTACCTTCTACATAC	0.348													9	103	---	---	---	---	PASS
AP3B2	8120	broad.mit.edu	37	15	83350255	83350255	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83350255C>T	uc010uoh.1	-	5	615	c.438G>A	c.(436-438)ATG>ATA	p.M146I	AP3B2_uc010uoi.1_Missense_Mutation_p.M146I|AP3B2_uc010uoj.1_Missense_Mutation_p.M114I|AP3B2_uc010uog.1_5'Flank	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2	146					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)			TAGCTAGCATCATGATGGGCA	0.567													32	249	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86076900	86076900	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86076900T>A	uc002blv.1	+	4	437	c.267T>A	c.(265-267)TTT>TTA	p.F89L	AKAP13_uc002bls.2_Missense_Mutation_p.F89L|AKAP13_uc002blt.1_Missense_Mutation_p.F89L|AKAP13_uc002blu.1_Missense_Mutation_p.F89L	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	89					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						AAGAAGACTTTCATTTCGTCC	0.473													28	300	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86076901	86076901	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86076901C>T	uc002blv.1	+	4	438	c.268C>T	c.(268-270)CAT>TAT	p.H90Y	AKAP13_uc002bls.2_Missense_Mutation_p.H90Y|AKAP13_uc002blt.1_Missense_Mutation_p.H90Y|AKAP13_uc002blu.1_Missense_Mutation_p.H90Y	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	90					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						AGAAGACTTTCATTTCGTCCA	0.473													28	299	---	---	---	---	PASS
MESP2	145873	broad.mit.edu	37	15	90319886	90319886	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90319886G>T	uc002bon.2	+	1	298	c.298G>T	c.(298-300)GCC>TCC	p.A100S	MESP2_uc010uqa.1_Intron	NM_001039958	NP_001035047	Q0VG99	MESP2_HUMAN	mesoderm posterior 2 homolog	100	Helix-loop-helix motif.				Notch signaling pathway	nucleus	DNA binding				0	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			GCTGGCCCGCGCCCTGCACGA	0.726													25	10	---	---	---	---	PASS
NGRN	51335	broad.mit.edu	37	15	90814723	90814723	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90814723G>T	uc002bpf.1	+	3	629	c.579G>T	c.(577-579)GTG>GTT	p.V193V	TTLL13_uc002bpe.1_RNA|NGRN_uc002bpg.1_Silent_p.V121V	NM_001033088	NP_001028260	Q9NPE2	NGRN_HUMAN	neugrin	193					neuron differentiation	extracellular region|nucleus				large_intestine(2)|ovary(1)	3	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			CTTTGAAAGTGATAGAGTCAG	0.488													6	482	---	---	---	---	PASS
FAM169B	283777	broad.mit.edu	37	15	99023833	99023833	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99023833C>G	uc002buk.1	-	4	430	c.180G>C	c.(178-180)ATG>ATC	p.M60I		NM_182562	NP_872368	Q8N8A8	F169B_HUMAN	hypothetical protein LOC283777	60											0						CCTCACCTTTCATCTTGGTTG	0.527													12	428	---	---	---	---	PASS
C15orf51	196968	broad.mit.edu	37	15	100341319	100341319	+	RNA	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100341319C>T	uc010urx.1	-	3		c.328G>A			C15orf51_uc010ury.1_RNA|uc002bvp.2_5'Flank|C15orf51_uc010urz.1_RNA|C15orf51_uc010bow.2_RNA	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						TTTCCATTTGCCGCTCCAGCT	0.582													6	627	---	---	---	---	PASS
LRRK1	79705	broad.mit.edu	37	15	101597168	101597168	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101597168C>G	uc002bwr.2	+	28	4759	c.4440C>G	c.(4438-4440)ATC>ATG	p.I1480M	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	1480	Protein kinase.				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCAAGGGCATCCGCCCGGTTC	0.602													48	819	---	---	---	---	PASS
TM2D3	80213	broad.mit.edu	37	15	102191910	102191910	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102191910G>A	uc002bxi.2	-	2	188	c.158C>T	c.(157-159)CCC>CTC	p.P53L	TM2D3_uc010usg.1_Intron|TM2D3_uc002bxh.2_5'Flank|TM2D3_uc002bxj.2_Intron|TM2D3_uc002bxk.2_5'UTR|TM2D3_uc010ush.1_Missense_Mutation_p.P53L	NM_078474	NP_510883	Q9BRN9	TM2D3_HUMAN	TM2 domain containing 3 isoform a	53						integral to membrane				ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGCTGCCCTGGGAACTACTGT	0.398													41	850	---	---	---	---	PASS
TM2D3	80213	broad.mit.edu	37	15	102191952	102191952	+	Nonsense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102191952G>C	uc002bxi.2	-	2	146	c.116C>G	c.(115-117)TCA>TGA	p.S39*	TM2D3_uc010usg.1_Intron|TM2D3_uc002bxh.2_5'Flank|TM2D3_uc002bxj.2_Intron|TM2D3_uc002bxk.2_5'UTR|TM2D3_uc010ush.1_Nonsense_Mutation_p.S39*	NM_078474	NP_510883	Q9BRN9	TM2D3_HUMAN	TM2 domain containing 3 isoform a	39						integral to membrane				ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ATCCTTTATTGACTGAGCCAG	0.433													32	843	---	---	---	---	PASS
TM2D3	80213	broad.mit.edu	37	15	102191970	102191970	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102191970G>A	uc002bxi.2	-	2	128	c.98C>T	c.(97-99)TCG>TTG	p.S33L	TM2D3_uc010usg.1_Intron|TM2D3_uc002bxh.2_5'Flank|TM2D3_uc002bxj.2_Intron|TM2D3_uc002bxk.2_5'UTR|TM2D3_uc010ush.1_Missense_Mutation_p.S33L	NM_078474	NP_510883	Q9BRN9	TM2D3_HUMAN	TM2 domain containing 3 isoform a	33						integral to membrane				ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CAGCGCCTGCGATTGCTCTAA	0.468													26	817	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2819118	2819118	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2819118T>C	uc002crk.2	+	12	8403	c.7854T>C	c.(7852-7854)TCT>TCC	p.S2618S		NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	2618	Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						cctcttcatcttcctcctcct	0.279													56	105	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3788606	3788606	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3788606A>C	uc002cvv.2	-	26	4552	c.4348T>G	c.(4348-4350)TAC>GAC	p.Y1450D	CREBBP_uc002cvw.2_Missense_Mutation_p.Y1412D	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1450	Cys/His-rich.		Y -> H (in RSTS1).		cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding	p.Y1450C(1)		haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		ATCTCATGGTAAACGGCTGTG	0.398			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				26	43	---	---	---	---	PASS
TXNDC11	51061	broad.mit.edu	37	16	11785816	11785816	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11785816T>C	uc010buu.1	-	9	1373	c.1311A>G	c.(1309-1311)GCA>GCG	p.A437A	TXNDC11_uc002dbg.1_Silent_p.A410A	NM_015914	NP_056998	Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	437					cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane					0						CTGGCAGCTGTGCCGGCACTT	0.637													14	74	---	---	---	---	PASS
UMOD	7369	broad.mit.edu	37	16	20359951	20359951	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20359951G>T	uc002dgz.2	-	3	801	c.672C>A	c.(670-672)AAC>AAA	p.N224K	UMOD_uc002dha.2_Missense_Mutation_p.N224K|UMOD_uc002dhb.2_Missense_Mutation_p.N257K	NM_003361	NP_003352	P07911	UROM_HUMAN	uromodulin precursor	224					cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)|skin(1)	2						GGGCGGCCGTGTTGCAGCGCA	0.711													4	15	---	---	---	---	PASS
RABEP2	79874	broad.mit.edu	37	16	28922461	28922461	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28922461C>A	uc002drq.2	-	6	982	c.934G>T	c.(934-936)GAG>TAG	p.E312*	uc010vct.1_Intron|RABEP2_uc010vdf.1_Nonsense_Mutation_p.E241*|RABEP2_uc010byn.2_Intron|RABEP2_uc002drr.2_Nonsense_Mutation_p.E312*	NM_024816	NP_079092	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	312	Potential.				endocytosis|protein transport	early endosome	growth factor activity|GTPase activator activity			ovary(1)|breast(1)|skin(1)	3						TCGTCCCGCTCGCGACTGACG	0.562													35	98	---	---	---	---	PASS
CDIPT	10423	broad.mit.edu	37	16	29871897	29871897	+	Intron	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29871897C>T	uc002dum.2	-						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|CDIPT_uc002duk.2_Intron|CDIPT_uc002dul.2_Intron|CDIPT_uc002dun.2_Intron	NM_006319	NP_006310	O14735	CDIPT_HUMAN	CDP-diacylglycerol-inositol							endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity|phosphatidylinositol transporter activity				0						GCAGGAAATGCTTACCCTCGA	0.592													8	43	---	---	---	---	PASS
ITGAX	3687	broad.mit.edu	37	16	31382415	31382415	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31382415G>A	uc002ebu.1	+	15	1788	c.1721G>A	c.(1720-1722)GGC>GAC	p.G574D	ITGAX_uc002ebt.2_Missense_Mutation_p.G574D|ITGAX_uc010vfk.1_Missense_Mutation_p.G224D	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	574	FG-GAP 7.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CGGATCGCGGGCTCCCAGCTC	0.582													63	329	---	---	---	---	PASS
ITGAD	3681	broad.mit.edu	37	16	31405562	31405562	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31405562G>C	uc002ebv.1	+	2	86	c.37G>C	c.(37-39)GCT>CCT	p.A13P	ITGAD_uc010vfl.1_Missense_Mutation_p.A13P|ITGAD_uc010cap.1_Missense_Mutation_p.A13P	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	13					cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						CTCAGTCCTGGCTTCTTATCA	0.502													26	88	---	---	---	---	PASS
C16orf58	64755	broad.mit.edu	37	16	31502156	31502156	+	Nonstop_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31502156T>A	uc002eci.1	-	13	1419	c.1407A>T	c.(1405-1407)TGA>TGT	p.*469C	C16orf58_uc002ecg.2_5'Flank|C16orf58_uc002ech.1_Nonstop_Mutation_p.*207C	NM_022744	NP_073581	Q96GQ5	CP058_HUMAN	hypothetical protein LOC64755	469						integral to membrane				ovary(1)|breast(1)	2						TCTGGGCTGCTCACAAGACCT	0.587													95	234	---	---	---	---	PASS
IRX6	79190	broad.mit.edu	37	16	55361550	55361550	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55361550G>T	uc002ehy.2	+	4	999	c.466G>T	c.(466-468)GAG>TAG	p.E156*	IRX6_uc002ehx.2_Nonsense_Mutation_p.E156*|IRX6_uc010ccb.1_RNA	NM_024335	NP_077311	P78412	IRX6_HUMAN	iroquois homeobox protein 6	156	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(1)	6						CGCGACCCGGGAGACCACCAG	0.562													38	69	---	---	---	---	PASS
GPR114	221188	broad.mit.edu	37	16	57601428	57601428	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57601428C>A	uc002elx.3	+	8	831	c.746C>A	c.(745-747)ACG>AAG	p.T249K	GPR114_uc010vhr.1_Missense_Mutation_p.T249K|GPR114_uc002ely.2_Missense_Mutation_p.T249K	NM_153837	NP_722579	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114 precursor	249	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)	1						GCACCTCTTACGTACATCTCC	0.607													73	88	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	65022192	65022192	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65022192T>C	uc002eoi.2	-	7	1301	c.867A>G	c.(865-867)AGA>AGG	p.R289R	CDH11_uc010cdn.2_RNA|CDH11_uc002eoj.2_Silent_p.R289R|CDH11_uc010vin.1_Silent_p.R163R	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	289	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TAGCTTTCACTCTTCCTACTT	0.403			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			49	277	---	---	---	---	PASS
FAM65A	79567	broad.mit.edu	37	16	67572954	67572954	+	Nonsense_Mutation	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67572954A>T	uc010vjp.1	+	4	475	c.379A>T	c.(379-381)AAG>TAG	p.K127*	FAM65A_uc010cei.1_5'UTR|FAM65A_uc002eth.2_Nonsense_Mutation_p.K107*|FAM65A_uc010cej.2_Nonsense_Mutation_p.K110*|FAM65A_uc002eti.1_Nonsense_Mutation_p.K70*|FAM65A_uc010vjq.1_Nonsense_Mutation_p.K121*|FAM65A_uc002etj.1_Nonsense_Mutation_p.K106*|FAM65A_uc002etk.2_Nonsense_Mutation_p.K106*	NM_024519	NP_078795	Q6ZS17	FA65A_HUMAN	hypothetical protein LOC79567	111	Potential.					cytoplasm	binding			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		AAGGGAGTCCAAGAGGAATTC	0.587													43	148	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76592434	76592434	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76592434G>C	uc002feu.1	+	26	4166	c.3781G>C	c.(3781-3783)GCT>CCT	p.A1261P	CNTNAP4_uc002fev.1_Missense_Mutation_p.A1125P|CNTNAP4_uc010chb.1_Missense_Mutation_p.A1188P|CNTNAP4_uc002fex.1_Missense_Mutation_p.A1264P	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	1261	Helical; (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						CACTGCCATAGCTGTTCGCAT	0.368													35	48	---	---	---	---	PASS
WDR81	124997	broad.mit.edu	37	17	1638985	1638985	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1638985G>A	uc002fti.2	+	8	1879	c.1618G>A	c.(1618-1620)GTG>ATG	p.V540M	WDR81_uc002fth.2_Missense_Mutation_p.V716M|WDR81_uc010vqp.1_Missense_Mutation_p.V564M|WDR81_uc002ftj.2_Missense_Mutation_p.V1767M|WDR81_uc010vqq.1_Missense_Mutation_p.V398M	NM_001163811	NP_001157283	Q562E7	WDR81_HUMAN	WD repeat domain 81 isoform 4	540										skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CCTGCGCTTTGTGGACTGCAG	0.652													177	32	---	---	---	---	PASS
AIPL1	23746	broad.mit.edu	37	17	6328914	6328914	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6328914C>A	uc002gcp.2	-	6	1116	c.1021G>T	c.(1021-1023)GAG>TAG	p.E341*	AIPL1_uc002gcq.2_Nonsense_Mutation_p.E281*|AIPL1_uc002gcr.2_Nonsense_Mutation_p.E278*|AIPL1_uc010clk.2_Nonsense_Mutation_p.E319*|AIPL1_uc010cll.2_Nonsense_Mutation_p.E317*|AIPL1_uc002gcs.2_3'UTR	NM_014336	NP_055151	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting	341					protein farnesylation|protein folding|visual perception	cytoplasm|nucleus	farnesylated protein binding|unfolded protein binding				0				COAD - Colon adenocarcinoma(228;0.141)		gcgggtggctctgtgggtggc	0.264													273	85	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577570	7577570	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577570C>A	uc002gim.2	-	7	905	c.711G>T	c.(709-711)ATG>ATT	p.M237I	TP53_uc002gig.1_Missense_Mutation_p.M237I|TP53_uc002gih.2_Missense_Mutation_p.M237I|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.M105I|TP53_uc010cng.1_Missense_Mutation_p.M105I|TP53_uc002gii.1_Missense_Mutation_p.M105I|TP53_uc010cnh.1_Missense_Mutation_p.M237I|TP53_uc010cni.1_Missense_Mutation_p.M237I|TP53_uc002gij.2_Missense_Mutation_p.M237I|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.M144I|TP53_uc002gio.2_Missense_Mutation_p.M105I	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	237	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		M -> L (in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> I (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.M237I(99)|p.M237K(8)|p.0?(7)|p.M237V(6)|p.M237fs*10(4)|p.M237R(3)|p.M237T(2)|p.M237L(2)|p.Y236_M237delYM(1)|p.Y236_M237insXX(1)|p.M237_N239delMCN(1)|p.H233fs*6(1)|p.M144I(1)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.Y236_M237>*L(1)|p.H233_C242del10(1)|p.M237fs*1(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AACTGTTACACATGTAGTTGT	0.567		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			102	45	---	---	---	---	PASS
GAS7	8522	broad.mit.edu	37	17	9846539	9846539	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9846539G>T	uc002gmg.1	-	7	791	c.630C>A	c.(628-630)GAC>GAA	p.D210E	GAS7_uc010vvc.1_Missense_Mutation_p.D24E|GAS7_uc002gmh.1_Missense_Mutation_p.D70E|GAS7_uc010vvd.1_Missense_Mutation_p.D162E|GAS7_uc002gmi.2_Missense_Mutation_p.D146E|GAS7_uc002gmj.1_Missense_Mutation_p.D150E|GAS7_uc010coh.1_Missense_Mutation_p.D150E	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c	210	FCH.				cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						TGCCTTGGGGGTCCTTCTTAT	0.527			T	MLL	AML*								12	362	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10233743	10233743	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10233743T>G	uc002gmk.1	-	21	2486	c.2396A>C	c.(2395-2397)TAC>TCC	p.Y799S		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	799	IQ.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						CCGCATCAGGTACCCCCTGCA	0.547													40	10	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10408812	10408812	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10408812C>T	uc002gmo.2	-	20	2285	c.2191G>A	c.(2191-2193)GCA>ACA	p.A731T	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	731	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						ATAGCACTTGCATTTAACACC	0.423													12	116	---	---	---	---	PASS
SMARCE1	6605	broad.mit.edu	37	17	38788534	38788534	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38788534C>T	uc002hux.2	-	8	751	c.627G>A	c.(625-627)GAG>GAA	p.E209E	SMARCE1_uc010wff.1_Silent_p.E174E|SMARCE1_uc010wfg.1_Silent_p.E139E|SMARCE1_uc002huy.2_Silent_p.E174E|SMARCE1_uc010wfh.1_Silent_p.E139E|SMARCE1_uc010wfi.1_Silent_p.E191E	NM_003079	NP_003070	Q969G3	SMCE1_HUMAN	SWI/SNF-related matrix-associated	209					chromatin modification|negative regulation of transcription, DNA-dependent|nervous system development|nucleosome disassembly|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nuclear chromosome|SWI/SNF complex|transcriptional repressor complex	chromatin binding|DNA binding|N-acetyltransferase activity|protein binding|protein N-terminus binding|transcription coactivator activity				0		Breast(137;0.000812)				GCACCACACTCTCACTAAGAA	0.463													177	33	---	---	---	---	PASS
KRTAP1-1	81851	broad.mit.edu	37	17	39197320	39197320	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39197320T>C	uc002hvw.1	-	1	394	c.330A>G	c.(328-330)GGA>GGG	p.G110G		NM_030967	NP_112229	Q07627	KRA11_HUMAN	keratin associated protein 1-1	110			Missing (in allele KAP1.7).			extracellular region|keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGCTCACAGCTCCACTGCTGC	0.642													58	20	---	---	---	---	PASS
KRTAP4-2	85291	broad.mit.edu	37	17	39334352	39334352	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39334352C>T	uc002hwd.2	-	1	109	c.65G>A	c.(64-66)CGT>CAT	p.R22H		NM_033062	NP_149051	Q9BYR5	KRA42_HUMAN	keratin associated protein 4-2	22	2.|20 X 5 AA repeats OF C-C-[GRQVS]-[SPT]- [VSTQ].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCAGCTGGGACGGCAGCAGTT	0.627													49	315	---	---	---	---	PASS
KRT34	3885	broad.mit.edu	37	17	39535405	39535405	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39535405C>T	uc002hwm.2	-	6	1038	c.1026G>A	c.(1024-1026)CTG>CTA	p.L342L		NM_021013	NP_066293	O76011	KRT34_HUMAN	keratin 34	342	Rod.|Coil 2.				epidermis development	intermediate filament	protein binding|structural molecule activity			central_nervous_system(1)	1		Breast(137;0.000496)				CGCTCTCCGTCAGCGTGTTTT	0.562													140	27	---	---	---	---	PASS
PLEKHH3	79990	broad.mit.edu	37	17	40826032	40826032	+	Splice_Site	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40826032C>T	uc002iau.2	-	3	686	c.219_splice	c.e3-1	p.R73_splice	PLEKHH3_uc010cyl.1_5'Flank|PLEKHH3_uc002iat.1_Splice_Site|PLEKHH3_uc002iav.2_Splice_Site|PLEKHH3_uc010cym.1_Splice_Site|PLEKHH3_uc002iaw.2_Splice_Site_p.R73_splice	NM_024927	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H						signal transduction	cytoskeleton				large_intestine(1)|ovary(1)	2		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		GCTCTGCAGCCTGGGCCAGAG	0.657													51	43	---	---	---	---	PASS
EZH1	2145	broad.mit.edu	37	17	40880863	40880863	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40880863G>T	uc002iaz.2	-	3	242	c.97C>A	c.(97-99)CAG>AAG	p.Q33K	EZH1_uc002iba.2_Missense_Mutation_p.Q33K|EZH1_uc010wgt.1_Intron|EZH1_uc010wgu.1_Missense_Mutation_p.Q39K|EZH1_uc010wgv.1_Missense_Mutation_p.Q33K|EZH1_uc010wgw.1_5'UTR|EZH1_uc010cyp.2_5'UTR|EZH1_uc010cyq.2_Missense_Mutation_p.Q33K|EZH1_uc010cys.2_Missense_Mutation_p.Q33K	NM_001991	NP_001982	Q92800	EZH1_HUMAN	enhancer of zeste homolog 1	33					anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	chromatin binding|DNA binding			ovary(3)	3		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		ATATTTGCCTGAAGCCGTTTA	0.348													166	48	---	---	---	---	PASS
GPATCH8	23131	broad.mit.edu	37	17	42477692	42477692	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42477692T>C	uc002igw.1	-	8	1817	c.1753A>G	c.(1753-1755)AGA>GGA	p.R585G	GPATCH8_uc002igv.1_Missense_Mutation_p.R507G|GPATCH8_uc010wiz.1_Missense_Mutation_p.R507G	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	585						intracellular	nucleic acid binding|zinc ion binding			ovary(2)|kidney(1)|skin(1)	4		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		CCTTTAGTTCTGGCATCTTTG	0.403											OREG0024461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	179	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51900535	51900535	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51900535G>T	uc002iua.2	+	1	297	c.141G>T	c.(139-141)ACG>ACT	p.T47T		NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	47					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						CTGTGGTCACGGAGATCAACA	0.527													149	61	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51902274	51902274	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51902274C>G	uc002iua.2	+	1	2036	c.1880C>G	c.(1879-1881)GCT>GGT	p.A627G	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	627					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						CAGGAGAGAGCTGGTGGAGTA	0.438													179	38	---	---	---	---	PASS
YPEL2	388403	broad.mit.edu	37	17	57430779	57430779	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57430779G>C	uc002ixm.1	+	2	337	c.9G>C	c.(7-9)AAG>AAC	p.K3N	YPEL2_uc002ixl.1_Missense_Mutation_p.K3N	NM_001005404	NP_001005404	Q96QA6	YPEL2_HUMAN	yippee-like 2	3						nucleolus					0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					CAATGGTGAAGATGACAAGAT	0.552													24	173	---	---	---	---	PASS
CCDC46	201134	broad.mit.edu	37	17	64179375	64179375	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64179375C>A	uc002jfl.2	-	2	262	c.43G>T	c.(43-45)GCA>TCA	p.A15S	CCDC46_uc002jfm.2_Missense_Mutation_p.A15S|CCDC46_uc010dep.2_Missense_Mutation_p.A15S	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a	15						centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			TCAAATTCTGCATCCAGCTTC	0.264													106	39	---	---	---	---	PASS
ABCA9	10350	broad.mit.edu	37	17	66979855	66979855	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66979855C>A	uc002jhu.2	-	36	4778	c.4635G>T	c.(4633-4635)CAG>CAT	p.Q1545H	ABCA9_uc010dez.2_Missense_Mutation_p.Q1507H	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	1545					transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					TCTACCTTTCCTGCTGAGCAG	0.458													181	38	---	---	---	---	PASS
GPRC5C	55890	broad.mit.edu	37	17	72436967	72436967	+	Splice_Site	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72436967G>T	uc002jks.2	+	1	1090	c.1051_splice	c.e1+1	p.A351_splice	GPRC5C_uc002jkp.2_Splice_Site_p.A396_splice|GPRC5C_uc002jkq.2_Intron|GPRC5C_uc002jkr.2_Splice_Site_p.A363_splice|GPRC5C_uc002jkt.2_Splice_Site_p.A351_splice|GPRC5C_uc002jku.2_5'Flank	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,							cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						CCGGTTGCAGGTGGGTCTCTG	0.552													14	189	---	---	---	---	PASS
FDXR	2232	broad.mit.edu	37	17	72860983	72860983	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72860983C>A	uc002jly.2	-	7	767	c.680G>T	c.(679-681)GGC>GTC	p.G227V	FDXR_uc010wri.1_Missense_Mutation_p.G175V|FDXR_uc010wrj.1_Missense_Mutation_p.G225V|FDXR_uc002jlw.2_5'UTR|FDXR_uc002jlx.2_Missense_Mutation_p.G233V|FDXR_uc002jmc.2_Missense_Mutation_p.G228V|FDXR_uc010wrk.1_Missense_Mutation_p.G258V|FDXR_uc010wrl.1_Missense_Mutation_p.G270V|FDXR_uc002jma.2_Missense_Mutation_p.G228V|FDXR_uc010wrm.1_Missense_Mutation_p.G187V|FDXR_uc002jlz.2_Missense_Mutation_p.G219V|FDXR_uc002jmb.2_RNA	NM_024417	NP_077728	P22570	ADRO_HUMAN	ferredoxin reductase isoform 1 precursor	227					cholesterol metabolic process|electron transport chain|steroid biosynthetic process|transport	mitochondrial matrix	ferredoxin-NADP+ reductase activity|protein binding				0	all_lung(278;0.172)|Lung NSC(278;0.207)					TCCACGCCGGCCCACTAGCCA	0.612											OREG0024720	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	207	---	---	---	---	PASS
FDXR	2232	broad.mit.edu	37	17	72861075	72861075	+	Intron	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72861075G>A	uc002jly.2	-						FDXR_uc010wri.1_Intron|FDXR_uc010wrj.1_Intron|FDXR_uc002jlw.2_Intron|FDXR_uc002jlx.2_Intron|FDXR_uc002jmc.2_Intron|FDXR_uc010wrk.1_Intron|FDXR_uc010wrl.1_Intron|FDXR_uc002jma.2_Intron|FDXR_uc010wrm.1_Intron|FDXR_uc002jlz.2_Intron|FDXR_uc002jmb.2_Intron	NM_024417	NP_077728	P22570	ADRO_HUMAN	ferredoxin reductase isoform 1 precursor						cholesterol metabolic process|electron transport chain|steroid biosynthetic process|transport	mitochondrial matrix	ferredoxin-NADP+ reductase activity|protein binding				0	all_lung(278;0.172)|Lung NSC(278;0.207)					GGAGGGCCTTGGAGTCATCAG	0.597											OREG0024720	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	28	162	---	---	---	---	PASS
COLEC12	81035	broad.mit.edu	37	18	348087	348087	+	Silent	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:348087C>G	uc002kkm.2	-	4	473	c.258G>C	c.(256-258)GTG>GTC	p.V86V		NM_130386	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	86	Potential.|Extracellular (Potential).				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				GGTCACTTTCCACTGCTGTGA	0.393													41	113	---	---	---	---	PASS
ADCYAP1	116	broad.mit.edu	37	18	907654	907654	+	Intron	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:907654C>A	uc010dkg.2	+						ADCYAP1_uc010dkh.2_Intron	NM_001099733	NP_001093203	P18509	PACA_HUMAN	adenylate cyclase activating polypeptide						activation of adenylate cyclase activity|cell-cell signaling|female pregnancy|nerve growth factor receptor signaling pathway|regulation of G-protein coupled receptor protein signaling pathway	extracellular region|soluble fraction	neuropeptide hormone activity|peptide hormone receptor binding				0						CCCGGCCACCCCGCAGGCCAG	0.507													10	21	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6999568	6999568	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6999568C>A	uc002knm.2	-	32	4633	c.4539G>T	c.(4537-4539)CCG>CCT	p.P1513P	LAMA1_uc010wzj.1_Silent_p.P989P	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1513	Laminin EGF-like 17.			P -> R (in Ref. 1).	axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CAGAGCCGTGCGGGTTGCAGT	0.592													22	45	---	---	---	---	PASS
CEP192	55125	broad.mit.edu	37	18	13048935	13048935	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13048935C>T	uc010xac.1	+	16	2225	c.2145C>T	c.(2143-2145)ATC>ATT	p.I715I	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Silent_p.I240I|CEP192_uc002kru.2_RNA|CEP192_uc002krs.1_Silent_p.I456I	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	715										ovary(4)|pancreas(1)	5						TGCTTAGGATCAGCACCATTG	0.403													60	146	---	---	---	---	PASS
NPC1	4864	broad.mit.edu	37	18	21125076	21125076	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21125076G>C	uc002kum.3	-	12	2069	c.1795C>G	c.(1795-1797)CTG>GTG	p.L599V	NPC1_uc010xaz.1_Missense_Mutation_p.L332V|NPC1_uc010xba.1_Missense_Mutation_p.L444V	NM_000271	NP_000262	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1 precursor	599					autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GAAATGGTCAGATTGGGATTC	0.328													7	157	---	---	---	---	PASS
RNF138	51444	broad.mit.edu	37	18	29703512	29703512	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29703512A>G	uc002kxg.2	+	5	863	c.424A>G	c.(424-426)ACA>GCA	p.T142A	RNF138_uc002kxh.2_Missense_Mutation_p.T48A	NM_016271	NP_057355	Q8WVD3	RN138_HUMAN	ring finger protein 138 isoform 1	142					Wnt receptor signaling pathway	intracellular	ligase activity|protein kinase binding|zinc ion binding				0						ATCTGATAACACAGAAACTTA	0.308													11	90	---	---	---	---	PASS
MBD1	4152	broad.mit.edu	37	18	47801364	47801364	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47801364C>T	uc010dow.1	-	10	1398	c.961G>A	c.(961-963)GTA>ATA	p.V321I	MBD1_uc002lef.2_Missense_Mutation_p.V128I|MBD1_uc002leg.2_Missense_Mutation_p.V272I|MBD1_uc010xdi.1_Missense_Mutation_p.V372I|MBD1_uc002leh.3_Missense_Mutation_p.V321I|MBD1_uc002len.2_Missense_Mutation_p.V321I|MBD1_uc002lei.3_Missense_Mutation_p.V321I|MBD1_uc002lej.3_Missense_Mutation_p.V321I|MBD1_uc002lek.3_Missense_Mutation_p.V272I|MBD1_uc002lel.3_Intron|MBD1_uc002lem.3_Missense_Mutation_p.V321I|MBD1_uc010xdj.1_Missense_Mutation_p.V321I|MBD1_uc010xdk.1_Missense_Mutation_p.V346I|MBD1_uc010dox.1_Intron|MBD1_uc002leo.2_Missense_Mutation_p.V321I	NM_015846	NP_056671	Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1 isoform 1	321					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|nuclear speck	methyl-CpG binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						TCCTCGTCTACACAGTAATAG	0.567													25	136	---	---	---	---	PASS
ATP8B1	5205	broad.mit.edu	37	18	55319349	55319349	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55319349C>T	uc002lgw.2	-	25	3317	c.3317G>A	c.(3316-3318)AGC>AAC	p.S1106N	uc002lgu.1_Intron|uc002lgv.1_Intron	NM_005603	NP_005594	O43520	AT8B1_HUMAN	ATPase, class I, type 8B, member 1	1106	Helical; (Potential).				ATP biosynthetic process|bile acid and bile salt transport|negative regulation of transcription, DNA-dependent	apical plasma membrane|integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			breast(5)|ovary(2)|central_nervous_system(2)|lung(1)	10		Colorectal(73;0.229)				AAGTGCAATGCTTCCAAAAAT	0.358									Byler_disease				40	72	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76753205	76753205	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76753205C>T	uc002lmt.2	+	2	1214	c.1214C>T	c.(1213-1215)TCG>TTG	p.S405L	SALL3_uc010dra.2_Missense_Mutation_p.S12L	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	405					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CCCAATGTGTCGGTGTTCGAG	0.647													10	52	---	---	---	---	PASS
CNN2	1265	broad.mit.edu	37	19	1032387	1032387	+	Intron	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1032387C>G	uc002lqu.2	+						CNN2_uc002lqt.1_Intron|CNN2_uc010drz.1_Intron|CNN2_uc002lqv.2_Intron|CNN2_uc010xgb.1_Intron|CNN2_uc010xgc.1_Intron	NM_004368	NP_004359	Q99439	CNN2_HUMAN	calponin 2 isoform a						actomyosin structure organization|cellular response to mechanical stimulus|regulation of actin filament-based process	cell-cell junction|stress fiber	actin binding|calmodulin binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTTGTGCCCTCCAGACTCATG	0.582													139	114	---	---	---	---	PASS
SIRT6	51548	broad.mit.edu	37	19	4179132	4179132	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4179132C>T	uc002lzo.2	-	3	406	c.346G>A	c.(346-348)GAC>AAC	p.D116N	SIRT6_uc002lzn.2_Missense_Mutation_p.D44N|SIRT6_uc002lzp.2_Intron|SIRT6_uc010xid.1_Missense_Mutation_p.D44N|SIRT6_uc002lzq.2_Missense_Mutation_p.D116N|SIRT6_uc002lzr.2_Missense_Mutation_p.D44N	NM_016539	NP_057623	Q8N6T7	SIRT6_HUMAN	sirtuin 6	116	NAD (By similarity).|Deacetylase sirtuin-type.				chromatin silencing|protein ADP-ribosylation	nuclear telomeric heterochromatin|nucleoplasm	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity|NAD+ binding|NAD-dependent histone deacetylase activity (H3-K9 specific)|protein binding|zinc ion binding			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGAGCCCGTCCACGTTCTGG	0.657													19	12	---	---	---	---	PASS
KDM4B	23030	broad.mit.edu	37	19	5131396	5131396	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5131396A>T	uc002mbq.3	+	12	1851	c.1625A>T	c.(1624-1626)CAG>CTG	p.Q542L	KDM4B_uc010xim.1_Missense_Mutation_p.Q576L|KDM4B_uc002mbr.3_Missense_Mutation_p.Q300L	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B	542					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1						GCCTTCAACCAGGAGCACGTG	0.652													63	25	---	---	---	---	PASS
KDM4B	23030	broad.mit.edu	37	19	5131397	5131397	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5131397G>T	uc002mbq.3	+	12	1852	c.1626G>T	c.(1624-1626)CAG>CAT	p.Q542H	KDM4B_uc010xim.1_Missense_Mutation_p.Q576H|KDM4B_uc002mbr.3_Missense_Mutation_p.Q300H	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B	542					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1						CCTTCAACCAGGAGCACGTGT	0.652													62	25	---	---	---	---	PASS
TUBB4	10382	broad.mit.edu	37	19	6495567	6495567	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6495567C>T	uc002mfg.1	-	4	1050	c.943G>A	c.(943-945)GCC>ACC	p.A315T	TUBB4_uc002mff.1_Missense_Mutation_p.A243T|MIR220B_hsa-mir-220b|MI0005529_5'Flank	NM_006087	NP_006078	P04350	TBB4_HUMAN	tubulin, beta 4	315					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(2)	2		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)		CGGAACACGGCGGCCACGGTC	0.647													5	164	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8136935	8136935	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8136935G>A	uc002mjf.2	-	62	8106	c.8085C>T	c.(8083-8085)CAC>CAT	p.H2695H	FBN3_uc002mje.2_Silent_p.H491H	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	2695						proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						ATGTCACCTGGTGGTCCCTGT	0.617													193	88	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8159323	8159323	+	Intron	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8159323C>A	uc002mjf.2	-							NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						TGGGGCTGGACACTCACCAAT	0.423													16	10	---	---	---	---	PASS
OR7G2	390882	broad.mit.edu	37	19	9213755	9213755	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9213755G>T	uc010xkk.1	-	1	228	c.228C>A	c.(226-228)CTC>CTA	p.L76L		NM_001005193	NP_001005193	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G,	55	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TGGGGGTGTGGAGGTGAGAGT	0.502													65	52	---	---	---	---	PASS
OR10H1	26539	broad.mit.edu	37	19	15918646	15918646	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15918646C>T	uc002nbq.2	-	1	291	c.202G>A	c.(202-204)GTC>ATC	p.V68I		NM_013940	NP_039228	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H,	68	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATCTCGGAGACGGAGAGGGCG	0.642													174	54	---	---	---	---	PASS
KLF2	10365	broad.mit.edu	37	19	16437684	16437684	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16437684T>C	uc002ndw.2	+	3	994	c.910T>C	c.(910-912)TGC>CGC	p.C304R		NM_016270	NP_057354	Q9Y5W3	KLF2_HUMAN	Kruppel-like factor	304	C2H2-type 2.				positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GCCCTACCACTGCAACTGGGA	0.647													33	19	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22154271	22154271	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22154271C>A	uc002nqp.2	-	6	3330	c.3181G>T	c.(3181-3183)GTA>TTA	p.V1061L	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				GTATGAATTACCTTATGTTTT	0.363													53	54	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22940877	22940877	+	Missense_Mutation	SNP	G	T	T	rs74455660		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940877G>T	uc010xrh.1	-	5	1561	c.1561C>A	c.(1561-1563)CAG>AAG	p.Q521K		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TGAATTATCTGATGTTTTCTA	0.378													6	404	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30934951	30934951	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30934951C>G	uc002nsu.1	+	2	620	c.482C>G	c.(481-483)CCG>CGG	p.P161R	ZNF536_uc010edd.1_Missense_Mutation_p.P161R	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	161	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					TTCAAGTGCCCGTACTGCGAC	0.657													58	116	---	---	---	---	PASS
ZNF570	148268	broad.mit.edu	37	19	37975309	37975309	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37975309T>C	uc002ogk.1	+	5	1314	c.785T>C	c.(784-786)GTT>GCT	p.V262A	ZNF570_uc010efl.1_Missense_Mutation_p.V318A|ZNF570_uc010xtr.1_Missense_Mutation_p.V59A	NM_144694	NP_653295	Q96NI8	ZN570_HUMAN	zinc finger protein 570	262	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCAAATCTTGTTCAACATCAG	0.398													25	286	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38964024	38964024	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38964024G>T	uc002oit.2	+	28	3903	c.3773G>T	c.(3772-3774)CGA>CTA	p.R1258L	RYR1_uc002oiu.2_Missense_Mutation_p.R1258L	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	1258	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CAGGTATCCCGAGTGGACGGC	0.612													124	572	---	---	---	---	PASS
SARS2	54938	broad.mit.edu	37	19	39409109	39409109	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39409109C>T	uc002oka.2	-	9	1029	c.869G>A	c.(868-870)CGC>CAC	p.R290H	SARS2_uc002ojz.2_Missense_Mutation_p.R100H|SARS2_uc010xup.1_Missense_Mutation_p.R292H|SARS2_uc002okb.2_Missense_Mutation_p.R290H|SARS2_uc010xuq.1_Missense_Mutation_p.R290H|SARS2_uc010xur.1_RNA	NM_017827	NP_060297	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2 isoform b precursor	290					seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			ATCTTTGAAGCGGGCAGGGTC	0.597													17	397	---	---	---	---	PASS
IRGC	56269	broad.mit.edu	37	19	44223450	44223450	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44223450C>T	uc002oxh.2	+	2	887	c.740C>T	c.(739-741)TCG>TTG	p.S247L		NM_019612	NP_062558	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	247						membrane	GTP binding|hydrolase activity, acting on acid anhydrides			ovary(1)|central_nervous_system(1)|skin(1)	3		Prostate(69;0.0435)				GGCCTGCTGTCGCTCCCCGAC	0.657													28	44	---	---	---	---	PASS
ZNF283	284349	broad.mit.edu	37	19	44351978	44351978	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44351978G>T	uc002oxr.3	+	7	1493	c.1225G>T	c.(1225-1227)GGG>TGG	p.G409W	ZNF283_uc002oxp.3_Missense_Mutation_p.G270W	NM_181845	NP_862828	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	409	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				CAAGGAATGTGGGAAGGCTTT	0.373													60	174	---	---	---	---	PASS
BCL3	602	broad.mit.edu	37	19	45262824	45262824	+	Silent	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45262824A>T	uc010xxe.1	+	9	1387	c.1317A>T	c.(1315-1317)CGA>CGT	p.R439R		NM_005178	NP_005169	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	439	Pro/Ser-rich.				DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|I-kappaB kinase/NF-kappaB cascade|maintenance of protein location in nucleus|negative regulation of apoptosis|negative regulation of interleukin-8 biosynthetic process|negative regulation of transcription, DNA-dependent|positive regulation of translation|protein import into nucleus, translocation|regulation of DNA binding|regulation of NF-kappaB import into nucleus|response to UV-C|response to virus	Bcl3-Bcl10 complex|Bcl3/NF-kappaB2 complex|nucleus|perinuclear region of cytoplasm	protein binding, bridging|transcription factor binding			ovary(1)|lung(1)	2	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				GGGTCCTCCGAGGCCCTGGCC	0.697			T	IGH@	CLL 								86	262	---	---	---	---	PASS
PPP5C	5536	broad.mit.edu	37	19	46878998	46878998	+	Silent	SNP	C	T	T	rs144237776		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46878998C>T	uc002pem.2	+	3	561	c.501C>T	c.(499-501)ATC>ATT	p.I167I	PPP5C_uc010xya.1_Silent_p.I34I|PPP5C_uc002pen.2_Silent_p.I167I	NM_006247	NP_006238	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	167					mitosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein dephosphorylation|transcription, DNA-dependent	Golgi apparatus|nucleus	metal ion binding|protein binding|protein serine/threonine phosphatase activity|signal transducer activity			lung(1)|pancreas(1)	2		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		CGCTGGACATCGAGAGCATGA	0.612													4	13	---	---	---	---	PASS
CTU1	90353	broad.mit.edu	37	19	51602334	51602334	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51602334G>A	uc010eop.2	-	3	636	c.571C>T	c.(571-573)CGG>TGG	p.R191W		NM_145232	NP_660275	Q7Z7A3	CTU1_HUMAN	ATP binding domain 3	191					tRNA thio-modification|tRNA wobble uridine modification	cytosol	ATP binding|protein binding|transferase activity|tRNA binding				0						cgggccagccgccccgcgtcg	0.373													6	6	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51920156	51920156	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51920156C>T	uc002pwo.2	-	3	1086	c.470G>A	c.(469-471)GGG>GAG	p.G157E	SIGLEC10_uc002pwp.2_Intron|SIGLEC10_uc002pwq.2_Intron|SIGLEC10_uc002pwr.2_Missense_Mutation_p.G157E|SIGLEC10_uc010ycy.1_Missense_Mutation_p.G157E|SIGLEC10_uc010ycz.1_Intron|SIGLEC10_uc010eow.2_5'UTR|SIGLEC10_uc002pws.1_Intron	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	157	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		CACCGGCTGCCCGGGCTCCAG	0.612													81	151	---	---	---	---	PASS
ZNF816A	125893	broad.mit.edu	37	19	53453974	53453974	+	Silent	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53453974G>T	uc002qal.1	-	5	1355	c.1054C>A	c.(1054-1056)CGA>AGA	p.R352R	ZNF321_uc010eqj.2_Intron|ZNF321_uc002qak.1_Intron|ZNF816A_uc002qam.1_Silent_p.R336R	NM_001031665	NP_001026835	Q0VGE8	ZN816_HUMAN	zinc finger protein 816A	352	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0313)		GCTGAATTTCGACCAAAAGTC	0.423													71	410	---	---	---	---	PASS
VSTM1	284415	broad.mit.edu	37	19	54545450	54545450	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54545450C>A	uc002qcw.3	-	6	664	c.488G>T	c.(487-489)AGT>ATT	p.S163I	VSTM1_uc010erb.2_Intron|VSTM1_uc002qcx.3_Missense_Mutation_p.G132V	NM_198481	NP_940883	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	163						integral to membrane					0	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		AGATGATGAACCTACAAAAAA	0.493													99	128	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54759149	54759149	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54759149C>T	uc002qex.2	-	5	1063	c.952G>A	c.(952-954)GGA>AGA	p.G318R	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.G309R|LILRB5_uc002qey.2_Missense_Mutation_p.G318R|LILRB5_uc002qez.2_Missense_Mutation_p.G218R|LILRB5_uc002qfa.1_Missense_Mutation_p.G208R|LILRB5_uc010yes.1_RNA	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	318	Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGCTCCTCACCTGCGATCAGG	0.677													46	69	---	---	---	---	PASS
LENG8	114823	broad.mit.edu	37	19	54962569	54962569	+	Intron	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54962569G>T	uc002qfv.1	+						LENG8_uc002qfw.2_Intron			Q96PV6	LENG8_HUMAN	RecName: Full=Leukocyte receptor cluster member 8;								protein binding			central_nervous_system(1)|pancreas(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		GGTTAGTGAGGCGAGAGGGAC	0.602													10	116	---	---	---	---	PASS
KIR2DS4	3809	broad.mit.edu	37	19	55354367	55354367	+	Missense_Mutation	SNP	A	G	G	rs1130508		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55354367A>G	uc002qhm.1	+	6	755	c.709A>G	c.(709-711)AAA>GAA	p.K237E	KIR2DS4_uc010yfk.1_RNA|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_Intron|KIR2DS4_uc002qhn.1_Intron	NM_012314	NP_036446	P43632	KI2S4_HUMAN	killer cell immunoglobulin-like receptor, two	237	Extracellular (Potential).					integral to plasma membrane	receptor activity				0				GBM - Glioblastoma multiforme(193;0.0192)		ACCAAGCTCCAAAACCGGTGA	0.507													4	136	---	---	---	---	PASS
NLRP7	199713	broad.mit.edu	37	19	55452951	55452951	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55452951C>T	uc002qih.3	-	2	205	c.129G>A	c.(127-129)TGG>TGA	p.W43*	NLRP7_uc002qig.3_Nonsense_Mutation_p.W43*|NLRP7_uc002qii.3_Nonsense_Mutation_p.W43*|NLRP7_uc010esk.2_Nonsense_Mutation_p.W43*|NLRP7_uc010esl.2_Nonsense_Mutation_p.W71*	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	43	DAPIN.						ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		CCACCTCAGACCATGGGGTCT	0.473													34	185	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55494236	55494236	+	Silent	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55494236C>A	uc002qij.2	+	6	1256	c.1170C>A	c.(1168-1170)GCC>GCA	p.A390A	NLRP2_uc010yfp.1_Silent_p.A367A|NLRP2_uc010esn.2_Silent_p.A366A|NLRP2_uc010eso.2_Silent_p.A387A|NLRP2_uc010esp.2_Silent_p.A368A	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	390	NACHT.				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GCAACGCGGCCCTGTTCCAGC	0.627													41	75	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56481925	56481925	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56481925G>T	uc002qmh.2	+	6	2468	c.2397G>T	c.(2395-2397)TTG>TTT	p.L799F	NLRP8_uc010etg.2_Missense_Mutation_p.L799F	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	799						cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		AAGACTGCTTGGCCACCCCTA	0.473													73	209	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56539467	56539467	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56539467A>T	uc002qmj.2	+	7	1868	c.1868A>T	c.(1867-1869)CAG>CTG	p.Q623L	NLRP5_uc002qmi.2_Missense_Mutation_p.Q604L	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	623						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GAGCTTAAACAGGCAGGCTTC	0.547													24	74	---	---	---	---	PASS
ZIM2	23619	broad.mit.edu	37	19	57286820	57286820	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57286820G>T	uc002qnr.2	-	11	1202	c.820C>A	c.(820-822)CCC>ACC	p.P274T	uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_Missense_Mutation_p.P70T|ZIM2_uc010ygr.1_Missense_Mutation_p.P70T|ZIM2_uc002qnq.2_Missense_Mutation_p.P274T|ZIM2_uc010etp.2_Missense_Mutation_p.P274T|ZIM2_uc010ygs.1_Missense_Mutation_p.P274T	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	274					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		AGGGTCTTGGGGTCATTCATT	0.443													52	147	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57335870	57335870	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57335870G>T	uc002qnu.2	-	1	505	c.154C>A	c.(154-156)CTA>ATA	p.L52I	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_5'UTR|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.L52I|PEG3_uc002qnv.2_Missense_Mutation_p.L52I|PEG3_uc002qnw.2_Intron|PEG3_uc002qnx.2_Intron|PEG3_uc010etr.2_Missense_Mutation_p.L52I	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	52	SCAN box.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		ACATAGATTAGGTTCCGAAAC	0.488													29	101	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57335871	57335871	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57335871G>T	uc002qnu.2	-	1	504	c.153C>A	c.(151-153)AAC>AAA	p.N51K	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_5'UTR|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.N51K|PEG3_uc002qnv.2_Missense_Mutation_p.N51K|PEG3_uc002qnw.2_Intron|PEG3_uc002qnx.2_Intron|PEG3_uc010etr.2_Missense_Mutation_p.N51K	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	51	SCAN box.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CATAGATTAGGTTCCGAAACC	0.493													29	100	---	---	---	---	PASS
C20orf27	54976	broad.mit.edu	37	20	3734772	3734772	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3734772C>A	uc002wji.1	-	6	687	c.458G>T	c.(457-459)GGT>GTT	p.G153V	C20orf27_uc002wjf.1_3'UTR|C20orf27_uc002wjh.1_Missense_Mutation_p.G178V	NM_001039140	NP_001034229	Q9GZN8	CT027_HUMAN	hypothetical protein LOC54976	153											0						ACACTTGACACCATCCAGCAG	0.692													37	40	---	---	---	---	PASS
ADRA1D	146	broad.mit.edu	37	20	4229009	4229009	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4229009C>T	uc002wkr.2	-	1	651	c.596G>A	c.(595-597)CGC>CAC	p.R199H		NM_000678	NP_000669	P25100	ADA1D_HUMAN	alpha-1D-adrenergic receptor	199	Cytoplasmic (By similarity).				cell proliferation|cell-cell signaling|DNA metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|multicellular organismal development|positive regulation of cell proliferation	integral to plasma membrane	alpha1-adrenergic receptor activity				0					Alfuzosin(DB00346)|Bethanidine(DB00217)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Doxazosin(DB00590)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Methotrimeprazine(DB01403)|Norepinephrine(DB00368)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)	GAGTGAGTGGCGCACGCCCAC	0.682													29	16	---	---	---	---	PASS
SEL1L2	80343	broad.mit.edu	37	20	13830204	13830204	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13830204G>T	uc010gcf.2	-	20	2076	c.1994C>A	c.(1993-1995)CCA>CAA	p.P665Q	SEL1L2_uc002woq.3_Missense_Mutation_p.P526Q|SEL1L2_uc010zrl.1_Missense_Mutation_p.P552Q|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	665	Helical; (Potential).					integral to membrane	binding			ovary(2)	2						GTCCCAGTGTGGTCCAATGGT	0.473													76	261	---	---	---	---	PASS
SEL1L2	80343	broad.mit.edu	37	20	13830205	13830205	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13830205G>T	uc010gcf.2	-	20	2075	c.1993C>A	c.(1993-1995)CCA>ACA	p.P665T	SEL1L2_uc002woq.3_Missense_Mutation_p.P526T|SEL1L2_uc010zrl.1_Missense_Mutation_p.P552T|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	665	Helical; (Potential).					integral to membrane	binding			ovary(2)	2						TCCCAGTGTGGTCCAATGGTG	0.478													76	260	---	---	---	---	PASS
C20orf12	55184	broad.mit.edu	37	20	18370448	18370448	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18370448C>G	uc010zsa.1	-	19	2181	c.1972G>C	c.(1972-1974)GAA>CAA	p.E658Q	C20orf12_uc010zrz.1_Missense_Mutation_p.E177Q|C20orf12_uc002wqp.3_Missense_Mutation_p.E349Q|C20orf12_uc002wqr.3_RNA|C20orf12_uc002wqs.3_Missense_Mutation_p.E525Q|C20orf12_uc002wqq.3_Missense_Mutation_p.E639Q	NM_001099407	NP_001092877	Q9NVP4	CT012_HUMAN	hypothetical protein LOC55184	466						intracellular	zinc ion binding			ovary(1)	1		Myeloproliferative disorder(85;0.0122)				CGATTGTCTTCATCACAGCAG	0.517													122	252	---	---	---	---	PASS
GGTLC1	92086	broad.mit.edu	37	20	23966534	23966534	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23966534C>T	uc002wts.2	-	4	515	c.382G>A	c.(382-384)GCC>ACC	p.A128T	GGTLC1_uc002wtu.2_Missense_Mutation_p.A128T	NM_178312	NP_842564	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	128							gamma-glutamyltransferase activity			ovary(1)	1						GTGCCCCCGGCAGCTCCCACC	0.647													165	362	---	---	---	---	PASS
DUSP15	128853	broad.mit.edu	37	20	30451699	30451699	+	Intron	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30451699G>A	uc002wwu.1	-						DUSP15_uc002wwv.1_Intron|DUSP15_uc002www.1_Intron|DUSP15_uc002wwx.1_Intron			Q9H1R2	DUS15_HUMAN	RecName: Full=Dual specificity protein phosphatase 15;          EC=3.1.3.48;          EC=3.1.3.16; AltName: Full=Vaccinia virus VH1-related dual-specific protein phosphatase Y; AltName: Full=VH1-related member Y;							cytoplasm|plasma membrane	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			ATCCCCCTCCGCTTAACTCAC	0.542													107	108	---	---	---	---	PASS
ASXL1	171023	broad.mit.edu	37	20	31021590	31021590	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31021590C>A	uc002wxs.2	+	11	2015	c.1589C>A	c.(1588-1590)GCG>GAG	p.A530E	ASXL1_uc010geb.2_Missense_Mutation_p.A421E	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	530					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						TTTGAGCAGGCGGCCTCTGCA	0.517			F|N|Mis		MDS|CMML								5	754	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33577935	33577935	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33577935C>T	uc002xbi.1	+	19	2104	c.2012C>T	c.(2011-2013)GCG>GTG	p.A671V	MIR499_hsa-mir-499|MI0003183_5'Flank	NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	629	Myosin head-like.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GAGAATTATGCGGGCTCCTGC	0.547													6	435	---	---	---	---	PASS
SYS1-DBNDD2	767557	broad.mit.edu	37	20	44037164	44037164	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44037164G>A	uc002xnx.2	+	4	553	c.57G>A	c.(55-57)CGG>CGA	p.R19R	DBNDD2_uc002xnz.2_Silent_p.R19R|DBNDD2_uc002xoa.2_Silent_p.R19R|DBNDD2_uc002xob.2_Silent_p.R19R|DBNDD2_uc002xoc.2_Silent_p.R19R|DBNDD2_uc002xod.2_Silent_p.R19R|DBNDD2_uc002xoe.2_Silent_p.R19R|DBNDD2_uc002xof.2_Silent_p.R19R|DBNDD2_uc002xog.2_Silent_p.R19R	NM_001048225	NP_001041690			SCF apoptosis response protein 1 isoform a												0						TTCGGGAGCGGCAAAAATTCT	0.552													5	293	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47364384	47364384	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47364384C>T	uc002xtw.1	-	2	276	c.253G>A	c.(253-255)GAC>AAC	p.D85N		NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	85	DH.				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TCCACTGAGTCGGCCACGTTC	0.597													35	48	---	---	---	---	PASS
KCNQ2	3785	broad.mit.edu	37	20	62076081	62076081	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62076081C>T	uc002yey.1	-	4	798	c.621G>A	c.(619-621)CGG>CGA	p.R207R	KCNQ2_uc002yez.1_Silent_p.R207R|KCNQ2_uc002yfa.1_Silent_p.R207R|KCNQ2_uc002yfb.1_Silent_p.R207R|KCNQ2_uc011aax.1_Silent_p.R207R|KCNQ2_uc002yfc.1_Silent_p.R207R	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein	207	Helical; Voltage-sensor; Name=Segment S4; (Potential).		R -> W (in EBN1; phenotype manifestations include myokymia in some patients; leads to a shift of voltage-dependent activation of the channel and a dramatic slowing of activation upon depolarization).|R -> Q (in a patient with isolated myokymia and no history of neonatal seizures; leads to a shift of voltage- dependent activation).		axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	TGCGGATCATCCGCAGAATCT	0.667													18	14	---	---	---	---	PASS
NPBWR2	2832	broad.mit.edu	37	20	62737384	62737384	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62737384G>A	uc011abt.1	-	1	801	c.801C>T	c.(799-801)GCC>GCT	p.A267A		NM_005286	NP_005277	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	267	Helical; Name=6; (Potential).					plasma membrane	opioid receptor activity|protein binding			large_intestine(1)	1	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					GGAGGCACACGGCCAGCACGA	0.677													19	98	---	---	---	---	PASS
ADAMTS5	11096	broad.mit.edu	37	21	28338580	28338580	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28338580C>T	uc002ymg.2	-	1	860	c.131G>A	c.(130-132)CGC>CAC	p.R44H		NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1	44					proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						CTGCCGCCGGCGGGGCTGGGC	0.766													5	2	---	---	---	---	PASS
SYNJ1	8867	broad.mit.edu	37	21	34051029	34051029	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34051029A>C	uc002yqh.2	-	12	1553	c.1553T>G	c.(1552-1554)TTG>TGG	p.L518W	SYNJ1_uc011ads.1_Missense_Mutation_p.L482W|SYNJ1_uc002yqf.2_Missense_Mutation_p.L479W|SYNJ1_uc002yqg.2_Missense_Mutation_p.L482W|SYNJ1_uc002yqi.2_Missense_Mutation_p.L518W	NM_003895	NP_003886	O43426	SYNJ1_HUMAN	synaptojanin 1 isoform a	479							inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			ovary(4)|skin(1)	5						TCCCAGTAGCAAAACATCAAT	0.393													84	32	---	---	---	---	PASS
HSF2BP	11077	broad.mit.edu	37	21	44949625	44949625	+	3'UTR	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44949625C>T	uc002zdi.2	-	9					HSF2BP_uc011aey.1_3'UTR	NM_007031	NP_008962	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding						spermatogenesis|transcription from RNA polymerase II promoter	cytosol	binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.18)		CCCTGGTGGCCGAGCACACCT	0.547													18	43	---	---	---	---	PASS
TRPM2	7226	broad.mit.edu	37	21	45795900	45795900	+	Intron	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45795900G>T	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						AGAGGAGGTAGGGGAGCTTGC	0.597													64	36	---	---	---	---	PASS
FTCD	10841	broad.mit.edu	37	21	47565322	47565322	+	Intron	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47565322G>T	uc002zif.2	-						FTCD_uc002zie.2_5'Flank|FTCD_uc002zig.2_Intron|FTCD_uc002zih.2_Intron|FTCD_uc010gqf.2_Intron|FTCD_uc010gqg.1_Intron	NM_006657	NP_006648	O95954	FTCD_HUMAN	formiminotransferase cyclodeaminase						folic acid-containing compound metabolic process|histidine catabolic process	centriole|cytosol|Golgi apparatus	folic acid binding|formimidoyltetrahydrofolate cyclodeaminase activity|glutamate formimidoyltransferase activity			pancreas(1)|skin(1)	2	Breast(49;0.214)			Colorectal(79;0.235)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)	TGCTGTGGCCGCCACTCACCA	0.721													5	2	---	---	---	---	PASS
CLTCL1	8218	broad.mit.edu	37	22	19222104	19222104	+	Silent	SNP	C	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19222104C>G	uc002zpb.2	-	7	1170	c.1095G>C	c.(1093-1095)GTG>GTC	p.V365V	CLTCL1_uc011agv.1_Silent_p.V365V|CLTCL1_uc011agw.1_Silent_p.V365V	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1 isoform 1	365	Globular terminal domain.				anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)					TGAATTTTCTCACAAACAACT	0.468			T	?	ALCL								13	134	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23101436	23101436	+	RNA	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23101436T>A	uc011aim.1	+	210		c.10865T>A								Parts of antibodies, mostly variable regions.												0						CCTCCGTGTCTGGGTCTCCTG	0.587													192	358	---	---	---	---	PASS
ASPHD2	57168	broad.mit.edu	37	22	26830243	26830243	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26830243A>T	uc003acg.2	+	2	1059	c.662A>T	c.(661-663)AAC>ATC	p.N221I		NM_020437	NP_065170	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	221	Lumenal (Potential).				peptidyl-amino acid modification	integral to endoplasmic reticulum membrane	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity			ovary(1)	1						TGGAAAATGAACAGCACCCCC	0.537													104	449	---	---	---	---	PASS
HPS4	89781	broad.mit.edu	37	22	26866751	26866751	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26866751G>A	uc003acl.2	-	7	1189	c.530C>T	c.(529-531)GCC>GTC	p.A177V	HPS4_uc003aci.2_Missense_Mutation_p.A172V|HPS4_uc003acj.2_Missense_Mutation_p.A23V|HPS4_uc003ack.2_5'UTR|HPS4_uc003acn.2_Missense_Mutation_p.A23V|HPS4_uc010gvd.1_Missense_Mutation_p.A177V|HPS4_uc003ach.2_5'UTR	NM_022081	NP_071364	Q9NQG7	HPS4_HUMAN	light ear protein isoform a	177					lysosome organization|positive regulation of eye pigmentation|protein stabilization|protein targeting	lysosome|melanosome|membrane fraction|platelet dense granule	protein homodimerization activity				0						CAGAATGCGGGCTGCCTTCAG	0.572									Hermansky-Pudlak_syndrome				5	234	---	---	---	---	PASS
MN1	4330	broad.mit.edu	37	22	28194126	28194126	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28194126C>A	uc003adj.2	-	1	3361	c.2406G>T	c.(2404-2406)TTG>TTT	p.L802F		NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1	802							binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						AGAGCGCGCCCAATTTACTGG	0.682			T	ETV6	AML|meningioma								36	69	---	---	---	---	PASS
EMID1	129080	broad.mit.edu	37	22	29639453	29639453	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29639453G>A	uc003aen.2	+	13	1163	c.1088G>A	c.(1087-1089)GGA>GAA	p.G363E	EMID1_uc003aem.2_Missense_Mutation_p.G365E|EMID1_uc003aeo.2_Missense_Mutation_p.G365E|EMID1_uc003aep.2_Missense_Mutation_p.G344E	NM_133455	NP_597712	Q96A84	EMID1_HUMAN	EMI domain containing 1	363	Collagen-like.					collagen					0						GGCCCTAAGGGAGACCCTGGT	0.388													8	93	---	---	---	---	PASS
PES1	23481	broad.mit.edu	37	22	30975732	30975732	+	Intron	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30975732G>A	uc003aij.1	-						PES1_uc003aik.1_Intron|PES1_uc003ail.1_Intron|PES1_uc003aim.1_Intron|PES1_uc003ain.1_Intron|PES1_uc003aio.1_Intron	NM_014303	NP_055118	O00541	PESC_HUMAN	pescadillo homolog 1, containing BRCT domain						cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	chromosome|nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						GTCCCATCCCGCTCACCTGGG	0.602													10	699	---	---	---	---	PASS
MCM5	4174	broad.mit.edu	37	22	35799327	35799327	+	Splice_Site	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35799327G>T	uc003anu.3	+	3	388	c.294_splice	c.e3+1	p.L98_splice	MCM5_uc010gwr.2_Splice_Site|MCM5_uc003anv.3_Splice_Site_p.L98_splice	NM_006739	NP_006730	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)	1						CCTGCAGCTGGTGAGTGGGAC	0.597													54	119	---	---	---	---	PASS
MIOX	55586	broad.mit.edu	37	22	50926092	50926092	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50926092C>T	uc003bll.1	+	3	212	c.98C>T	c.(97-99)TCA>TTA	p.S33L	MIOX_uc003blm.1_Missense_Mutation_p.S33L|MIOX_uc003bln.1_Missense_Mutation_p.S33L	NM_017584	NP_060054	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	33					inositol catabolic process	cytoplasm|inclusion body	aldo-keto reductase (NADP) activity|ferric iron binding|inositol oxygenase activity				0		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGCCTGCAGTCAGGTCCCCTC	0.667													39	102	---	---	---	---	PASS
ARSE	415	broad.mit.edu	37	X	2864051	2864051	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2864051C>T	uc004crc.3	-	7	1229	c.979G>A	c.(979-981)GAC>AAC	p.D327N	ARSE_uc011mhi.1_Missense_Mutation_p.D273N|ARSE_uc011mhh.1_Missense_Mutation_p.D352N	NM_000047	NP_000038	P51690	ARSE_HUMAN	arylsulfatase E precursor	327					skeletal system development	Golgi stack	arylsulfatase activity|metal ion binding			ovary(1)|central_nervous_system(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACCATCCAGTCCATCTCCTCT	0.473													35	67	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53574823	53574823	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53574823T>C	uc004dsp.2	-	68	10849	c.10447A>G	c.(10447-10449)ACC>GCC	p.T3483A	HUWE1_uc004dsn.2_Missense_Mutation_p.T2291A	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	3483	Thr-rich.				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						gcagtggtggtggAGGAAGCA	0.383													13	0	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65480022	65480022	+	Silent	SNP	T	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65480022T>C	uc011moz.1	+	19	3186	c.3126T>C	c.(3124-3126)CCT>CCC	p.P1042P	HEPH_uc004dwn.2_Silent_p.P1042P|HEPH_uc004dwo.2_Silent_p.P772P|HEPH_uc010nkr.2_Silent_p.P850P|HEPH_uc011mpa.1_Silent_p.P1042P	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	1039	Extracellular (Potential).|Plastocyanin-like 6.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						CCAGCAACCCTGGGACATGGC	0.527													43	14	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73062730	73062730	+	RNA	SNP	A	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73062730A>G	uc004ebm.1	-	1		c.9859T>C				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						ATAGTCTGTAAAAAGGGGCCA	0.493													122	15	---	---	---	---	PASS
P2RY10	27334	broad.mit.edu	37	X	78216990	78216990	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78216990C>A	uc004ede.2	+	4	1342	c.973C>A	c.(973-975)CGC>AGC	p.R325S	P2RY10_uc004edf.2_Missense_Mutation_p.R325S	NM_014499	NP_055314	O00398	P2Y10_HUMAN	G-protein coupled purinergic receptor P2Y10	325	Cytoplasmic (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(2)|breast(1)	5						TTCTGTGACCCGCTCCCGCCT	0.438													266	36	---	---	---	---	PASS
PAK3	5063	broad.mit.edu	37	X	110435802	110435802	+	Silent	SNP	C	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110435802C>T	uc004epa.2	+	10	1020	c.993C>T	c.(991-993)GTC>GTT	p.V331V	PAK3_uc010npt.1_Silent_p.V316V|PAK3_uc010npu.1_Silent_p.V316V|PAK3_uc004eoy.1_Silent_p.V71V|PAK3_uc004eoz.2_Silent_p.V316V|PAK3_uc011mst.1_RNA|PAK3_uc010npv.1_Silent_p.V352V|PAK3_uc010npw.1_Silent_p.V337V	NM_001128173	NP_001121645	O75914	PAK3_HUMAN	p21-activated kinase 3 isoform d	331	Protein kinase.				multicellular organismal development		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding			lung(6)|ovary(3)|large_intestine(1)	10						AAATTCTGGTCATGAGGGAAA	0.299										TSP Lung(19;0.15)			17	73	---	---	---	---	PASS
KIAA1210	57481	broad.mit.edu	37	X	118230556	118230556	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118230556G>T	uc004era.3	-	8	1167	c.1167C>A	c.(1165-1167)TTC>TTA	p.F389L		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	389								p.G389D(1)		ovary(4)|skin(1)	5						CTGGGGTGCTGAAACCAATGG	0.498													57	7	---	---	---	---	PASS
ATP11C	286410	broad.mit.edu	37	X	138857060	138857060	+	Nonsense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138857060T>A	uc004faz.2	-	19	2113	c.2014A>T	c.(2014-2016)AAA>TAA	p.K672*	ATP11C_uc004fay.2_RNA|ATP11C_uc004fba.2_Nonsense_Mutation_p.K672*	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	672	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					ACCCAGACTTTCAGGCCTGCT	0.488													26	125	---	---	---	---	PASS
CXorf66	347487	broad.mit.edu	37	X	139038093	139038093	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139038093A>T	uc004fbb.2	-	3	1070	c.1048T>A	c.(1048-1050)TAC>AAC	p.Y350N		NM_001013403	NP_001013421	Q5JRM2	CX066_HUMAN	hypothetical protein LOC347487 precursor	350	Cytoplasmic (Potential).					integral to membrane					0						ACTTGATTGTACCCTCTGTCA	0.353													90	26	---	---	---	---	PASS
SPANXN1	494118	broad.mit.edu	37	X	144329181	144329181	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144329181G>T	uc004fcb.2	+	1	75	c.75G>T	c.(73-75)GAG>GAT	p.E25D		NM_001009614	NP_001009614	Q5VSR9	SPXN1_HUMAN	SPANX-N1 protein	25											0	Acute lymphoblastic leukemia(192;6.56e-05)					AAAATGATGAGGTAAGATtgt	0.234													179	53	---	---	---	---	PASS
MAGEA4	4103	broad.mit.edu	37	X	151092185	151092185	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151092185G>C	uc004fez.2	+	3	205	c.49G>C	c.(49-51)GAG>CAG	p.E17Q	MAGEA4_uc004ffa.2_Missense_Mutation_p.E17Q|MAGEA4_uc004ffb.2_Missense_Mutation_p.E17Q|MAGEA4_uc004ffc.2_Missense_Mutation_p.E17Q|MAGEA4_uc004ffd.2_Missense_Mutation_p.E17Q	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	17							protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GGAAGGCGTTGAGGCCCAAGA	0.602													13	112	---	---	---	---	PASS
MAGEA6	4105	broad.mit.edu	37	X	151870230	151870230	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151870230G>C	uc004ffq.1	+	3	1114	c.920G>C	c.(919-921)TGG>TCG	p.W307S	MAGEA6_uc004ffr.1_Missense_Mutation_p.W307S|MAGEA2_uc010nto.2_Intron	NM_005363	NP_005354	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	307	MAGE.						protein binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					CTGCATGAGTGGGCTTTGAGA	0.577													249	44	---	---	---	---	PASS
ATP2B3	492	broad.mit.edu	37	X	152818709	152818709	+	Silent	SNP	G	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152818709G>A	uc004fht.1	+	11	2166	c.2040G>A	c.(2038-2040)GAG>GAA	p.E680E	ATP2B3_uc004fhs.1_Silent_p.E680E	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	680	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGGCATTGAGGACCCTGTGC	0.642													13	126	---	---	---	---	PASS
PCDH11Y	83259	broad.mit.edu	37	Y	4967120	4967120	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:4967120T>A	uc004fqo.2	+	2	2235	c.1501T>A	c.(1501-1503)TCT>ACT	p.S501T	PCDH11Y_uc010nwg.1_Missense_Mutation_p.S490T|PCDH11Y_uc004fql.1_Missense_Mutation_p.S490T|PCDH11Y_uc004fqm.1_Missense_Mutation_p.S490T|PCDH11Y_uc004fqn.1_Missense_Mutation_p.S501T|PCDH11Y_uc004fqp.1_Missense_Mutation_p.S272T	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	501	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						TTTCACCCAGTCTTTCGTAAC	0.433													51	23	---	---	---	---	PASS
PDPN	10630	broad.mit.edu	37	1	13910742	13910744	+	Intron	DEL	GGA	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13910742_13910744delGGA	uc001avd.2	+						PDPN_uc001avc.2_Intron|PDPN_uc009vob.2_5'Flank|PDPN_uc009voc.2_5'Flank|PDPN_uc001ave.2_5'Flank|PDPN_uc001avf.2_5'Flank	NM_006474	NP_006465	Q86YL7	PDPN_HUMAN	lung type-I cell membrane-associated						cell morphogenesis|lymphangiogenesis|regulation of cell shape	filopodium membrane|integral to plasma membrane|lamellipodium membrane|microvillus membrane|ruffle membrane				ovary(2)	2	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		GCTGAGCGCCGGAGGAGGAGAGG	0.690													5	3	---	---	---	---	
KLHDC7A	127707	broad.mit.edu	37	1	18805165	18805180	+	5'Flank	DEL	AGGCAGGCAGGCAGGC	-	-	rs11269542	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18805165_18805180delAGGCAGGCAGGCAGGC	uc001bax.2	+						KLHDC7A_uc009vpg.2_5'Flank	NM_152375	NP_689588	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A							integral to membrane				ovary(2)|upper_aerodigestive_tract(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		gaaggaaggaaggcaggcaggcaggcaggcaggcag	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	22569991	22569998	+	IGR	DEL	GGCAGGCC	-	-	rs71958787		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22569991_22569998delGGCAGGCC								WNT4 (99606 upstream) : ZBTB40 (208346 downstream)																							caggcaggcaggcaggccggcaggcaAA	0.288													6	4	---	---	---	---	
ASAP3	55616	broad.mit.edu	37	1	23758498	23758499	+	Intron	INS	-	A	A	rs143586833		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23758498_23758499insA	uc001bha.2	-						ASAP3_uc001bgy.1_Intron|ASAP3_uc001bgz.1_Intron|ASAP3_uc010odz.1_Intron|ASAP3_uc010oea.1_Intron|ASAP3_uc001bhb.2_Intron	NM_017707	NP_060177	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	cytoplasm	ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						GCCTCTAGGAtttttttttttt	0.213													11	5	---	---	---	---	
HIVEP3	59269	broad.mit.edu	37	1	42011235	42011237	+	Intron	DEL	CAC	-	-	rs150183501		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42011235_42011237delCAC	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001cgy.2_Intron	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				tcactaccatcaccaccaccacc	0.000													4	2	---	---	---	---	
DOCK7	85440	broad.mit.edu	37	1	63018372	63018372	+	Intron	DEL	C	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63018372delC	uc001daq.2	-						DOCK7_uc001dan.2_Intron|DOCK7_uc001dao.2_Intron|DOCK7_uc001dap.2_Intron|DOCK7_uc001dam.2_Intron	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7						activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						AAAACAAAAACCAAATTTACA	0.358													54	49	---	---	---	---	
FUBP1	8880	broad.mit.edu	37	1	78444764	78444765	+	5'UTR	INS	-	GGCCG	GGCCG	rs140681455	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78444764_78444765insGGCCG	uc001dii.2	-	1					FUBP1_uc001dih.3_RNA|FUBP1_uc010orm.1_5'UTR|DNAJB4_uc010orn.1_5'Flank	NM_003902	NP_003893	Q96AE4	FUBP1_HUMAN	far upstream element-binding protein						transcription from RNA polymerase II promoter	nucleus	protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			central_nervous_system(2)|lung(1)	3						AAGAAAATGGCGGCCGTCGAAG	0.525													9	4	---	---	---	---	
MCOLN2	255231	broad.mit.edu	37	1	85417779	85417779	+	Intron	DEL	G	-	-	rs679961	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85417779delG	uc001dkm.2	-						MCOLN2_uc001dkn.2_Intron	NM_153259	NP_694991	Q8IZK6	MCLN2_HUMAN	mucolipin 2							integral to membrane	ion channel activity			ovary(3)|upper_aerodigestive_tract(1)	4				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		tagaaaaaaagaaaaGAGTAT	0.159													4	2	---	---	---	---	
NBPF16	728936	broad.mit.edu	37	1	148756337	148756337	+	Intron	DEL	T	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148756337delT	uc010pba.1	+						NBPF16_uc009wkt.1_Intron	NM_001102663	NP_001096133			hypothetical protein LOC728936												0	all_hematologic(923;0.032)					GAATCTATCCTTTTTCTTTTC	0.318													3	3	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154728394	154728396	+	Intron	DEL	AGA	-	-	rs149878824	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154728394_154728396delAGA	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			gaagaagaagagaagaagaagag	0.000													4	2	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240255569	240255571	+	In_Frame_Del	DEL	GGC	-	-	rs35817759		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240255569_240255571delGGC	uc010pyd.1	+	1	385_387	c.160_162delGGC	c.(160-162)GGCdel	p.G59del	FMN2_uc010pye.1_In_Frame_Del_p.G59del	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	59					actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGGGGAgggggcggcggcggcg	0.557													6	5	---	---	---	---	
OR2L13	284521	broad.mit.edu	37	1	248223848	248223849	+	Intron	DEL	TA	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248223848_248223849delTA	uc001ids.2	+						OR2L3_uc001idx.1_5'Flank	NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			aataatagtgtatatagggctc	0.035													17	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2910679	2910679	+	Intron	DEL	C	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2910679delC	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																		accccctcttcccagcccaca	0.080													6	3	---	---	---	---	
THUMPD2	80745	broad.mit.edu	37	2	39982898	39982899	+	Intron	INS	-	AGTAT	AGTAT	rs10688564		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39982898_39982899insAGTAT	uc002rru.2	-						THUMPD2_uc002rrv.2_Intron|THUMPD2_uc010ynt.1_Intron	NM_025264	NP_079540	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2								methyltransferase activity			skin(1)	1		all_hematologic(82;0.248)				CATCTATTTTGAGTAAATAATA	0.238													4	5	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87954896	87954896	+	Intron	DEL	A	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87954896delA	uc002srs.3	+									Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						AAGTAAACTGAAAAAAAAAAA	0.458													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	162363350	162363350	+	IGR	DEL	C	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162363350delC								TBR1 (81777 upstream) : SLC4A10 (117495 downstream)																							AGCAGCAATTCCGACGATCAT	0.403													220	101	---	---	---	---	
GOLGA4	2803	broad.mit.edu	37	3	37293117	37293117	+	Intron	DEL	T	-	-	rs112817114		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37293117delT	uc003cgv.2	+						GOLGA4_uc010hgr.1_Intron|GOLGA4_uc003cgw.2_Intron|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgu.1_Intron	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4						Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						ACAATTGGTCTTTTTTTTTTT	0.184													4	2	---	---	---	---	
ST3GAL6	10402	broad.mit.edu	37	3	98492656	98492656	+	Intron	DEL	G	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98492656delG	uc003dsz.2	+						ST3GAL6_uc003dsy.2_Intron|ST3GAL6_uc003dta.2_Intron|ST3GAL6_uc003dtb.2_Intron|ST3GAL6_uc003dtc.2_Intron|ST3GAL6_uc010hpd.2_Intron	NM_006100	NP_006091	Q9Y274	SIA10_HUMAN	alpha2,3-sialyltransferase VI						amino sugar metabolic process|glycolipid metabolic process|protein glycosylation|protein lipoylation	integral to Golgi membrane	sialyltransferase activity			ovary(1)	1						AAATCAATGTGGCCATGCTGG	0.373													15	18	---	---	---	---	
ZNF148	7707	broad.mit.edu	37	3	125096683	125096690	+	5'Flank	DEL	TGTGTGTG	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125096683_125096690delTGTGTGTG	uc003ehx.3	-						ZNF148_uc003ehz.3_5'Flank|ZNF148_uc010hsa.2_5'Flank|ZNF148_uc003eia.3_5'Flank|ZNF148_uc003ehy.2_5'Flank	NM_021964	NP_068799	Q9UQR1	ZN148_HUMAN	zinc finger protein 148						cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4						tgttctgttttgtgtgtgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	142895155	142895155	+	IGR	DEL	C	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142895155delC								CHST2 (53345 upstream) : SLC9A9 (88910 downstream)																							GGCCTCAGGGCCCCCCCCCAG	0.746													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	168563890	168563891	+	IGR	INS	-	TCC	TCC			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168563890_168563891insTCC								C3orf50 (15518 upstream) : MECOM (237396 downstream)																							ccttctcctctttcttctcttc	0.000													4	2	---	---	---	---	
PHC3	80012	broad.mit.edu	37	3	169881250	169881255	+	Intron	DEL	GTGTGT	-	-	rs147045637		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169881250_169881255delGTGTGT	uc010hws.1	-						PHC3_uc003fgl.2_Intron|PHC3_uc011bpq.1_Intron|PHC3_uc011bpr.1_Intron|PHC3_uc003fgm.2_Intron|PHC3_uc003fgo.1_Intron	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			TTAGTAAAGAgtgtgtgtgtgtgtgt	0.257													3	3	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173919136	173919137	+	Intron	INS	-	GAAG	GAAG	rs141892977		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173919136_173919137insGAAG	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			gtgggaggaatgaaggaaggaa	0.089													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3619299	3619300	+	IGR	INS	-	CCTT	CCTT	rs144281803	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3619299_3619300insCCTT								LRPAP1 (85075 upstream) : ADRA2C (148775 downstream)																							tccttcccctcccttcttccct	0.000													4	3	---	---	---	---	
CSN1S1	1446	broad.mit.edu	37	4	70805075	70805075	+	Intron	DEL	C	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70805075delC	uc003hep.1	+						CSN1S1_uc003heq.1_Intron|CSN1S1_uc003her.1_Intron	NM_001890	NP_001881	P47710	CASA1_HUMAN	casein alpha s1 isoform 1							extracellular region	protein binding|transporter activity				0						GAGTAGCTATCCAAAAGAAGT	0.348													4	11	---	---	---	---	
ADAMTS3	9508	broad.mit.edu	37	4	73316639	73316640	+	Intron	INS	-	GGAA	GGAA	rs149707445	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73316639_73316640insGGAA	uc003hgk.1	-							NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAGGAGAGCAGggaaggaagga	0.228													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	78905956	78905957	+	IGR	INS	-	GG	GG	rs142472246	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78905956_78905957insGG								MRPL1 (32012 upstream) : FRAS1 (72767 downstream)																							gcagaggcagaggcagaggggc	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	87835555	87835556	+	IGR	INS	-	CC	CC			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87835555_87835556insCC								C4orf36 (21980 upstream) : AFF1 (20607 downstream)																							tttttttttttttttttttttt	0.238													4	2	---	---	---	---	
ANK2	287	broad.mit.edu	37	4	114274006	114274007	+	Intron	INS	-	T	T	rs34053670	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114274006_114274007insT	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_5'Flank|ANK2_uc011cgb.1_Intron	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTTTTCAGTTGTTTTTTTTTTC	0.431													4	2	---	---	---	---	
FABP2	2169	broad.mit.edu	37	4	120243417	120243418	+	5'Flank	INS	-	TC	TC	rs144572173	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120243417_120243418insTC	uc003icw.2	-							NM_000134	NP_000125	P12104	FABPI_HUMAN	intestinal fatty acid binding protein 2								fatty acid binding			ovary(1)	1						TTAATTCTTATTAATTAATTCT	0.282													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	154051038	154051038	+	IGR	DEL	A	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154051038delA								FHDC1 (150190 upstream) : TRIM2 (23232 downstream)																							caccacccccaccaccaccat	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6364763	6364772	+	IGR	DEL	ACACACACAC	-	-	rs140860734		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6364763_6364772delACACACACAC								FLJ33360 (27358 upstream) : MED10 (7268 downstream)																							CTGGATGACTacacacacacacacacacac	0.352													6	4	---	---	---	---	
NSUN2	54888	broad.mit.edu	37	5	6623158	6623158	+	Intron	DEL	A	-	-	rs111573762		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6623158delA	uc003jdu.2	-						NSUN2_uc003jdt.2_5'Flank|NSUN2_uc011cmk.1_Intron|NSUN2_uc003jdv.2_Intron	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2							cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						GACaaaaaagaaaaaaaaaaa	0.259													6	4	---	---	---	---	
FAM151B	167555	broad.mit.edu	37	5	79797285	79797286	+	Intron	DEL	AA	-	-	rs34586243		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79797285_79797286delAA	uc003kgv.1	+						FAM151B_uc010jal.1_Intron	NM_205548	NP_991111	Q6UXP7	F151B_HUMAN	hypothetical protein LOC167555												0		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)		TCTCAAATTGAAAAAAAAAAAA	0.183													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172178243	172178244	+	IGR	INS	-	AAGG	AAGG	rs28532090		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172178243_172178244insAAGG								NEURL1B (59712 upstream) : DUSP1 (16858 downstream)																							agaaggaaagaaaggaaggaag	0.099													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8828313	8828314	+	IGR	INS	-	GTG	GTG	rs148388272	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8828313_8828314insGTG								HULC (174236 upstream) : None (None downstream)																							tggaggcaattgtggtggtgat	0.079													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	25417758	25417759	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs55791612		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25417758_25417759insTTCCTTCC								NPVF (149653 upstream) : MIR148A (571780 downstream)																							ttggcccttctttccttccttc	0.000													6	5	---	---	---	---	
CRCP	27297	broad.mit.edu	37	7	65599533	65599533	+	Intron	DEL	T	-	-	rs146459004		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65599533delT	uc003tus.2	+						CRCP_uc003tuv.2_Intron|CRCP_uc011kdw.1_Intron|CRCP_uc003tut.2_Intron|CRCP_uc003tuu.2_Intron	NM_014478	NP_055293	O75575	RPC9_HUMAN	calcitonin gene-related peptide-receptor						acrosome reaction|innate immune response|response to virus|transcription from RNA polymerase III promoter	DNA polymerase III complex|nucleus|plasma membrane	calcitonin receptor activity|DNA-directed RNA polymerase activity|nucleotide binding				0						GGAACAAATCttttttttttt	0.299													4	3	---	---	---	---	
ACN9	57001	broad.mit.edu	37	7	96764950	96764951	+	Intron	DEL	GT	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96764950_96764951delGT	uc003uoo.3	+							NM_020186	NP_064571	Q9NRP4	ACN9_HUMAN	ACN9 homolog precursor						regulation of gluconeogenesis	mitochondrial intermembrane space					0	all_cancers(62;2.54e-08)|all_epithelial(64;2.24e-08)|Esophageal squamous(72;0.00507)|all_lung(186;0.154)|Lung NSC(181;0.159)					atgtgcgtgcgtgtgtgtgtgt	0.079													3	3	---	---	---	---	
LAMB1	3912	broad.mit.edu	37	7	107603171	107603171	+	Intron	DEL	G	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107603171delG	uc003vew.2	-						LAMB1_uc003vev.2_Intron|LAMB1_uc003vex.2_Intron	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor						axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	aaaaaaaaaagaaagaaagaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141036958	141036959	+	IGR	INS	-	CACTAC	CACTAC	rs62638832		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141036958_141036959insCACTAC								MRPS33 (322177 upstream) : AGK (214119 downstream)																							accaccaccatcaccaccacca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	1746187	1746188	+	IGR	INS	-	GTGT	GTGT	rs67050836		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1746187_1746188insGTGT								CLN8 (11452 upstream) : MIR596 (19209 downstream)																							tggaaCCCCGGgtgtgcgtgtg	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	47511973	47511976	+	IGR	DEL	CTCT	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47511973_47511976delCTCT								None (None upstream) : BEYLA (240532 downstream)																							TTCTGGATTGCTCTCTAAGAGATT	0.284													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	112230680	112230680	+	IGR	DEL	T	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:112230680delT								None (None upstream) : None (None downstream)																							TTCCTTTCCCttttttttttt	0.025													8	4	---	---	---	---	
PLEC	5339	broad.mit.edu	37	8	145026375	145026378	+	5'Flank	DEL	CACG	-	-	rs71318634		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145026375_145026378delCACG	uc003zaf.1	-						PLEC_uc003zag.1_Intron|PLEC_uc003zah.2_Intron|PLEC_uc003zaj.2_Intron	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1						cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						cacacacacacacgcgcgcacaca	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	19383919	19383920	+	IGR	INS	-	TG	TG			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19383919_19383920insTG								RPS6 (3684 upstream) : ACER2 (13887 downstream)																							AAAAAAAGATTtgtgtgtgtgt	0.233													3	3	---	---	---	---	
PLAA	9373	broad.mit.edu	37	9	26908166	26908166	+	Intron	DEL	T	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26908166delT	uc003zqd.2	-						PLAA_uc003zqe.2_Intron	NM_001031689	NP_001026859	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein						phospholipid metabolic process|signal transduction		phospholipase A2 activator activity				0		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		GAGCtttgtcttttttttttt	0.169													7	4	---	---	---	---	
LOC100129066	100129066	broad.mit.edu	37	9	92322520	92322521	+	Intron	INS	-	C	C	rs35300763		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92322520_92322521insC	uc004aqs.2	+							NR_024280				Homo sapiens cDNA FLJ42342 fis, clone UTERU2000794.												0						ttccttcccttccttccttcct	0.079													3	6	---	---	---	---	
FAM129B	64855	broad.mit.edu	37	9	130293770	130293770	+	Intron	DEL	A	-	-	rs5900751		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130293770delA	uc004brh.2	-						FAM129B_uc004bri.2_Intron|FAM129B_uc004brj.3_Intron	NM_022833	NP_073744	Q96TA1	NIBL1_HUMAN	hypothetical protein LOC64855 isoform 1								protein binding				0						ctcaaaaaagaaaaaaataat	0.000													0	6	---	---	---	---	
VAV2	7410	broad.mit.edu	37	9	136657133	136657134	+	Intron	INS	-	CA	CA			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136657133_136657134insCA	uc004ces.2	-						VAV2_uc004cer.2_Intron|VAV2_uc004cet.1_5'Flank	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		GTGTGTGAATGAGCTGTGCTGG	0.351													3	6	---	---	---	---	
GPSM1	26086	broad.mit.edu	37	9	139235823	139235824	+	Intron	INS	-	GGGCT	GGGCT	rs150586482	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139235823_139235824insGGGCT	uc004chd.2	+						GPSM1_uc004chc.2_3'UTR	NM_001145638	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1 (AGS3-like, C.						cell differentiation|nervous system development|signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|plasma membrane	binding|GTPase activator activity				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		CATCAGCCAGAgggctgggctg	0.569													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	4734408	4734418	+	IGR	DEL	GGTAGGTGAAG	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4734408_4734418delGGTAGGTGAAG								LOC100216001 (14146 upstream) : AKR1E2 (133984 downstream)																							aaggaaggaaggtaggtgaagggaaggaagg	0.071													10	5	---	---	---	---	
MRC1	4360	broad.mit.edu	37	10	17928294	17928297	+	Intron	DEL	CTTC	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17928294_17928297delCTTC	uc001ipk.2	+							NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						TGGGTGTtttcttccttccttcct	0.191													3	4	---	---	---	---	
ARHGAP12	94134	broad.mit.edu	37	10	32141656	32141657	+	Intron	DEL	TC	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32141656_32141657delTC	uc001ivz.1	-						ARHGAP12_uc001ivy.1_Intron|ARHGAP12_uc009xls.2_Intron|ARHGAP12_uc001iwb.1_Intron|ARHGAP12_uc001iwc.1_Intron|ARHGAP12_uc009xlq.1_Intron|ARHGAP12_uc001iwd.1_Intron|ARHGAP12_uc009xlr.1_Intron	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)				AACAAAAAAttctttttttttt	0.114													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34021905	34021908	+	IGR	DEL	GGAA	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34021905_34021908delGGAA								NRP1 (397899 upstream) : PARD3 (378190 downstream)																							atggaagtagggaaggaaggaagg	0.108													4	3	---	---	---	---	
FAM21C	253725	broad.mit.edu	37	10	46238682	46238682	+	Intron	DEL	T	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46238682delT	uc001jcu.2	+						FAM21C_uc001jcs.1_Intron|FAM21C_uc001jct.2_Intron|FAM21C_uc010qfi.1_Intron	NM_015262	NP_056077	A8K5W5	A8K5W5_HUMAN	hypothetical protein LOC253725											ovary(1)	1						AAAAAAAGAATTTTTTTTTTA	0.269													4	2	---	---	---	---	
SLC18A2	6571	broad.mit.edu	37	10	119013080	119013080	+	Intron	DEL	T	-	-	rs2256299		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119013080delT	uc001ldd.1	+						SLC18A2_uc009xyy.1_Intron	NM_003054	NP_003045	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine),						neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity				0		Colorectal(252;0.19)		all cancers(201;0.029)	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)	GCGGGGGGggtcgtggttggc	0.284													6	3	---	---	---	---	
KRTAP5-5	439915	broad.mit.edu	37	11	1651191	1651199	+	In_Frame_Del	DEL	GGCTGTGGA	-	-	rs144216147		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651191_1651199delGGCTGTGGA	uc001lty.2	+	1	159_167	c.121_129delGGCTGTGGA	c.(121-129)GGCTGTGGAdel	p.GCG47del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	47_49						keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ctgtggctccggctgtggaggctgtgggg	0.129													32	38	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19637850	19637851	+	Intron	INS	-	TGTG	TGTG	rs146490839	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19637850_19637851insTGTG	uc001mpp.2	+							NM_001111018	NP_001104488	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						TTGCTTCTGACtgtgtgtgtgt	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	57390664	57390691	+	IGR	DEL	AGGAAGGAAGGAAGGAAGGAAGGAAGGG	-	-	rs71470280	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57390664_57390691delAGGAAGGAAGGAAGGAAGGAAGGAAGGG								SERPING1 (8338 upstream) : MIR130A (17980 downstream)																							gaaggaaggaaggaaggaaggaaggaaggaaggaagggagggagggag	0.000													4	3	---	---	---	---	
ATG2A	23130	broad.mit.edu	37	11	64664497	64664497	+	Intron	DEL	T	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64664497delT	uc001obx.2	-						ATG2A_uc001obw.2_Intron	NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A								protein binding			ovary(1)|central_nervous_system(1)	2						GACTGTGTCCttttttttttt	0.299													5	3	---	---	---	---	
XRRA1	143570	broad.mit.edu	37	11	74631052	74631052	+	Intron	DEL	A	-	-	rs112064551		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74631052delA	uc009yub.2	-						XRRA1_uc001ovm.2_Intron|XRRA1_uc001ovo.2_Intron|XRRA1_uc001ovq.3_Intron|XRRA1_uc001ovp.3_Intron|XRRA1_uc001ovr.2_Intron	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1						response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1						ATAAAACTGCAAAAAAAAAAA	0.333													4	2	---	---	---	---	
INTS4	92105	broad.mit.edu	37	11	77605234	77605234	+	Intron	DEL	G	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77605234delG	uc001oys.2	-						C11orf67_uc001oyp.2_Intron|C11orf67_uc001oyr.1_Intron|INTS4_uc001oyt.2_Intron	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			GGCTGCACAAGCTAAACCAAG	0.338													8	6	---	---	---	---	
LOC144438	144438	broad.mit.edu	37	12	49086750	49086750	+	5'Flank	DEL	A	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49086750delA	uc001rsd.3	-							NR_024266				Homo sapiens cDNA FLJ11223 fis, clone PLACE1008209.												0						TTCTTAGTCCAAAAAAAAAAA	0.323													4	2	---	---	---	---	
LOC283392	283392	broad.mit.edu	37	12	72666481	72666483	+	Intron	DEL	AAG	-	-	rs111457826		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72666481_72666483delAAG	uc010stv.1	-						TRHDE_uc001sxa.2_5'Flank	NR_026836				Homo sapiens thyrotropin-releasing hormone degrading enzyme, mRNA (cDNA clone IMAGE:4992272).												0						gaagaagaaaaagaagaggaaga	0.488													7	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	30984754	30984755	+	IGR	INS	-	AGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGA	AGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGA	rs68107497		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30984754_30984755insAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGA								LOC100188949 (36718 upstream) : HMGB1 (48126 downstream)																							aagaaaGAGAGaggaaggaagg	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22481334	22481334	+	Intron	DEL	C	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22481334delC	uc001wbw.2	+						uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TGGAGAGAGACCCTTCGTGTG	0.488													9	5	---	---	---	---	
PSME1	5720	broad.mit.edu	37	14	24604315	24604316	+	5'Flank	DEL	AC	-	-	rs72022116		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24604315_24604316delAC	uc001wmg.2	+						PSME1_uc001wmh.2_5'Flank	NM_006263	NP_006254	Q06323	PSME1_HUMAN	proteasome activator subunit 1 isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|proteasome activator complex				ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00831)		ccgtcCCCCAacacacacacac	0.089													3	3	---	---	---	---	
ATP6V1D	51382	broad.mit.edu	37	14	67809927	67809927	+	Intron	DEL	T	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67809927delT	uc001xjf.2	-						ATP6V1D_uc001xje.2_Intron	NM_015994	NP_057078	Q9Y5K8	VATD_HUMAN	H(+)-transporting two-sector ATPase						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting two-sector ATPase complex, catalytic domain|vacuolar proton-transporting V-type ATPase complex	protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)|lung(1)	2				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		TTCATAACACTTTTTTTTTTT	0.373													7	4	---	---	---	---	
DCAF4	26094	broad.mit.edu	37	14	73412936	73412943	+	Intron	DEL	AAAAAAAA	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73412936_73412943delAAAAAAAA	uc001xng.2	+						DCAF4_uc001xnj.2_Intron|DCAF4_uc010ttr.1_Intron|DCAF4_uc001xnh.2_Intron|DCAF4_uc010tts.1_Intron|DCAF4_uc010ttt.1_Intron|DCAF4_uc001xni.2_Intron|DCAF4_uc001xnk.2_Intron	NM_015604	NP_056419	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4 isoform 1							CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)|skin(1)	3						ttgtctctacaaaaaaaaaaaaaaaaaa	0.043													4	2	---	---	---	---	
SLC24A4	123041	broad.mit.edu	37	14	92954321	92954323	+	Intron	DEL	CTC	-	-	rs113190696	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92954321_92954323delCTC	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron|SLC24A4_uc010auj.2_Intron|SLC24A4_uc010twn.1_Intron|SLC24A4_uc001yan.2_Intron	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		cctcctcctgctcctcctcctcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	96208201	96208202	+	Intron	INS	-	GT	GT	rs145962966	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96208201_96208202insGT	uc001yfd.1	+											human full-length cDNA clone CS0DG006YJ19 of B cells (Ramos cell line) of Homo sapiens (human).																		TAATCATGATAgtgtgtgtgtg	0.312													2	4	---	---	---	---	
INF2	64423	broad.mit.edu	37	14	105153816	105153817	+	5'Flank	INS	-	AC	AC	rs75790704		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105153816_105153817insAC	uc001ypb.2	+						INF2_uc001ypc.2_5'Flank|INF2_uc001yoy.3_5'Flank	NM_022489	NP_071934	Q27J81	INF2_HUMAN	inverted formin 2 isoform 1						actin cytoskeleton organization	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm	actin binding|Rho GTPase binding				0		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		cacacacacatacacacacaca	0.450													4	2	---	---	---	---	
TUBGCP4	27229	broad.mit.edu	37	15	43690581	43690581	+	Intron	DEL	A	-	-	rs150462033		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43690581delA	uc001zro.2	+						TUBGCP4_uc001zrn.2_Intron|TUBGCP4_uc010bdh.2_Intron	NM_014444	NP_055259	Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	structural constituent of cytoskeleton			ovary(3)	3		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		cccatctcataaaaaaaaaaa	0.090													6	3	---	---	---	---	
TMC3	342125	broad.mit.edu	37	15	81664691	81664694	+	Intron	DEL	ACAC	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81664691_81664694delACAC	uc002bgo.1	-						TMC3_uc010blr.1_Intron|TMC3_uc002bgp.2_Intron	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3							integral to membrane				ovary(1)|liver(1)	2						TGTCTCTCTGacacacacacacac	0.324													5	3	---	---	---	---	
AGBL1	123624	broad.mit.edu	37	15	86923462	86923463	+	Intron	INS	-	CCTG	CCTG	rs113927338		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86923462_86923463insCCTG	uc002blz.1	+							NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						tcattccctcccctgcctgcct	0.144													6	3	---	---	---	---	
ABHD2	11057	broad.mit.edu	37	15	89695309	89695309	+	Intron	DEL	T	-	-	rs34458230		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89695309delT	uc002bnj.2	+						ABHD2_uc002bnk.2_Intron	NM_007011	NP_008942	P08910	ABHD2_HUMAN	alpha/beta hydrolase domain containing protein							integral to membrane	carboxylesterase activity			ovary(1)|lung(1)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)					TGTAGAATAGttttttttttt	0.234													16	7	---	---	---	---	
NR2F2	7026	broad.mit.edu	37	15	96881005	96881005	+	3'UTR	DEL	A	-	-	rs34678417		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96881005delA	uc010uri.1	+	3					NR2F2_uc002btp.2_3'UTR|NR2F2_uc010urj.1_3'UTR|NR2F2_uc010urk.1_3'UTR	NM_021005	NP_066285	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2						lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(1)	3	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			TGTGAATTTCAAAAAAAAAAA	0.289													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	18120452	18120459	+	IGR	DEL	CTTCCTTT	-	-	rs72073684	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18120452_18120459delCTTCCTTT								XYLT1 (555714 upstream) : NOMO2 (390724 downstream)																							tccttccttccttcctttctttctccct	0.111													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25276656	25276657	+	IGR	INS	-	T	T	rs146823283	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25276656_25276657insT								ZKSCAN2 (7801 upstream) : HS3ST4 (426690 downstream)																							TTTCTCATTTCTTTTATTTTCT	0.020													4	4	---	---	---	---	
ZNF423	23090	broad.mit.edu	37	16	49525453	49525453	+	Intron	DEL	C	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49525453delC	uc002efs.2	-						ZNF423_uc010vgn.1_Intron	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423						cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				TGTTTTTTGGCtttttttttt	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	60214732	60214735	+	IGR	DEL	TCTT	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60214732_60214735delTCTT								None (None upstream) : None (None downstream)																							ttcttctttctctttctttctttc	0.000													5	3	---	---	---	---	
TBC1D28	254272	broad.mit.edu	37	17	18549316	18549317	+	5'Flank	INS	-	AC	AC	rs55762200		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18549316_18549317insAC	uc002gud.2	-							NM_001039397	NP_001034486	Q2M2D7	TBC28_HUMAN	TBC1 domain family, member 28							intracellular	Rab GTPase activator activity			ovary(1)	1						acacacacacacCACttgttgc	0.203													4	2	---	---	---	---	
PITPNC1	26207	broad.mit.edu	37	17	65486229	65486240	+	Intron	DEL	TGTGTGTGTGTG	-	-	rs72374539		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65486229_65486240delTGTGTGTGTGTG	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549	Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			CAGGCTTTTCtgtgtgtgtgtgtgtgtgtgtg	0.231													3	3	---	---	---	---	
OTOP3	347741	broad.mit.edu	37	17	72930384	72930385	+	5'Flank	INS	-	TGTG	TGTG	rs55986022		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72930384_72930385insTGTG	uc010wrr.1	+						OTOP3_uc010wrq.1_5'Flank	NM_178233	NP_839947	Q7RTS5	OTOP3_HUMAN	otopetrin 3							integral to membrane|intracellular	zinc ion binding			ovary(1)	1	all_lung(278;0.151)|Lung NSC(278;0.185)					cctggctaaattgtgtgtgtgt	0.000													4	3	---	---	---	---	
GNAL	2774	broad.mit.edu	37	18	11735770	11735773	+	Intron	DEL	AGAG	-	-	rs67564417		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11735770_11735773delAGAG	uc002kqc.2	+							NM_182978	NP_892023	P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						aaaaaaagaaagagagaaagaaag	0.064													5	5	---	---	---	---	
TMEM146	257062	broad.mit.edu	37	19	5754402	5754404	+	Intron	DEL	GTC	-	-	rs28697922		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5754402_5754404delGTC	uc002mda.2	+						TMEM146_uc010duj.1_Intron	NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor							integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						TTGTCTCTGTGTCtttttttttt	0.271													9	5	---	---	---	---	
KEAP1	9817	broad.mit.edu	37	19	10600448	10600449	+	Frame_Shift_Ins	INS	-	T	T			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10600448_10600449insT	uc002moq.1	-	4	1562_1563	c.1406_1407insA	c.(1405-1407)AATfs	p.N469fs	KEAP1_uc002mop.1_Frame_Shift_Ins_p.N187fs|KEAP1_uc002mor.1_Frame_Shift_Ins_p.N469fs	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	469	Kelch 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			AAAGGAGACGATTGAGGACAGC	0.554													38	55	---	---	---	---	
ZNF428	126299	broad.mit.edu	37	19	44111569	44111570	+	3'UTR	DEL	AC	-	-	rs35296355		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44111569_44111570delAC	uc002oxa.2	-	3					SRRM5_uc002oxb.2_Intron	NM_182498	NP_872304	Q96B54	ZN428_HUMAN	zinc finger protein 428							intracellular	zinc ion binding				0		Prostate(69;0.0153)				GGGCGGGAATacacacacacac	0.322													5	4	---	---	---	---	
NTN5	126147	broad.mit.edu	37	19	49173241	49173241	+	Intron	DEL	T	-	-	rs71179032		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49173241delT	uc002pkb.2	-						SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|NTN5_uc002pkc.2_Intron	NM_145807	NP_665806	Q8WTR8	NET5_HUMAN	netrin 5 precursor							extracellular region				large_intestine(1)|pancreas(1)	2						atcaccatcatcaccaccacc	0.000													4	2	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50309616	50309618	+	Intron	DEL	CCT	-	-	rs35426636		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50309616_50309618delCCT	uc002ppn.2	+						AP2A1_uc002ppo.2_Intron|AP2A1_uc010enk.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCACTTTGACCCTCCTCCTCTCA	0.532													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	51321023	51321024	+	Intron	INS	-	GT	GT			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51321023_51321024insGT	uc002ptj.2	+											Homo sapiens hypothetical gene MGC45922, mRNA (cDNA clone MGC:45922 IMAGE:5428578), complete cds.																		GTTGTGAGGGCgtgtgtgtgtg	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	16755431	16755434	+	IGR	DEL	AAAG	-	-	rs74177310		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16755431_16755434delAAAG								OTOR (22623 upstream) : PCSK2 (451318 downstream)																							ggaagatagaaaagaaagaaagaa	0.000													11	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	40500509	40500509	+	IGR	DEL	T	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40500509delT								CHD6 (253376 upstream) : PTPRT (200884 downstream)																							ccttcctttctttttttttta	0.010													4	4	---	---	---	---	
DSCAM	1826	broad.mit.edu	37	21	41741312	41741313	+	Intron	INS	-	GT	GT	rs143618739	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41741312_41741313insGT	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				cgtgcgtctgcgtgtgtgtgtg	0.272													4	2	---	---	---	---	
TMPRSS6	164656	broad.mit.edu	37	22	37474736	37474737	+	Intron	INS	-	G	G	rs150526071	by1000genomes	TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37474736_37474737insG	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						aggaagaggaagaggaagagga	0.149													5	3	---	---	---	---	
APOO	79135	broad.mit.edu	37	X	23854949	23854950	+	Intron	DEL	TT	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23854949_23854950delTT	uc004dax.2	-						APOO_uc004daw.2_Intron|APOO_uc004day.3_Intron	NM_024122	NP_077027	Q9BUR5	APOO_HUMAN	apolipoprotein O precursor						lipid transport	high-density lipoprotein particle|integral to membrane|low-density lipoprotein particle|very-low-density lipoprotein particle					0						CTGTTGTGGCTTGCTGAATCAA	0.386													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	79829147	79829147	+	IGR	DEL	A	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79829147delA								FAM46D (128337 upstream) : BRWD3 (102536 downstream)																							GCTTCCCCCTAAAGAGCAGCT	0.542													76	625	---	---	---	---	
DIAPH2	1730	broad.mit.edu	37	X	96194492	96194515	+	Intron	DEL	TATATATGTATATATATATGTATG	-	-	rs72476044		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96194492_96194515delTATATATGTATATATATATGTATG	uc004efu.3	+						DIAPH2_uc004eft.3_Intron	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156						cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						tgtatgtatatatatatgtatatatatatgtatgtatatatata	0.107													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	117359358	117359359	+	IGR	DEL	CA	-	-	rs72469154		TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117359358_117359359delCA								KLHL13 (108570 upstream) : WDR44 (120683 downstream)																							ATCGGCCCAGcacacacacaca	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	118835730	118835731	+	IGR	DEL	AC	-	-			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118835730_118835731delAC								SEPT6 (8397 upstream) : ANKRD58 (56845 downstream)																							TGGGGAGACTacacacacacac	0.248													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	8801361	8801362	+	IGR	INS	-	G	G			TCGA-33-4532-01A-01D-1267-08	TCGA-33-4532-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:8801361_8801362insG								TTTY11 (115938 upstream) : RBMY1A3P (353308 downstream)																							gaaagaaggaagaaggaaggaa	0.045													4	2	---	---	---	---	
