Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SPEN	23013	broad.mit.edu	37	1	16255242	16255242	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16255242C>T	uc001axk.1	+	11	2711	c.2507C>T	c.(2506-2508)TCA>TTA	p.S836L	SPEN_uc010obp.1_Missense_Mutation_p.S795L	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	836					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TCTCAGTCTTCAGAAACGGAC	0.448													22	61	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16890432	16890432	+	3'UTR	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16890432G>A	uc009vos.1	-	31					uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GCTTAGTAAGGGCTGCTTACT	0.473													39	510	---	---	---	---	PASS
SDHB	6390	broad.mit.edu	37	1	17345379	17345379	+	Silent	SNP	A	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17345379A>C	uc001bae.2	-	8	991	c.840T>G	c.(838-840)GTT>GTG	p.V280V		NM_003000	NP_002991	P21912	DHSB_HUMAN	succinate dehydrogenase complex, subunit B, iron	280					respiratory electron transport chain|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	2 iron, 2 sulfur cluster binding|3 iron, 4 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|protein binding|succinate dehydrogenase (ubiquinone) activity|ubiquinone binding			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0049)|COAD - Colon adenocarcinoma(227;1.18e-05)|BRCA - Breast invasive adenocarcinoma(304;2.41e-05)|Kidney(64;0.000188)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)	Succinic acid(DB00139)	GAAACAGTTAAACTGAAGCTT	0.333			Mis|N|F			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome				54	138	---	---	---	---	PASS
PADI4	23569	broad.mit.edu	37	1	17668535	17668535	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17668535C>T	uc001baj.2	+	7	778	c.750C>T	c.(748-750)TAC>TAT	p.Y250Y	PADI4_uc009vpc.2_Silent_p.Y250Y	NM_012387	NP_036519	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	250					chromatin modification|peptidyl-citrulline biosynthetic process from peptidyl-arginine|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	TGGACTTCTACGTGGAGGCCC	0.607													15	50	---	---	---	---	PASS
RPA2	6118	broad.mit.edu	37	1	28233712	28233712	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28233712C>A	uc001bpe.1	-	3	481	c.199G>T	c.(199-201)GGG>TGG	p.G67W	RPA2_uc001bpd.1_Missense_Mutation_p.G75W|RPA2_uc010ofp.1_5'UTR	NM_002946	NP_002937	P15927	RFA2_HUMAN	replication protein A2, 32kDa	67					cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|regulation of double-strand break repair via homologous recombination|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor A complex|PML body	protein phosphatase binding|single-stranded DNA binding			skin(1)	1		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		TCAACATTCCCAATTCTGAAC	0.353								Direct_reversal_of_damage|NER					41	156	---	---	---	---	PASS
COL16A1	1307	broad.mit.edu	37	1	32154546	32154546	+	Silent	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32154546C>A	uc001btk.1	-	25	2048	c.1683G>T	c.(1681-1683)TCG>TCT	p.S561S	COL16A1_uc001btj.1_Silent_p.S390S|COL16A1_uc001btl.3_Silent_p.S561S	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	561	Nonhelical region 8 (NC8).				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CCCCTACAACCGAGCTGCAGG	0.612													14	41	---	---	---	---	PASS
BAI2	576	broad.mit.edu	37	1	32193848	32193848	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32193848G>C	uc001btn.2	-	31	4804	c.4450C>G	c.(4450-4452)CTC>GTC	p.L1484V	BAI2_uc001btm.2_Missense_Mutation_p.L478V|BAI2_uc001btp.1_Missense_Mutation_p.L478V|BAI2_uc010ogn.1_Missense_Mutation_p.L454V|BAI2_uc010ogo.1_Missense_Mutation_p.L1093V|BAI2_uc010ogp.1_Missense_Mutation_p.L1417V|BAI2_uc010ogq.1_Missense_Mutation_p.L1450V|BAI2_uc001bto.2_Missense_Mutation_p.L1483V	NM_001703	NP_001694	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1484	Cytoplasmic (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(5)|breast(4)|ovary(2)|central_nervous_system(1)|skin(1)	13		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		TCGTGGTAGAGTTCTGAATGC	0.637													7	27	---	---	---	---	PASS
KLF17	128209	broad.mit.edu	37	1	44596261	44596261	+	Silent	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44596261C>A	uc001clp.2	+	3	1061	c.1003C>A	c.(1003-1005)CGG>AGG	p.R335R		NM_173484	NP_775755	Q5JT82	KLF17_HUMAN	zinc finger protein 393	335	C2H2-type 2.				regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					ACGACATATGCGGGTACACAC	0.493													4	152	---	---	---	---	PASS
EIF2B3	8891	broad.mit.edu	37	1	45446687	45446687	+	Intron	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45446687G>C	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron|EIF2B3_uc001cmw.2_Intron	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					CTTTGTCATAGCTCACCTTCA	0.433													58	79	---	---	---	---	PASS
ANGPTL3	27329	broad.mit.edu	37	1	63068003	63068003	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63068003T>C	uc001das.1	+	5	934	c.883T>C	c.(883-885)TTC>CTC	p.F295L	DOCK7_uc001dan.2_Intron|DOCK7_uc001dao.2_Intron|DOCK7_uc001dap.2_Intron|DOCK7_uc001daq.2_Intron|DOCK7_uc009wah.1_Intron	NM_014495	NP_055310	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3 precursor	295	Fibrinogen C-terminal.				acylglycerol homeostasis|artery morphogenesis|cell-matrix adhesion|cholesterol homeostasis|cholesterol metabolic process|fatty acid metabolic process|glycerol metabolic process|integrin-mediated signaling pathway|lipid storage|negative regulation of lipoprotein lipase activity|negative regulation of phospholipase activity|phospholipid catabolic process|phospholipid homeostasis|positive regulation of angiogenesis|positive regulation of cell migration|positive regulation of lipid catabolic process|triglyceride homeostasis	extracellular space	cell surface binding|growth factor activity|integrin binding|phospholipase inhibitor activity				0						ATCACAAAACTTCAATGAAAC	0.294													3	153	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70484480	70484480	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70484480C>A	uc001dep.2	+	13	1315	c.1285C>A	c.(1285-1287)CAG>AAG	p.Q429K	LRRC7_uc009wbg.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	429						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						CATGTTTCCCCAGCAGCCTCG	0.368													9	51	---	---	---	---	PASS
ADAMTSL4	54507	broad.mit.edu	37	1	150526192	150526192	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150526192C>A	uc001eux.2	+	6	961	c.725C>A	c.(724-726)CCC>CAC	p.P242H	ADAMTSL4_uc001euw.2_Missense_Mutation_p.P242H|ADAMTSL4_uc009wlw.2_Missense_Mutation_p.P242H|ADAMTSL4_uc010pcg.1_Missense_Mutation_p.P242H	NM_019032	NP_061905	Q6UY14	ATL4_HUMAN	thrombospondin repeat containing 1 isoform 1	242					apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding			ovary(1)|skin(1)	2	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GAGGTGGCCCCCAGAACCAGG	0.632													4	74	---	---	---	---	PASS
CREB3L4	148327	broad.mit.edu	37	1	153941878	153941878	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153941878G>T	uc001fdn.3	+	4	756	c.490G>T	c.(490-492)GCC>TCC	p.A164S	SLC39A1_uc001fdl.2_5'Flank|CREB3L4_uc010pef.1_Missense_Mutation_p.A17S|CREB3L4_uc001fdo.3_Missense_Mutation_p.A144S|CREB3L4_uc001fdm.1_Missense_Mutation_p.A164S|CREB3L4_uc001fdp.1_Missense_Mutation_p.A144S|CREB3L4_uc010peg.1_3'UTR|CREB3L4_uc001fdr.2_Missense_Mutation_p.A164S|CREB3L4_uc001fdq.2_Missense_Mutation_p.A144S	NM_130898	NP_570968	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like	164	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TGATGCTCATGCCCACATCCT	0.532													27	63	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157771861	157771861	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157771861G>T	uc001frg.2	-	5	843	c.730C>A	c.(730-732)CAC>AAC	p.H244N	FCRL1_uc001frf.2_RNA|FCRL1_uc001frh.2_Missense_Mutation_p.H244N|FCRL1_uc001fri.2_Missense_Mutation_p.H244N|FCRL1_uc001frj.2_RNA	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	244	Ig-like C2-type 3.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ATATCCTCGTGATAAAACCAG	0.582													8	55	---	---	---	---	PASS
METTL13	51603	broad.mit.edu	37	1	171756950	171756950	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171756950G>A	uc001ghz.2	+	4	1536	c.1189G>A	c.(1189-1191)GAC>AAC	p.D397N	METTL13_uc001gia.2_Missense_Mutation_p.D311N|METTL13_uc001gib.2_Missense_Mutation_p.D241N|METTL13_uc010pml.1_Missense_Mutation_p.D396N	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1	397							methyltransferase activity|protein binding			kidney(1)	1						CTTGAGCGGTGACTATGTCAT	0.552													12	41	---	---	---	---	PASS
NPL	80896	broad.mit.edu	37	1	182775341	182775341	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182775341G>T	uc009wyb.2	+	5	344	c.204G>T	c.(202-204)GAG>GAT	p.E68D	NPL_uc010pnx.1_Translation_Start_Site|NPL_uc010pny.1_RNA|NPL_uc001gpo.1_Translation_Start_Site|NPL_uc009wyc.2_Missense_Mutation_p.E68D|NPL_uc001gpp.3_Missense_Mutation_p.E68D|NPL_uc001gpq.1_Missense_Mutation_p.E68D	NM_030769	NP_110396	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase	68					carbohydrate metabolic process	cytoplasm	N-acetylneuraminate lyase activity			ovary(1)|central_nervous_system(1)|skin(1)	3						AGGTTGCAGAGGAGTGGGTGA	0.522													8	30	---	---	---	---	PASS
SYT2	127833	broad.mit.edu	37	1	202572184	202572184	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202572184C>T	uc001gye.2	-	4	601	c.408G>A	c.(406-408)GAG>GAA	p.E136E	SYT2_uc010pqb.1_Silent_p.E136E|SYT2_uc009xaf.2_5'UTR	NM_001136504	NP_001129976	Q8N9I0	SYT2_HUMAN	synaptotagmin II	136	Phospholipid binding (By similarity).|Cytoplasmic (Potential).				neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	GGTTCTCTGGCTCTTTCTCCT	0.572													25	100	---	---	---	---	PASS
SYT2	127833	broad.mit.edu	37	1	202574736	202574736	+	Silent	SNP	T	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202574736T>G	uc001gye.2	-	2	358	c.165A>C	c.(163-165)ATA>ATC	p.I55I	SYT2_uc010pqb.1_Silent_p.I55I|SYT2_uc009xaf.2_Intron	NM_001136504	NP_001129976	Q8N9I0	SYT2_HUMAN	synaptotagmin II	55	Vesicular (Potential).				neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	GAATCTTGTTTATCTCATTGA	0.537													19	64	---	---	---	---	PASS
CNTN2	6900	broad.mit.edu	37	1	205033505	205033505	+	Silent	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205033505C>A	uc001hbr.2	+	11	1565	c.1296C>A	c.(1294-1296)CGC>CGA	p.R432R	CNTN2_uc001hbq.1_Silent_p.R323R|CNTN2_uc001hbs.2_Silent_p.R220R	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	432	Ig-like C2-type 5.				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCGCGGCCCGCGGGGGAGAGA	0.612													80	123	---	---	---	---	PASS
PM20D1	148811	broad.mit.edu	37	1	205813990	205813990	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205813990C>A	uc001hdj.2	-	4	570	c.525G>T	c.(523-525)AGG>AGT	p.R175S	PM20D1_uc009xbr.2_RNA	NM_152491	NP_689704	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1 precursor	175						extracellular region	metal ion binding|peptidase activity			skin(1)	1	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GGATGTACTTCCTGATCAGCA	0.493													22	65	---	---	---	---	PASS
PLXNA2	5362	broad.mit.edu	37	1	208257880	208257880	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208257880C>T	uc001hgz.2	-	10	2901	c.2143G>A	c.(2143-2145)GGG>AGG	p.G715R		NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor	715	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TTTACCTCCCCGACTGGAATC	0.572													16	101	---	---	---	---	PASS
KCNH1	3756	broad.mit.edu	37	1	211093061	211093061	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211093061G>A	uc001hib.2	-	7	1553	c.1383C>T	c.(1381-1383)CTC>CTT	p.L461L	KCNH1_uc001hic.2_Silent_p.L434L	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	461					myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		CCACACTGGTGAGGCTGGTCA	0.507													34	112	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215848418	215848418	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215848418G>A	uc001hku.1	-	63	13222	c.12835C>T	c.(12835-12837)CAA>TAA	p.Q4279*		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4279	Fibronectin type-III 28.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGCAGTTTTTGGGgattcata	0.358										HNSCC(13;0.011)			15	84	---	---	---	---	PASS
PARP1	142	broad.mit.edu	37	1	226567635	226567635	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226567635C>T	uc001hqd.3	-	10	1702	c.1531G>A	c.(1531-1533)GTC>ATC	p.V511I		NM_001618	NP_001609	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase family, member 1	511	Automodification domain.				cellular response to insulin stimulus|protein ADP-ribosylation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nuclear envelope|nucleolus|transcription factor complex	DNA binding|identical protein binding|NAD+ ADP-ribosyltransferase activity|protein N-terminus binding|transcription factor binding|zinc ion binding			lung(3)|ovary(2)|breast(2)|skin(2)|upper_aerodigestive_tract(1)	10	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		TCCTCCTTGACCTGGCCCTTG	0.607								Direct_reversal_of_damage|PARP_enzymes_that_bind_to_DNA					23	162	---	---	---	---	PASS
KCNK1	3775	broad.mit.edu	37	1	233807193	233807193	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233807193G>A	uc010pxo.1	+	3	1096	c.928G>A	c.(928-930)GGC>AGC	p.G310S	KCNK1_uc001hvw.2_RNA|KCNK1_uc001hvx.2_RNA	NM_002245	NP_002236	O00180	KCNK1_HUMAN	potassium channel, subfamily K, member 1	310	Cytoplasmic (Potential).					voltage-gated potassium channel complex	inward rectifier potassium channel activity			central_nervous_system(1)	1		all_cancers(173;0.00217)|all_epithelial(177;0.121)|Prostate(94;0.122)|Acute lymphoblastic leukemia(190;0.175)			Ibutilide(DB00308)|Quinidine(DB00908)	CCAGGCAGCTGGCATGAAAGA	0.502													9	32	---	---	---	---	PASS
FH	2271	broad.mit.edu	37	1	241669322	241669322	+	Silent	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241669322T>C	uc001hyx.2	-	6	917	c.885A>G	c.(883-885)GCA>GCG	p.A295A		NM_000143	NP_000134	P07954	FUMH_HUMAN	fumarate hydratase precursor	295					fumarate metabolic process|tricarboxylic acid cycle	cell junction|mitochondrial matrix|tricarboxylic acid cycle enzyme complex	fumarate hydratase activity			lung(3)|ovary(1)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	Colorectal(1306;2.33e-53)|COAD - Colon adenocarcinoma(196;1.05e-44)|KIRC - Kidney renal clear cell carcinoma(1967;0.000109)		CAGCCACTTTTGCAGCAACCT	0.413			Mis|N|F			lieomyomatosis|renal			Hereditary_Leiomyomatosis_and_Renal_Cell_Cancer				35	56	---	---	---	---	PASS
OR2T29	343563	broad.mit.edu	37	1	248722769	248722769	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248722769G>A	uc001ieo.1	-	1	6	c.6C>T	c.(4-6)GCC>GCT	p.A2A		NM_001004694	NP_001004694	Q8NH02	O2T29_HUMAN	olfactory receptor, family 2, subfamily T,	8	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAGTGTGGTTGGCCATCCTGG	0.473													8	37	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1906962	1906962	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1906962T>G	uc002qxe.2	-	14	2749	c.1922A>C	c.(1921-1923)TAT>TCT	p.Y641S	MYT1L_uc002qxd.2_Missense_Mutation_p.Y639S|MYT1L_uc010ewl.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	641					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GGTCTTGGAATATTTCTCGAG	0.488													14	93	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1926988	1926988	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1926988C>G	uc002qxe.2	-	10	1380	c.553G>C	c.(553-555)GAA>CAA	p.E185Q	MYT1L_uc002qxd.2_Missense_Mutation_p.E185Q|MYT1L_uc010ewl.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	185					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCATCCTTTTCTGTGTCTTGC	0.333													3	18	---	---	---	---	PASS
DDX1	1653	broad.mit.edu	37	2	15760450	15760450	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15760450A>T	uc002rce.2	+	17	1613	c.1325A>T	c.(1324-1326)CAC>CTC	p.H442L	DDX1_uc010yjq.1_Missense_Mutation_p.H350L	NM_004939	NP_004930	Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1	442	Necessary for interaction with RELA.				DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		GATACTGTACACCATGTTGTT	0.378													20	86	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25966231	25966231	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25966231G>A	uc002rgs.2	-	12	3196	c.2975C>T	c.(2974-2976)GCG>GTG	p.A992V	ASXL2_uc002rgt.1_Intron	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	992					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCTATGAGCGCTCCCATCCC	0.483													52	41	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27799449	27799449	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27799449A>C	uc002rkz.3	+	1	61	c.10A>C	c.(10-12)ACA>CCA	p.T4P		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	4										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					TATGGAGCTGACACCAGGGGC	0.433													6	38	---	---	---	---	PASS
TRMT61B	55006	broad.mit.edu	37	2	29093054	29093054	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29093054C>T	uc002rmm.2	-	1	122	c.90G>A	c.(88-90)GAG>GAA	p.E30E	TRMT61B_uc002rmn.2_Silent_p.E30E|TRMT61B_uc010ezk.2_RNA	NM_017910	NP_060380	Q9BVS5	TR61B_HUMAN	tRNA methyltransferase 61 homolog B	30							tRNA (adenine-N1-)-methyltransferase activity				0						CCTCGAAGGGCTCCTGCCCCA	0.617													4	36	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32836642	32836642	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32836642C>G	uc010ezu.2	+	73	14521	c.14387C>G	c.(14386-14388)GCT>GGT	p.A4796G		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	4796					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					CATGCAGCAGCTCTCAAGGTG	0.483													39	27	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50573836	50573836	+	Silent	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50573836G>T	uc010fbp.2	-	1	1059	c.252C>A	c.(250-252)GGC>GGA	p.G84G	NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	84	Extracellular (Potential).				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CACCGTGTCCGCCTCGCAAGG	0.572													17	65	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	51253554	51253554	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51253554G>A	uc010fbq.2	-	3	2303	c.826C>T	c.(826-828)CAA>TAA	p.Q276*	NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxd.1_Intron	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TATTTTCCTTGGTCATTGTCA	0.378													3	23	---	---	---	---	PASS
VRK2	7444	broad.mit.edu	37	2	58366957	58366957	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58366957A>C	uc002rzo.2	+	14	1758	c.1013A>C	c.(1012-1014)AAC>ACC	p.N338T	VRK2_uc010fcb.2_Missense_Mutation_p.N338T|VRK2_uc002rzs.2_Missense_Mutation_p.N338T|VRK2_uc002rzr.2_Missense_Mutation_p.N338T|VRK2_uc010fcc.2_Missense_Mutation_p.N220T|VRK2_uc002rzv.2_Missense_Mutation_p.N338T|VRK2_uc010fcd.2_Missense_Mutation_p.N315T|VRK2_uc002rzp.2_Missense_Mutation_p.N338T|VRK2_uc010ypg.1_Missense_Mutation_p.N338T|VRK2_uc002rzq.2_Missense_Mutation_p.N338T|VRK2_uc002rzu.2_Missense_Mutation_p.N338T|VRK2_uc002rzt.2_Missense_Mutation_p.N220T	NM_001130482	NP_001123954	Q86Y07	VRK2_HUMAN	vaccinia related kinase 2 isoform 2	338						integral to membrane	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						CATACTCCAAACAGTCAAAAA	0.353													17	87	---	---	---	---	PASS
PELI1	57162	broad.mit.edu	37	2	64331869	64331869	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64331869G>C	uc002scs.3	-	2	4206	c.167C>G	c.(166-168)ACT>AGT	p.T56S	PELI1_uc002sct.3_Missense_Mutation_p.T56S|PELI1_uc002scu.1_RNA	NM_020651	NP_065702	Q96FA3	PELI1_HUMAN	pellino protein	56					innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol				ovary(1)	1						AATATGCACAGTGCTGGGCTT	0.378													18	111	---	---	---	---	PASS
SLC4A5	57835	broad.mit.edu	37	2	74474421	74474421	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74474421C>T	uc002sko.1	-	14	1803	c.1801G>A	c.(1801-1803)GAC>AAC	p.D601N	SLC4A5_uc002skl.2_RNA|SLC4A5_uc002skn.2_Missense_Mutation_p.D601N|SLC4A5_uc010ffc.1_Missense_Mutation_p.D601N|SLC4A5_uc002skp.1_Missense_Mutation_p.D537N|SLC4A5_uc002sks.1_Missense_Mutation_p.D601N	NM_021196	NP_067019	Q9BY07	S4A5_HUMAN	sodium bicarbonate transporter 4 isoform a	601	Cytoplasmic (Potential).					apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						TCCATGTAGTCCAGGCCATTG	0.557													8	61	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89545004	89545004	+	RNA	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89545004G>A	uc010ytr.1	-	13		c.1607C>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		CCCTTACCTGGGACCCAGAGC	0.567													8	29	---	---	---	---	PASS
ASTL	431705	broad.mit.edu	37	2	96799269	96799269	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96799269C>T	uc010yui.1	-	5	350	c.350G>A	c.(349-351)CGC>CAC	p.R117H		NM_001002036	NP_001002036	Q6HA08	ASTL_HUMAN	astacin-like metalloendopeptidase precursor	117					proteolysis		metalloendopeptidase activity|zinc ion binding				0						GATGACCTGGCGGCTGGGCTC	0.567													17	67	---	---	---	---	PASS
IL18RAP	8807	broad.mit.edu	37	2	103040576	103040576	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103040576T>A	uc002tbx.2	+	4	860	c.376T>A	c.(376-378)TGT>AGT	p.C126S	IL18RAP_uc010fiz.2_Intron	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	126	Extracellular (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						GTCATATATTTGTAGACCCAA	0.353													12	109	---	---	---	---	PASS
FOXD4L1	200350	broad.mit.edu	37	2	114257312	114257312	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114257312C>T	uc002tjw.3	+	1	652	c.479C>T	c.(478-480)TCG>TTG	p.S160L		NM_012184	NP_036316	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	160	Fork-head.				axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0						CACAACCTCTCGCTGAACGAC	0.647													8	229	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138030207	138030207	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138030207G>A	uc002tva.1	+	10	2278	c.2278G>A	c.(2278-2280)GAT>AAT	p.D760N	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Missense_Mutation_p.D650N	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		AGAGTGTGAAGATGTTTCCTT	0.388													15	25	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141819824	141819824	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141819824G>A	uc002tvj.1	-	8	2004	c.1032C>T	c.(1030-1032)GAC>GAT	p.D344D	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	344	Extracellular (Potential).|LDL-receptor class B 3.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATTCCCGTAGTCAGTAAAGA	0.443										TSP Lung(27;0.18)			4	45	---	---	---	---	PASS
TTC21B	79809	broad.mit.edu	37	2	166758329	166758329	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166758329C>G	uc002udk.2	-	20	2793	c.2660G>C	c.(2659-2661)TGT>TCT	p.C887S		NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	887	TPR 13.					cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						AATCTCTGCACAAATTTCAGC	0.408													46	52	---	---	---	---	PASS
SCN9A	6335	broad.mit.edu	37	2	167141004	167141004	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167141004G>A	uc010fpl.2	-	12	2274	c.1933C>T	c.(1933-1935)CTG>TTG	p.L645L	uc002udp.2_Intron|SCN9A_uc002udr.1_Silent_p.L516L|SCN9A_uc002uds.1_Silent_p.L516L|SCN9A_uc002udt.1_Silent_p.L516L	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	645						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	ACCTCTGGCAGAAGCTGTCCA	0.542													8	27	---	---	---	---	PASS
ABCB11	8647	broad.mit.edu	37	2	169792886	169792886	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169792886T>G	uc002ueo.1	-	22	2794	c.2668A>C	c.(2668-2670)ATG>CTG	p.M890L	ABCB11_uc010zda.1_Missense_Mutation_p.M332L|ABCB11_uc010zdb.1_Missense_Mutation_p.M366L	NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	890	Helical; (Potential).|ABC transmembrane type-1 2.				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)	GCAATGATCATGGCCACAGTG	0.507													17	123	---	---	---	---	PASS
PPIG	9360	broad.mit.edu	37	2	170493661	170493661	+	Silent	SNP	A	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170493661A>T	uc002uez.2	+	14	2113	c.1893A>T	c.(1891-1893)TCA>TCT	p.S631S	PPIG_uc010fpx.2_Silent_p.S616S|PPIG_uc010fpy.2_Silent_p.S624S|PPIG_uc002ufb.2_Silent_p.S631S|PPIG_uc002ufd.2_Silent_p.S628S	NM_004792	NP_004783	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G	631	Arg/Ser-rich (RS domain).				protein folding|RNA splicing	nuclear matrix|nuclear speck	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|central_nervous_system(1)	3					L-Proline(DB00172)	CACGGAGCTCAGAGAGAGAAG	0.438													7	65	---	---	---	---	PASS
METTL8	79828	broad.mit.edu	37	2	172216968	172216968	+	Missense_Mutation	SNP	C	G	G	rs112550880		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172216968C>G	uc010zdo.1	-	3	340	c.199G>C	c.(199-201)GAA>CAA	p.E67Q	METTL8_uc002ugu.3_Missense_Mutation_p.E67Q|METTL8_uc002ugv.3_Missense_Mutation_p.E67Q|METTL8_uc002ugt.3_Missense_Mutation_p.E67Q|METTL8_uc002ugs.3_Missense_Mutation_p.E17Q|METTL8_uc010zdp.1_Missense_Mutation_p.E22Q	NM_024770	NP_079046	B3KW44	B3KW44_HUMAN	methyltransferase like 8	67							methyltransferase activity			ovary(1)	1						GCTGAGTTTTCTTTTACTTTT	0.418													17	83	---	---	---	---	PASS
HOXD3	3232	broad.mit.edu	37	2	177036830	177036830	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177036830T>A	uc002ukt.1	+	3	1303	c.1127T>A	c.(1126-1128)CTG>CAG	p.L376Q		NM_006898	NP_008829	P31249	HXD3_HUMAN	homeobox D3	376					anterior/posterior pattern formation|cartilage development|cell-matrix adhesion|embryonic skeletal system morphogenesis|Notch signaling pathway|positive regulation of gene expression|positive regulation of neuron differentiation|thyroid gland development		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)		GTCTTCAACCTGGGCCACCTC	0.687													4	38	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179413936	179413936	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179413936G>A	uc010zfg.1	-	288	84937	c.84713C>T	c.(84712-84714)GCA>GTA	p.A28238V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.A21933V|TTN_uc010zfi.1_Missense_Mutation_p.A21866V|TTN_uc010zfj.1_Missense_Mutation_p.A21741V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29165							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGCCACTTGCAGGTCCAAC	0.468													35	52	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179471837	179471837	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179471837T>C	uc010zfg.1	-	227	46012	c.45788A>G	c.(45787-45789)CAA>CGA	p.Q15263R	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Q8958R|TTN_uc010zfi.1_Missense_Mutation_p.Q8891R|TTN_uc010zfj.1_Missense_Mutation_p.Q8766R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16190							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTATATTCTTGTCCCTCAAG	0.413													25	313	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196765213	196765213	+	Silent	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196765213G>T	uc002utj.3	-	28	4442	c.4341C>A	c.(4339-4341)CTC>CTA	p.L1447L		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1447	AAA 1 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						CTGTCCGAAAGAGAGCCTATG	0.303													22	110	---	---	---	---	PASS
MYRIP	25924	broad.mit.edu	37	3	40286056	40286056	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40286056G>A	uc003cka.2	+	13	2355	c.2220G>A	c.(2218-2220)CAG>CAA	p.Q740Q	MYRIP_uc010hhu.2_RNA|MYRIP_uc010hhv.2_Silent_p.Q675Q|MYRIP_uc010hhw.2_Silent_p.Q651Q|MYRIP_uc011ayz.1_Silent_p.Q553Q|uc003ckb.2_Intron	NM_015460	NP_056275	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	740	Actin-binding.				intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		TGGAGGACCAGGTGGCCACGG	0.607													10	41	---	---	---	---	PASS
NKTR	4820	broad.mit.edu	37	3	42680326	42680326	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42680326G>C	uc003clo.2	+	13	3277	c.3130G>C	c.(3130-3132)GTT>CTT	p.V1044L	NKTR_uc003clm.1_Missense_Mutation_p.V791L|NKTR_uc003clp.2_Missense_Mutation_p.V791L|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Missense_Mutation_p.V934L|NKTR_uc003clr.1_Missense_Mutation_p.V791L|NKTR_uc003cls.2_Missense_Mutation_p.V744L	NM_005385	NP_005376	P30414	NKTR_HUMAN	natural killer-tumor recognition sequence	1044					protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)		AGAGAAAAAAGTTTCTGAAAA	0.373													9	84	---	---	---	---	PASS
VPRBP	9730	broad.mit.edu	37	3	51517747	51517747	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51517747G>C	uc003dbe.1	-	3	266	c.98C>G	c.(97-99)CCT>CGT	p.P33R	VPRBP_uc003dbg.1_Missense_Mutation_p.P33R	NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein	33					interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		GGTAAGGATAGGTACCATGTC	0.398													36	108	---	---	---	---	PASS
KCTD6	200845	broad.mit.edu	37	3	58486964	58486964	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58486964G>A	uc003dkj.3	+	3	436	c.319G>A	c.(319-321)GAT>AAT	p.D107N	KCTD6_uc003dki.3_Missense_Mutation_p.D107N|KCTD6_uc003dkk.3_Missense_Mutation_p.D107N	NM_001128214	NP_001121686	Q8NC69	KCTD6_HUMAN	potassium channel tetramerisation domain	107						voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000177)|Kidney(10;0.00229)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.148)		GTGTCTCAATGATCCTAAGCC	0.413													31	102	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62477987	62477987	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62477987C>T	uc003dll.2	-	20	3222	c.2862G>A	c.(2860-2862)CTG>CTA	p.L954L	CADPS_uc003dlk.1_Silent_p.L451L|CADPS_uc003dlm.2_Silent_p.L964L|CADPS_uc003dln.2_Silent_p.L924L	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	954	MHD1.|Interaction with DRD2.				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GAAAATCATTCAGCAGCTGAA	0.433													113	100	---	---	---	---	PASS
OR5AC2	81050	broad.mit.edu	37	3	97806143	97806143	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97806143G>C	uc011bgs.1	+	1	127	c.127G>C	c.(127-129)GGC>CGC	p.G43R		NM_054106	NP_473447	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC,	43	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CACCATGGTGGGCAACCTTGG	0.448													53	369	---	---	---	---	PASS
OR5AC2	81050	broad.mit.edu	37	3	97806144	97806144	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97806144G>T	uc011bgs.1	+	1	128	c.128G>T	c.(127-129)GGC>GTC	p.G43V		NM_054106	NP_473447	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC,	43	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						ACCATGGTGGGCAACCTTGGA	0.448													54	370	---	---	---	---	PASS
OR5H2	79310	broad.mit.edu	37	3	98002381	98002381	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98002381T>C	uc003dsj.1	+	1	650	c.650T>C	c.(649-651)GTG>GCG	p.V217A		NM_001005482	NP_001005482	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H,	217	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3						TTCACCATTGTGACAGTTCTT	0.363													56	112	---	---	---	---	PASS
SENP7	57337	broad.mit.edu	37	3	101044876	101044876	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101044876G>T	uc003dut.2	-	24	3175	c.3064C>A	c.(3064-3066)CCT>ACT	p.P1022T	SENP7_uc003duu.2_Missense_Mutation_p.P957T|SENP7_uc003duv.2_Missense_Mutation_p.P989T|SENP7_uc003duw.2_Missense_Mutation_p.P956T|SENP7_uc003dux.2_Missense_Mutation_p.P858T|SENP7_uc003dus.2_Missense_Mutation_p.P210T	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1	1022	Protease.				proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5						ACATGACGAGGAAACCACTTC	0.363													15	125	---	---	---	---	PASS
BBX	56987	broad.mit.edu	37	3	107492179	107492179	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107492179A>C	uc010hpr.2	+	11	1938	c.1611A>C	c.(1609-1611)AAA>AAC	p.K537N	BBX_uc003dwk.3_Missense_Mutation_p.K537N|BBX_uc003dwl.3_Intron|BBX_uc010hps.1_Missense_Mutation_p.K558N|BBX_uc003dwm.3_Missense_Mutation_p.K537N|BBX_uc003dwo.3_5'Flank	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1	537	Lys-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			GAGAGAAGAAAATGTCAAAGG	0.448													11	92	---	---	---	---	PASS
KIAA1524	57650	broad.mit.edu	37	3	108278663	108278663	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108278663C>T	uc003dxb.3	-	16	2223	c.1954G>A	c.(1954-1956)GCA>ACA	p.A652T		NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen	652	Potential.					cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3						TCAGCCTGTGCAAGGGCTAGA	0.353													12	93	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113115361	113115361	+	Intron	SNP	T	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113115361T>G	uc003eae.1	-							NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2											central_nervous_system(1)	1						AATGTACTGCTTACCCCTGTG	0.358													11	66	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121151797	121151797	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121151797G>A	uc003eee.3	-	29	7756	c.7627C>T	c.(7627-7629)CTA>TTA	p.L2543L	POLQ_uc003eed.2_Silent_p.L1715L	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	2543					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		ACTTCATATAGGAGTTCATCA	0.428								DNA_polymerases_(catalytic_subunits)					6	66	---	---	---	---	PASS
IFT122	55764	broad.mit.edu	37	3	129207101	129207101	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129207101C>T	uc003emm.2	+	16	2059	c.1853C>T	c.(1852-1854)TCC>TTC	p.S618F	IFT122_uc003eml.2_Missense_Mutation_p.S669F|IFT122_uc003emn.2_Missense_Mutation_p.S559F|IFT122_uc003emo.2_Missense_Mutation_p.S507F|IFT122_uc003emp.2_Missense_Mutation_p.S468F|IFT122_uc010htc.2_Missense_Mutation_p.S610F|IFT122_uc011bky.1_Missense_Mutation_p.S409F|IFT122_uc003emq.2_Missense_Mutation_p.S458F|IFT122_uc003emr.2_Missense_Mutation_p.S409F|IFT122_uc011bla.1_Missense_Mutation_p.S409F|IFT122_uc010hte.2_5'UTR|IFT122_uc003ems.2_Missense_Mutation_p.S17F|IFT122_uc011bkx.1_Missense_Mutation_p.S458F|IFT122_uc011bkz.1_RNA|IFT122_uc010htd.1_Missense_Mutation_p.S97F	NM_052989	NP_443715	Q9HBG6	IF122_HUMAN	WD repeat domain 10 isoform 2	618					camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2						ATCCTGCAGTCCGCTCCCATG	0.488													26	88	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130281906	130281906	+	Intron	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130281906T>C	uc010htl.2	+							NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor						axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						GTTTGTGGTTTTGCAGGCCCT	0.383													14	139	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130287388	130287388	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130287388T>A	uc010htl.2	+	5	2372	c.2341T>A	c.(2341-2343)TTT>ATT	p.F781I		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	781	Nonhelical region.|VWFA 4.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						TGTTGAGAATTTTGACATTCT	0.463													25	109	---	---	---	---	PASS
CP	1356	broad.mit.edu	37	3	148925286	148925286	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148925286G>A	uc003ewy.3	-	5	1153	c.900C>T	c.(898-900)CAC>CAT	p.H300H	CP_uc011bnr.1_RNA|CP_uc003ewx.3_Silent_p.H81H|CP_uc003ewz.2_Silent_p.H300H|CP_uc010hvf.1_Silent_p.H26H	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor	300	F5/8 type A 1.|Plastocyanin-like 2.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	GTGCTTGCCCGTGAAAGAAAG	0.458													22	88	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155211982	155211982	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155211982G>A	uc011bok.1	-	16	2371	c.2094C>T	c.(2092-2094)TTC>TTT	p.F698F	PLCH1_uc011boj.1_Silent_p.F698F|PLCH1_uc011bol.1_Silent_p.F680F	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	698	PI-PLC Y-box.				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CATTTGCCTTGAATTTGGCTC	0.408													22	80	---	---	---	---	PASS
SLC2A2	6514	broad.mit.edu	37	3	170732477	170732477	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170732477T>C	uc003fhe.1	-	3	461	c.152A>G	c.(151-153)GAT>GGT	p.D51G	SLC2A2_uc003fhf.1_5'UTR|SLC2A2_uc011bpu.1_Intron	NM_000340	NP_000331	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose	51	Extracellular (Potential).				carbohydrate metabolic process|cellular lipid metabolic process|endocrine pancreas development|energy reserve metabolic process|regulation of insulin secretion	integral to plasma membrane|membrane fraction	D-glucose transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)			TTTTCGGTCATCCAGTGGAAC	0.358													31	145	---	---	---	---	PASS
PLD1	5337	broad.mit.edu	37	3	171330190	171330190	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171330190C>A	uc003fhs.2	-	25	2877	c.2761G>T	c.(2761-2763)GGA>TGA	p.G921*	PLD1_uc003fht.2_Nonsense_Mutation_p.G883*|PLD1_uc003fhu.3_Nonsense_Mutation_p.G215*	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a	921	Catalytic.				cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	TCACGCTTTCCCAGCATGCTG	0.423													15	98	---	---	---	---	PASS
PLD1	5337	broad.mit.edu	37	3	171330191	171330191	+	Silent	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171330191C>A	uc003fhs.2	-	25	2876	c.2760G>T	c.(2758-2760)CTG>CTT	p.L920L	PLD1_uc003fht.2_Silent_p.L882L|PLD1_uc003fhu.3_Silent_p.L214L	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a	920	Catalytic.				cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	CACGCTTTCCCAGCATGCTGC	0.418													15	96	---	---	---	---	PASS
CCDC39	339829	broad.mit.edu	37	3	180334415	180334415	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180334415G>C	uc010hxe.2	-	18	2590	c.2475C>G	c.(2473-2475)GAC>GAG	p.D825E	CCDC39_uc003fkn.2_RNA|TTC14_uc003fkm.2_Intron	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	825	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GAAGTTTGATGTCTTGTTCTT	0.303													4	37	---	---	---	---	PASS
C3orf59	151963	broad.mit.edu	37	3	192517160	192517160	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192517160C>T	uc011bsp.1	-	2	812	c.491G>A	c.(490-492)TGC>TAC	p.C164Y		NM_178496	NP_848591	Q8IYB1	M21D2_HUMAN	hypothetical protein LOC151963	164											0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)		AATGGTGCAGCAGTCTTTCCA	0.488													15	120	---	---	---	---	PASS
ATP8A1	10396	broad.mit.edu	37	4	42581886	42581886	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42581886C>G	uc003gwr.2	-	11	1176	c.944G>C	c.(943-945)GGC>GCC	p.G315A	ATP8A1_uc003gws.2_Missense_Mutation_p.G315A|ATP8A1_uc011byz.1_Missense_Mutation_p.G315A	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),	315	Helical; (Potential).				ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	AATGGCTGAGCCCACAGAACA	0.363													10	37	---	---	---	---	PASS
UBA6	55236	broad.mit.edu	37	4	68566759	68566759	+	Intron	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68566759C>T	uc003hdg.3	-						UBA6_uc003hdi.2_Intron|UBA6_uc003hdj.2_Intron|LOC550112_uc003hdl.3_5'Flank|LOC550112_uc003hdk.2_5'Flank	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2						protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0						CCCTTCTCGTCCTCTCACCTG	0.697											OREG0016213	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	35	---	---	---	---	PASS
RUFY3	22902	broad.mit.edu	37	4	71670132	71670132	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71670132A>C	uc003hfr.2	+	17	2313	c.1718A>C	c.(1717-1719)AAG>ACG	p.K573T	RUFY3_uc011cay.1_Missense_Mutation_p.K509T	NM_001037442	NP_001032519	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3 isoform 1	Error:Variant_position_missing_in_Q7L099_after_alignment					negative regulation of axonogenesis	filopodium|growth cone					0		all_hematologic(202;0.248)	Lung(101;0.235)			AGCCTAACAAAGGTAACTGTG	0.512													10	34	---	---	---	---	PASS
ARHGEF38	54848	broad.mit.edu	37	4	106534556	106534556	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106534556G>T	uc003hxu.2	+	3	546	c.400G>T	c.(400-402)GTG>TTG	p.V134L		NM_017700	NP_060170	Q9NXL2	ARH38_HUMAN	hypothetical protein LOC54848	134	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|breast(1)	3						TAGGCTGGATGTGGATAGCTT	0.438													31	94	---	---	---	---	PASS
RPL34	6164	broad.mit.edu	37	4	109543360	109543360	+	Silent	SNP	G	T	T	rs114737869	byFrequency	TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109543360G>T	uc003hyz.2	+	3	209	c.165G>T	c.(163-165)GGG>GGT	p.G55G	LOC285456_uc003hyy.2_5'Flank|LOC285456_uc011cfl.1_5'Flank|RPL34_uc003hza.2_Silent_p.G55G	NM_000995	NP_000986	P49207	RL34_HUMAN	ribosomal protein L34	55					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000286)		GACTTCGAGGGGTAAGTGTAC	0.458													13	34	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114279464	114279464	+	Silent	SNP	G	C	C	rs147826317		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114279464G>C	uc003ibe.3	+	38	9790	c.9690G>C	c.(9688-9690)ACG>ACC	p.T3230T	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Silent_p.T532T|ANK2_uc011cgb.1_Silent_p.T3245T	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	3197					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CCGTGCAAACGGGTGATATAC	0.488													22	65	---	---	---	---	PASS
PRDM5	11107	broad.mit.edu	37	4	121698419	121698419	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121698419C>A	uc003idn.2	-	13	1711	c.1461G>T	c.(1459-1461)AAG>AAT	p.K487N	PRDM5_uc003ido.2_Missense_Mutation_p.K456N|PRDM5_uc010ine.2_Missense_Mutation_p.K456N	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	487					histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						AGATTTTCTCCTTTTCTCCTG	0.378													39	82	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187539071	187539071	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187539071G>A	uc003izf.2	-	10	8857	c.8669C>T	c.(8668-8670)TCA>TTA	p.S2890L		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2890	Extracellular (Potential).|Cadherin 26.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						ACCATGATCTGATGCAACCAC	0.428										HNSCC(5;0.00058)			15	26	---	---	---	---	PASS
SLC6A3	6531	broad.mit.edu	37	5	1406353	1406353	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1406353T>A	uc003jck.2	-	12	1670	c.1549A>T	c.(1549-1551)AGC>TGC	p.S517C		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	517					cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	CAGTACAGGCTGGGCCGCTGC	0.657													48	45	---	---	---	---	PASS
SEMA5A	9037	broad.mit.edu	37	5	9066614	9066614	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9066614G>C	uc003jek.2	-	17	2930	c.2218C>G	c.(2218-2220)CCG>GCG	p.P740A		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	740	TSP type-1 4.|Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						AGCAAATTCGGATCAGCCAGG	0.557													20	179	---	---	---	---	PASS
TAS2R1	50834	broad.mit.edu	37	5	9629815	9629815	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9629815G>A	uc003jem.1	-	1	649	c.330C>T	c.(328-330)GTC>GTT	p.V110V		NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN	taste receptor T2R1	110	Cytoplasmic (Potential).				chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity			ovary(3)	3						GTGGGTGACGGACGCTGGCAA	0.448													7	23	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13841798	13841798	+	Intron	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13841798G>C	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TCAATACACTGACCTGAGCAG	0.269									Kartagener_syndrome				7	54	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13841814	13841814	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13841814G>A	uc003jfd.2	-	33	5513	c.5471C>T	c.(5470-5472)TCC>TTC	p.S1824F		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1824	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AGCAGGGAAGGATGAAAGAAA	0.279									Kartagener_syndrome				9	71	---	---	---	---	PASS
TARS	6897	broad.mit.edu	37	5	33455798	33455798	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33455798G>T	uc003jhy.2	+	6	977	c.682G>T	c.(682-684)GCA>TCA	p.A228S	TARS_uc011cob.1_Missense_Mutation_p.A216S|TARS_uc010iup.1_Missense_Mutation_p.A169S|TARS_uc011coc.1_Missense_Mutation_p.A249S|TARS_uc003jhz.2_Missense_Mutation_p.A124S|TARS_uc011cod.1_Missense_Mutation_p.A107S	NM_152295	NP_689508	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	228					threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity			ovary(2)	2					L-Threonine(DB00156)	AACTTTACTGGCAATGTTTAA	0.373													33	55	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33630995	33630995	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33630995G>A	uc003jia.1	-	13	2075	c.1912C>T	c.(1912-1914)CGA>TGA	p.R638*	ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	638	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TCTATGGGTCGGCAGTAGAGC	0.473										HNSCC(64;0.19)			5	76	---	---	---	---	PASS
SPEF2	79925	broad.mit.edu	37	5	35694425	35694425	+	Silent	SNP	A	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35694425A>T	uc003jjo.2	+	13	2046	c.1935A>T	c.(1933-1935)TCA>TCT	p.S645S	SPEF2_uc003jjq.3_Silent_p.S645S|SPEF2_uc003jjp.1_Silent_p.S136S	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	645					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GTCCAGTTTCAGATGAAGTAT	0.343													6	43	---	---	---	---	PASS
MAP1B	4131	broad.mit.edu	37	5	71490073	71490073	+	Silent	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71490073C>G	uc003kbw.3	+	5	1132	c.891C>G	c.(889-891)CTC>CTG	p.L297L	MAP1B_uc010iyw.1_Silent_p.L314L|MAP1B_uc010iyx.1_Silent_p.L171L|MAP1B_uc010iyy.1_Silent_p.L171L	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	297						microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TCTGGAAGCTCATCCGACACT	0.483													46	46	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127648397	127648397	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127648397C>T	uc003kuu.2	-	37	5247	c.4808G>A	c.(4807-4809)CGC>CAC	p.R1603H		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1603	TB 6.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GCATGAAGAGCGACTGACGCC	0.552													10	363	---	---	---	---	PASS
SHROOM1	134549	broad.mit.edu	37	5	132158930	132158930	+	Intron	SNP	A	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132158930A>T	uc003kxx.2	-						SHROOM1_uc003kxy.1_Intron	NM_133456	NP_597713	Q2M3G4	SHRM1_HUMAN	shroom family member 1						actin filament bundle assembly|cell morphogenesis	cytoplasm|microtubule	actin filament binding			pancreas(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTGCAACCTGAACCCCTTTTA	0.706													6	21	---	---	---	---	PASS
PCDHA7	56141	broad.mit.edu	37	5	140215054	140215054	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140215054C>T	uc003lhq.2	+	1	1086	c.1086C>T	c.(1084-1086)GAC>GAT	p.D362D	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Silent_p.D362D	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	362	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCAGAGGACGCCCAACCAG	0.517													27	83	---	---	---	---	PASS
NMUR2	56923	broad.mit.edu	37	5	151784573	151784573	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151784573G>A	uc003luv.2	-	1	268	c.102C>T	c.(100-102)GCC>GCT	p.A34A		NM_020167	NP_064552	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	34	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity			ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			CGCAGAGGAAGGCCAGATACT	0.527													15	38	---	---	---	---	PASS
TRIM41	90933	broad.mit.edu	37	5	180660676	180660676	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180660676C>T	uc003mne.1	+	5	1898	c.1204C>T	c.(1204-1206)CCT>TCT	p.P402S	uc003mnb.1_5'Flank|TRIM41_uc003mnc.1_3'UTR|TRIM41_uc003mnd.1_Missense_Mutation_p.P402S|TRIM41_uc003mnf.1_RNA|TRIM41_uc003mng.1_5'UTR	NM_033549	NP_291027	Q8WV44	TRI41_HUMAN	tripartite motif-containing 41 isoform 1	402						cytoplasm|nucleus	ligase activity|protein binding|zinc ion binding				0	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGTCTGGTCCCCTGACCCGTG	0.592													5	70	---	---	---	---	PASS
ZKSCAN3	80317	broad.mit.edu	37	6	28327435	28327435	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28327435C>T	uc003nle.3	+	2	288	c.72C>T	c.(70-72)GTC>GTT	p.V24V	ZKSCAN3_uc010jrc.2_Silent_p.V24V|ZKSCAN3_uc003nlf.3_Intron	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	24					positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						AGCTTCTGGTCATAAAGGTGG	0.572													100	59	---	---	---	---	PASS
DAAM2	23500	broad.mit.edu	37	6	39869080	39869080	+	Missense_Mutation	SNP	C	A	A	rs148294935	by1000genomes	TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39869080C>A	uc003oow.2	+	24	2970	c.2814C>A	c.(2812-2814)TTC>TTA	p.F938L	DAAM2_uc003oox.2_Missense_Mutation_p.F937L	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of	938	FH2.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					CTTGACAGTTCGCCAAGGCCT	0.572													5	212	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51640615	51640615	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51640615C>A	uc003pah.1	-	54	8821	c.8545G>T	c.(8545-8547)GGA>TGA	p.G2849*	PKHD1_uc010jzn.1_Nonsense_Mutation_p.G832*|PKHD1_uc003pai.2_Nonsense_Mutation_p.G2849*	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2849	G8 2.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CCAATTGTTCCTGGGTCAATA	0.303													34	57	---	---	---	---	PASS
C6orf165	154313	broad.mit.edu	37	6	88125496	88125496	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88125496G>T	uc003plv.2	+	5	468	c.376G>T	c.(376-378)GAA>TAA	p.E126*	C6orf165_uc003plw.2_5'UTR|C6orf165_uc010kbv.1_RNA|C6orf165_uc003plu.1_Nonsense_Mutation_p.E126*	NM_001031743	NP_001026913	Q8IYR0	CF165_HUMAN	hypothetical protein LOC154313 isoform 1	126										central_nervous_system(1)	1		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		TGCTAAAGAAGAATTGGAAAG	0.438													18	52	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90390407	90390407	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90390407G>A	uc003pnn.1	-	74	12282	c.12166C>T	c.(12166-12168)CGC>TGC	p.R4056C		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	4056					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TTTGGCAAGCGACGCAGAAGC	0.572													8	30	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	101847225	101847225	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101847225G>A	uc003pqp.3	+	1	321	c.72G>A	c.(70-72)CTG>CTA	p.L24L	GRIK2_uc003pqn.2_Silent_p.L24L|GRIK2_uc003pqo.3_Silent_p.L24L|GRIK2_uc010kcw.2_Silent_p.L24L	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	24					glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	TCTGTTTACTGTGGATTGGAT	0.478													22	78	---	---	---	---	PASS
THEMIS	387357	broad.mit.edu	37	6	128150678	128150678	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128150678C>T	uc003qbi.2	-	4	971	c.652G>A	c.(652-654)GAC>AAC	p.D218N	THEMIS_uc010kfa.2_Missense_Mutation_p.D121N|THEMIS_uc011ebt.1_Missense_Mutation_p.D218N|THEMIS_uc010kfb.2_Missense_Mutation_p.D183N	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	218	CABIT 1.				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						CCATAAAAGTCTTTAGGAAAT	0.358													18	77	---	---	---	---	PASS
PHACTR2	9749	broad.mit.edu	37	6	144086387	144086387	+	Intron	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144086387C>T	uc003qjq.3	+						PHACTR2_uc010khh.2_Intron|PHACTR2_uc010khi.2_Intron|PHACTR2_uc003qjr.3_Intron	NM_014721	NP_055536	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2 isoform 3								actin binding|protein phosphatase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		TGCAAGGTCTCTCTATTGTAG	0.363													27	59	---	---	---	---	PASS
PHACTR2	9749	broad.mit.edu	37	6	144086522	144086522	+	Silent	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144086522G>T	uc003qjq.3	+	6	916	c.786G>T	c.(784-786)GGG>GGT	p.G262G	PHACTR2_uc010khh.2_Silent_p.G182G|PHACTR2_uc010khi.2_Silent_p.G273G|PHACTR2_uc003qjr.3_Silent_p.G193G	NM_014721	NP_055536	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2 isoform 3	262							actin binding|protein phosphatase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		GGACAGTGGGGACCACCAAGG	0.507													16	56	---	---	---	---	PASS
STXBP5	134957	broad.mit.edu	37	6	147637480	147637480	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147637480A>T	uc003qlz.2	+	16	1900	c.1739A>T	c.(1738-1740)CAG>CTG	p.Q580L	STXBP5_uc010khz.1_Missense_Mutation_p.Q580L|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Missense_Mutation_p.Q251L	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	580	WD 9.				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		ATCCCTCCTCAGTCTCATCCA	0.448													12	42	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152777154	152777154	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152777154C>T	uc010kiw.2	-	23	3196	c.2594G>A	c.(2593-2595)TGT>TAT	p.C865Y	SYNE1_uc003qot.3_Missense_Mutation_p.C872Y|SYNE1_uc003qou.3_Missense_Mutation_p.C865Y|SYNE1_uc010kjb.1_Missense_Mutation_p.C848Y|SYNE1_uc003qow.2_Missense_Mutation_p.C160Y|SYNE1_uc003qox.1_Missense_Mutation_p.C381Y|SYNE1_uc003qoz.2_Missense_Mutation_p.C297Y|SYNE1_uc003qoy.2_Missense_Mutation_p.C432Y	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	865	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGTTTTCTTACAGTTTTCTTG	0.373										HNSCC(10;0.0054)			27	65	---	---	---	---	PASS
PNLDC1	154197	broad.mit.edu	37	6	160237602	160237602	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160237602C>T	uc003qsx.1	+	14	1226	c.1055C>T	c.(1054-1056)GCG>GTG	p.A352V	PNLDC1_uc003qsy.1_Missense_Mutation_p.A363V	NM_173516	NP_775787	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain	352	Cytoplasmic (Potential).					integral to membrane|nucleus	nucleic acid binding				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CACGAAGCCGCGTATGATGCC	0.408													19	71	---	---	---	---	PASS
GET4	51608	broad.mit.edu	37	7	934986	934986	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:934986G>C	uc003sjl.1	+	9	1003	c.911G>C	c.(910-912)AGC>ACC	p.S304T	GET4_uc003sjj.1_RNA	NM_015949	NP_057033	Q7L5D6	GET4_HUMAN	hypothetical protein LOC51608	304					tail-anchored membrane protein insertion into ER membrane|transport	BAT3 complex	protein binding				0						CTTCTGACCAGCCTCATGGGC	0.642													23	58	---	---	---	---	PASS
INTS1	26173	broad.mit.edu	37	7	1516229	1516229	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1516229C>A	uc003skn.2	-	37	5229	c.5128G>T	c.(5128-5130)GGG>TGG	p.G1710W	INTS1_uc003skm.1_5'Flank	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	1710					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		TGGTCCCGCCCCTGCCAGATG	0.687													20	39	---	---	---	---	PASS
USP42	84132	broad.mit.edu	37	7	6189570	6189570	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6189570G>A	uc011jwo.1	+	13	1866	c.1743G>A	c.(1741-1743)CCG>CCA	p.P581P	USP42_uc010kth.1_Silent_p.P514P|USP42_uc011jwp.1_Silent_p.P581P|USP42_uc011jwq.1_Silent_p.P388P|USP42_uc011jwr.1_Silent_p.P426P	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	581					cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		TAACAAAACCGATCCCCCGCA	0.527													3	42	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20197949	20197949	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20197949C>A	uc003sus.3	-	5	2344	c.2035G>T	c.(2035-2037)GAA>TAA	p.E679*	MACC1_uc010kug.2_Nonsense_Mutation_p.E679*	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5	679					positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						TCAAAATCTTCCAGGGACAGA	0.343													11	71	---	---	---	---	PASS
FAM188B	84182	broad.mit.edu	37	7	30921895	30921895	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30921895G>T	uc003tbt.2	+	16	2148	c.2071G>T	c.(2071-2073)GAC>TAC	p.D691Y	FAM188B_uc010kwe.2_Missense_Mutation_p.D662Y|AQP1_uc011kac.1_Missense_Mutation_p.D37Y|FAM188B_uc003tbu.2_Missense_Mutation_p.D211Y	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	691											0						GCTCCTGCGTGACTGGAGGAC	0.612													17	44	---	---	---	---	PASS
CCDC129	223075	broad.mit.edu	37	7	31611726	31611726	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31611726C>T	uc003tcj.1	+	6	1312	c.319C>T	c.(319-321)CAG>TAG	p.Q107*	CCDC129_uc011kad.1_Nonsense_Mutation_p.Q117*|CCDC129_uc003tci.1_Nonsense_Mutation_p.Q106*|CCDC129_uc011kae.1_Nonsense_Mutation_p.Q133*|CCDC129_uc003tck.1_Nonsense_Mutation_p.Q15*	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	107											0						ATCTTTGCATCAGTTTTCAGA	0.403													4	25	---	---	---	---	PASS
ZP3	7784	broad.mit.edu	37	7	76026960	76026960	+	Translation_Start_Site	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76026960G>A	uc003ufc.3	+	1	120	c.-220G>A	c.(-222--218)CGGTG>CGATG		SRCRB4D_uc003ufb.2_Missense_Mutation_p.T248I	NM_007155	NP_009086	P21754	ZP3_HUMAN	zona pellucida glycoprotein 3 isoform 2						binding of sperm to zona pellucida|blastocyst formation|egg coat formation|humoral immune response mediated by circulating immunoglobulin|intracellular protein transport|negative regulation of binding of sperm to zona pellucida|negative regulation of transcription, DNA-dependent|oocyte development|phosphatidylinositol-mediated signaling|positive regulation of acrosomal vesicle exocytosis|positive regulation of acrosome reaction|positive regulation of antral ovarian follicle growth|positive regulation of calcium ion import|positive regulation of calcium ion transport via store-operated calcium channel activity|positive regulation of humoral immune response|positive regulation of interferon-gamma production|positive regulation of interleukin-4 production|positive regulation of leukocyte migration|positive regulation of ovarian follicle development|positive regulation of phosphatidylinositol biosynthetic process|positive regulation of protein kinase activity|positive regulation of protein kinase B signaling cascade|positive regulation of T cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of type IV hypersensitivity|protein kinase C signaling cascade	endoplasmic reticulum|extracellular space|Golgi apparatus|integral to membrane|multivesicular body|outer acrosomal membrane|perinuclear region of cytoplasm|plasma membrane|proteinaceous extracellular matrix	acrosin binding|manganese ion transmembrane transporter activity|receptor activity|sugar binding				0						GATGTGTCCGGTGCCATAGCC	0.701													8	12	---	---	---	---	PASS
LMTK2	22853	broad.mit.edu	37	7	97822522	97822522	+	Silent	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97822522G>T	uc003upd.1	+	11	3038	c.2745G>T	c.(2743-2745)GGG>GGT	p.G915G		NM_014916	NP_055731	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2 precursor	915					early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					TGAGTGTAGGGAGTAGTCTCC	0.532													15	91	---	---	---	---	PASS
PTCD1	26024	broad.mit.edu	37	7	99023070	99023070	+	Missense_Mutation	SNP	C	A	A	rs141837479		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99023070C>A	uc003uqh.2	-	6	1216	c.1085G>T	c.(1084-1086)CGG>CTG	p.R362L	PTCD1_uc011kiw.1_Missense_Mutation_p.R411L	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	362										ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CCTCCTTGGCCGCTGCCTGCT	0.647													29	75	---	---	---	---	PASS
ZNF394	84124	broad.mit.edu	37	7	99091835	99091835	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99091835C>A	uc003uqs.2	-	3	1164	c.1003G>T	c.(1003-1005)GAC>TAC	p.D335Y	ZNF394_uc003uqt.2_Missense_Mutation_p.D128Y	NM_032164	NP_115540	Q53GI3	ZN394_HUMAN	zinc finger protein 394	335					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TCTCCACTGTCAGACTTGTGA	0.493													39	97	---	---	---	---	PASS
NAA38	51691	broad.mit.edu	37	7	117825716	117825716	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117825716G>C	uc003vjg.2	+	2	232	c.40G>C	c.(40-42)GCC>CCC	p.A14P		NM_016200	NP_057284	O95777	NAA38_HUMAN	U6 snRNA-associated Sm-like protein LSm8	14					nuclear mRNA splicing, via spliceosome	nucleus|ribonucleoprotein complex	protein binding|U6 snRNA binding				0						AGGAACTGTTGCCGTTATTAC	0.343													8	118	---	---	---	---	PASS
CADPS2	93664	broad.mit.edu	37	7	122111574	122111574	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122111574A>G	uc010lkp.2	-	13	2204	c.2041T>C	c.(2041-2043)TGT>CGT	p.C681R	CADPS2_uc011knx.1_Missense_Mutation_p.C52R|CADPS2_uc003vkg.3_Missense_Mutation_p.C378R|CADPS2_uc010lkq.2_Missense_Mutation_p.C678R	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	681					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TAACGGGCACAGTACTCATCT	0.418													2	18	---	---	---	---	PASS
OPN1SW	611	broad.mit.edu	37	7	128413738	128413738	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128413738A>C	uc003vnt.3	-	4	892	c.892T>G	c.(892-894)TAC>GAC	p.Y298D		NM_001708	NP_001699	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	298	Helical; Name=7; (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0						ATGGGATTGTAGATGCAAGCA	0.458													11	41	---	---	---	---	PASS
WDR91	29062	broad.mit.edu	37	7	134881005	134881005	+	Silent	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134881005G>T	uc003vsp.2	-	8	1197	c.1135C>A	c.(1135-1137)CGG>AGG	p.R379R	WDR91_uc010lmq.2_5'UTR|WDR91_uc010lmr.2_RNA	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	379										breast(2)|ovary(1)|skin(1)	4						GAGGATGCCCGAGTCAGTGGC	0.622													3	40	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141727446	141727446	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141727446C>T	uc003vwy.2	+	10	1186	c.1132C>T	c.(1132-1134)CTT>TTT	p.L378F		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	378	Lumenal (Potential).|Maltase.				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTACTGGGCGCTTGGATTTCA	0.443													10	65	---	---	---	---	PASS
TMEM176B	28959	broad.mit.edu	37	7	150493564	150493564	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150493564C>T	uc003wht.3	-	2	260	c.94G>A	c.(94-96)GCT>ACT	p.A32T	TMEM176B_uc003whu.3_Missense_Mutation_p.A32T|TMEM176B_uc003whv.3_Missense_Mutation_p.A32T|TMEM176B_uc003whw.3_Missense_Mutation_p.A32T	NM_001101313	NP_001094783	Q3YBM2	T176B_HUMAN	transmembrane protein 176B isoform a	32					cell differentiation|organ morphogenesis	integral to membrane|nuclear membrane				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGTGTCAAAGCTGACTCCTGG	0.527													26	54	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35606179	35606179	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35606179A>T	uc003xjr.1	+	12	2229	c.1901A>T	c.(1900-1902)CAT>CTT	p.H634L	UNC5D_uc003xjs.1_Missense_Mutation_p.H629L|UNC5D_uc003xju.1_Missense_Mutation_p.H210L	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	634	ZU5.|Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGGAATATCCATTTAAAGAAG	0.468													13	146	---	---	---	---	PASS
ZNF703	80139	broad.mit.edu	37	8	37556171	37556171	+	Silent	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37556171C>A	uc003xjy.1	+	2	1949	c.1752C>A	c.(1750-1752)GCC>GCA	p.A584A		NM_025069	NP_079345	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	584					adherens junction assembly|mammary gland epithelial cell differentiation|negative regulation of homotypic cell-cell adhesion|negative regulation of transcription, DNA-dependent|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of mammary gland epithelial cell proliferation|regulation of canonical Wnt receptor signaling pathway|regulation of cell cycle|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			breast(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			TAGCTTCAGCCTCGGCGCTGG	0.507													5	52	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41834699	41834699	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41834699T>C	uc010lxb.2	-	8	1734	c.1190A>G	c.(1189-1191)AAT>AGT	p.N397S	MYST3_uc010lxc.2_Missense_Mutation_p.N397S|MYST3_uc003xon.3_Missense_Mutation_p.N397S|MYST3_uc010lxd.2_Missense_Mutation_p.N397S	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	397	Interaction with RUNX1-1.				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			CAAGGAGACATTGCTATCTCT	0.453													8	188	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52366245	52366245	+	Silent	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52366245G>T	uc003xqu.3	-	10	1184	c.1083C>A	c.(1081-1083)ATC>ATA	p.I361I		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	361	Ig-like C2-type 2.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TGGTCCAAGTGATAAGAGGGT	0.507													17	53	---	---	---	---	PASS
RB1CC1	9821	broad.mit.edu	37	8	53573547	53573547	+	Silent	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53573547T>C	uc003xre.3	-	11	2124	c.1566A>G	c.(1564-1566)AAA>AAG	p.K522K	RB1CC1_uc003xrf.3_Silent_p.K522K	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1	522					autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TCTTTCCATCTTTGACTAAAG	0.289													17	84	---	---	---	---	PASS
LYPLA1	10434	broad.mit.edu	37	8	54967634	54967634	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54967634C>G	uc003xry.2	-	6	540	c.346G>C	c.(346-348)GGA>CGA	p.G116R	LYPLA1_uc011ldx.1_Missense_Mutation_p.G111R|LYPLA1_uc003xrz.2_Missense_Mutation_p.G95R	NM_006330	NP_006321	O75608	LYPA1_HUMAN	lysophospholipase 1	116					fatty acid metabolic process|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytosol	lysophospholipase activity|palmitoyl-(protein) hydrolase activity			central_nervous_system(1)	1		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;8.48e-07)|Epithelial(17;9.29e-05)|all cancers(17;0.000689)			GAAAACCCTCCCAAAATAATT	0.328													4	72	---	---	---	---	PASS
CSPP1	79848	broad.mit.edu	37	8	68087623	68087623	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68087623G>C	uc003xxi.2	+	26	3182	c.3151G>C	c.(3151-3153)GAG>CAG	p.E1051Q	ARFGEF1_uc003xxl.1_3'UTR|CSPP1_uc003xxj.2_Missense_Mutation_p.E1016Q|CSPP1_uc003xxk.2_Missense_Mutation_p.E671Q|CSPP1_uc010lyw.2_Missense_Mutation_p.E111Q	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1	1051						centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			CCTGCTAAGAGAGCAGCAGAA	0.418													23	79	---	---	---	---	PASS
KCNB2	9312	broad.mit.edu	37	8	73480396	73480396	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73480396C>A	uc003xzb.2	+	2	1015	c.427C>A	c.(427-429)CAA>AAA	p.Q143K		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	143	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			CAGATATCATCAAAAAAAAGA	0.443													4	130	---	---	---	---	PASS
SLC26A7	115111	broad.mit.edu	37	8	92406156	92406156	+	Intron	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92406156T>C	uc003yex.2	+						SLC26A7_uc003yey.2_Intron|SLC26A7_uc003yez.2_Intron|SLC26A7_uc003yfa.2_Intron	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a							basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			ACTTGTGCTTTCTTGAAGCTT	0.363													19	111	---	---	---	---	PASS
C8orf37	157657	broad.mit.edu	37	8	96259840	96259840	+	3'UTR	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96259840C>T	uc003yho.1	-	6						NM_177965	NP_808880	Q96NL8	CH037_HUMAN	hypothetical protein LOC157657												0	Breast(36;3.41e-05)					GTGCAGTCTGCATTCTTAATG	0.458													10	69	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104898313	104898313	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104898313C>A	uc003yls.2	+	2	1061	c.820C>A	c.(820-822)CCA>ACA	p.P274T	RIMS2_uc003ylp.2_Missense_Mutation_p.P496T|RIMS2_uc003ylw.2_Missense_Mutation_p.P304T|RIMS2_uc003ylq.2_Missense_Mutation_p.P304T|RIMS2_uc003ylr.2_Missense_Mutation_p.P304T	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	527					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ACCTCCACCACCAAAGCCTCA	0.428										HNSCC(12;0.0054)			13	51	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113314135	113314135	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113314135G>T	uc003ynu.2	-	53	8486	c.8327C>A	c.(8326-8328)TCA>TAA	p.S2776*	CSMD3_uc003yns.2_Nonsense_Mutation_p.S1978*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.S2736*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.S2607*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2776	Extracellular (Potential).|Sushi 17.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TGAGCCATATGAAGTTTGAGT	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			30	69	---	---	---	---	PASS
SLC30A8	169026	broad.mit.edu	37	8	118184797	118184797	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118184797G>A	uc003yoh.2	+	8	1217	c.987G>A	c.(985-987)GTG>GTA	p.V329V	SLC30A8_uc010mcz.2_Silent_p.V280V|SLC30A8_uc011lia.1_Silent_p.V280V|SLC30A8_uc003yog.2_Silent_p.V280V	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8	329	Cytoplasmic (Potential).				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			ACAGCCAAGTGGTTCGGAGAG	0.507													21	107	---	---	---	---	PASS
DMRTA1	63951	broad.mit.edu	37	9	22451172	22451172	+	Silent	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22451172G>T	uc003zpp.1	+	2	1002	c.777G>T	c.(775-777)GGG>GGT	p.G259G		NM_022160	NP_071443	Q5VZB9	DMRTA_HUMAN	DMRT-like family A1	259					cell differentiation|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|skin(1)	2		all_cancers(5;4.09e-243)|Acute lymphoblastic leukemia(3;8.25e-150)|all_hematologic(3;4.25e-147)|Esophageal squamous(3;2.32e-09)|Renal(3;1.71e-07)|Breast(3;2.07e-06)|Hepatocellular(5;0.00563)		GBM - Glioblastoma multiforme(1;5.12e-278)|Lung(24;8.2e-52)|LUSC - Lung squamous cell carcinoma(38;1.46e-37)|OV - Ovarian serous cystadenocarcinoma(39;0.0517)		GTGTCATTGGGAAACAAAGTA	0.438													21	52	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101801014	101801014	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101801014C>T	uc004azb.1	+	22	2680	c.2474C>T	c.(2473-2475)CCG>CTG	p.P825L		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	825	Triple-helical region 4 (COL4).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				GTGGGGCCTCCGGTTGGTATC	0.468													27	114	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119858349	119858349	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119858349T>A	uc004bjs.1	-	5	1351	c.1250A>T	c.(1249-1251)CAG>CTG	p.Q417L	ASTN2_uc004bjr.1_Missense_Mutation_p.Q417L|ASTN2_uc004bjt.1_Missense_Mutation_p.Q366L	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	417	Cytoplasmic (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						ACTGCGGTACTGCTCCGTGTA	0.512													9	47	---	---	---	---	PASS
MASTL	84930	broad.mit.edu	37	10	27459686	27459686	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27459686G>A	uc001itm.2	+	8	2437	c.1798G>A	c.(1798-1800)GAA>AAA	p.E600K	MASTL_uc001itl.2_Missense_Mutation_p.E600K|MASTL_uc009xkw.1_Missense_Mutation_p.E600K|MASTL_uc009xkx.1_RNA	NM_032844	NP_116233	Q96GX5	GWL_HUMAN	microtubule associated serine/threonine	600	Protein kinase.				cell division|G2/M transition of mitotic cell cycle|mitosis|negative regulation of protein phosphatase type 2A activity|regulation of cell cycle|response to DNA damage stimulus	centrosome|cleavage furrow|nucleus	ATP binding|protein phosphatase 2A binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						ATCCTCTTTTGAAGAATCAAA	0.373													14	29	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43285800	43285800	+	Silent	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43285800G>T	uc001jaj.2	+	5	835	c.477G>T	c.(475-477)GGG>GGT	p.G159G		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	159					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						CCAGCTTTGGGTTTGAAATGG	0.358													30	108	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55582958	55582958	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55582958C>A	uc001jju.1	-	33	4923	c.4528G>T	c.(4528-4530)GCA>TCA	p.A1510S	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.A1507S|PCDH15_uc010qhw.1_Missense_Mutation_p.A1470S|PCDH15_uc010qhx.1_Missense_Mutation_p.A1441S|PCDH15_uc010qhy.1_Missense_Mutation_p.A1517S|PCDH15_uc010qhz.1_Missense_Mutation_p.A1512S|PCDH15_uc010qia.1_Missense_Mutation_p.A1490S|PCDH15_uc010qib.1_Missense_Mutation_p.A1487S	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1510	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				AATTTTCTTGCAGACTTCAGT	0.373										HNSCC(58;0.16)			79	34	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55663006	55663006	+	Silent	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55663006C>A	uc001jju.1	-	26	3893	c.3498G>T	c.(3496-3498)GTG>GTT	p.V1166V	PCDH15_uc010qhq.1_Silent_p.V1171V|PCDH15_uc010qhr.1_Silent_p.V1166V|PCDH15_uc010qhs.1_Silent_p.V1178V|PCDH15_uc010qht.1_Silent_p.V1173V|PCDH15_uc010qhu.1_Silent_p.V1166V|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Silent_p.V1166V|PCDH15_uc010qhw.1_Silent_p.V1129V|PCDH15_uc010qhx.1_Silent_p.V1095V|PCDH15_uc010qhy.1_Silent_p.V1171V|PCDH15_uc010qhz.1_Silent_p.V1166V|PCDH15_uc010qia.1_Silent_p.V1144V|PCDH15_uc010qib.1_Silent_p.V1144V	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1166	Cadherin 11.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CGCATACCTTCACTCTGAGTA	0.363										HNSCC(58;0.16)			35	30	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55782681	55782681	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55782681G>T	uc001jju.1	-	19	2892	c.2497C>A	c.(2497-2499)CCA>ACA	p.P833T	PCDH15_uc010qhq.1_Missense_Mutation_p.P838T|PCDH15_uc010qhr.1_Missense_Mutation_p.P833T|PCDH15_uc010qhs.1_Missense_Mutation_p.P845T|PCDH15_uc010qht.1_Missense_Mutation_p.P840T|PCDH15_uc010qhu.1_Missense_Mutation_p.P833T|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.P833T|PCDH15_uc010qhw.1_Missense_Mutation_p.P796T|PCDH15_uc010qhx.1_Missense_Mutation_p.P762T|PCDH15_uc010qhy.1_Missense_Mutation_p.P838T|PCDH15_uc010qhz.1_Missense_Mutation_p.P833T|PCDH15_uc010qia.1_Missense_Mutation_p.P811T|PCDH15_uc010qib.1_Missense_Mutation_p.P811T|PCDH15_uc001jjw.2_Missense_Mutation_p.P833T	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	833	Extracellular (Potential).|Cadherin 8.				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				GTCCCAGCTGGCAAATTCTCT	0.358										HNSCC(58;0.16)			5	153	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68138905	68138905	+	Intron	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68138905C>G	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						TGGCAACTGACTTACCAGTAC	0.408													16	71	---	---	---	---	PASS
DDIT4	54541	broad.mit.edu	37	10	74034084	74034084	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74034084C>T	uc001jsx.1	+	2	312	c.110C>T	c.(109-111)GCG>GTG	p.A37V		NM_019058	NP_061931	Q9NX09	DDIT4_HUMAN	RTP801	37					apoptosis					pancreas(1)	1						TGGGGGTCGGCGACCCGGGAG	0.687													31	24	---	---	---	---	PASS
MYST4	23522	broad.mit.edu	37	10	76790711	76790711	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76790711C>T	uc001jwn.1	+	18	6622	c.6129C>T	c.(6127-6129)CAC>CAT	p.H2043H	MYST4_uc001jwo.1_Silent_p.H1751H|MYST4_uc001jwp.1_Silent_p.H1860H	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic	2043	Interaction with RUNX1 and RUNX2.|Met-rich.				histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)					CCCCACCCCACGGTAACATGA	0.532			T	CREBBP	AML								15	39	---	---	---	---	PASS
LIPJ	142910	broad.mit.edu	37	10	90362337	90362337	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90362337G>C	uc001kff.2	+	9	1042	c.728G>C	c.(727-729)CGT>CCT	p.R243P		NM_001010939	NP_001010939	Q5W064	LIPJ_HUMAN	lipase, family member J	243					lipid catabolic process		hydrolase activity			ovary(1)	1		all_cancers(4;2.79e-10)|Prostate(4;1.68e-15)|all_epithelial(4;1.43e-09)|Colorectal(252;0.0381)|Breast(4;0.141)|Melanoma(5;0.2)|all_hematologic(4;0.222)		Colorectal(12;1.02e-05)|COAD - Colon adenocarcinoma(12;1.54e-05)		CCTCAGAGTCGTTTGGATGTG	0.274													37	64	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97131812	97131812	+	Intron	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97131812G>A	uc001kkp.2	-						SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		GGAGGCTGACGGGAAGCAGAG	0.468													18	24	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97200878	97200878	+	Intron	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97200878C>G	uc001kkp.2	-						SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron|SORBS1_uc001kkx.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TTTAAAATGACTTACCAGAAC	0.438													27	139	---	---	---	---	PASS
PIK3AP1	118788	broad.mit.edu	37	10	98411397	98411397	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98411397C>T	uc001kmq.2	-	5	852	c.724G>A	c.(724-726)GGG>AGG	p.G242R	PIK3AP1_uc001kmp.2_Missense_Mutation_p.G64R	NM_152309	NP_689522	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	242	DBB.					cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		GAAACGTTCCCAGATGAAAGG	0.393													11	21	---	---	---	---	PASS
MIR1307	100302174	broad.mit.edu	37	10	105154076	105154076	+	RNA	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105154076G>T	hsa-mir-1307|MI0006444	-			c.83G>T			USMG5_uc001kww.1_5'UTR|USMG5_uc001kwx.1_Intron|PDCD11_uc001kwy.1_5'Flank																	0						ACGCCACGCCGAGTCGATTGG	0.498													3	63	---	---	---	---	PASS
PDCD11	22984	broad.mit.edu	37	10	105183290	105183290	+	Intron	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105183290T>C	uc001kwy.1	+							NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		ACTGTGGTTCTGCACTGCAGG	0.468													36	19	---	---	---	---	PASS
XPNPEP1	7511	broad.mit.edu	37	10	111630550	111630550	+	Silent	SNP	G	A	A	rs143796899		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111630550G>A	uc001kyp.1	-	18	1646	c.1506C>T	c.(1504-1506)TGC>TGT	p.C502C	XPNPEP1_uc009xxt.1_Silent_p.C521C|XPNPEP1_uc001kyq.1_Silent_p.C431C	NM_020383	NP_065116	Q9NQW7	XPP1_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 1,	502					bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity			ovary(3)|pancreas(1)	4		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		AACTGATGCCGCAAGGACCCT	0.498													4	174	---	---	---	---	PASS
PNLIPRP2	5408	broad.mit.edu	37	10	118396324	118396324	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118396324G>C	uc001lcq.2	+	12	991	c.968G>C	c.(967-969)GGA>GCA	p.G323A	PNLIPRP2_uc009xyv.1_RNA	NM_005396	NP_005387	P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2	322					galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity			large_intestine(1)	1				all cancers(201;0.015)		CCAGCTGAAGGATGCCCCAAA	0.408													8	4	---	---	---	---	PASS
C10orf119	79892	broad.mit.edu	37	10	121596523	121596523	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121596523G>T	uc001ler.2	-	13	1731	c.1433C>A	c.(1432-1434)GCC>GAC	p.A478D	C10orf119_uc001leq.1_Missense_Mutation_p.A303D|C10orf119_uc001les.1_Missense_Mutation_p.A303D	NM_024834	NP_079110	Q9BTE3	MCMBP_HUMAN	chromosome 10 open reading frame 119	478					cell division|DNA-dependent DNA replication|mitosis|S phase of mitotic cell cycle|sister chromatid cohesion	nucleus	chromatin binding				0		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.0044)		GTTGCTCAGGGCTGTCACATT	0.428													4	80	---	---	---	---	PASS
PDE3B	5140	broad.mit.edu	37	11	14808182	14808182	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14808182G>T	uc001mln.2	+	3	1582	c.1229G>T	c.(1228-1230)TGT>TTT	p.C410F	PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	410					cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						TTTTACCCCTGTTCTGAAATA	0.378													74	70	---	---	---	---	PASS
KIF18A	81930	broad.mit.edu	37	11	28058072	28058072	+	Silent	SNP	A	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28058072A>G	uc001msc.2	-	14	2270	c.2088T>C	c.(2086-2088)CTT>CTC	p.L696L		NM_031217	NP_112494	Q8NI77	KI18A_HUMAN	kinesin family member 18A	696					blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2						GTTCTTTGCTAAGAGAATCAT	0.378													26	106	---	---	---	---	PASS
NUP160	23279	broad.mit.edu	37	11	47830025	47830025	+	Silent	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47830025T>C	uc001ngm.2	-	18	2383	c.2298A>G	c.(2296-2298)ACA>ACG	p.T766T	NUP160_uc009ylw.2_RNA	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa	766					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						GTAGGGGAGCTGTTCGATGTA	0.418													45	27	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	56143177	56143177	+	IGR	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56143177C>A								OR8J1 (14506 upstream) : OR5R1 (41559 downstream)																							TGAAGATGCCCCTCTTTGTGC	0.453													18	83	---	---	---	---	PASS
SLC15A3	51296	broad.mit.edu	37	11	60707042	60707042	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60707042C>A	uc001nqn.2	-	6	1579	c.1345G>T	c.(1345-1347)GTC>TTC	p.V449F	SLC15A3_uc001nqo.2_Missense_Mutation_p.R392S	NM_016582	NP_057666	Q8IY34	S15A3_HUMAN	solute carrier family 15, member 3	449					oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity				0						TTGTACAGGACCTCCCCAATC	0.567													8	40	---	---	---	---	PASS
RAB6A	5870	broad.mit.edu	37	11	73389000	73389000	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73389000G>A	uc001oue.2	-	8	1091	c.570C>T	c.(568-570)GAC>GAT	p.D190D	RAB6A_uc001ouf.2_Silent_p.D190D|RAB6A_uc009yts.2_Silent_p.D86D	NM_002869	NP_002860	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family isoform a	190					minus-end-directed organelle transport along microtubule|peptidyl-cysteine methylation|protein targeting to Golgi|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic vesicle|cytosol|Golgi membrane|trans-Golgi network	GTP binding|GTPase activity|protein domain specific binding				0						CCAGTTTTATGTCAATCACTG	0.408													29	35	---	---	---	---	PASS
OMP	4975	broad.mit.edu	37	11	76814207	76814207	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76814207C>T	uc010rsk.1	+	1	322	c.322C>T	c.(322-324)CGC>TGC	p.R108C	CAPN5_uc001oxx.2_Intron|CAPN5_uc009yup.2_Intron|CAPN5_uc009yuq.2_Intron|CAPN5_uc001oxy.2_Intron	NM_006189	NP_006180	P47874	OMP_HUMAN	olfactory marker protein	108					sensory perception of smell|synaptic transmission						0						CATCTTCTGGCGCAAGGAGGA	0.612													9	45	---	---	---	---	PASS
FZD4	8322	broad.mit.edu	37	11	86662462	86662462	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86662462C>G	uc001pce.2	-	2	1642	c.1336G>C	c.(1336-1338)GTT>CTT	p.V446L	PRSS23_uc001pcc.1_RNA	NM_012193	NP_036325	Q9ULV1	FZD4_HUMAN	frizzled 4 precursor	446	Helical; Name=6; (Potential).				canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|negative regulation of cell-substrate adhesion|neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|progesterone secretion|regulation of vascular endothelial growth factor receptor signaling pathway|substrate adhesion-dependent cell spreading|vasculogenesis|Wnt receptor signaling pathway, calcium modulating pathway	cell projection|cell surface|cytoplasm	cytokine binding|G-protein coupled receptor activity|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|Wnt receptor activity|Wnt-protein binding			large_intestine(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GTTGCAGGAACTGTGTACAGT	0.403													11	145	---	---	---	---	PASS
MMP12	4321	broad.mit.edu	37	11	102742661	102742661	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102742661G>T	uc001phk.2	-	3	417	c.372C>A	c.(370-372)GAC>GAA	p.D124E		NM_002426	NP_002417	P39900	MMP12_HUMAN	matrix metalloproteinase 12 preproprotein	124		Calcium 1.			positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)	CACGGTTCATGTCAGGTGTGT	0.388													6	39	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108382994	108382994	+	Silent	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108382994T>C	uc001pkk.2	-	6	3351	c.3240A>G	c.(3238-3240)GAA>GAG	p.E1080E	EXPH5_uc010rvy.1_Silent_p.E892E|EXPH5_uc010rvz.1_Silent_p.E924E|EXPH5_uc010rwa.1_Silent_p.E1004E	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	1080					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CTTTGGAACATTCATTCGCTG	0.428													22	107	---	---	---	---	PASS
CLDN25	644672	broad.mit.edu	37	11	113651059	113651059	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113651059T>A	uc009yyw.1	+	1	542	c.542T>A	c.(541-543)CTA>CAA	p.L181Q		NM_001101389	NP_001094859	C9JDP6	CLD25_HUMAN	claudin 25	181	Helical; (Potential).					integral to membrane|tight junction	structural molecule activity				0						CTTGGTGGGCTACTCCTCATC	0.557													29	53	---	---	---	---	PASS
ARHGEF12	23365	broad.mit.edu	37	11	120312406	120312406	+	Intron	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120312406C>A	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron|ARHGEF12_uc010rzn.1_Intron|ARHGEF12_uc009zau.1_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		ATAATCATTTCTTCCTCTAGA	0.373			T	MLL	AML								15	57	---	---	---	---	PASS
ADAMTS15	170689	broad.mit.edu	37	11	130332161	130332161	+	Intron	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130332161C>T	uc010scd.1	+							NM_139055	NP_620686	Q8TE58	ATS15_HUMAN	a disintegrin-like and metalloprotease						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		TAAGCCAGGACGGCGGGAGGG	0.652													8	10	---	---	---	---	PASS
LEPREL2	10536	broad.mit.edu	37	12	6947151	6947151	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6947151A>G	uc001qra.1	+	15	1893	c.1859A>G	c.(1858-1860)CAG>CGG	p.Q620R	LEPREL2_uc001qqz.1_Missense_Mutation_p.Q427R|LEPREL2_uc001qrb.1_Missense_Mutation_p.Q427R|GNB3_uc001qrc.2_5'Flank|GNB3_uc001qrd.2_5'Flank|GNB3_uc009zfe.2_5'Flank	NM_014262	NP_055077	Q8IVL6	P3H3_HUMAN	leprecan-like 2 precursor	620	Fe2OG dioxygenase.				negative regulation of cell proliferation	endoplasmic reticulum	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity				0					L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GATGACTTCCAGGGTGGGGAC	0.627													7	13	---	---	---	---	PASS
CD163L1	283316	broad.mit.edu	37	12	7593778	7593778	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7593778C>T	uc001qsy.2	-	2	122	c.96G>A	c.(94-96)CTG>CTA	p.L32L	CD163L1_uc010sge.1_Silent_p.L32L	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	32						extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						AGCAGGAATTCAGGAGCAGGA	0.413													74	114	---	---	---	---	PASS
ARHGAP9	64333	broad.mit.edu	37	12	57867924	57867924	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57867924C>T	uc001sod.2	-	19	2282	c.2089G>A	c.(2089-2091)GAC>AAC	p.D697N	ARHGAP9_uc001sny.2_Intron|ARHGAP9_uc001snz.2_Missense_Mutation_p.D423N|ARHGAP9_uc001soa.2_Missense_Mutation_p.D296N|ARHGAP9_uc001sob.2_Missense_Mutation_p.D607N|ARHGAP9_uc001soc.2_Missense_Mutation_p.D607N|ARHGAP9_uc001soe.1_Missense_Mutation_p.D686N	NM_032496	NP_115885	Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9 isoform 1	626	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			lung(1)	1			GBM - Glioblastoma multiforme(3;3.37e-34)			ACATGAATGTCATCCCACTCA	0.552													12	47	---	---	---	---	PASS
IRAK3	11213	broad.mit.edu	37	12	66603993	66603993	+	Intron	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66603993C>G	uc001sth.2	+						IRAK3_uc010ssy.1_Intron	NM_007199	NP_009130	Q9Y616	IRAK3_HUMAN	interleukin-1 receptor-associated kinase 3						interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8				GBM - Glioblastoma multiforme(28;0.0203)		TATGAAAAAACCAGTTTTTTT	0.269													4	129	---	---	---	---	PASS
MDM2	4193	broad.mit.edu	37	12	69233474	69233474	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69233474T>A	uc001sui.2	+	11	1626	c.1339T>A	c.(1339-1341)TGT>AGT	p.C447S	MDM2_uc009zri.2_Missense_Mutation_p.C402S|MDM2_uc009zqx.2_Missense_Mutation_p.C392S|MDM2_uc009zqw.2_3'UTR|MDM2_uc001suk.2_Intron|MDM2_uc001sun.3_Missense_Mutation_p.C266S|MDM2_uc009zqz.2_Missense_Mutation_p.C394S|MDM2_uc009zra.2_Missense_Mutation_p.C245S|MDM2_uc001sum.1_Missense_Mutation_p.C75S|MDM2_uc009zrd.2_Missense_Mutation_p.C131S|MDM2_uc009zrc.2_Missense_Mutation_p.C131S|MDM2_uc009zre.2_Missense_Mutation_p.C188S|MDM2_uc009zrf.2_Missense_Mutation_p.C131S|MDM2_uc001suo.2_Missense_Mutation_p.C241S|MDM2_uc009zrg.2_Missense_Mutation_p.C163S|MDM2_uc009zrh.2_Missense_Mutation_p.C215S	NM_002392	NP_002383	Q00987	MDM2_HUMAN	mouse double minute 2 homolog isoform MDM2	441	Necessary for interaction with USP2.|RING-type.			C->G: Fails to interact with MDM4.	cellular response to hypoxia|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|establishment of protein localization|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein complex assembly|protein destabilization|protein localization to nucleus|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to antibiotic|synaptic transmission	cytosol|endocytic vesicle membrane|insoluble fraction|nucleolus|nucleoplasm|plasma membrane|protein complex	enzyme binding|identical protein binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|central_nervous_system(1)	3	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TTGTGTGATTTGTCAAGGTCG	0.413			A		sarcoma|glioma|colorectal|other								25	178	---	---	---	---	PASS
PLXNC1	10154	broad.mit.edu	37	12	94690982	94690982	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94690982G>A	uc001tdc.2	+	25	4201	c.3952G>A	c.(3952-3954)GAC>AAC	p.D1318N	PLXNC1_uc010sut.1_Missense_Mutation_p.D365N|PLXNC1_uc009zsv.2_Missense_Mutation_p.D57N	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	1318	Cytoplasmic (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						GTACTCGGATGACCACTGCCA	0.493													21	143	---	---	---	---	PASS
FAM71C	196472	broad.mit.edu	37	12	100043183	100043183	+	3'UTR	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100043183C>A	uc001tgn.2	+	2					ANKS1B_uc001tge.1_Intron|ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_153364	NP_699195	Q8NEG0	FA71C_HUMAN	hypothetical protein LOC196472												0				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		ATGAATCCAACATACCTCCCA	0.418													69	40	---	---	---	---	PASS
SBNO1	55206	broad.mit.edu	37	12	123801907	123801907	+	Intron	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123801907T>A	uc010tap.1	-						SBNO1_uc010tao.1_Intron|SBNO1_uc010taq.1_Intron|SBNO1_uc001ues.1_5'Flank	NM_018183	NP_060653	A3KN83	SBNO1_HUMAN	sno, strawberry notch homolog 1								ATP binding|DNA binding|hydrolase activity			breast(5)|skin(2)|ovary(1)|kidney(1)	9	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		CAATATTCTGTGTCAAATATA	0.388													20	29	---	---	---	---	PASS
GTF2H3	2967	broad.mit.edu	37	12	124130034	124130034	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124130034G>C	uc001ufo.1	+	3	152	c.126G>C	c.(124-126)ATG>ATC	p.M42I	GTF2H3_uc010tau.1_Missense_Mutation_p.M1I	NM_001516	NP_001507	Q13889	TF2H3_HUMAN	general transcription factor IIH, polypeptide 3,	42					mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	core TFIIH complex|holo TFIIH complex	damaged DNA binding|metal ion binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|translation factor activity, nucleic acid binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.1e-05)|Epithelial(86;0.000388)|all cancers(50;0.00362)		ATGCCGTGATGGTGCTGGGAA	0.363								NER					39	18	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132551372	132551372	+	Silent	SNP	A	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132551372A>C	uc001ujn.2	+	48	8642	c.8607A>C	c.(8605-8607)GCA>GCC	p.A2869A	EP400_uc001ujl.2_Silent_p.A2868A|EP400_uc001ujm.2_Silent_p.A2788A|EP400_uc001ujp.2_Silent_p.A79A	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2905					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		AGACCCAGGCACCCCAGCCAG	0.622													9	45	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19751624	19751624	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19751624G>T	uc009zzj.2	-	4	548	c.499C>A	c.(499-501)CTA>ATA	p.L167I		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	167					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GCAAATTCTAGCTTGGACTTC	0.577													23	115	---	---	---	---	PASS
KCNRG	283518	broad.mit.edu	37	13	50589841	50589841	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50589841T>C	uc001vdu.2	+	1	452	c.212T>C	c.(211-213)TTA>TCA	p.L71S	DLEU2_uc001vdn.1_Intron|DLEU2_uc001vdo.1_Intron|KCNRG_uc001vdt.2_Missense_Mutation_p.L71S|TRIM13_uc001vdp.1_3'UTR|TRIM13_uc001vdq.1_3'UTR|TRIM13_uc001vdr.1_3'UTR|TRIM13_uc001vds.1_3'UTR	NM_173605	NP_775876	Q8N5I3	KCNRG_HUMAN	potassium channel regulator isoform 1	71	BTB.					voltage-gated potassium channel complex	identical protein binding|voltage-gated potassium channel activity				0		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.48e-10)|COAD - Colon adenocarcinoma(199;0.204)		CACCAGCTTTTATTACCCACT	0.383													15	109	---	---	---	---	PASS
FBXL3	26224	broad.mit.edu	37	13	77581289	77581289	+	Silent	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77581289G>C	uc001vkd.2	-	5	1649	c.1278C>G	c.(1276-1278)CCC>CCG	p.P426P		NM_012158	NP_036290	Q9UKT7	FBXL3_HUMAN	F-box and leucine-rich repeat protein 3	426					regulation of circadian rhythm|rhythmic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.218)		GBM - Glioblastoma multiforme(99;0.0521)		TTTACCAAGTGGGCATCATGT	0.358													14	66	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77714292	77714292	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77714292T>G	uc001vkf.2	-	52	7385	c.7294A>C	c.(7294-7296)AAA>CAA	p.K2432Q	MYCBP2_uc010aev.2_Missense_Mutation_p.K1836Q	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	2432					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GCCACAAATTTTCGAACCTGA	0.423													11	21	---	---	---	---	PASS
OR4N5	390437	broad.mit.edu	37	14	20612106	20612106	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20612106C>G	uc010tla.1	+	1	212	c.212C>G	c.(211-213)GCA>GGA	p.A71G		NM_001004724	NP_001004724	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N,	71	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		TTACTGGATGCATCCTACTCC	0.473													43	223	---	---	---	---	PASS
SFTA3	253970	broad.mit.edu	37	14	36946257	36946257	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36946257G>A	uc001wtr.2	-	3	812	c.180C>T	c.(178-180)TGC>TGT	p.C60C	SFTA3_uc001wtq.2_RNA|SFTA3_uc001wts.2_RNA	NM_001101341	NP_001094811	P0C7M3	SFTA3_HUMAN	surfactant associated 3	60											0						GACTTGGCACGCAAACAGCGA	0.517													22	122	---	---	---	---	PASS
TRIM9	114088	broad.mit.edu	37	14	51446263	51446263	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51446263C>A	uc001wyx.3	-	9	2677	c.1912G>T	c.(1912-1914)GAG>TAG	p.E638*	TRIM9_uc001wyy.2_Nonsense_Mutation_p.E719*	NM_015163	NP_055978	Q9C026	TRIM9_HUMAN	tripartite motif protein 9 isoform 1	638	B30.2/SPRY.				proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			skin(2)|lung(1)	3	all_epithelial(31;0.00418)|Breast(41;0.148)					ATCCCTCCCTCAGTTCTGTAG	0.393													114	242	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68248188	68248188	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68248188C>T	uc001xka.2	-	22	4570	c.4431G>A	c.(4429-4431)CTG>CTA	p.L1477L	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Silent_p.L1477L	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1477					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		ACTGTAGGGCCAGCCGACTTC	0.517													11	140	---	---	---	---	PASS
ZFYVE1	53349	broad.mit.edu	37	14	73444717	73444717	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73444717T>C	uc001xnm.2	-	8	2193	c.1553A>G	c.(1552-1554)TAT>TGT	p.Y518C	ZFYVE1_uc001xnl.2_Missense_Mutation_p.Y103C|ZFYVE1_uc010arj.2_Intron	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1 isoform 1	518						endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		CCGACTACGATAGACCACGCC	0.493													23	83	---	---	---	---	PASS
KCNK10	54207	broad.mit.edu	37	14	88654343	88654343	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88654343G>A	uc001xwo.2	-	6	1421	c.964C>T	c.(964-966)CTA>TTA	p.L322L	KCNK10_uc001xwm.2_Silent_p.L327L|KCNK10_uc001xwn.2_Silent_p.L327L	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	322	Cytoplasmic (Potential).				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						AGAACCCGTAGCCAATCTCCG	0.478													28	105	---	---	---	---	PASS
MIR329-1	574408	broad.mit.edu	37	14	101493134	101493134	+	RNA	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101493134G>T	hsa-mir-329-1|MI0001725	+			c.13G>T			MIR329-2_hsa-mir-329-2|MI0001726_5'Flank|MIR494_hsa-mir-494|MI0003134_5'Flank|uc010txm.1_5'Flank																	0						TACCTGAAGAGAGGTTTTCTG	0.443													29	119	---	---	---	---	PASS
HSP90AA1	3320	broad.mit.edu	37	14	102552662	102552662	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102552662C>G	uc001yku.3	-	2	244	c.54G>C	c.(52-54)GAG>GAC	p.E18D	HSP90AA1_uc001ykv.3_Missense_Mutation_p.E140D|HSP90AA1_uc001ykw.1_5'UTR|HSP90AA1_uc001ykx.1_Missense_Mutation_p.E7D	NM_005348	NP_005339	P07900	HS90A_HUMAN	heat shock 90kDa protein 1, alpha isoform 2	18					axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)	AGGCGAACGTCTCAACCTCCT	0.478													12	87	---	---	---	---	PASS
EIF5	1983	broad.mit.edu	37	14	103804221	103804221	+	Intron	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103804221G>C	uc001ymq.2	+						EIF5_uc001ymr.2_Intron|EIF5_uc001yms.2_Intron|EIF5_uc001ymt.2_Intron|EIF5_uc001ymu.2_Intron|SNORA28_uc001ymv.1_RNA	NM_001969	NP_001960	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5						regulation of translational initiation|RNA metabolic process	cytosol	GTP binding|GTPase activity|translation initiation factor activity			pancreas(1)|breast(1)|skin(1)	3		Melanoma(154;0.155)	Epithelial(46;0.182)			AAAACTGTCTGACACAATTTG	0.413													25	75	---	---	---	---	PASS
OCA2	4948	broad.mit.edu	37	15	28000605	28000605	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28000605T>A	uc001zbh.3	-	24	2556	c.2446A>T	c.(2446-2448)ATG>TTG	p.M816L	OCA2_uc010ayv.2_Missense_Mutation_p.M792L	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	816	Extracellular (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		ACAACCATCATTGGGAAGCCC	0.438									Oculocutaneous_Albinism				12	52	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48748893	48748893	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48748893C>A	uc001zwx.1	-	44	5691	c.5363G>T	c.(5362-5364)AGC>ATC	p.S1788I	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	1788	EGF-like 29; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ACATCGGAAGCTGCCAACCAT	0.433													30	123	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53907987	53907987	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53907987C>A	uc002acj.2	-	15	2458	c.2416G>T	c.(2416-2418)GGA>TGA	p.G806*	WDR72_uc010bfi.1_Nonsense_Mutation_p.G806*	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	806										lung(1)|skin(1)	2				all cancers(107;0.0511)		TTATCCACTCCCCATGGCAAA	0.358													114	234	---	---	---	---	PASS
LRRC49	54839	broad.mit.edu	37	15	71341747	71341747	+	Splice_Site	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71341747G>A	uc002asw.2	+	16	2105	c.1858_splice	c.e16-1	p.E620_splice	LRRC49_uc002asu.2_Splice_Site_p.E610_splice|LRRC49_uc002asx.2_Splice_Site_p.E576_splice|LRRC49_uc010ukf.1_Splice_Site_p.E625_splice|LRRC49_uc002asy.2_Splice_Site_p.E326_splice|LRRC49_uc002asz.2_Splice_Site_p.E592_splice	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49							cytoplasm|microtubule				ovary(1)	1						TTTTTTAACAGGAAATAAAGG	0.294													9	35	---	---	---	---	PASS
KIAA1024	23251	broad.mit.edu	37	15	79750711	79750711	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79750711G>T	uc002bew.1	+	2	2297	c.2222G>T	c.(2221-2223)CGT>CTT	p.R741L	KIAA1024_uc010unk.1_Missense_Mutation_p.R741L	NM_015206	NP_056021	Q9UPX6	K1024_HUMAN	hypothetical protein LOC23251	741						integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4						TATACCAACCGTGTGGGCCTC	0.463													3	79	---	---	---	---	PASS
NARFL	64428	broad.mit.edu	37	16	780537	780537	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:780537C>T	uc002cjr.2	-	11	1323	c.1311G>A	c.(1309-1311)GGG>GGA	p.G437G	NARFL_uc002cjp.2_Silent_p.G335G|NARFL_uc002cjq.2_Silent_p.G335G|NARFL_uc002cjs.2_Silent_p.G219G	NM_022493	NP_071938	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	437					iron-sulfur cluster assembly|oxygen homeostasis|regulation of transcription, DNA-dependent|response to hypoxia		4 iron, 4 sulfur cluster binding|metal ion binding				0		Hepatocellular(780;0.0218)				GCTCCTGAACCCCAGGCGCGT	0.667													12	64	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9934909	9934909	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9934909T>A	uc002czo.3	-	6	1929	c.1381A>T	c.(1381-1383)ATT>TTT	p.I461F	GRIN2A_uc010uym.1_Missense_Mutation_p.I461F|GRIN2A_uc010uyn.1_Missense_Mutation_p.I304F|GRIN2A_uc002czr.3_Missense_Mutation_p.I461F	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	461	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	AGAATATCAATGCAGAACCCC	0.333													34	147	---	---	---	---	PASS
RSL1D1	26156	broad.mit.edu	37	16	11945310	11945310	+	Silent	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11945310C>A	uc002dbp.1	-	1	133	c.60G>T	c.(58-60)TCG>TCT	p.S20S	RSL1D1_uc010buv.1_Silent_p.S20S|RSL1D1_uc010uyw.1_5'UTR|RSL1D1_uc010buw.2_RNA	NM_015659	NP_056474	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	20					regulation of protein localization|translation	large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						CCGCTGGAGTCGAGGTGGAGG	0.612													3	62	---	---	---	---	PASS
ABCC6	368	broad.mit.edu	37	16	16284196	16284196	+	Missense_Mutation	SNP	C	A	A	rs72653768		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16284196C>A	uc002den.3	-	12	1497	c.1460G>T	c.(1459-1461)CGG>CTG	p.R487L	ABCC6_uc010bvo.2_RNA|ABCC6_uc010uzz.1_Missense_Mutation_p.R499L	NM_001171	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C, member 6	487	ABC transmembrane type-1 1.|Cytoplasmic (By similarity).				response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		GAGCCGTGCCCGTGAGTCCTT	0.493													3	55	---	---	---	---	PASS
C16orf88	400506	broad.mit.edu	37	16	19718381	19718381	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19718381C>T	uc002dgq.2	-	5	1243	c.1228G>A	c.(1228-1230)GAC>AAC	p.D410N		NM_001012991	NP_001013009	Q1ED39	CP088_HUMAN	hypothetical protein LOC400506	410	Interaction with ZFP106 (By similarity).					nucleolus					0						TGCAGGCTGTCAGCCGCCTTC	0.627													14	50	---	---	---	---	PASS
ZNF267	10308	broad.mit.edu	37	16	31926937	31926937	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31926937C>G	uc002ecs.3	+	4	1576	c.1367C>G	c.(1366-1368)ACA>AGA	p.T456R		NM_003414	NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	456	C2H2-type 5.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						CAACATCAGACAACTCATACA	0.338													17	120	---	---	---	---	PASS
TOX3	27324	broad.mit.edu	37	16	52473846	52473846	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52473846C>A	uc002egw.2	-	7	1193	c.1022G>T	c.(1021-1023)CGT>CTT	p.R341L	TOX3_uc010vgt.1_Missense_Mutation_p.R336L|TOX3_uc010vgu.1_Missense_Mutation_p.R341L	NM_001080430	NP_001073899	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	341					apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity				0						CTGAACAGAACGGATGGTCTG	0.458													10	51	---	---	---	---	PASS
CHD9	80205	broad.mit.edu	37	16	53338368	53338368	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53338368C>T	uc002ehb.2	+	30	6614	c.6450C>T	c.(6448-6450)TCC>TCT	p.S2150S	CHD9_uc002egy.2_Silent_p.S2150S|CHD9_uc002ehc.2_Silent_p.S2150S|CHD9_uc002ehf.2_Silent_p.S1264S|CHD9_uc010cbw.2_Intron|CHD9_uc002ehg.1_Silent_p.S156S	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2150	Ser-rich.				cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				CATCTTCTTCCTCATCATCCT	0.308													3	8	---	---	---	---	PASS
LDHD	197257	broad.mit.edu	37	16	75148012	75148012	+	Silent	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75148012C>G	uc002fdm.2	-	6	797	c.750G>C	c.(748-750)GGG>GGC	p.G250G	LDHD_uc002fdn.2_Silent_p.G227G	NM_153486	NP_705690	Q86WU2	LDHD_HUMAN	D-lactate dehydrogenase isoform 1 precursor	250	FAD-binding PCMH-type.						D-lactate dehydrogenase (cytochrome) activity|flavin adenine dinucleotide binding|protein binding				0						GGCCCAGCGTCCCCTCGGAGC	0.662													71	52	---	---	---	---	PASS
CHST5	23563	broad.mit.edu	37	16	75563556	75563556	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75563556C>T	uc002fei.2	-	3	2122	c.727G>A	c.(727-729)GAC>AAC	p.D243N	CHST5_uc002fej.1_Missense_Mutation_p.D249N	NM_024533	NP_078809	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	243	Lumenal (Potential).				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						ATGCCGTTGTCGCGTGCCAGT	0.726													10	17	---	---	---	---	PASS
CLEC3A	10143	broad.mit.edu	37	16	78056612	78056612	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78056612G>T	uc002ffh.3	+	1	170	c.89G>T	c.(88-90)AGG>ATG	p.R30M		NM_005752	NP_005743	O75596	CLC3A_HUMAN	C-type lectin domain family 3 member A	30					skeletal system development	extracellular region	sugar binding				0						TTAAAAGCCAGGAAGCACAGC	0.483													3	51	---	---	---	---	PASS
CDYL2	124359	broad.mit.edu	37	16	80638367	80638367	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80638367A>G	uc002ffs.2	-	7	1544	c.1439T>C	c.(1438-1440)CTC>CCC	p.L480P		NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	480						nucleus	catalytic activity|protein binding			central_nervous_system(1)	1						CTTGAGCATGAGGCATTCCTT	0.532													40	102	---	---	---	---	PASS
KLHL36	79786	broad.mit.edu	37	16	84691194	84691194	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84691194G>A	uc002fig.2	+	3	922	c.781G>A	c.(781-783)GCC>ACC	p.A261T	KLHL36_uc010chl.2_Missense_Mutation_p.A260T	NM_024731	NP_079007	Q8N4N3	KLH36_HUMAN	kelch-like 36	261										skin(2)	2						GCCCAAGGAGGCCAACTGCGA	0.672													4	35	---	---	---	---	PASS
ITGAE	3682	broad.mit.edu	37	17	3664340	3664340	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3664340C>T	uc002fwo.3	-	6	664	c.565G>A	c.(565-567)GAG>AAG	p.E189K		NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor	189	Glu-rich (acidic).|Extracellular (Potential).|X-domain (extra domain).				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		tcctcctcctccttgtcttcc	0.413													23	62	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577106	7577106	+	Missense_Mutation	SNP	G	A	A	rs17849781		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577106G>A	uc002gim.2	-	8	1026	c.832C>T	c.(832-834)CCT>TCT	p.P278S	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.P278S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.P146S|TP53_uc010cng.1_Missense_Mutation_p.P146S|TP53_uc002gii.1_Missense_Mutation_p.P146S|TP53_uc010cnh.1_Missense_Mutation_p.P278S|TP53_uc010cni.1_Missense_Mutation_p.P278S|TP53_uc002gij.2_Missense_Mutation_p.P278S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	278	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.P278L(52)|p.P278S(48)|p.P278R(26)|p.P278T(21)|p.P278A(18)|p.P278H(11)|p.0?(7)|p.P278fs*67(5)|p.P278F(3)|p.P278fs*28(2)|p.?(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.V274_P278del(1)|p.P278P(1)|p.C277_P278insXXXXXXX(1)|p.F270_D281del12(1)|p.P278_G279insXXXXX(1)|p.C275_R283delCACPGRDRR(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275fs*20(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCTCTCCCAGGACAGGCACAA	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			23	11	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10212956	10212956	+	Silent	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10212956C>A	uc002gmk.1	-	34	4938	c.4848G>T	c.(4846-4848)CTG>CTT	p.L1616L		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1616	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						TCTTTAGCCTCAGGGCGTCGT	0.567													3	12	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10359839	10359839	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10359839T>C	uc002gmn.2	-	17	2042	c.1931A>G	c.(1930-1932)AAG>AGG	p.K644R	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	644	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						AGAAGAACCCTTCTTTTTGCC	0.333													46	34	---	---	---	---	PASS
MYH3	4621	broad.mit.edu	37	17	10543358	10543358	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10543358C>T	uc002gmq.1	-	21	2714	c.2637G>A	c.(2635-2637)GTG>GTA	p.V879V		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	879	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						GGACCAGAGTCACCAGTTTTT	0.403													25	63	---	---	---	---	PASS
STAC2	342667	broad.mit.edu	37	17	37370535	37370535	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37370535C>G	uc002hrs.2	-	8	1111	c.892G>C	c.(892-894)GTT>CTT	p.V298L	STAC2_uc010cvt.2_Missense_Mutation_p.V156L	NM_198993	NP_945344	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	298	SH3.				intracellular signal transduction		metal ion binding			pancreas(1)	1						TAGAGTGCAACGTAGGAGTAC	0.607													60	87	---	---	---	---	PASS
C17orf37	84299	broad.mit.edu	37	17	37886012	37886012	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37886012C>A	uc002hsq.2	-	3	230	c.190G>T	c.(190-192)GCC>TCC	p.A64S		NM_032339	NP_115715	Q9BRT3	CQ037_HUMAN	hypothetical protein LOC84299	64					cell redox homeostasis	cytosol|membrane	selenium binding				0	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;3.72e-63)|all cancers(3;1.87e-56)|BRCA - Breast invasive adenocarcinoma(8;6.8e-45)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)			ATCTCAAAGGCACCTGGTAAG	0.483													36	155	---	---	---	---	PASS
JUP	3728	broad.mit.edu	37	17	39913763	39913763	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39913763G>A	uc002hxq.2	-	12	2227	c.1950C>T	c.(1948-1950)TTC>TTT	p.F650F	JUP_uc010wfs.1_Intron|JUP_uc002hxr.2_Silent_p.F650F|JUP_uc002hxs.2_Silent_p.F650F	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin	650					adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		CGGAGATGCGGAACAGGACGG	0.622													16	109	---	---	---	---	PASS
TBX21	30009	broad.mit.edu	37	17	45821586	45821586	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45821586A>G	uc002ilv.1	+	4	1005	c.794A>G	c.(793-795)AAG>AGG	p.K265R		NM_013351	NP_037483	Q9UL17	TBX21_HUMAN	T-box 21	265	T-box.				lymphocyte migration|multicellular organismal development|positive regulation of transcription, DNA-dependent|response to virus	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0						TCCCTCCATAAGTACCAGCCC	0.547													8	85	---	---	---	---	PASS
COPZ2	51226	broad.mit.edu	37	17	46105865	46105865	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46105865G>A	uc002imy.2	-	12	571	c.558C>T	c.(556-558)GGC>GGT	p.G186G		NM_016429	NP_057513	Q9P299	COPZ2_HUMAN	coatomer protein complex, subunit zeta 2	186					intracellular protein transport|vesicle-mediated transport	cis-Golgi network|COPI vesicle coat					0						CAGTCAAGCCGCCATCATCTG	0.592													5	8	---	---	---	---	PASS
LUC7L3	51747	broad.mit.edu	37	17	48819091	48819091	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48819091A>T	uc002isr.2	+	5	542	c.425A>T	c.(424-426)CAG>CTG	p.Q142L	LUC7L3_uc002isp.1_Missense_Mutation_p.Q66L|LUC7L3_uc010wmw.1_Missense_Mutation_p.Q66L|LUC7L3_uc002isq.2_Missense_Mutation_p.Q142L|LUC7L3_uc002iss.2_Missense_Mutation_p.Q142L	NM_006107	NP_006098	O95232	LC7L3_HUMAN	LUC7-like 3	142	Potential.				apoptosis|mRNA processing|response to stress|RNA splicing	focal adhesion|nuclear speck	DNA binding|mRNA binding|protein binding				0						CTTCTGCAACAGGTGAGAATT	0.323													9	57	---	---	---	---	PASS
C17orf82	388407	broad.mit.edu	37	17	59489450	59489450	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59489450C>A	uc002izh.1	+	1	339	c.114C>A	c.(112-114)TTC>TTA	p.F38L		NM_203425	NP_982249	Q86X59	CQ082_HUMAN	hypothetical protein LOC388407	38											0						CCCCCTCCTTCGCTGTCCTTG	0.682											OREG0024630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	29	---	---	---	---	PASS
ARSG	22901	broad.mit.edu	37	17	66274223	66274223	+	Intron	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66274223T>A	uc002jhc.2	+						SLC16A6_uc002jgz.1_Intron|SLC16A6_uc002jha.1_Intron	NM_014960	NP_055775	Q96EG1	ARSG_HUMAN	Arylsulfatase G precursor						sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CCGAAAGATGTACTAACCTGA	0.373													27	35	---	---	---	---	PASS
DNAI2	64446	broad.mit.edu	37	17	72308155	72308155	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72308155A>T	uc002jkf.2	+	12	1607	c.1508A>T	c.(1507-1509)GAG>GTG	p.E503V	DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA|uc002jkh.1_5'Flank|DNAI2_uc002jki.2_RNA	NM_023036	NP_075462	Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate polypeptide 2	503					cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity			ovary(2)|central_nervous_system(1)	3						TTTGAGCGTGAGACCCGGCGA	0.652									Kartagener_syndrome				21	37	---	---	---	---	PASS
RNF157	114804	broad.mit.edu	37	17	74163102	74163102	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74163102C>A	uc002jqz.2	-	5	618	c.549G>T	c.(547-549)TGG>TGT	p.W183C	RNF157_uc002jra.2_Missense_Mutation_p.W183C	NM_052916	NP_443148	Q96PX1	RN157_HUMAN	ring finger protein 157	183							zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.187)			CCTCTTCGGCCCACTCGGAGG	0.602													18	149	---	---	---	---	PASS
AATK	9625	broad.mit.edu	37	17	79095253	79095253	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79095253G>A	uc010dia.2	-	11	2563	c.2483C>T	c.(2482-2484)ACG>ATG	p.T828M	AATK_uc010dhz.2_RNA	NM_001080395	NP_001073864	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	828	Pro-rich.					integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			AGTAGCAGGCGTGGGAGAGTC	0.672													4	6	---	---	---	---	PASS
C18orf19	125228	broad.mit.edu	37	18	13671861	13671861	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13671861C>T	uc010dlh.2	-	4	1017	c.585G>A	c.(583-585)AAG>AAA	p.K195K	C18orf19_uc010dlg.2_Intron|C18orf19_uc010dli.2_Silent_p.K195K|C18orf19_uc002ksj.3_Silent_p.K195K|C18orf19_uc010dlj.2_Intron	NM_001098801	NP_001092271	Q96ND0	CR019_HUMAN	hypothetical protein LOC125228	195	DUF1279.					integral to membrane				breast(2)	2						CAGTACCCACCTTAAACAAGG	0.448													12	60	---	---	---	---	PASS
SLC39A6	25800	broad.mit.edu	37	18	33706701	33706701	+	Silent	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33706701G>T	uc010dmy.2	-	2	560	c.270C>A	c.(268-270)ATC>ATA	p.I90I	SLC39A6_uc002kzj.2_Intron	NM_012319	NP_036451	Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter),	90	Extracellular (Potential).					integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity			ovary(1)|pancreas(1)	2						ggtgTATATGGATTCTTTTAA	0.159													16	60	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63430272	63430272	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63430272C>G	uc002ljz.2	+	2	519	c.194C>G	c.(193-195)CCC>CGC	p.P65R	CDH7_uc002lka.2_Missense_Mutation_p.P65R|CDH7_uc002lkb.2_Missense_Mutation_p.P65R	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	65	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				GGTTCAGACCCCCTCTATGTA	0.423													6	50	---	---	---	---	PASS
GALR1	2587	broad.mit.edu	37	18	74962661	74962661	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74962661C>A	uc002lms.3	+	1	654	c.157C>A	c.(157-159)CTA>ATA	p.L53I		NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1	53	Helical; Name=1; (Potential).				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		GGGCAACAGCCTAGTGATCAC	0.667													12	14	---	---	---	---	PASS
ODF3L2	284451	broad.mit.edu	37	19	463979	463979	+	Silent	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:463979T>A	uc002lor.2	-	4	971	c.735A>T	c.(733-735)CCA>CCT	p.P245P	SHC2_uc002loq.3_5'Flank|ODF3L2_uc010drp.2_Silent_p.P209P	NM_182577	NP_872383	Q3SX64	OD3L2_HUMAN	outer dense fiber of sperm tails 3-like 2	245	DUF1309 3.|Pro-rich.										0						TGACCTGCTCTGGGCAGTGGG	0.612													13	7	---	---	---	---	PASS
CIRBP	1153	broad.mit.edu	37	19	1270929	1270929	+	5'UTR	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1270929C>T	uc002lrr.3	+	2					C19orf23_uc010xgk.1_5'Flank|CIRBP_uc010dsg.1_5'UTR|CIRBP_uc002lrt.2_5'UTR|CIRBP_uc010xgl.1_5'UTR|CIRBP_uc002lrv.3_5'UTR|CIRBP_uc002lru.2_RNA	NM_001280	NP_001271	Q14011	CIRBP_HUMAN	cold inducible RNA binding protein						mRNA stabilization|positive regulation of translation|response to cold|response to UV|stress granule assembly	nucleoplasm|stress granule	mRNA 3'-UTR binding|nucleotide binding|protein binding|SSU rRNA binding|translation repressor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		tgccacaggccgccatggcat	0.299													47	133	---	---	---	---	PASS
DAPK3	1613	broad.mit.edu	37	19	3964897	3964897	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3964897C>A	uc002lzc.1	-	2	248	c.155G>T	c.(154-156)AGC>ATC	p.S52I	DAPK3_uc002lzd.1_Missense_Mutation_p.S52I	NM_001348	NP_001339	O43293	DAPK3_HUMAN	death-associated protein kinase 3	52	Protein kinase.				apoptosis|chromatin modification|induction of apoptosis|intracellular protein kinase cascade	cytoplasm|PML body	ATP binding|leucine zipper domain binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|ovary(1)|large_intestine(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCACGCCGGCTGGATGACAG	0.612													15	46	---	---	---	---	PASS
FUT6	2528	broad.mit.edu	37	19	5831879	5831879	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5831879T>A	uc002mdf.1	-	4	1226	c.700A>T	c.(700-702)ATG>TTG	p.M234L	FUT6_uc002mdg.1_Missense_Mutation_p.M234L|FUT6_uc002mdh.1_Missense_Mutation_p.M234L|FUT6_uc010dul.1_Missense_Mutation_p.M234L	NM_001040701	NP_001035791	P51993	FUT6_HUMAN	fucosyltransferase 6	234	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						AGCGTCTCCATCATGGTTCCC	0.617													31	88	---	---	---	---	PASS
ZNF846	162993	broad.mit.edu	37	19	9869345	9869345	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9869345G>A	uc002mmb.1	-	6	939	c.408C>T	c.(406-408)CAC>CAT	p.H136H	ZNF846_uc010xky.1_RNA|ZNF846_uc010xkz.1_RNA|ZNF846_uc010dww.2_Silent_p.H7H|ZNF846_uc002mmc.1_Silent_p.H7H	NM_001077624	NP_001071092	Q147U1	ZN846_HUMAN	zinc finger protein 846	136	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TCTCTCCAATGTGAGTTATCA	0.378													44	100	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	15989680	15989680	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15989680G>A	uc002nbs.1	-	13	1514	c.1464C>T	c.(1462-1464)CGC>CGT	p.R488R	CYP4F2_uc010xot.1_Silent_p.R339R	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	488					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						GGACGCGGAAGCGCAGCAGCG	0.682													18	16	---	---	---	---	PASS
AP1M1	8907	broad.mit.edu	37	19	16317171	16317171	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16317171G>A	uc002ndu.2	+	3	392	c.219G>A	c.(217-219)AAG>AAA	p.K73K	AP1M1_uc002ndv.2_Silent_p.K73K|AP1M1_uc010xpd.1_Silent_p.K73K	NM_032493	NP_115882	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	73					cellular membrane organization|endosome to melanosome transport|interspecies interaction between organisms|intracellular protein transport|melanosome organization|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding			ovary(3)|breast(1)	4						CATCCAAGAAGAACGCGTGCG	0.587													45	138	---	---	---	---	PASS
ZNF506	440515	broad.mit.edu	37	19	19905475	19905475	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19905475G>C	uc010eci.2	-	4	1369	c.1221C>G	c.(1219-1221)AAC>AAG	p.N407K	ZNF506_uc002nog.2_Intron|ZNF506_uc002noh.3_Missense_Mutation_p.N375K	NM_001099269	NP_001092739	Q5JVG8	ZN506_HUMAN	zinc finger protein 506 isoform 1	407	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|zinc ion binding				0						CTGAGGACCAGTTAAAAGCTT	0.358													9	57	---	---	---	---	PASS
POP4	10775	broad.mit.edu	37	19	30104871	30104871	+	Missense_Mutation	SNP	G	A	A	rs61731483	byFrequency	TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30104871G>A	uc002nsf.2	+	6	574	c.518G>A	c.(517-519)CGC>CAC	p.R173H	POP4_uc002nsg.2_Missense_Mutation_p.R92H	NM_006627	NP_006618	O95707	RPP29_HUMAN	processing of precursor 4	173					mRNA cleavage|rRNA processing|tRNA processing	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease P activity|RNA binding				0	Ovarian(5;0.000567)|Breast(6;0.0602)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0623)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.225)			AAAGAAGACCGCCTGAAAGGT	0.448													14	39	---	---	---	---	PASS
C19orf2	8725	broad.mit.edu	37	19	30498384	30498384	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30498384C>G	uc002nsr.2	+	7	555	c.525C>G	c.(523-525)CAC>CAG	p.H175Q	C19orf2_uc002nsq.2_Missense_Mutation_p.H157Q|C19orf2_uc002nss.2_Missense_Mutation_p.H135Q|C19orf2_uc002nst.2_Missense_Mutation_p.H99Q	NM_003796	NP_003787	O94763	RMP_HUMAN	RPB5-mediating protein isoform a	175					protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)|kidney(1)	2	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)		TAGCAAAACACCGAATTGCTC	0.368													6	39	---	---	---	---	PASS
NFKBIB	4793	broad.mit.edu	37	19	39395764	39395764	+	Intron	SNP	A	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39395764A>G	uc002ojw.2	+						NFKBIB_uc002ojx.2_Intron|NFKBIB_uc002ojy.2_Intron	NM_002503	NP_002494	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleus	protein binding|signal transducer activity|transcription coactivator activity			lung(1)|kidney(1)	2	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			AGGCCAGGTGAGCCACGAGGG	0.582													3	183	---	---	---	---	PASS
CA11	770	broad.mit.edu	37	19	49143530	49143530	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49143530C>T	uc002pjz.1	-	4	855	c.293G>A	c.(292-294)GGA>GAA	p.G98E	SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|DBP_uc002pjx.3_5'Flank|DBP_uc002pjy.2_5'Flank|DBP_uc010elz.1_5'Flank	NM_001217	NP_001208	O75493	CAH11_HUMAN	carbonic anhydrase XI precursor	98						extracellular region					0		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)		GTACAAGGTTCCCCGGAGCTG	0.552													31	65	---	---	---	---	PASS
NUCB1	4924	broad.mit.edu	37	19	49422337	49422337	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49422337G>T	uc002plb.3	+	9	939	c.867G>T	c.(865-867)ATG>ATT	p.M289I	NUCB1_uc002pla.2_Missense_Mutation_p.M289I|NUCB1_uc002plc.2_Missense_Mutation_p.M289I|NUCB1_uc002pld.2_5'UTR	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor	289	Binds to GNAI2 and GNAI3 (By similarity).					ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		TGCGGGAGATGGAGGAGGAGC	0.612													9	35	---	---	---	---	PASS
PTOV1	53635	broad.mit.edu	37	19	50358105	50358105	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50358105C>T	uc002pqf.1	+	4	580	c.410C>T	c.(409-411)CCG>CTG	p.P137L	PTOV1_uc010ybf.1_Missense_Mutation_p.P105L|PTOV1_uc002ppz.3_RNA|PTOV1_uc002pqb.3_Missense_Mutation_p.P105L|PTOV1_uc002pqa.2_RNA|PTOV1_uc002pqc.1_RNA|PTOV1_uc002pqd.2_RNA|PTOV1_uc002pqe.1_RNA	NM_017432	NP_059128	Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	137					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|plasma membrane					0		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		GACCAGTGGCCGCAGAAGCTG	0.672													9	37	---	---	---	---	PASS
KLK15	55554	broad.mit.edu	37	19	51329905	51329905	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51329905G>A	uc002ptl.2	-	4	621	c.590C>T	c.(589-591)GCG>GTG	p.A197V	KLK1_uc002ptk.1_5'Flank|KLK1_uc010ycg.1_5'Flank|KLK15_uc002ptm.2_Intron|KLK15_uc002ptn.2_Intron|KLK15_uc002pto.2_Missense_Mutation_p.A196V|KLK15_uc010ych.1_RNA|KLK15_uc010yci.1_Intron|KLK15_uc010eod.2_Intron	NM_017509	NP_059979	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15 isoform 4	197	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)|breast(1)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		TCTGCCCTCCGCGCCTGCACA	0.587													33	82	---	---	---	---	PASS
SIGLEC8	27181	broad.mit.edu	37	19	51961567	51961567	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51961567A>T	uc002pwt.2	-	1	142	c.75T>A	c.(73-75)GAT>GAA	p.D25E	SIGLEC8_uc010yda.1_Missense_Mutation_p.D25E|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Missense_Mutation_p.D25E	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	25	Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GCAAGTAACCATCCCCATATT	0.512													24	105	---	---	---	---	PASS
ZNF83	55769	broad.mit.edu	37	19	53116804	53116804	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53116804G>A	uc002pzu.3	-	2	2258	c.1014C>T	c.(1012-1014)ATC>ATT	p.I338I	ZNF83_uc002pzv.3_Silent_p.I338I|ZNF83_uc010eps.2_Silent_p.I310I|ZNF83_uc010ept.2_Silent_p.I338I|ZNF83_uc010epu.2_Silent_p.I338I|ZNF83_uc010epv.2_Silent_p.I338I|ZNF83_uc010epw.2_Silent_p.I338I|ZNF83_uc010epx.2_Silent_p.I310I|ZNF83_uc010epy.2_Silent_p.I338I|ZNF83_uc010epz.2_Silent_p.I310I	NM_018300	NP_060770	P51522	ZNF83_HUMAN	zinc finger protein 83 isoform a	338	C2H2-type 9.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		CTCCAGTGTGGATTCTCCAGT	0.413													5	201	---	---	---	---	PASS
ZNF211	10520	broad.mit.edu	37	19	58152335	58152335	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58152335G>A	uc002qpq.2	+	3	661	c.481G>A	c.(481-483)GCA>ACA	p.A161T	ZNF211_uc010yhb.1_Missense_Mutation_p.A165T|ZNF211_uc002qpp.2_Missense_Mutation_p.A174T|ZNF211_uc002qpr.2_Missense_Mutation_p.A225T|ZNF211_uc002qps.2_Missense_Mutation_p.A226T|ZNF211_uc002qpt.2_Missense_Mutation_p.A173T|ZNF211_uc010yhc.1_Missense_Mutation_p.A173T|ZNF211_uc010yhd.1_Missense_Mutation_p.A100T|ZNF211_uc010yhe.1_Missense_Mutation_p.A152T	NM_198855	NP_942152	Q13398	ZN211_HUMAN	zinc finger protein 211 isoform 2	161						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CATTACAGAGGCACCTTTCAG	0.463													25	87	---	---	---	---	PASS
SSTR4	6754	broad.mit.edu	37	20	23016254	23016254	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23016254C>T	uc002wsr.2	+	1	198	c.134C>T	c.(133-135)GCG>GTG	p.A45V		NM_001052	NP_001043	P31391	SSR4_HUMAN	somatostatin receptor 4	45	Extracellular (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			ovary(1)	1	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					gcgcgggcggcgggcATGGTC	0.557													7	21	---	---	---	---	PASS
C20orf114	92747	broad.mit.edu	37	20	31876669	31876669	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31876669G>A	uc002wyw.1	+	3	399	c.238G>A	c.(238-240)GTC>ATC	p.V80I	C20orf114_uc010gej.1_Missense_Mutation_p.V80I	NM_033197	NP_149974	Q8TDL5	LPLC1_HUMAN	LPLUNC1 protein precursor	80						extracellular space	lipid binding			central_nervous_system(2)|skin(2)	4						GGTGAACACCGTCCTGAAGCA	0.627													11	32	---	---	---	---	PASS
C20orf114	92747	broad.mit.edu	37	20	31894731	31894731	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31894731G>T	uc002wyw.1	+	15	1494	c.1333G>T	c.(1333-1335)GGG>TGG	p.G445W	C20orf114_uc002wyx.1_RNA	NM_033197	NP_149974	Q8TDL5	LPLC1_HUMAN	LPLUNC1 protein precursor	445						extracellular space	lipid binding			central_nervous_system(2)|skin(2)	4						ATTAAGATCTGGGGTCCCAGT	0.572													18	115	---	---	---	---	PASS
DSN1	79980	broad.mit.edu	37	20	35381248	35381248	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35381248C>A	uc010gfr.2	-	11	1387	c.1014G>T	c.(1012-1014)AAG>AAT	p.K338N	DSN1_uc002xfz.2_Missense_Mutation_p.K338N|DSN1_uc002xfy.3_Missense_Mutation_p.K128N|DSN1_uc002xga.2_Missense_Mutation_p.K338N|DSN1_uc010zvs.1_Missense_Mutation_p.K231N|DSN1_uc002xgc.2_Missense_Mutation_p.K322N|DSN1_uc002xgb.2_Missense_Mutation_p.K322N	NM_001145316	NP_001138788	Q9H410	DSN1_HUMAN	DSN1, MIND kinetochore complex component,	338					cell division|chromosome segregation|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding			ovary(2)	2		Myeloproliferative disorder(115;0.00874)				GTAGCTGAAGCTTCAACAGTT	0.428													20	87	---	---	---	---	PASS
DHX35	60625	broad.mit.edu	37	20	37634944	37634944	+	Silent	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37634944G>A	uc002xjh.2	+	12	1178	c.1167G>A	c.(1165-1167)CAG>CAA	p.Q389Q	DHX35_uc010zwa.1_Silent_p.Q234Q|DHX35_uc010zwb.1_Silent_p.Q234Q|DHX35_uc010zwc.1_Silent_p.Q358Q	NM_021931	NP_068750	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	389	Helicase C-terminal.					catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				CAGCTAATCAGCGAGCAGGAC	0.493													146	84	---	---	---	---	PASS
HNF4A	3172	broad.mit.edu	37	20	43043307	43043307	+	Intron	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43043307G>C	uc002xma.2	+						HNF4A_uc002xlt.2_Intron|HNF4A_uc002xlu.2_Intron|HNF4A_uc002xlv.2_Intron|HNF4A_uc002xly.2_Intron|HNF4A_uc002xlz.2_Intron|HNF4A_uc010ggq.2_Intron	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b						blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GACCAGGTGAGGATGGGCGTG	0.602													7	2	---	---	---	---	PASS
WFDC10B	280664	broad.mit.edu	37	20	44313602	44313602	+	Intron	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44313602G>C	uc002xpb.2	-						WFDC10B_uc002xpc.2_Intron	NM_172006	NP_742003	Q8IUB3	WF10B_HUMAN	WAP four-disulfide core domain 10B isoform a							extracellular region	peptidase inhibitor activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				CTTGATTCCTGAAATGATGCA	0.483													31	19	---	---	---	---	PASS
CSE1L	1434	broad.mit.edu	37	20	47682981	47682981	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47682981G>A	uc002xty.2	+	5	544	c.410G>A	c.(409-411)CGC>CAC	p.R137H	CSE1L_uc010zyg.1_Intron|CSE1L_uc010ghx.2_Missense_Mutation_p.R137H	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein	137					apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			ATGGTGAATCGCTTTCAGAGT	0.353													91	43	---	---	---	---	PASS
CABLES2	81928	broad.mit.edu	37	20	60969244	60969244	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60969244A>G	uc002ycv.2	-	5	690	c.683T>C	c.(682-684)CTA>CCA	p.L228P		NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	228					cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CACACCTTCTAGCTCAAAGAC	0.632													15	123	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22658738	22658738	+	Intron	SNP	T	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22658738T>C	uc002yld.1	+						NCAM2_uc011acb.1_Intron|NCAM2_uc011acc.1_Intron	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		CGACAGTTAGTATTTTGGTAA	0.373													54	79	---	---	---	---	PASS
ADAMTS1	9510	broad.mit.edu	37	21	28213384	28213384	+	Silent	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28213384C>A	uc002ymf.2	-	4	1766	c.1311G>T	c.(1309-1311)CTG>CTT	p.L437L		NM_006988	NP_008919	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1	437	Peptidase M12B.				integrin-mediated signaling pathway|negative regulation of cell proliferation|proteolysis		heparin binding|zinc ion binding			lung(3)|large_intestine(2)|central_nervous_system(1)	6		Breast(209;0.000962)		Lung(58;0.215)		GGCTGTGGTCCAGGTTGGAAA	0.483													4	113	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40582738	40582738	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40582738G>T	uc002yxk.1	-	35	4157	c.4018C>A	c.(4018-4020)CAA>AAA	p.Q1340K	BRWD1_uc010goc.1_5'UTR|BRWD1_uc002yxl.2_Missense_Mutation_p.Q1340K|BRWD1_uc010god.1_Intron	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1340	Bromo 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TCAACAGGTTGTCTAAATGGT	0.363													3	48	---	---	---	---	PASS
DIP2A	23181	broad.mit.edu	37	21	47965852	47965852	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47965852G>T	uc002zjo.2	+	20	2555	c.2372G>T	c.(2371-2373)GGC>GTC	p.G791V	DIP2A_uc011afy.1_Missense_Mutation_p.G727V|DIP2A_uc011afz.1_Missense_Mutation_p.G787V|DIP2A_uc002zjl.2_Missense_Mutation_p.G791V|DIP2A_uc002zjm.2_Missense_Mutation_p.G791V|DIP2A_uc010gql.2_Missense_Mutation_p.G748V|DIP2A_uc002zjn.2_Missense_Mutation_p.G791V|DIP2A_uc002zjq.2_Missense_Mutation_p.G183V	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a	791					multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		ACCAGGACAGGCCTGCTGGGC	0.602													4	79	---	---	---	---	PASS
DIP2A	23181	broad.mit.edu	37	21	47970521	47970521	+	Silent	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47970521C>T	uc002zjo.2	+	23	2886	c.2703C>T	c.(2701-2703)CCC>CCT	p.P901P	DIP2A_uc011afy.1_Silent_p.P837P|DIP2A_uc011afz.1_Silent_p.P897P	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a	901					multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		ACACCTTGCCCAAGGCTCCTC	0.577													8	15	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22735726	22735726	+	Intron	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22735726C>A	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						CCACAGTGCTCCAGGCCAATA	0.597													17	150	---	---	---	---	PASS
DEPDC5	9681	broad.mit.edu	37	22	32174082	32174082	+	Intron	SNP	C	G	G			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32174082C>G	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alr.1_Intron|DEPDC5_uc011alt.1_Intron	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						TGTATTCTTTCAGAGCACAGG	0.279													15	60	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36710337	36710337	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36710337G>C	uc003apg.2	-	13	1638	c.1407C>G	c.(1405-1407)ATC>ATG	p.I469M	MYH9_uc003aph.1_Missense_Mutation_p.I333M	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	469	Myosin head-like.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						TGGTGTAATTGATGCACAGCT	0.527			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				13	26	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38121714	38121714	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38121714C>T	uc003atr.2	+	7	3422	c.3151C>T	c.(3151-3153)CCG>TCG	p.P1051S	TRIOBP_uc003atu.2_Missense_Mutation_p.P879S|TRIOBP_uc003atq.1_Missense_Mutation_p.P1051S|TRIOBP_uc003ats.1_Missense_Mutation_p.P879S	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	1051					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					TGAGAGTGAACCGCCCCACCA	0.667													19	120	---	---	---	---	PASS
SMC1B	27127	broad.mit.edu	37	22	45802340	45802340	+	Splice_Site	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45802340C>A	uc003bgc.2	-	4	667	c.615_splice	c.e4+1	p.E205_splice	SMC1B_uc003bgd.2_Splice_Site_p.E205_splice|SMC1B_uc003bge.1_Splice_Site	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes						chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TGACATCTTACCTCTTCCTTC	0.343													5	44	---	---	---	---	PASS
NLGN4X	57502	broad.mit.edu	37	X	5821715	5821715	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5821715G>A	uc010ndh.2	-	5	1505	c.1004C>T	c.(1003-1005)ACC>ATC	p.T335I	NLGN4X_uc004crp.2_Missense_Mutation_p.T355I|NLGN4X_uc004crq.2_Missense_Mutation_p.T335I|NLGN4X_uc010ndi.2_Missense_Mutation_p.T372I|NLGN4X_uc004crr.2_Missense_Mutation_p.T335I|NLGN4X_uc010ndj.2_Missense_Mutation_p.T335I	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor	335	Extracellular (Potential).				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4						TATGTGGTAGGTGGCCGGGGT	0.582													20	59	---	---	---	---	PASS
RAI2	10742	broad.mit.edu	37	X	17819468	17819468	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17819468C>A	uc004cyf.2	-	3	1233	c.663G>T	c.(661-663)TTG>TTT	p.L221F	RAI2_uc004cyg.2_Missense_Mutation_p.L221F|RAI2_uc010nfa.2_Missense_Mutation_p.L221F|RAI2_uc004cyh.3_Missense_Mutation_p.L221F|RAI2_uc011miy.1_Missense_Mutation_p.L171F	NM_021785	NP_068557	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	221	Pro-rich.				embryo development					ovary(1)|breast(1)	2	Hepatocellular(33;0.183)					CCAGGGGGGACAAGGGGGAGC	0.627													8	21	---	---	---	---	PASS
GK	2710	broad.mit.edu	37	X	30695509	30695509	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30695509C>T	uc004dch.3	+	4	456	c.277C>T	c.(277-279)CAG>TAG	p.Q93*	GK_uc010ngj.2_Nonsense_Mutation_p.Q93*|GK_uc004dci.3_Nonsense_Mutation_p.Q93*|GK_uc011mjz.1_5'UTR|GK_uc011mka.1_5'UTR|GK_uc010ngk.2_5'UTR	NM_203391	NP_976325	P32189	GLPK_HUMAN	glycerol kinase isoform a	93					glycerol-3-phosphate metabolic process|triglyceride biosynthetic process	cytosol|mitochondrial outer membrane	ATP binding|glycerol kinase activity			central_nervous_system(1)	1						TGTCAGCAACCAGAGGGAAAC	0.413													52	20	---	---	---	---	PASS
CFP	5199	broad.mit.edu	37	X	47486161	47486161	+	Intron	SNP	G	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47486161G>A	uc004dig.3	-						CFP_uc004dih.2_Intron|CFP_uc004dii.1_Intron|CFP_uc010nhu.2_Intron	NM_001145252	NP_001138724	P27918	PROP_HUMAN	complement factor properdin precursor						complement activation, alternative pathway|defense response to bacterium	extracellular space				breast(2)|lung(1)	3						CGTGAACCCTGAGATGCTGAC	0.612													11	19	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50052552	50052552	+	Silent	SNP	A	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50052552A>T	uc004dox.3	+	6	1681	c.1383A>T	c.(1381-1383)CCA>CCT	p.P461P	CCNB3_uc004doy.2_Silent_p.P461P|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	461					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					TAAAGTCTCCAACTGAGGAGT	0.473													11	41	---	---	---	---	PASS
RLIM	51132	broad.mit.edu	37	X	73812015	73812015	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73812015C>A	uc004ebu.2	-	5	1425	c.1135G>T	c.(1135-1137)GTC>TTC	p.V379F	RLIM_uc004ebw.2_Missense_Mutation_p.V379F	NM_183353	NP_899196	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	379					random inactivation of X chromosome|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|transcriptional repressor complex	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						ATGGTACTGACATAGGTTCTC	0.428													14	22	---	---	---	---	PASS
DCAF12L1	139170	broad.mit.edu	37	X	125685917	125685917	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125685917G>T	uc004eul.2	-	1	926	c.675C>A	c.(673-675)GAC>GAA	p.D225E		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	225	WD 2.									skin(3)|ovary(1)	4						CATCGAACTTGTCCGGGTCCA	0.642													13	9	---	---	---	---	PASS
KAZ	23254	broad.mit.edu	37	1	15100899	15100899	+	Intron	DEL	C	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15100899delC	uc001avm.3	+						KAZ_uc009vog.1_Intron|KAZ_uc010obj.1_Intron	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						CTTATCTCCTCCCTTTCCCCT	0.333													4	2	---	---	---	---	
ST6GALNAC3	256435	broad.mit.edu	37	1	76540541	76540541	+	5'UTR	DEL	G	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76540541delG	uc001dhh.2	+	1					ST6GALNAC3_uc001dhg.3_5'UTR|ST6GALNAC3_uc010orh.1_5'UTR	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						CAGGAGGGCCGGCGGAGCGCC	0.692													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143209394	143209394	+	Intron	DEL	A	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143209394delA	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		TTTTCTTTCCAAAAGTTTGAA	0.254													13	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	199130136	199130137	+	IGR	INS	-	G	G	rs142603788	by1000genomes	TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199130136_199130137insG								MIR181A1 (301854 upstream) : NR5A2 (866633 downstream)																							gaaggaaggaagaaggaaggaa	0.149													5	5	---	---	---	---	
DARS	1615	broad.mit.edu	37	2	136664813	136664813	+	3'UTR	DEL	T	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136664813delT	uc002tux.1	-	16					DARS_uc010fnj.1_3'UTR	NM_001349	NP_001340	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase						aspartyl-tRNA aminoacylation|protein complex assembly	cytosol|nuclear membrane|plasma membrane|soluble fraction	aminoacylase activity|aspartate-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	TGTGGCtttcttttttttttt	0.254													6	3	---	---	---	---	
PRPF40A	55660	broad.mit.edu	37	2	153537686	153537699	+	Intron	DEL	AAATACGCCCCAGT	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153537686_153537699delAAATACGCCCCAGT	uc002tyi.2	-						PRPF40A_uc002tyh.3_Intron|PRPF40A_uc010zcd.1_Intron|PRPF40A_uc002tyj.2_Intron|PRPF40A_uc002tyl.1_Intron	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3						mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						GAATCCTAAAAAATACGCCCCAGTCTACTTGACA	0.388													36	27	---	---	---	---	
FBXW12	285231	broad.mit.edu	37	3	48420122	48420122	+	Intron	DEL	G	-	-	rs9311422	by1000genomes	TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48420122delG	uc003csr.2	+						FBXW12_uc010hjv.2_Intron|FBXW12_uc003css.2_Intron|FBXW12_uc010hjw.2_Intron	NM_207102	NP_996985	Q6X9E4	FBW12_HUMAN	F-box and WD repeat domain containing 12 isoform												0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ttttttttttggagacagagt	0.189													4	3	---	---	---	---	
TEX264	51368	broad.mit.edu	37	3	51728004	51728015	+	Intron	DEL	TTCCTTCCTTCC	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51728004_51728015delTTCCTTCCTTCC	uc010hls.2	+						TEX264_uc003dbk.3_Intron|TEX264_uc010hlt.2_Intron|TEX264_uc003dbl.3_Intron|TEX264_uc003dbm.3_Intron	NM_001129884	NP_001123356	Q9Y6I9	TX264_HUMAN	testis expressed 264 precursor							extracellular region					0				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		ATCCCTttctttccttccttccttccttcctt	0.156													7	6	---	---	---	---	
ATXN7	6314	broad.mit.edu	37	3	63974140	63974140	+	Intron	DEL	A	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63974140delA	uc003dlw.3	+						ATXN7_uc003dlv.2_Intron|ATXN7_uc010hnv.2_Intron|ATXN7_uc011bfn.1_Intron	NM_000333	NP_000324	O15265	ATX7_HUMAN	ataxin 7 isoform a						cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		TTTTACTATGAAAAAAAAAAA	0.363													4	2	---	---	---	---	
SGEF	26084	broad.mit.edu	37	3	153842162	153842162	+	Intron	DEL	T	-	-	rs66618151		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153842162delT	uc011bog.1	+						SGEF_uc011boh.1_Intron	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine						regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTGCttttccttttttttttt	0.244													3	3	---	---	---	---	
ADIPOQ	9370	broad.mit.edu	37	3	186566039	186566042	+	Intron	DEL	GAAG	-	-	rs63385760		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186566039_186566042delGAAG	uc003fra.2	+						ADIPOQ_uc010hyy.2_Intron	NM_004797	NP_004788	Q15848	ADIPO_HUMAN	adiponectin precursor						brown fat cell differentiation|cellular response to drug|cellular response to insulin stimulus|detection of oxidative stress|fatty acid beta-oxidation|generation of precursor metabolites and energy|glucose homeostasis|glucose metabolic process|low-density lipoprotein particle clearance|negative regulation of blood pressure|negative regulation of DNA biosynthetic process|negative regulation of ERK1 and ERK2 cascade|negative regulation of eukaryotic cell surface binding|negative regulation of fat cell differentiation|negative regulation of gluconeogenesis|negative regulation of granulocyte differentiation|negative regulation of heterotypic cell-cell adhesion|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of intracellular protein transport|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|negative regulation of macrophage differentiation|negative regulation of MAP kinase activity|negative regulation of phagocytosis|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein autophosphorylation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of synaptic transmission|negative regulation of transcription, DNA-dependent|negative regulation of tumor necrosis factor production|negative regulation of tumor necrosis factor-mediated signaling pathway|positive regulation of cAMP-dependent protein kinase activity|positive regulation of cholesterol efflux|positive regulation of fatty acid metabolic process|positive regulation of glucose import|positive regulation of glycogen (starch) synthase activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of metanephric glomerular visceral epithelial cell development|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myeloid cell apoptosis|positive regulation of protein kinase A signaling cascade|positive regulation of renal albumin absorption|protein homooligomerization|protein localization in plasma membrane|response to glucose stimulus|response to tumor necrosis factor	collagen|endoplasmic reticulum|extracellular space	cytokine activity|eukaryotic cell surface binding|hormone activity|protein homodimerization activity			ovary(1)	1	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		aggaaggaaagaaggaaggaagga	0.069													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49506430	49506430	+	IGR	DEL	T	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49506430delT								CWH43 (442337 upstream) : None (None downstream)																							TTCTTCTCTATTTTTTTGTAC	0.279													4	2	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54940765	54940768	+	Intron	DEL	ACAC	-	-	rs111704606		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54940765_54940768delACAC	uc003haa.2	+							NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	CAacacacaaacacacacacacac	0.275			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475785	90475786	+	IGR	INS	-	A	A	rs140241795	by1000genomes	TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475785_90475786insA								GPR98 (15753 upstream) : ARRDC3 (188755 downstream)																							aggaaggaaggaggaaggaagg	0.030													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	65102093	65102096	+	IGR	DEL	GAAG	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65102093_65102096delGAAG								YTHDF3 (976748 upstream) : MIR124-2 (189610 downstream)																							aggaaggaaagaaggaaggaagga	0.000													4	3	---	---	---	---	
CA3	761	broad.mit.edu	37	8	86360169	86360169	+	Intron	DEL	A	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86360169delA	uc003ydj.2	+						CA3_uc011lfv.1_Intron	NM_005181	NP_005172	P07451	CAH3_HUMAN	carbonic anhydrase III						one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0						aaccaacaacaaaaaaaacCC	0.224													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	101438808	101438809	+	IGR	INS	-	AT	AT			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101438808_101438809insAT								RNF19A (116481 upstream) : ANKRD46 (83178 downstream)																							accaccaccaccactaccacca	0.000													4	2	---	---	---	---	
NSMCE2	286053	broad.mit.edu	37	8	126317202	126317203	+	Intron	INS	-	AAG	AAG	rs35212928		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126317202_126317203insAAG	uc003yrw.2	+							NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			aggaaggaagaaagaaagaaaa	0.054													6	3	---	---	---	---	
RC3H2	54542	broad.mit.edu	37	9	125622524	125622525	+	Intron	INS	-	C	C			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125622524_125622525insC	uc010mwc.1	-						RC3H2_uc004bnc.2_Intron|RC3H2_uc004bnd.1_Intron|RC3H2_uc004bne.3_Intron	NM_001100588	NP_001094058	Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type zinc finger domains 2							cell surface|endomembrane system|membrane|membrane fraction|perinuclear region of cytoplasm	DNA binding|zinc ion binding			ovary(2)|lung(2)	4						AAACACTTCAGACATTGCCACA	0.366													4	2	---	---	---	---	
CHKA	1119	broad.mit.edu	37	11	67831875	67831875	+	Intron	DEL	A	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67831875delA	uc001onj.2	-						CHKA_uc001onk.2_Intron	NM_001277	NP_001268	P35790	CHKA_HUMAN	choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)	actctgtctcaaaaaaaaaaa	0.129													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	91840167	91840168	+	IGR	DEL	AC	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91840167_91840168delAC								DCN (263361 upstream) : BTG1 (538698 downstream)																							attgtttttaacacacacacac	0.000													4	2	---	---	---	---	
FRMD6	122786	broad.mit.edu	37	14	52171344	52171344	+	Intron	DEL	G	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52171344delG	uc001wzd.2	+						FRMD6_uc001wzb.2_Intron|FRMD6_uc001wzc.2_Intron|FRMD6_uc001wze.2_Intron	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN	FERM domain containing 6							cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)					TCAGTGAGGTGGGAGGGAGGA	0.453													6	6	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	21142709	21142709	+	Intron	DEL	G	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21142709delG	uc010vbe.1	-						DNAH3_uc002die.2_Intron	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		aaggaaggaaggaaggaagga	0.035													4	2	---	---	---	---	
PRKCB	5579	broad.mit.edu	37	16	24106174	24106175	+	Intron	INS	-	AGGG	AGGG	rs9933887	by1000genomes	TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24106174_24106175insAGGG	uc002dmd.2	+						PRKCB_uc002dme.2_Intron	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	ggaaggaaggaaaggaagaaaa	0.035													2	5	---	---	---	---	
CCDC102A	92922	broad.mit.edu	37	16	57554851	57554852	+	Intron	INS	-	A	A			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57554851_57554852insA	uc002elw.2	-							NM_033212	NP_149989	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A											ovary(1)	1						gactctgtctcaaaaaaaaaaa	0.178													5	3	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57919461	57919462	+	Intron	INS	-	CTCT	CTCT	rs34366661		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57919461_57919462insCTCT	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						ttccttccttcctctctctctc	0.000													6	5	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21205359	21205364	+	Intron	DEL	GGGGCT	-	-	rs74998514		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21205359_21205364delGGGGCT	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CGTCGGAGAGggggctggggctgggg	0.583													5	5	---	---	---	---	
NPEPPS	9520	broad.mit.edu	37	17	45646982	45646982	+	Intron	DEL	T	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45646982delT	uc002ilr.3	+						NPEPPS_uc010wkt.1_Intron|NPEPPS_uc010wku.1_Intron|NPEPPS_uc010dba.1_Intron	NM_006310	NP_006301	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive						proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0						TATTAAGAGCttttttttttt	0.169													4	3	---	---	---	---	
EPB41L3	23136	broad.mit.edu	37	18	5629415	5629418	+	Intron	DEL	CACA	-	-	rs67422549		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5629415_5629418delCACA	uc002kmv.1	-						EPB41L3_uc010dkq.1_5'Flank			Q9Y2J2	E41L3_HUMAN	Homo sapiens mRNA for KIAA0987 protein, partial cds.						cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						CCTTacacaccacacacacacaca	0.564													4	2	---	---	---	---	
CYP2F1	1572	broad.mit.edu	37	19	41877314	41877327	+	Intron	DEL	CTTTCTCTCTCTCT	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41877314_41877327delCTTTCTCTCTCTCT	uc010xvw.1	+						TMEM91_uc002oqi.2_Intron|TMEM91_uc010ehq.2_Intron			P24903	CP2F1_HUMAN	SubName: Full=cDNA FLJ51986, highly similar to Homo sapiens cytochrome P450, family 2, subfamily F, polypeptide 1 (CYP2F1), mRNA;						naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						tccctccctcctttctctctctctctttctctct	0.000													3	3	---	---	---	---	
RALGAPA2	57186	broad.mit.edu	37	20	20449586	20449587	+	Intron	DEL	TG	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20449586_20449587delTG	uc002wrz.2	-						RALGAPA2_uc010gcx.2_Intron|RALGAPA2_uc010zsg.1_Intron	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250						activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						ACCTCCATCCtgtgtgtgtgtg	0.361													4	2	---	---	---	---	
C20orf112	140688	broad.mit.edu	37	20	31035206	31035207	+	3'UTR	INS	-	AAAAA	AAAAA	rs149650216		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31035206_31035207insAAAAA	uc002wxu.3	-	8					C20orf112_uc010gec.2_3'UTR	NM_080616	NP_542183	Q96MY1	CT112_HUMAN	hypothetical protein LOC140688												0						GGTGAGATTCCaaaaaaaaaaa	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57840414	57840417	+	IGR	DEL	TTCC	-	-	rs57847155		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57840414_57840417delTTCC								ZNF831 (6249 upstream) : EDN3 (35082 downstream)																							cttccttcctttcctccttccttt	0.069													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27694169	27694172	+	IGR	DEL	GTGT	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27694169_27694172delGTGT								MIAT (579220 upstream) : MN1 (450094 downstream)																							AAGACTTtgcgtgtgtgtgtgtgt	0.328													4	2	---	---	---	---	
NRK	203447	broad.mit.edu	37	X	105139283	105139283	+	Intron	DEL	A	-	-			TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105139283delA	uc004emd.2	+						NRK_uc010npc.1_Intron	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase								ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						CTAAAGAAAGAATTGTGTCTG	0.299										HNSCC(51;0.14)			4	2	---	---	---	---	
IL13RA1	3597	broad.mit.edu	37	X	117925585	117925585	+	Intron	DEL	A	-	-	rs11318857		TCGA-33-4582-01A-01D-1441-08	TCGA-33-4582-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117925585delA	uc004eqs.2	+						IL13RA1_uc004eqt.1_Intron	NM_001560	NP_001551	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1 precursor							interleukin-13 receptor complex	cytokine receptor activity				0						TTCTTAGGTCAAAAAAAAAAA	0.328													3	3	---	---	---	---	
